MSH3 modulatory molecules

MSH3 splice modulating constructs with specific antisense RNA sequences effectively reduce MSH3 expression, addressing the inadequacies of current treatments for nucleotide repeat disorders by inhibiting disease progression.

WO2026039524A1PCT designated stage Publication Date: 2026-02-19ASCIDIAN THERAPEUTICS INC
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/041807
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-08-14
Filing Date
2025-08-13
Publication Date
2026-02-19

AI Technical Summary

Technical Problem

Current treatments for nucleotide repeat disorders, such as ALS and Huntington's disease, are inadequate in effectively targeting and reducing MSH3 expression, which contributes to disease progression.

Method used

Development of MSH3 splice modulating constructs, comprising specific antisense RNA sequences targeting MSH3 exons 7 or 15, combined with small nuclear RNA sequences, to induce exon skipping and reduce MSH3 expression.

Benefits of technology

The constructs significantly decrease MSH3 expression in target cells by up to 50%, thereby delaying or inhibiting nucleotide repeat expansion and treating associated disorders.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025041807_19022026_PF_FP_ABST
    Figure US2025041807_19022026_PF_FP_ABST
Patent Text Reader

Abstract

MSH3 splice modulators and constructs encoding same are described herein. Compositions and vectors comprising same (e.g., AAV vectors) are also encompassed herein. MSH3 splice modulators and constructs encoding same, as well as compositions and vectors (e.g., AAV vectors) comprising MSH3 splice modulators and constructs encoding MSH3 splice modulators may be used alone or in combination with additional therapeutics for treating nucleotide repeat expansion disorders or in the preparation of medicaments for treating nucleotide repeat expansion disorders. Exemplary nucleotide repeat expansion disorders include the following: Huntington's Disease (HD), Myotonic Dystrophy 1 (DMPK), Myotonic Dystrophy 2 (CNBP), Fuchs Endothelial Corneal Dystrophy (TCF4), Fragile X Syndrome (FMR1), Friedreich Ataxia (FXN), C9orf72 ALS / FTD (C9orf72), SCA1, 2, 3, 6, 7, 8, 10, 17, and 31, Spinal and bulbar muscular atrophy (AR).
Need to check novelty before this filing date? Find Prior Art

Description

[0001]Biospark Docket No. ASC-001WO MSH3 MODULATORY MOLECULES CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the priority benefit of U.S. provisional application no.63 / 683,161, filed August 14, 2024, the contents of which are incorporated herein in their entireties by reference thereto. SEQUENCE LISTING The instant application contains a Sequence Listing which has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. Said XML Sequence Listing, created on August 12, 2025, is named ASC-001WO_SL.xml and is 105,444 bytes in size. BACKGROUND The human genome contains many short tandem repeats. Expansion of a subset of these repeat tracts underlies over fifty human disorders, including common genetic causes of amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (C9orf72), polyglutamine- associated ataxias and Huntington disease (HD), myotonic dystrophy, and intellectual disability disorders such as Fragile X syndrome. MutS homolog 3 (MSH3) is a protein that is involved in the DNA mismatch repair pathway. MSH3 also plays a role in disease onset and progression in several nucleotide repeat disorders in that it contributes to expansion of nucleotide repeat tracts. MSH3 is therefore recognized as a therapeutic target for a variety of nucleotide repeat disorders. Exon skipping mediated by constructs that include antisense RNA that binds to a target pre- mRNA and a modified snRNA sequence can induce nonsense-mediated decay and effectively knockdown expression of a given target. Effectiveness of such splice modulating constructs is influenced by the particular antisense RNA sequence and the location on the target pre-mRNA where the antisense RNA sequence binds. Splice modulating constructs that effectively target and knock down MSH3 expression would be beneficial for treatment of nucleotide repeat disorders. SUMMARY Embodiments disclosed herein include MSH3 splice modulating constructs that effectively knock down MSH3 expression. In particular, disclosed herein is an MSH3 splice modulator construct comprising, operatively linked: (a) a sequence encoding a first antisense RNA sequence that targets a target exon of MSH3 pre-mRNA, wherein the target exon is MSH3 exon 7 or MSH3 exon 15, and wherein the target exon comprises a 5’ exon-intron junction, an exon sequence, and a 3’ exon-intron junction, and (i) wherein the first antisense RNA targets a sequence that is entirely encompassed by the exon sequence; or (ii) wherein the first antisense RNA sequence comprises or consists of any one of SEQ ID NOs: 5, 6, 14-16, 20, 21, or 30-32 or a sequence having at least 90% identity to any one of SEQ ID NOs: 5, 6, 14-16, 20, 21, or 30-32; or (iii) wherein the first antisense RNA sequence comprises or consists of any one of SEQ ID NOs: 7, 13, 22, or 29 or a sequence having at least 90% identity to any one of SEQ ID NOs: 7, 13, 22, or 29, wherein the first antisense RNA sequence does not comprise any one of SEQ ID NOs: 17, 18, 33 or 34, or a sequence having at least 90% identity to any one of SEQ ID NOs: 17, 18, 33, or 34; and (b) a sequence encoding a small nuclear RNA (snRNA) sequence configured to promote exon skipping of the target exon. In some embodiments, the first antisense RNA targets a sequence that is entirely encompassed by the exon sequence, and wherein the first antisense RNA sequence comprises or consists of any one of SEQ ID NOs: 8-12 or 23-28 or a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 8-12 or 23-28. In some embodiments, the first antisense RNA comprises or consists of a sequence having 100% identity to (a) 12-18 consecutive nucleotides of any one of SEQ ID NOs: 5, 9-11, 15, 16, 20, 24-27, 31, or 32; (b) a sequence having 100% identity to 12-18 consecutive nucleotides of SEQ ID NO: 8, 14, 23, or 30 wherein the 5’ end of SEQ ID NO: 8, 14, 23, or 30 is included in the 12-18 consecutive nucleotides; or (c) a sequence having 100% identity to 12-18 consecutive nucleotides of SEQ ID NO: 6, 12, 21, or 28, wherein the 3’ end of SEQ ID NO: 6, 12, 21, or 28 is included in the 12-18 consecutive nucleotides. In some embodiments, the first antisense RNA is at least 24 nucleotides in length. In some embodiments, the first antisense RNA is no more than 24 nucleotides in length. In some embodiments, the first antisense RNA is less than 36 nucleotides in length. In some embodiments, the MSH3 splice modulator construct further comprises a sequence encoding a second antisense RNA sequence that targets MSH3 exon 7 or MSH3 exon 15. In some embodiments, the second antisense RNA sequence comprises or consists of any one of SEQ ID NOs: 5-34 or a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 5-34. In some embodiments, the first antisense RNA sequence consists of any one of SEQ ID NOs: 5-16 or 20-32 or a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 5-16 or 20-32. In some embodiments, the second antisense RNA sequence consists of any one of SEQ ID NOs: 5-34 or a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 5-34. In some embodiments, the sequence encoding the first antisense RNA sequence is 5’ to the sequence encoding the second antisense RNA sequence. In some embodiments, the construct further comprises a sequence encoding a linker between the first antisense RNA sequence and the second antisense RNA sequence. In some embodiments, the MSH3 splice modulator construct does not include a sequence encoding a linker between the first antisense RNA sequence and the second antisense RNA sequence. In some embodiments, the first antisense RNA sequence comprises or consists of SEQ ID NO: 7 or a sequence having at least 90% sequence identity to SEQ ID NO: 7, and wherein the second antisense RNA sequence comprises or consists of SEQ ID NO: 13 or a sequence having at least 90% identity to SEQ ID NO: 13. In some embodiments, the first antisense RNA sequence comprises or consists of SEQ ID NO: 22 or a sequence having at least 90% sequence identity to SEQ ID NO: 22, and wherein the second antisense RNA sequence comprises or consists of SEQ ID NO: 29 or a sequence having at least 90% identity to SEQ ID NO: 29. In some embodiments, the first antisense RNA or, when present, the second antisense RNA, comprises or consists of any one of SEQ ID NOs: 9-11, 13, 14, or 27-29, or a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 9-11, 13, 14, or 27-29. In some embodiments, the MSH3 splice modulator construct further comprises a U1 promoter and a U1 terminator operatively linked to the first antisense RNA sequence, the sequence encoding the snRNA sequence, and, when present, the second antisense RNA sequence. In some embodiments, the snRNA is a modified snRNA. In some embodiments, the modified snRNA comprises a U7 Sm OPT sequence or a U2 snRNA sequence. In some embodiments, the construct comprises a sequence comprising any one of SEQ ID NOs: 38-49, 55-69, 75, or 76 or a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 38-49, 55- 69, 75, or 76. In some embodiments, the construct comprises any one of SEQ ID NOs: 42-44, 46, 47, 55, 56, or 64-66. Also disclosed is an MSH3 splice modulator construct comprising, operatively linked: (a) a sequence encoding a first antisense RNA sequence, wherein the first antisense RNA sequence comprises any one of SEQ ID NOs: 17, 18, 33, or 34 or a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 17, 18, 33 or 34; (b) a sequence encoding a second antisense RNA sequence, wherein the second antisense RNA sequence comprises any one of SEQ ID NOs: 17, 18, 33, or 34 or a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 17, 18, 33 or 34; and (c) a sequence encoding a small nuclear RNA (snRNA) sequence configured to promote exon skipping of a target exon; wherein the splice modulator construct does not include a sequence encoding a linker between the first antisense RNA sequence and the second antisense RNA sequence. In some embodiments, the construct further comprises a U1 promoter and a U1 terminator operatively linked to the first antisense RNA sequence, the sequence encoding the snRNA sequence, and the second antisense RNA sequence. In some embodiments, the snRNA is a modified snRNA. In some embodiments, the modified snRNA comprises a U7 Sm OPT sequence or a U2 snRNA sequence. In some embodiments, the first antisense RNA sequence comprises SEQ ID NO: 17 or a sequence having at least 90% sequence identity to SEQ ID NO: 17 and wherein the second antisense RNA sequence comprises SEQ ID NO: 18 or a sequence having at least 90% sequence identity to SEQ ID NO: 18. In some embodiments, the construct comprises SEQ ID NO: 54 or a sequence having at least 90% sequence identity to SEQ ID NO: 54. In some embodiments, the first antisense RNA sequence comprises SEQ ID NO: 33 or a sequence having at least 90% sequence identity to SEQ ID NO: 33 and wherein the second antisense RNA sequence comprises SEQ ID NO: 34 or a sequence having at least 90% sequence identity to SEQ ID NO: 34. In some embodiments, a sequence having at least 90% sequence identity to SEQ ID NO: 74. Also disclosed is a splice modulator construct that comprises, from 5’ to 3’: (a) a first DNA sequence encoding a first antisense RNA that targets an exon sequence of a target exon, an exon-intron junction of a target exon, or an intron sequence flanking a target exon; (b) a second DNA sequence encoding an hnRNPA1 binding sequence; and (c) a third DNA sequence encoding a second antisense RNA that targets an exon sequence of the target exon, an exon- intron junction of the target exon, or an intron sequence flanking the target exon. In some embodiments, the target exon is an MSH3 exon. In some embodiments, the target exon is MSH3 exon 7 or MSH3 exon 15. In some embodiments, the first antisense RNA targets a 3’ exon-intron junction of the target exon. In some embodiments, the second antisense RNA targets a 5’ intron-exon junction of the target exon. In some embodiments, the second DNA sequence (i.e., the sequence encoding the hnRNPA1 binding sequence) comprises a sequence having at least 85%, 90%, or 95% sequence identity to SEQ ID NO: 81. In some embodiments, the second DNA sequence comprises, consists of, or consists essentially of SEQ ID NO: 81. In some embodiments, the target exon is not an MSH3 exon. Also disclosed is an MSH3 splice modulator construct comprising any two or more of the MSH3 splice modulator constructs disclosed above combined on a single polynucleotide molecule. Also disclosed is a composition comprising any two or more of the MSH3 splice modulator constructs disclosed above. Also disclosed is a composition comprising an RNA molecule encoded by any of the MSH3 splice modulator constructs disclosed above. Also disclosed is a vector comprising any of the MSH3 splice modulator constructs disclosed above. In some embodiments, the vector further comprises a 5’ regulatory domain. In some embodiments, the 5’ regulatory domain comprises a constitutive promoter or a tissue specific promoter. In some embodiments, the constitutive promoter is a CMV promoter or a CAGGS promoter. In some embodiments, the 5’ regulatory domain comprises an snRNA promoter. In some embodiments, the snRNA promoter comprises a U1, U2, U4, U5, U6atac, U7, U11, or U12 promoter. Also disclosed is a proviral plasmid comprising any of the MSH3 splice modulator constructs disclosed above. Also disclosed is an adeno-associated virus (AAV) comprising any of the MSH3 splice modulator constructs disclosed above. In some embodiments, the AAV further comprises a 5’ regulatory domain. In some embodiments, the 5’ regulatory domain comprises a constitutive promoter or a tissue specific promoter. In some embodiments, the constitutive promoter is a CMV promoter or a CAGGS promoter. In some embodiments, the AAV exhibits neuronal tropism. In some embodiments, the AAV is AAV9, AAV8, AAV5, AAV2, AAV7, or AAV2.7m8, AAV-retro, AAV1, AAV4, or AAV-PHP.eB. Also disclosed is a composition comprising any of the MSH3 splice modulator constructs disclosed above, any of the vectors disclosed above, any of the proviral plasmids disclosed above, any of the AAVs described above. In some embodiments, the composition comprises a pharmaceutically acceptable excipient. Also disclosed is a method comprising transfecting or transducing the target cell with any of the MSH3 splice modulator constructs disclosed above, any of the vectors disclosed above, any of the proviral plasmids disclosed above, or any of the AAVs described above. In some embodiments, the expression of MSH3 in a target cell is reduced by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% relative to expression of MSH3 in a target cell that expresses wildtype levels of MSH3. In some embodiments, the expression of MSH3 in a target cell is reduced by about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, or about 50% relative to expression of MSH3 in a target cell that expresses wildtype levels of MSH3. In some embodiments, the target cell is a brain cell, a motor neuron, a cardiac muscle cell, a smooth muscle cell, a skeletal muscle cell, or a corneal endothelial cell. Also disclosed is a method of delaying or inhibiting nucleotide repeat expansion in a gene of a target cell, the method comprising transfecting or transducing the target cell with any of the MSH3 splice modulator constructs disclosed above, any of the vectors disclosed above, any of the proviral plasmids disclosed above, or any of the AAVs described above. In some embodiments, the target cell is a brain cell, a motor neuron, a cardiac muscle cell, a smooth muscle cell, a skeletal muscle cell, or a corneal endothelial cell. Also disclosed is a method of delaying or inhibiting nucleotide repeat expansion in a subject, the method comprising administering to the subject any of the MSH3 splice modulator constructs disclosed above, any of the vectors disclosed above, any of the proviral plasmids disclosed above, or any of the AAVs described above. In some embodiments, the subject has Huntington’s disease, myotonic dystrophy 1, myotonic dystrophy 2, Fuchs endothelial corneal dystrophy, fragile X syndrome, Friedreich ataxia, C9orf72 ALS / FTD, SCA1, SCA2, SCA3, SCA6, SCA7, SCA8, SCA10, SCA17, SCA31, or spinal and bulbar muscular atrophy or wherein the subject has been diagnosed as being at risk for Huntington’s disease, myotonic dystrophy 1, myotonic dystrophy 2, Fuchs endothelial corneal dystrophy, fragile X syndrome, Friedreich ataxia, C9orf72 ALS / FTD, SCA1, SCA2, SCA3, SCA6, SCA7, SCA8, SCA10, SCA17, SCA31, or spinal and bulbar muscular atrophy. In some embodiments, the administering comprises contacting a neural, endothelial cell, or muscle cell of the subject with any of the MSH3 splice modulator constructs disclosed above, any of the vectors disclosed above, any of the proviral plasmids disclosed above, or any of the AAVs described above. Also disclosed is a method of treating a repeat expansion disorder in a subject in need thereof, the method comprising administering to the subject any of the MSH3 splice modulator constructs disclosed above, any of the vectors disclosed above, any of the proviral plasmids disclosed above, or any of the AAVs described above, or any of the compositions described above in a therapeutically effective amount. In some embodiments, the trinucleotide repeat expansion disorder is Huntington’s disease, myotonic dystrophy 1, myotonic dystrophy 2, Fuchs endothelial corneal dystrophy, fragile X syndrome, Friedreich ataxia, C9orf72 ALS / FTD, SCA1, SCA2, SCA3, SCA6, SCA7, SCA8, SCA10, SCA17, SCA31, or spinal and bulbar muscular atrophy. Also disclosed is a method of treating Huntington’s disease in a subject in need thereof, the method comprising administering to the subject any of the MSH3 splice modulator constructs disclosed above, any of the vectors disclosed above, any of the proviral plasmids disclosed above, any of the AAVs described above, or any of the compositions described above in a therapeutically effective amount. In some embodiments, the treatment methods disclosed above comprise administration of any of the MSH3 splice modulator constructs disclosed above, any of the vectors disclosed above, any of the proviral plasmids disclosed above, any of the AAVs described above, or any of the compositions described above to the subject’s brain, cardiac muscle, skeletal muscle, or eye. In some embodiments, the subject is a mammal, preferentially a rodent, non-human primate, or a human. In some embodiments, the subject is genetically predisposed to have HD or has been diagnosed with HD. Also disclosed is any of the MSH3 splice modulator constructs disclosed above, any of the vectors disclosed above, any of the proviral plasmids disclosed above, or any of the AAVs described above for use in preventing or treating HD, myotonic dystrophy 1, myotonic dystrophy 2, Fuchs endothelial corneal dystrophy, fragile X syndrome, Friedreich ataxia, C9orf72 ALS / FTD, SCA1, SCA2, SCA3, SCA6, SCA7, SCA8, SCA10, SCA17, SCA31, or spinal and bulbar muscular atrophy in a subject in need thereof. Also disclosed is any of the MSH3 splice modulator constructs disclosed above, any of the vectors disclosed above, any of the proviral plasmids disclosed above, or any of the AAVs described above for use in the preparation of a medicament for the treatment or prevention of HD, myotonic dystrophy 1, myotonic dystrophy 2, Fuchs endothelial corneal dystrophy, fragile X syndrome, Friedreich ataxia, C9orf72 ALS / FTD, SCA1, SCA2, SCA3, SCA6, SCA7, SCA8, SCA10, SCA17, SCA31, or spinal and bulbar muscular atrophy in a subject in need thereof. In some embodiments, an MSH3 splice modulator comprising at least one sequence encoding a small nuclear RNA (snRNA) that blocks normal processing of MSH3 pre-mRNA is described. In some embodiments, the MSH3 splice modulator blocks normal processing of MSH3 pre-mRNA via, e.g., introducing a premature stop codon into the MSH3 pre-mRNA that targets the MSH3 mRNA for nonsense-mediated decay. In some embodiments, an MSH3 splice modulator construct is described comprising, operatively linked: (a) a sequence encoding an antisense RNA (asRNA) that blocks normal processing of MSH3 pre-mRNA by, e.g., promoting exon skipping of a target exon of MSH3 pre- mRNA, wherein the target exon is any one of MSH3 exons 7 or 15, or a combination thereof, and wherein the asRNA target comprises a 5’ intron-exon junction, an exon sequence, or a 3’ exon-intron junction sequence of either MSH3 exons 7 or 15; and (b) a sequence encoding a small nuclear RNA (snRNA) sequence. In some embodiments, the MSH3 splice modulator construct further comprises a U1 promoter and a U1 terminator operatively linked to (a) and (b). In some embodiments, the snRNA is a modified snRNA. In some embodiments, the modified snRNA comprises a U7 Sm OPT sequence or a U2 snRNA sequence. In some embodiments, the antisense RNA targets the 5’ intron-exon junction, the exon sequence, or the 3’ exon-intron junction, or any combination thereof of the 5’ intron-exon junction, the exon sequence, and the 3’ exon-intron junction of the target exon / s. In some embodiments, an MSH3 splice modulator construct comprises at least one asRNA. In some embodiments, an MSH3 splice modulator construct comprises at least one asRNA, wherein the at least one asRNA targets MSH3 exon 7, MSH3 exon 15, or a combination of MSH3 exons 7 and 15. In some embodiments, the antisense RNA comprises, consists essentially of, or consists of any one of SEQ ID NOs: 5-16 or 20-32 or a sequence having at least 90% identity to any one of SEQ ID NOs: 5-16 or 20-32. In some embodiments, the antisense RNA comprises, consists essentially of, or consists of combinations of SEQ ID NOs: 5-35 or combinations of sequences, wherein each of such sequences has at least 90% identity to any one of SEQ ID NOs: 5-35. In some embodiments, the antisense RNA comprises, consists essentially of, or consists of combinations of SEQ ID NOs: 5-18 or 20-34 or combinations of sequences, wherein each of such sequences has at least 90% identity to any one of SEQ ID NOs: 5-18 or 20-34, with the proviso that when such combinations consist of two sequences, the combination does not consist essentially of or consist of SEQ ID NOs: 17 and 18 (or a combination of two sequences wherein each sequence has at least 90% identity to SEQ ID NOs: 17 or 18, respectively); or the combination does not consist essentially of or consist of SEQ ID NOs: 33 and 34 (or a combination of two sequences wherein each sequence has at least 90% identity to SEQ ID NOs: 33 or 34, respectively). In some embodiments, the antisense RNA comprises, consists essentially of, or consists of combinations of at least three of SEQ ID NOs: 5-35, or combinations of at least three sequences, wherein each of such sequences has at least 90% identity to any one of SEQ ID NOs: 5-35, or any combination thereof. In some embodiments, the antisense RNA comprises, consists essentially of, or consists of combinations of at least three of SEQ ID NOs: 5-18 or 20- 34, or combinations of at least three sequences, wherein each of such sequences has at least 90% identity to any one of SEQ ID NOs: 5-18 or 20-34, or any combination thereof (e.g., a combination of SEQ ID NOs: 9 and 10 and a sequence having at least 90% identity to SEQ ID NO: 18; or a combination of SEQ ID NOs: 9, 10, and 18; or a combination of SEQ ID NOs: 27 and 28 and a sequence having at least 90% identity to SEQ ID NO: 33; or a combination of SEQ ID NOs: 27, 28, and 33; or a combination of SEQ ID NOs: 9, 10, and 33). In some embodiments, such combinations of antisense RNA comprise combinations of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35 of the antisense RNA described herein. In some embodiments, an MSH3 splice modulator construct described above comprises any one of SEQ ID NOs: 38-76, with the proviso that such MSH3 splice modulator constructs do not include SEQ ID NOs: 52, 53, 72, or 73. In some embodiments, an MSH3 splice modulator construct described above comprises any one of SEQ ID NOs: 38-76, with the proviso that such MSH3 splice modulator constructs do not include SEQ ID NOs: 52, 53, 54, 72, 73, or 74. In some embodiments, MSH3 splice modulator constructs described above are used in combination, wherein such combinations comprise at least one of SEQ ID NOs: 38-76. In some embodiments, MSH3 splice modulator constructs described above are used in combination wherein such combinations comprise at least one of SEQ ID NOs: 38-76, with the proviso that when such combinations consist of two MSH3 splice modulator constructs, the combination of two MSH3 splice modulator constructs does not consist essentially of or consist of a combination of two of SEQ ID NOs: 52, 53, 72, or 73. In some embodiments, MSH3 splice modulator constructs described above are used in combination wherein such combinations comprise at least one of SEQ ID NOs: 38-76, with the proviso that when such combinations consist of two MSH3 splice modulator constructs, the combination of two MSH3 splice modulator constructs does not consist essentially of or consist of a combination of two of SEQ ID NOs: 52, 53, 54, 72, 73, or 74. In some embodiments, MSH3 splice modulator constructs described above are used in combination, wherein such combinations comprise at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 , 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35 of the MSH3 splice modulator constructs described. In some embodiments, the MSH3 splice modulator construct comprises any one of SEQ ID NOs: 38-51, 54-71, or 74-76. In some embodiments, the MSH3 splice modulator construct comprises any one of SEQ ID NOs: 42, 43, 44, 46, 47, 50, 51, 55, 56, 64, 65, or 74. In some embodiments, MSH3 splice modulator constructs described above are used in combination, wherein such combinations comprise at least one of SEQ ID NOs: 42, 43, 44, 46, 47, 50, 51, 55, 56, 64, 65, or 74. In some embodiments, MSH3 splice modulator constructs described above are used in combination, wherein such combinations comprise at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 of SEQ ID NOs: 42, 43, 44, 46, 47, 50, 51, 55, 56, 64, 65, or 74. Accordingly, exemplary MSH3 exon 7 and exon 15 splice modulators are described herein. Notably, some of these exemplary MSH3 splice modulators comprise a single, shorter asRNA, which feature confers benefits, including a reduction in the size of MSH3-targeting U7 SmOPT molecules encoding shorter asRNA as compared to longer asRNA. Indeed, a reduction in size could facilitate inclusion of additional features (e.g., a plurality of asRNA or a plurality of MSH3 splice modulator constructs) in a single vector (e.g., an AAV vector). Results presented herein also reveal that the targeted binding location of exemplary single, shorter asRNAs described herein along exon 7 or exon 15 can improve splice modulating efficiency. Identification of these binding areas / locations, also referred to herein as exon skipping hot spots, significantly advances the solution to the problem of how to reduce MSH3 expression, thereby delaying progression of a trinucleotide repeat disorder in a patient in need thereof and possibly even preventing further disease progression in a patient with a trinucleotide repeat disorder or preventing disease in a patient at risk for developing a trinucleotide repeat disorder. In some embodiments, the antisense RNA comprises, operatively linked in a 5’ to 3’ direction: (a) a sequence that targets the 3’ exon-intron junction; and (b) a sequence that targets the 5’ intron-exon junction of exon 7. In some embodiments, the antisense RNA that targets both the 5’ intron-exon junction and the 3’ exon-intron junction of exon 7 comprises SEQ ID NOs: 7 and 13, SEQ ID NOs: 7 and 18, SEQ ID NOs: 17 and 13, or SEQ ID NOs: 17 and 18. In some embodiments, the antisense RNA that targets both the 5’ intron-exon junction and the 3’ exon- intron junction of exon 7 comprises SEQ ID NOs: 7 and 13, SEQ ID NOs: 7 and 18, or SEQ ID NOs: 17 and 13. In some embodiments, the antisense RNA that targets both the 5’ intron-exon junction and the 3’ exon-intron junction of exon 7 comprises SEQ ID NOs: 7 and 13. In some embodiments, the MSH3 splice modulator construct comprises any one of SEQ ID NOs: 56 (SEQ ID NO: 13 + SEQ ID NO: 7 + SEQ ID NO: 2 + SEQ ID NO: 3) or 54 (SEQ ID NO: 18 + SEQ ID NO: 17 + SEQ ID NO: 2 + SEQ ID NO: 3) or a combination of SEQ ID NO: 7 + SEQ ID NO: 18 + SEQ ID NO: 2 + SEQ ID NO: 3 arranged in 5’ to 3’ order, a combination of SEQ ID NO: 17 + SEQ ID NO: 13 + SEQ ID NO: 2 + SEQ ID NO: 3 arranged in 5’ to 3’ order, a combination of SEQ ID NO:18 + SEQ ID NO: 7 + SEQ ID NO: 2 + SEQ ID NO: 3 arranged in 5’ to 3’ order, or a combination of SEQ ID NO: 13 + SEQ ID NO: 17 + SEQ ID NO: 2 + SEQ ID NO: 3 arranged in 5’ to 3’ order. In some embodiments, an MSH3 splice modulator construct encoding antisense RNA comprising a sequence that targets the 3’ exon-intron junction of exon 7 can be used in combination with an MSH3 splice modulator construct encoding antisense RNA comprising a sequence that targets the 5’ intron-exon junction of exon 7. In some embodiments, such combinations of MSH3 splice modulator constructs comprise SEQ ID NOs: 40 (SEQ ID NO: 7 + SEQ ID NO: 2 + SEQ ID NO: 3) and 46 (SEQ ID NO: 13 + SEQ ID NO: 2 + SEQ ID NO: 3); SEQ ID NOs: 40 (SEQ ID NO: 7 + SEQ ID NO: 2 + SEQ ID NO: 3) and 51 (SEQ ID NO: 18 + SEQ ID NO: 2 + SEQ ID NO: 3); or SEQ ID NOs: 50 (SEQ ID NO: 17 + SEQ ID NO: 2 + SEQ ID NO: 3) and 46 (SEQ ID NO: 13 + SEQ ID NO: 2 + SEQ ID NO: 3), or SEQ ID NOs: 50 (SEQ ID NO: 17 + SEQ ID NO: 2 + SEQ ID NO: 3) and 51 (SEQ ID NO: 18 + SEQ ID NO: 2 + SEQ ID NO: 3), or any combination thereof. In some embodiments, the antisense RNA comprises, operatively linked in a 5’ to 3’ direction: (a) a sequence that targets the 3’ exon-intron junction; (b) a linker sequence of at least 15 nucleotides that does not anneal to the target exon; and (c) a sequence that targets the 5’ intron-exon junction of exon 7. In some embodiments, the linker sequence is less than 50% complementary to all sequences of the target exon of the same length as the linker. In some embodiments, the antisense RNA that targets both the 5’ intron-exon junction and the 3’ exon- intron junction of exon 7 comprises SEQ ID NOs: 7 and 13, SEQ ID NOs: 7 and 18, or SEQ ID NOs: 17 and 13. In some embodiments, the antisense RNA that targets both the 5’ intron-exon junction and the 3’ exon-intron junction of exon 7 comprises SEQ ID NOs: 7 and 13. In some embodiments, the MSH3 splice modulator construct comprises any one of SEQ ID NOs: 55 (SEQ ID NO: 7 + SEQ ID NO: 80 + SEQ ID NO: 13 + SEQ ID NO: 2 + SEQ ID NO: 3) or a combination of SEQ ID NO: 7 + SEQ ID NO: 80 + SEQ ID NO: 18 + SEQ ID NO: 2 + SEQ ID NO: 3 arranged in 5’ to 3’ order or a combination of SEQ ID NO: 17 + SEQ ID NO: 80 + SEQ ID NO: 13 + SEQ ID NO: 2 + SEQ ID NO: 3 arranged in 5’ to 3’ order. In some embodiments, the MSH3 splice modulator construct consists of SEQ ID NO: 53 (SEQ ID NO: 18 + SEQ ID NO: 80 + SEQ ID NO: 17 + SEQ ID NO: 2 + SEQ ID NO: 3). In some embodiments, the antisense RNA comprises, operatively linked in a 5’ to 3’ direction: (a) a sequence that targets the 3’ exon-intron junction; and (b) a sequence that targets the 5’ intron-exon junction of exon 15. In some embodiments, the antisense RNA that targets both the 5’ intron-exon junction and the 3’ exon-intron junction of exon 15 comprises SEQ ID NOs: 22 and 29, SEQ ID NOs: 22 and 34, SEQ ID NOs: 33 and 29 or SEQ ID NOs: 33 and 34. In some embodiments, the antisense RNA that targets both the 5’ intron-exon junction and the 3’ exon- intron junction of exon 15 comprises SEQ ID NOs: 22 and 29, SEQ ID NOs: 22 and 34, or SEQ ID NOs: 33 and 29. In some embodiments, the antisense RNA that targets both the 5’ intron- exon junction and the 3’ exon-intron junction of exon 15 comprises SEQ ID NOs: 22 and 29. In some embodiments, the MSH3 splice modulator construct comprises any one of SEQ ID NOs: 76 (SEQ ID NO: 29 + SEQ ID NO: 22 + SEQ ID NO: 2 + SEQ ID NO: 3) or 74 (SEQ ID NO: 34 + SEQ ID NO: 33 + SEQ ID NO: 2 + SEQ ID NO: 3) or a combination of SEQ ID NO: 22 + SEQ ID NO: 34 + SEQ ID NO: 2 + SEQ ID NO: 3 arranged in 5’ to 3’ order,a combination of SEQ ID NO: 33 + SEQ ID NO: 29 + SEQ ID NO: 2 + SEQ ID NO: 3 arranged in 5’ to 3’ order, or a combination of SEQ ID NO: 34 + SEQ ID NO: 22 + SEQ ID NO: 2 + SEQ ID NO: 3 arranged in 5’ to 3’ order, a combination of SEQ ID NO: 29 + SEQ ID NO: 33 + SEQ ID NO: 2 + SEQ ID NO: 3 arranged in 5’ to 3’ order. In some embodiments, the antisense RNA comprises, operatively linked in a 5’ to 3’ direction: (a) a sequence that targets the 3’ exon-intron junction; (b) a linker sequence of at least 15 nucleotides that does not anneal to the target exon; and (c) a sequence that targets the 5’ intron-exon junction of exon 15. In some embodiments, the linker sequence is less than 50% complementary to all sequences of the target exon of the same length as the linker. In some embodiments, the antisense RNA that targets both the 5’ intron-exon junction and the 3’ exon- intron junction of exon 15 comprises SEQ ID NOs: 22 and 29, SEQ ID NOs: 22 and 34, or SEQ ID NOs: 33 and 29. In some embodiments, the antisense RNA that targets both the 5’ intron- exon junction and the 3’ exon-intron junction of exon 15 comprises SEQ ID NOs: 22 and 29. In some embodiments, the MSH3 splice modulator construct comprises any one of SEQ ID NOs: 75 (SEQ ID NO: 29 + SEQ ID NO: 80 + SEQ ID NO: 22 + SEQ ID NO: 2 + SEQ ID NO: 3) or a combination of SEQ ID NO: 22 + SEQ ID NO: 80 + SEQ ID NO: 34 + SEQ ID NO: 2 + SEQ ID NO: 3 arranged in 5’ to 3’ order, a combination of SEQ ID NO: 33 + SEQ ID NO: 80 + SEQ ID NO: 29 + SEQ ID NO: 2 + SEQ ID NO: 3 arranged in 5’ to 3’ order, a combination of SEQ ID NO: 34 + SEQ ID NO: 80 + SEQ ID NO: 22 + SEQ ID NO: 2 + SEQ ID NO: 3 arranged in 5’ to 3’ order, or a combination of SEQ ID NO: 29 + SEQ ID NO: 80 + SEQ ID NO: 33 + SEQ ID NO: 2 + SEQ ID NO: 3 arranged in 5’ to 3’ order. In some embodiments, an MSH3 splice modulator comprises an antisense RNA that targets an exon sequence exon 7 or exon 15 of MSH3 pre-mRNA. In some embodiments, the asRNA targets a sequence comprising at least 15, 20, 24, or 36 consecutive nucleotides within SEQ ID NO: 96 (exon 7 mRNA sequence) or SEQ ID NO: 97 (exon 15 mRNA sequence). In some embodiments, the asRNA targets a sequence comprising at most 15, 20, 24, or 36 consecutive nucleotides within SEQ ID NO: 96 or SEQ ID NO: 97. In some embodiments, the asRNA that targets the indicated sequence is 100% complementary to the indicated sequence. In some embodiments, the asRNA that targets the indicated sequence is complementary to the indicated sequence with no more than 1, 2, or 3 mismatches between the asRNA and the indicated sequence. In some embodiments, an MSH3 splice modulator comprises an antisense RNA that targets an intron sequence flanking exon 7 or exon 15 of MSH3 pre-mRNA. In some embodiments, the asRNA targets a sequence comprising at least 15, 20, 24, or 36 consecutive nucleotides within SEQ ID NO: 100 (portion of intron 6 mRNA sequence), SEQ ID NO: 101 (portion of intron 7 mRNA sequence), SEQ ID NO: 104 (portion of intron 14 mRNA sequence), or SEQ ID NO: 105 (portion of intron 15 mRNA sequence). In some embodiments, the asRNA targets a sequence comprising at most 15, 20, 24, or 36 consecutive nucleotides within SEQ ID NO: 100, 101, 104, or 105. In some embodiments, the asRNA that targets the indicated sequence is 100% complementary to the indicated sequence. In some embodiments, the asRNA that targets the indicated sequence is complementary to the indicated sequence with no more than 1, 2, or 3 mismatches between the asRNA and the indicated sequence. In some embodiments, an MSH3 splice modulator comprises an antisense RNA that targets an exon-intron junction sequence of exon 7 or exon 15 of MSH3 pre-mRNA. In some embodiments, the asRNA targets a sequence comprising at least 15, 20, 24, or 36 consecutive nucleotides within SEQ ID NO: 98 (sequence surrounding intron 6 – exon 7 junction), SEQ ID NO: 99 (sequence surrounding exon 7 – intron 7 junction), SEQ ID NO: 102 (sequence surrounding intron 14 – exon 15 junction), or SEQ ID NO: 103 (sequence surrounding exon 15 – intron 15 junction). In some embodiments, the asRNA targets a sequence comprising at most 15, 20, 24, or 36 consecutive nucleotides within SEQ ID NO: 98, 99, 102, or 103. In some embodiments, the asRNA that targets the indicated sequence is 100% complementary to the indicated sequence. In some embodiments, the asRNA that targets the indicated sequence is complementary to the indicated sequence with no more than 1, 2, or 3 mismatches between the asRNA and the indicated sequence. Also disclosed herein are MSH3 splice modulator construct vectors comprising at least one of the MSH3 splice modulator constructs and / or MSH3 splice modulator constructs comprising at least one of the MSH3 antisense RNA described above. In some embodiments, at least one of the MSH3 splice modulator construct / s is / are comprised on a single vector. In some embodiments, the single vector is an AAV vector. In some embodiments, the MSH3 splice modulator construct comprises any one of SEQ ID NOs: 38-51, 54-71, or 74-76. In some embodiments, the MSH3 splice modulator construct comprises any one of SEQ ID NOs: 42, 43, 44, 46, 47, 50, 51, 55, 56, 64, 65, or 74. In some embodiments, the AAV vector is a scAAV or ssAAV vector. In some embodiments of the MSH3 antisense RNA and MSH3 splice modulator constructs described above, the trinucleotide repeat disorder is Huntington’s Disease (HD). In some embodiments, trinucleotide repeat associated with HD comprises an expansion of CAG repeats in an HTT gene allele. In some embodiments, the expansion of CAG repeats in an HTT gene allele comprises greater than 35 CAG repeats (SEQ ID NO: 85). In some embodiments, the trinucleotide repeat associated with HD is autosomal dominant. In some embodiments, the trinucleotide repeat associated with HD is expressed in at least one of cortical pyramidal neurons, striatal medium spiny neurons, or hypothalamic neurons. In some embodiments, the trinucleotide repeat disorder is myotonic dystrophy 1, myotonic dystrophy 2, Fuchs endothelial corneal dystrophy, Friedreich ataxia, C9orf72 ALS / FTD, SCA1, SCA2, SCA3, SCA6, SCA7, SCA8, SCA10, SCA17, SCA31, or spinal and bulbar muscular atrophy. In some embodiments, the trinucleotide repeat disorder is associated with any of the following genes: DMPK, CNBP, FMR1, FXN, C9ORF72, AR, TCF4, ATXN1, ATXN2, ATXN3, ATXN6, ATXN7, ATXN8, ATXN10, TBP, or BEAN1 / TK2. Also disclosed is a vector comprising any of the MSH3 antisense RNA and / or MSH3 splice modulator constructs described above. Also disclosed is a proviral plasmid comprising any of the MSH3 antisense RNA and / or MSH3 splice modulator constructs described above. Also disclosed is an adeno-associated virus (AAV) comprising any of the MSH3 antisense RNA and / or MSH3 splice modulator constructs described above. Also disclosed is an adeno-associated virus (AAV) comprising any of the MSH3 antisense RNA and / or MSH3 splice modulator constructs described above, wherein the AAV optionally comprises a 5’ regulatory domain operatively linked 5’ to the MSH3 antisense RNA and / or MSH3 splice modulator constructs. In some embodiments, the promoter is a U1 promoter or a U7 promoter. In some embodiments, the AAV may comprise a 5’ regulatory domain which comprises a constitutive promoter. In some embodiments, the constitutive promoter is a CMV promoter or a CAGGS promoter. In some embodiments (e.g., HD), the AAV exhibits neuronal tropism. In some embodiments, the AAV is AAV9, AAV8, AAV5, AAV2, AAV7, or AAV2.7m8, AAV-retro, AAV1, AAV4, or AAV-PHP.eB. Also disclosed is a composition comprising any of the MSH3 antisense RNA and / or MSH3 splice modulator constructs described above; any of the vectors described above; any of the proviral plasmids described above; or any of the AAVs described above. In some embodiments, the composition further comprises a pharmaceutically acceptable excipient. Also disclosed is a method of treating Huntington’s disease (HD) in a subject in need thereof, the method comprising administering to the subject any of the MSH3 antisense RNA and / or MSH3 splice modulator constructs described above; any of the vectors described above; any of the proviral plasmids described above; any of the AAVs described above; or any of the compositions of described above in a therapeutically effective amount. In some embodiments of the methods described above, the method comprises administration of any of the MSH3 antisense RNA and / or MSH3 splice modulator constructs described above; any of the vectors described above; any of the proviral plasmids described above; any of the AAVs described above; or any of the compositions of described above to the subject’s brain. In some embodiments, the subject is a mammal, preferentially a rodent, non-human primate, or a human. In some embodiments, the subject is genetically predisposed to have HD or has been diagnosed with HD. Also disclosed is any of the MSH3 antisense RNA and / or MSH3 splice modulator constructs described above; any of the vectors described above; any of the proviral plasmids described above; any of the AAVs described above; or any of the compositions described above for use in preventing or treating HD in a subject in need thereof. Also disclosed herein is any of the MSH3 antisense RNA and / or MSH3 splice modulator constructs described above; any of the vectors described above; any of the proviral plasmids described above; any of the AAVs described above; or any of the compositions of described above for use in the preparation of a medicament for the treatment or prevention of HD in a subject in need thereof. BRIEF DESCRIPTION OF THE DRAWINGS FIGs.1A and 1B present cartoons depicting MSH3 knockdown by small nuclear RNA (snRNA)- based antisense RNA (asRNA). MSH3 can be inactivated by antisense RNAs encoded in a snRNA scaffold that anneal to MSH3 splice junctions, preventing exon inclusion. This leads to exon skipping and the generation of a premature stop codon, ultimately causing nonsense mediated decay (NMD) of the MSH3 transcript. The illustrations here depict an example of MSH3 splice modulators targeting the skipping of exons 7 and 15. FIGs.2A and 2B depict the MSH3 pre-mRNA labeled with 24mer asRNA targets tiling along the exon and an asRNA containing the entirety of the exon (top boxes), 36mer asRNAs against the branchpoint, 3’ splice site, and 5’ splice site (middle boxes), and dual 3’ splice site / 5’ splice site asRNAs of either 24mer or 36mer length with or without a linker sequence between the asRNAs indicated (bottom boxes). SEQ IDs of each asRNA are listed beside its representation. FIGs.3A and 3B depict relative MSH3 RNA expression levels of exon 6 – exon 7 and exon 7 – exon 8 junctions in cells treated with MSH3 splice modulators targeting exon 7 skipping (A), and exon 14 – exon 15 and exon 15 – exon 16 junctions in cells treated with MSH3 splice modulators targeting exon 15 skipping (B). Controls include molecules containing U7 scaffolds with scrambled asRNAs, a U1 scaffold with a scrambled asRNA (SEQ IDs 77-79), and a non- transfected control. The splice modulator transcripts in order from left to right are SEQ ID 38 (SEQ ID 5 + SEQ ID 2 + SEQ ID 3), SEQ ID 39 (SEQ ID 6 + SEQ ID 2 + SEQ ID 3), SEQ ID 40 (SEQ ID 7 + SEQ ID 2 + SEQ ID 3), SEQ ID 41 (SEQ ID 8 + SEQ ID 2 + SEQ ID 3), SEQ ID 42 (SEQ ID 9 + SEQ ID 2 + SEQ ID 3), SEQ ID 43 (SEQ ID 10 + SEQ ID 2 + SEQ ID 3), SEQ ID 44 (SEQ ID 11 + SEQ ID 2 + SEQ ID 3), SEQ ID 45 (SEQ ID 12 + SEQ ID 2 + SEQ ID 3), SEQ ID 46 (SEQ ID 13 + SEQ ID 2 + SEQ ID 3), SEQ ID 47 (SEQ ID 14 + SEQ ID 2 + SEQ ID 3), SEQ ID 48 (SEQ ID 15 + SEQ ID 2 + SEQ ID 3), SEQ ID 49 (SEQ ID 16 + SEQ ID 2 + SEQ ID 3), SEQ ID 50 (SEQ ID 17 + SEQ ID 2 + SEQ ID 3), SEQ ID 51 (SEQ ID 18 + SEQ ID 2 + SEQ ID 3), SEQ ID 52 (SEQ ID 19 + SEQ ID 2 + SEQ ID 3), SEQ ID 53 (SEQ ID 18 + SEQ ID 80 + SEQ ID 17 + SEQ ID 2 + SEQ ID 3), SEQ ID 54 (SEQ ID 18 + SEQ ID 17 + SEQ ID 2 + SEQ ID 3), SEQ ID 55 (SEQ ID 13 + SEQ ID 80 + SEQ ID 7 + SEQ ID 2 + SEQ ID 3), SEQ ID 56 (SEQ ID 13 + SEQ ID 7 + SEQ ID 2 + SEQ ID 3) (A), and SEQ ID 57 (SEQ ID 20 + SEQ ID 2 + SEQ ID 3), SEQ ID 58 (SEQ ID 21 + SEQ ID 2 + SEQ ID 3), SEQ ID 59 (SEQ ID 22 + SEQ ID 2 + SEQ ID 3), SEQ ID 60 (SEQ ID 23 + SEQ ID 2 + SEQ ID 3), SEQ ID 61 (SEQ ID 24 + SEQ ID 2 + SEQ ID 3), SEQ ID 62 (SEQ ID 25 + SEQ ID 2 + SEQ ID 3), SEQ ID 63 (SEQ ID 26 + SEQ ID 2 + SEQ ID 3), SEQ ID 64 (SEQ ID 27 + SEQ ID 2 + SEQ ID 3), SEQ ID 65 (SEQ ID 28 + SEQ ID 2 + SEQ ID 3), SEQ ID 66 (SEQ ID 29 + SEQ ID 2 + SEQ ID 3), SEQ ID 67 (SEQ ID 30 + SEQ ID 2 + SEQ ID 3), SEQ ID 68 (SEQ ID 31 + SEQ ID 2 + SEQ ID 3), SEQ ID 69 (SEQ ID 32 + SEQ ID 2 + SEQ ID 3), SEQ ID 70 (SEQ ID 33 + SEQ ID 2 + SEQ ID 3), SEQ ID 71 (SEQ ID 34 + SEQ ID 2 + SEQ ID 3), SEQ ID 72 (SEQ ID 35 + SEQ ID 2 + SEQ ID 3), SEQ ID 73 (SEQ ID 34 + SEQ ID 80 + SEQ ID 33 + SEQ ID 2 + SEQ ID 3), SEQ ID 74 (SEQ ID 34 + SEQ ID 33 + SEQ ID 2 + SEQ ID 3), SEQ ID 75 (SEQ ID 29 + SEQ ID 80 + SEQ ID 22 + SEQ ID 2 + SEQ ID 3), SEQ ID 76 (SEQ ID 29 + SEQ ID 22 + SEQ ID 2 + SEQ ID 3) (b). Control SEQ IDs are SEQ ID 77 (SEQ ID 36 + SEQ ID 2 + SEQ ID 3), SEQ ID 78 (SEQ ID 37 + SEQ ID 2 + SEQ ID 3), SEQ ID 79 (which includes the SEQ ID 36 scrambled asRNA) (B). FIGs.4A and 4B depict relative MSH3 RNA expression levels of exon 6 – exon 7 and exon 7 – exon 8 junctions in cells treated with MSH3 splice modulators targeting exon 7 skipping (A), and exon 14 – exon 15 and exon 15 – exon 16 junctions in cells treated with MSH3 splice modulators targeting exon 15 skipping (B). asRNA targets tile from upstream of the intronic branch point to downstream of the 5’ splice site. The splice modulator transcripts are SEQ ID 38 (SEQ ID 5 + SEQ ID 2 + SEQ ID 3), SEQ ID 39 (SEQ ID 6 + SEQ ID 2 + SEQ ID 3), SEQ ID 40 (SEQ ID 7 + SEQ ID 2 + SEQ ID 3), SEQ ID 41 (SEQ ID 8 + SEQ ID 2 + SEQ ID 3), SEQ ID 42 (SEQ ID 9 + SEQ ID 2 + SEQ ID 3), SEQ ID 43 (SEQ ID 10 + SEQ ID 2 + SEQ ID 3), SEQ ID 44 (SEQ ID 11 + SEQ ID 2 + SEQ ID 3), SEQ ID 45 (SEQ ID 12 + SEQ ID 2 + SEQ ID 3), SEQ ID 46 (SEQ ID 13 + SEQ ID 2 + SEQ ID 3), SEQ ID 47 (SEQ ID 14 + SEQ ID 2 + SEQ ID 3), and SEQ ID 48 (SEQ ID 15 + SEQ ID 2 + SEQ ID 3) (A), and SEQ ID 57 (SEQ ID 20 + SEQ ID 2 + SEQ ID 3), SEQ ID 58 (SEQ ID 21 + SEQ ID 2 + SEQ ID 3), SEQ ID 59 (SEQ ID 22 + SEQ ID 2 + SEQ ID 3), SEQ ID 60 (SEQ ID 23 + SEQ ID 2 + SEQ ID 3), SEQ ID 61 (SEQ ID 24 + SEQ ID 2 + SEQ ID 3), SEQ ID 62 (SEQ ID 25 + SEQ ID 2 + SEQ ID 3), SEQ ID 63 (SEQ ID 26 + SEQ ID 2 + SEQ ID 3), SEQ ID 64 (SEQ ID 27 + SEQ ID 2 + SEQ ID 3), SEQ ID 65 (SEQ ID 28 + SEQ ID 2 + SEQ ID 3), SEQ ID 66 (SEQ ID 29 + SEQ ID 2 + SEQ ID 3), SEQ ID 67 (SEQ ID 30 + SEQ ID 2 + SEQ ID 3), SEQ ID 68 (SEQ ID 31 + SEQ ID 2 + SEQ ID 3) (B). FIGs.5A and 5B depict relative MSH3 RNA expression levels of exon 6 – exon 7 and exon 7 – exon 8 junctions in cells treated with MSH3 splice modulators targeting exon 7 skipping (A), and exon 14 – exon 15 and exon 15 – exon 16 junctions in cells treated with MSH3 splice modulators targeting exon 15 skipping (B). asRNAs target the branch point, 3’ splice site (3’ss), and 5’ splice site (5’ss) of the target exon and consist of either 24nt or 36nt asRNAs. The splice modulator transcripts targeting the branch point are SEQ ID 38 (SEQ ID 5 + SEQ ID 2 + SEQ ID 3), SEQ ID 49 (SEQ ID 16 + SEQ ID 2 + SEQ ID 3) (A), and SEQ ID 57 (SEQ ID 20 + SEQ ID 2 + SEQ ID 3), SEQ ID 69 (SEQ ID 32 + SEQ ID 2 + SEQ ID 3) (B). The splice modulator transcripts targeting the 3’ss are SEQ ID 40 (SEQ ID 7 + SEQ ID 2 + SEQ ID 3), SEQ ID 50 (SEQ ID 17 + SEQ ID 2 + SEQ ID 3) (A), and SEQ ID 59 (SEQ ID 22 + SEQ ID 2 + SEQ ID 3), SEQ ID 70 (SEQ ID 33 + SEQ ID 2 + SEQ ID 3) (B). Splice modulator transcripts targeting the 5’ss are SEQ ID 46 (SEQ ID 13 + SEQ ID 2 + SEQ ID 3), SEQ ID 51 (SEQ ID 18 + SEQ ID 2 + SEQ ID 3) (A), and SEQ ID 66 (SEQ ID 29 + SEQ ID 2 + SEQ ID 3), SEQ ID 71 (SEQ ID 34 + SEQ ID 2 + SEQ ID 3) (B). FIGs.6A and 6B depict relative MSH3 RNA expression levels of exon 6 – exon 7 and exon 7 – exon 8 junctions in cells treated with MSH3 splice modulators targeting exon 7 skipping (A), and exon 14 – exon 15 and exon 15 – exon 16 junctions in cells treated with MSH3 splice modulators targeting exon 15 skipping (B). All molecules consist of asRNAs targeting the 3’ splice site and 5’ splice site of the target exon, consist of either 24nt or 36nt asRNAs, and either have asRNAs separated by a linker sequence or contain no linker sequence. The splice modulator transcripts from left to right are SEQ ID 53 (SEQ ID 18 + SEQ ID 80 + SEQ ID 17 + SEQ ID 2 + SEQ ID 3), SEQ ID 54 (SEQ ID 18 + SEQ ID 17 + SEQ ID 2 + SEQ ID 3), SEQ ID 55 (SEQ ID 13 + SEQ ID 80 + SEQ ID 7 + SEQ ID 2 + SEQ ID 3), SEQ ID 56 (SEQ ID 13 + SEQ ID 7 + SEQ ID 2 + SEQ ID 3) (A), and SEQ ID 73 (SEQ ID 34 + SEQ ID 80 + SEQ ID 33 + SEQ ID 2 + SEQ ID 3), SEQ ID 74 (SEQ ID 34 + SEQ ID 33 + SEQ ID 2 + SEQ ID 3), SEQ ID 75 (SEQ ID 29 + SEQ ID 80 + SEQ ID 22 + SEQ ID 2 + SEQ ID 3), SEQ ID 76 (SEQ ID 29 + SEQ ID 22 + SEQ ID 2 + SEQ ID 3) (B). FIGs.7A and 7B depict relative MSH3 RNA expression levels of exon 6 – exon 7 and exon 7 – exon 8 junctions in cells treated with MSH3 splice modulators targeting exon 7 skipping (A), and exon 14 – exon 15 and exon 15 – exon 16 junctions in cells treated with MSH3 splice modulators targeting exon 15 skipping (B). Molecules target the 3’ splice site and 5’ splice site of the target exon and consist of asRNAs that are either 24nt or 36nt in length in a single or dual format with and without a linker sequence. The splice modulator transcripts from left to right are SEQ ID 50 (SEQ ID 17 + SEQ ID 2 + SEQ ID 3), SEQ ID 51 (SEQ ID 18 + SEQ ID 2 + SEQ ID 3), SEQ ID 53 (SEQ ID 18 + SEQ ID 80 + SEQ ID 17 + SEQ ID 2 + SEQ ID 3), SEQ ID 54 (SEQ ID 18 + SEQ ID 17 + SEQ ID 2 + SEQ ID 3), SEQ ID 40 (SEQ ID 7 + SEQ ID 2 + SEQ ID 3), SEQ ID 46 (SEQ ID 13 + SEQ ID 2 + SEQ ID 3), SEQ ID 55 (SEQ ID 13 + SEQ ID 80 + SEQ ID 7 + SEQ ID 2 + SEQ ID 3), SEQ ID 56 (SEQ ID 13 + SEQ ID 7 + SEQ ID 2 + SEQ ID 3) (A), and SEQ ID 70 (SEQ ID 33 + SEQ ID 2 + SEQ ID 3), SEQ ID 71 (SEQ ID 34 + SEQ ID 2 + SEQ ID 3), SEQ ID 73 (SEQ ID 34 + SEQ ID 80 + SEQ ID 33 + SEQ ID 2 + SEQ ID 3), SEQ ID 74 (SEQ ID 34 + SEQ ID 33 + SEQ ID 2 + SEQ ID 3), SEQ ID 59 (SEQ ID 22 + SEQ ID 2 + SEQ ID 3), SEQ ID 66 (SEQ ID 29 + SEQ ID 2 + SEQ ID 3), SEQ ID 75 (SEQ ID 29 + SEQ ID 80 + SEQ ID 22 + SEQ ID 2 + SEQ ID 3), SEQ ID 76 (SEQ ID 29 + SEQ ID 22 + SEQ ID 2 + SEQ ID 3) (B). FIGs.8A-8C depict Western Blot band quantification of relative MSH3 protein levels in cells treated with MSH3 splice modulators targeting exons 7 and 15 (A), MSH3 transcript expression of exon 6 – exon 7 and exon 7 – exon 8 junctions in cells treated with MSH3 splice modulators targeting exon 7 skipping by RT-ddPCR (B), and MSH3 transcript expression of exon 14 – exon 15 and exon 15 – exon 16 junctions in cells treated with MSH3 splice modulators targeting exon 15 skipping by RT-ddPCR (C). The splice modulator transcripts from left to right are SEQ ID 38 (SEQ ID 5 + SEQ ID 2 + SEQ ID 3), SEQ ID 43 (SEQ ID 10 + SEQ ID 2 + SEQ ID 3), SEQ ID 50 (SEQ ID 17 + SEQ ID 2 + SEQ ID 3), SEQ ID 51 (SEQ ID 18 + SEQ ID 2 + SEQ ID 3), SEQ ID 53 (SEQ ID 18 + SEQ ID 80 + SEQ ID 17 + SEQ ID 2 + SEQ ID 3), SEQ ID 57 (SEQ ID 20 + SEQ ID 2 + SEQ ID 3), SEQ ID 65 (SEQ ID 28 + SEQ ID 2 + SEQ ID 3), SEQ ID 66 (SEQ ID 29 + SEQ ID 2 + SEQ ID 3), SEQ ID 73 (SEQ ID 34 + SEQ ID 80 + SEQ ID 33 + SEQ ID 2 + SEQ ID 3), and SEQ ID 74 (SEQ ID 34 + SEQ ID 33 + SEQ ID 2 + SEQ ID 3). Controls are SEQ ID 77 (SEQ ID 36 + SEQ ID 2 + SEQ ID 3) (scrambled asRNA) and a transfection control. FIGs.9A and 9B depict MSH3 RNA transcript expression levels relative to control treatment (A) and MSH3 protein levels relative to control treatment (B) in glutamatergic neurons differentiated from human induced pluripotent stem cells (iPSC) derived from a healthy donor. Controls include molecules containing U7 scaffolds with scrambled asRNA (SEQ ID NO: 77) and untreated cells. The splice modulator transcripts tested in order from left to right are SEQ ID NO: 82 (which is, from 5’ to 3’, SEQ ID NO: 81, SEQ ID NO: 9, SEQ ID NO: 2, and SEQ ID NO: 3), SEQ ID NO: 83 (which is, from 5’ to 3’, SEQ ID NO: 81, SEQ ID NO: 10, SEQ ID NO: 2, and SEQ ID NO: 3), SEQ ID NO: 53, and SEQ ID NO: 84 (which is, from 5’ to 3’, SEQ ID NO: 81, SEQ ID NO: 28, SEQ ID NO: 2, and SEQ ID NO: 3). Control SEQ ID NO: is SEQ ID NO: 77. FIGs.10A and 10B depict MSH3 RNA transcript expression levels relative to untreated control cells (A) and MSH3 protein levels relative to untreated control cells (B) in skeletal muscle cells differentiated from human induced pluripotent stem cells (iPSC) derived from a healthy donor. The splice modulator transcript is SEQ ID NO: 84 (which is, from 5’ to 3’, SEQ ID NO: 81, SEQ ID NO: 28, SEQ ID NO: 2, and SEQ ID NO: 3). FIGs.11A and 11B depict MSH3 RNA transcript expression levels relative to untreated control cells (A) and MSH3 protein levels relative to untreated control cells (B) in striatal neurons differentiated from human induced pluripotent stem cells (iPSC) derived from a healthy donor. The splice modulator transcript is SEQ ID NO: 53. FIGs.12A and 12B depict MSH3 RNA transcript expression levels relative to untreated control cells (A) and MSH3 protein levels relative to untreated control cells (B) in striatal neurons differentiated from human induced pluripotent stem cells (iPSC) derived from a Huntington’s Disease patient with CAG repeat size of >127 (SEQ ID NO: 86). The splice modulator transcript is SEQ ID NO: 53. FIGs.13A and 13B depict MSH3 RNA transcript expression levels relative to control tissues (A) and MSH3 protein levels relative to control tissues (B) of a MSH3 splice modulator delivered to the parietal cortex of African Green Monkey (Chlorocebus sabaeus) by AAV. The splice modulator transcript is SEQ ID NO: 53. FIG.14 depicts somatic instability analysis in striatal neurons differentiated from human induced pluripotent stem cells (iPSC) derived from a Huntington’s Disease patient with CAG repeat size of >127. The x-axis depicts CAG repeat size and the y-axis indicates the frequency of Nanopore long-read sequencing reads. CAG repeat sizes were determined by Nanopore long-read sequencing of HTT CAG repeat PCR amplicons in cells treated with MSH3 splice modulator (SEQ ID NO: 84; which is, from 5’ to 3’, SEQ ID NO: 81, SEQ ID NO: 28, SEQ ID NO: 2, and SEQ ID NO: 3) or control splice modulator (SEQ ID NO: 77) packaged in AAV. Neurons were pretreated with FAN1 shRNA to enhance repeat expansion prior to AAV treatment. The vertical line indicates the starting peak CAG size. FIGs.15A and 15B depict relative MSH3 RNA expression levels of exon 6 – exon 7 and exon 7 – exon 8 junctions in cells treated with MSH3 splice modulators targeting exon 7 skipping (A), and exon 14 – exon 15 and exon 15 – exon 16 junctions in cells treated with MSH3 splice modulators targeting exon 15 skipping (B). In FIG.15A, the MSH3 splice modulator indicated as having neither the hnRNPA1 tail nor hnRNPA1 linker was SEQ ID NO: 55 (5’ to 3’: SEQ ID NO: 13 + SEQ ID NO: 80 + SEQ ID NO: 7 + SEQ ID NO: 2 + SEQ ID NO: 3); the MSH3 splice modulator indicated as having an hnRNPA1 tail and not having hnRNPA1 linker was, 5’ to 3’, SEQ ID NO: 81 + SEQ ID NO: 13 + SEQ ID NO: 80 + SEQ ID NO: 7 + SEQ ID NO: 2 + SEQ ID NO: 3; and the MSH3 splice modulator indicated as having an hnRNPA1 linker and not having an hnRNPA1 tail was, from 5’ to 3’, SEQ ID NO: 13 + SEQ ID NO: 81 + SEQ ID NO: 7 + SEQ ID NO: 2 + SEQ ID NO: 3. In FIG.15B, the MSH3 splice modulator indicated as having neither the hnRNPA1 tail nor hnRNPA1 linker was SEQ ID NO: 75 (5’ to 3’: SEQ ID NO: 29 + SEQ ID NO: 80 + SEQ ID NO: 22 + SEQ ID NO: 2 + SEQ ID NO: 3); the MSH3 splice modulator indicated as having an hnRNPA1 tail and not having hnRNPA1 linker was, 5’ to 3’, SEQ ID NO: 81 + SEQ ID NO: 29 + SEQ ID NO: 80 + SEQ ID NO: 22 + SEQ ID NO: 2 + SEQ ID NO: 3; and the MSH3 splice modulator indicated as having an hnRNPA1 linker and not having an hnRNPA1 tail was, from 5’ to 3’, SEQ ID NO: 29 + SEQ ID NO: 81 + SEQ ID NO: 22 + SEQ ID NO: 2 + SEQ ID NO: 3. In all of the descriptions of the drawings above, the sequences associated with the SEQ ID NO references are DNA sequences (i.e., they have T nucleotides and not U nucleotides). However, it will be understood that the RNA forms of the MSH3 splice modulators would have the same sequences as the sequences associated with the indicated SEQ ID NO references, except that U would be substituted for each T in the sequence. DETAILED DESCRIPTION The following examples are provided to illustrate some embodiments of the present disclosure but are not intended to limit the scope of the disclosure; it will be understood by their exemplary nature that other procedures, methodologies, or techniques known to those skilled in the art may alternatively be used. Nucleotide repeat expansion disorders are genetic disorders caused by nucleotide repeat expansions in the genome whereby nucleotide repeats in certain genes exceed the normal, stable genomic range for that gene. The nucleotide repeats can cause genomic instability and can lead to the generation of defective or toxic mRNA transcripts and / or proteins, and / or impair RNA transcription. Trinucleotide repeat expansion disorders are an exemplary category of nucleotide repeat expansion disorders. Nucleotide repeat expansion disorders can be categorized by the type of repeat expansion. Type 1 disorders (e.g. Huntington's disease) are caused by a supranormal number of CAG repeats in a particular gene that, when translated into protein, result in a protein comprising an expanded polyglutamine tract relative to that of a wildtype protein. Type 2 disorders are caused by heterogeneous expansions that are typically short in length. Type 3 disorders (e.g., fragile X syndrome and Friedreich’s ataxia) are characterized by large repeat expansions that are generally located in non-coding regions of the genome. Nucleotide repeat expansion disorders are characterized by a wide variety of symptoms, including in some examples progressive neuronal dysfunction leading to neurodegeneration, a common feature of Type 1 disorders. Subjects may be considered at risk for developing a nucleotide repeat expansion disorder because they exhibit a level of nucleotide repeat expansion in a gene associated with disease at birth. Individuals with disease-associated germline repeat expansion levels may undergo somatic nucleotide repeat expansion, whereby nucleotide repeat expansion occurs after embryogenesis, reaching a pathological level later in life. The level of nucleotide repeat expansion, and the life cycle timing of that expansion can impact age of onset of disease, rate of progression of disease, and / or presence of disease. The present inventors sought to design molecules, constructs, and vectors comprising same, as well as compositions comprising any of these molecules, constructs, and vectors comprising same that can be used to delay and potentially inhibit somatic nucleotide repeat expansion, thereby delaying, treating, or preventing a somatic nucleotide repeat expansion disorder in a subject in need thereof. Accordingly, molecules, constructs, and vectors comprising same, and compositions comprising such molecules, constructs, and vectors comprising same may be used in methods for treating somatic nucleotide repeat expansion disorders and in the preparation of medicaments for treating somatic nucleotide repeat expansion disorders. MutS Homolog 3 (MSH3) protein is a component of the DNA mismatch repair system. MSH3 forms heterodimers with MSH2, which heterodimers are normally involved in maintaining genomic stability via detection and repair of short stretches of mismatched DNA that arise during normal transcription and replication. MSH3 / MSH2 heterodimers also recognize large DNA mismatches, repair of which can lead to genomic instability through expansion of nucleotide repeats. Indeed, there is mounting evidence that the underlying mechanism of pathogenesis for Huntington's disease (HD) and some other nucleotide repeat disorders is somatic instability of the CAG repeat tract. Genome Wide Association Studies (GWAS) performed in HD patients, for example, identified many components of the DNA repair pathway as key genetic modifiers associated with the rate of disease progression. In HD patients, single nucleotide variants (SNVs) in the MSH3 gene that reduce its expression are linked to delayed age of onset of the disease. MSH3 is speculated to be a good target for a HD therapeutic and evidence suggests that MSH3 knockdown leads to inhibition of somatic CAG repeat expansion both in vitro and in vivo. These findings have broader implications that therapeutics leading to reduced levels of MSH3 could provide therapeutic benefit in the context of other repeat expansion disorders characterized by unstable repeats, such as, e.g., various spinocerebellar ataxias (SCA) and fragile X syndrome. Other repeat expansion disorders that may be benefited by MSH3 knockdown include myotonic dystrophy 1, myotonic dystrophy 2, Fuchs endothelial corneal dystrophy, Friedreich ataxia, C9orf72 ALS / FTD, SCA1, SCA2, SCA3, SCA6, SCA7, SCA8, SCA10, SCA17, SCA31, or spinal and bulbar muscular atrophy. Accordingly, the present inventors have pursued several approaches to reduce MSH3 levels. Some embodiments of treatment methods described herein, or of constructs and / or molecules for use in methods of treatment or in the preparation of medicaments for treatment, focus on MSH3 as the primary and exclusive target. Some embodiments involve methods of treating, delaying, or preventing trinucleotide repeat expansion disorders by administering to a subject a therapeutic agent that reduces MSH3 expression. In some embodiments, the nucleotide repeat expansion disorder is a trinucleotide repeat expansion disorder, which leads to a polyglutamine disease. In some embodiments, the polyglutamine disease is dentatorubropallidoluysian atrophy, Huntington’s disease, spinal and bulbar muscular atrophy, spinocerebellar ataxia type 1, spinocerebellar ataxia type 2, spinocerebellar ataxia type 3, spinocerebellar ataxia type 6, spinocerebellar ataxia type 7, spinocerebellar ataxia type 17, or Huntington’s disease-like 2. In some embodiments, the trinucleotide repeat expansion disorder is Huntington’s disease. In some embodiments, the trinucleotide repeat expansion disorder is a non-polyglutamine disease. In some embodiments, the non-polyglutamine disease is fragile X syndrome, fragile X- associated tremor / ataxia syndrome, fragile XE mental retardation, Friedreich’s ataxia, myotonic dystrophy type 1, spinocerebellar ataxia type 8, spinocerebellar ataxia type 12, oculopharyngeal muscular dystrophy, Fragile X-associated premature ovarian failure, FRA2A syndrome, FRA7A syndrome, or early infantile epileptic encephalopathy. Exemplary nucleotide repeat expansion disorders include the following: Myotonic Dystrophy 1 (DMPK), Myotonic Dystrophy 2 (Cellular nucleic acid-binding protein; CNBP), Fuchs Endothelial Corneal Dystrophy (TCF4), Fragile X Syndrome (FMR1), Friedreich Ataxia (FXN), C9orf72 ALS / FTD (C9orf72), SCA1, 2, 3, 6, 7, 8, 10, 17, and 31, Spinal and bulbar muscular atrophy (AR). Results presented herein demonstrate that MSH3 splice modulators described herein dramatically reduce MSH3 mRNA and MSH3 protein expression in a statistically significant manner in a variety of in vitro cellular model systems relevant to trinucleotide repeat expansion disorders. FIGs.9A and 9B, for example, demonstrate that the splice modulators of SEQ ID NOs: 53, 82, 83, and 84 reduce MSH3 mRNA and protein levels, respectively, in glutamatergic neurons differentiated from human iPSCs derived from a healthy donor. FIGs.10A and 10B, for example, demonstrate that the splice modulator of SEQ ID NO: 84 reduces MSH3 mRNA and protein levels in skeletal muscle cells differentiated from human iPSCs derived from a healthy donor. FIGs.11A and 11B, for example, demonstrate that the splice modulator of SEQ ID NO: 53 reduces MSH3 mRNA and protein levels in striatal neurons differentiated from human iPSCs derived from a healthy donor. FIGs.12A and 12B, for example, demonstrate that the splice modulator of SEQ ID NO: 53 reduces MSH3 mRNA and protein levels in striatal neurons differentiated from human iPSCs derived from a Huntington’s Disease patient. FIGs.13A and 13B, for example, demonstrate that the splice modulator of SEQ ID NO: 53 reduces MSH3 mRNA and protein levels in the parietal cortex of African Green Monkey. The cell types tested in these experiments are representative of cell types affected by various nucleotide repeat disorders, which supports the conclusion that the MSH3 splice modulators of the present disclosure can effectively alter disease progression in nucleotide repeat disorders. Further evidence attesting to the potential therapeutic benefit of MSH3 splice modulators described herein is presented in FIG.14. Results presented in FIG.14 show that an exemplary MSH3 splice modulator [the splice modulator of SEQ ID NO: 84 (which is, from 5’ to 3’, SEQ ID NO: 81, SEQ ID NO: 28, SEQ ID NO: 2, and SEQ ID NO: 3)] inhibited CAG repeat expansion in striatal neurons differentiated from human iPSCs derived from a Huntington’s Disease patient, whereas a negative control, a scrambled asRNA control (SEQ ID NO: 77), was ineffectual. As shown in FIG.14 and described in the brief description thereof, the numbers of genomic CAG repeats were tested after 50 and 76 days of culture with either the splice modulator of SEQ ID NO: 84 or negative control (SEQ ID NO: 77), and the MSH3 splice modulator inhibited CAG repeat expansion to a significant degree relative to the negative control. This beneficial effect was evident after 50 days of culture and was particularly pronounced after 76 days of culture. These results indicate that MSH3 knockdown by splice modulators described herein can affect disease progression in repeat expansion disorders by inhibiting expansion of trinucleotide repeats. Accordingly, based on the evidence presented herein in an accepted cellular model of Huntington’s Disease (striatal neurons differentiated from human iPSCs derived from a Huntington’s Disease patient), it is reasonable to predict that MSH3 splice modulators described herein would have a similar effect in a Huntington’s Disease patient and thus, inhibit repeat expansion in such a patient. It is, therefore, plausible that MSH3 splice modulators described herein will confer therapeutic benefit when administered to patients afflicted with trinucleotide repeat expansion disorders, such as Huntington’s Disease, by inhibiting expansion of trinucleotide repeats in treated patients. This is significant because expansion of trinucleotide repeats is known to be correlated with manifestation of such disorders and, in many circumstances, the number of repeats is positively correlated with severity of disease and age of onset. Accordingly, the present inventors envision that administration of the MSH3 splice modulators described herein to patients at early stages of disease, after diagnosis and when the patients are asymptomatic or the symptoms of disease are mild, will be particularly beneficial to such patients because the MSH3 splice modulators will reduce or prevent further expansion of trinucleotide repeats. The present inventors further envision that administration of the MSH3 splice modulators described herein to patients at any stage of disease will confer therapeutic benefit to patients diagnosed with any trinucleotide repeat expansion disorder, particularly those described herein, because the MSH3 splice modulators will reduce or prevent further expansion of trinucleotide repeats in such patients. Results presented herein surprisingly show that MSH3 splice modulators that target exons 7 and 15 (e.g., by including asRNAs with complementarity to exon sequences or exon-intron junction sequences of these exons or to intron sequences flanking these exons) are more effective than MSH3 splice modulators that target other exons. Results presented herein surprisingly show further that MSH3 splice modulators that include asRNA sequences that target, bind to, or have complementarity to sequences that are entirely within exon sequences of target exons 7 and 15 (i.e., asRNA sequences that do not bind, target, or have substantial complementarity to intron sequences or exon-intron junction sequences) are effective at inducing exon skipping of the target exon. For example, MSH3 splice modulators having sequences set forth in SEQ ID NOs: 43, 64, 82, 83, 84, among others, promoted exon skipping as well as, or better than, certain constructs that target exon-intron junction sequences. Splice modulation of MSH3 MSH3 can be inactivated by incorporating sequences that are complementary to MSH3 splice junctions or MSH3 exon sequences into snRNA sequences, such as the U7 snRNA. Modified snRNAs such as the U7 SmOPT were designed by 1) changing the targeting sequence (e.g., the histone binding sequence at the 5′ region of U7 snRNA) to the complementary sequence of the gene to be modified, and 2) changing the binding site (U7 Sm WT) for U7 snRNP specific proteins (Lsm10 and Lsm11) to the consensus sequence derived from major spliceosomal uridine-rich small nuclear ribonucleoproteins (U snRNPs) (U7 Sm OPT), leading to the formation of a spliceosomal-type heptameric protein core wrapped around U7 Sm OPT. In some embodiments, asRNA molecules described herein consist of the U1 promoter, snRNA (with asRNA sequence targeting MSH3 intron-exon boundaries or MSH3 exon sequences, or combinations thereof, and consensus Sm binding site), and a U1 terminator. See, e.g., FIG.1A and 1B. U7SmOPT molecules comprising an antisense sequence to the indicated exon sequence, intron sequence, and / or intron / exon junction region described herein may be referred to as MSH3 splice modulator constructs. See, e.g., FIG.1A and 1B. When operatively linked to an antisense RNA sequence that binds to a target sequence associated with a target exon of MSH3 pre-mRNA (e.g., an exon sequence of the target exon, an exon-intron junction sequence of a target exon, or an intron sequence flanking the target exon), a U7 SmOPT sequence (e.g., an RNA sequence comprising or consisting of a combination of SEQ ID NO: 2 (AATTTTTGG) and SEQ ID NO: 3 (AGCAGGTTTTCTGACTTCGGTCGGAAAACCCCT) operatively linked, e.g., as in SEQ ID NO: 106) can promote exon skipping of the target exon. A U7 SmOPT sequence (e.g., an RNA sequence comprising or consisting of a combination of SEQ ID NO: 2 and SEQ ID NO: 3 operatively linked, e.g., as in SEQ ID NO: 106) can also bind a spliceosomal- type heptameric protein core. In some embodiments, splice modulators of the present disclosure comprise a means for binding a spliceosomal-type heptameric protein core. A U7 SmOPT sequence (e.g., an RNA sequence comprising or consisting of a combination of SEQ ID NO: 2 and SEQ ID NO: 3 operatively linked, e.g., as in SEQ ID NO: 106) can also bind snRNPs. In some embodiments, splice modulators of the present disclosure comprise a means for binding snRNPs. An additional RNA element that can enhance exon skipping activity when operatively linked to an antisense RNA sequence that targets or binds to a target exon or associated sequence of a pre-mRNA is an hnRNPA1 binding sequence which is an RNA sequence that includes one or more binding sites for the heterogeneous ribonucleoprotein A1 (hnRNPA1) protein. An exemplary sequence for an hnRNPA1 binding sequence is set forth in SEQ ID NO: 81 (which, when in an RNA will have U substituted for each T in SEQ ID NO: 81). The hnRNPA1 binding sequence of SEQ ID NO: 81 includes two hnRNPA1 binding sites. MSH3 splice modulator constructs disclosed herein may comprise, e.g., a means for recruiting hnRNPA1 protein or a means for binding hnRNPA1 protein, which may be provided by the sequence of SEQ ID NO: 81. In some embodiments, splice modulator constructs of the present disclosure comprise an hnRNPA1 binding sequence (e.g., SEQ ID NO: 81). In some embodiments, the hnRNPA1 binding sequence is on the 5’ end of a splice modulator RNA molecule. In such embodiments, the hnRNPA1 binding sequence may be referred to as an “hnRNPA1 tail.” In some embodiments, the hnRNPA1 binding sequence is at an internal location within a splice modulator RNA molecule or DNA construct. In some embodiments, the hnRNPA1 binding sequence is between two asRNA sequences. In some embodiments, the two asRNA sequences may, as an example, each target a different exon-intron junction of a target exon. In some embodiments, the two asRNA sequences may target different exon sequences of a target exon. Various combinations of asRNA sequences may be used in embodiments in which an hnRNPA1 binding sequence is in a 5’ tail position or an internal position, including any of the combinations of MSH3-targeting asRNA sequences disclosed herein. Exemplary structures of splice modulator constructs that include hnRNPA1 binding sequences, depicted in a 5’ to 3’ orientation, are as follows: [hnRNPA1]-[asRNA1]-[snRNA] [hnRNPA1]-[asRNA1]-[asRNA2]-[snRNA] [hnRNPA1]-[asRNA1]-[linker]-[asRNA2]-[snRNA] [asRNA1]-[hnRNPA1]-[asRNA2]-[snRNA] In the above exemplary structures; [hnRNPA1] represents an hnRNPA1 binding sequence (e.g., SEQ ID NO: 81); [snRNA] represents a small nuclear RNA (e.g., U7smOPT (SEQ ID NO: 106); [linker] represents a linker which can be, for example, any of the linkers disclosed herein (e.g., SEQ ID NO: 80) that are not hnRNPA1 binding sequences; [asRNA1] represents a first antisense RNA sequence that binds to a first target mRNA sequence (which can be any of the asRNAs disclosed herein); and [asRNA2] represents a second antisense RNA sequence that binds to a second target mRNA sequence distinct from the first target mRNA sequence. In some embodiments [asRNA1] binds to a 3’ exon-intron junction of a target exon and [asRNA2] binds to a 5’ intron-exon junction of the same target exon. In some embodiments, the target exon is an MSH3 target exon (e.g., MSH3 exon 7 or MSH3 exon 15). In some embodiments, the target exon is an exon of a gene other than MSH3. Embodiments in which [hnRNPA1] is between [asRNA1] and [asRNA2] may be described as having hnRNPA1 binding sequence in a “linker” position. However, an hnRNPA1 binding sequence is distinct from linkers disclosed herein in that it is capable of binding hnRNPA1 protein, whereas linkers disclosed herein are not hnRNPA1 binding sequences. Experimental results presented herein show that an hnRNPA1 binding sequence (e.g., SEQ ID NO: 81) can enhance exon skipping when added to constructs that do not have an hnRNPA1 binding sequence. The experimental results further show that constructs with an hnRNPA1 binding sequence at an internal position, such as between two asRNA sequences, are more effective at inducing exon skipping than constructs in which the hnRNPA1 binding sequence is in a 5’ “tail” position. See, for example, FIGs.15A and 15B. These results applied for two distinct exons, indicating that the advantage of having the hnRNPA1 in an internal position is not limited to a particular exon or target gene context. The present inventors designed and tested MSH3 splice modulators targeting the skipping of MSH3 exons 7 or 15. In some embodiments, an MSH3 splice modulator construct is described comprising, operatively linked: (a) a sequence encoding an antisense RNA (asRNA) that blocks normal processing of MSH3 pre-mRNA by, e.g., promoting exon skipping of a target exon of MSH3 pre- mRNA, wherein the target exon is any one of MSH3 exons 7 or 15, or a combination thereof, and wherein the asRNA target comprises a 5’ intron-exon junction, an exon sequence, or a 3’ exon-intron junction sequence of MSH3 exons 7 or 15 (or any combination thereof); and (b) a sequence encoding a small nuclear RNA (snRNA) sequence. In some embodiments, the MSH3 splice modulator construct further comprises a U1 promoter and a U1 terminator operatively linked to (a) and (b). In some embodiments, the snRNA is a modified snRNA. In some embodiments, the modified snRNA comprises a U7 Sm OPT sequence or a U2 snRNA sequence. In some embodiments, the antisense RNA targets a 5’ intron-exon junction, an exon sequence, or a 3’ exon-intron junction, or any combination thereof of the 5’ intron-exon junction, the exon sequence, and the 3’ exon-intron junction of the target exon / s. In some embodiments, an MSH3 splice modulator construct comprises at least one asRNA. In some embodiments, an MSH3 splice modulator construct comprises at least one asRNA, wherein the at least one asRNA targets MSH3 exon 7, MSH3 exon 15, or a combination of MSH3 exons 7 and 15. In some embodiments, the antisense RNA comprises, consists essentially of, or consists of any one of SEQ ID NOs: 5-16 or 20-32 or a sequence having at least 90% identity to any one of SEQ ID NOs: 5-16 or 20-32. In some embodiments, the antisense RNA comprises, consists essentially of, or consists of combinations of SEQ ID NOs: 5-35 or combinations of sequences, wherein each of such sequences has at least 90% identity to any one of SEQ ID NOs: 5-35. In some embodiments, the antisense RNA comprises, consists essentially of, or consists of combinations of SEQ ID NOs: 5-18 or 20-34 or combinations of sequences, wherein each of such sequences has at least 90% identity to any one of SEQ ID NOs: 5-18 or 20-34, with the proviso that when such combinations consist of two sequences, the combination does not consist essentially of or consist of SEQ ID NOs: 17 and 18 (or a combination of two sequences wherein each sequence has at least 90% identity to SEQ ID NOs: 17 or 18, respectively); or the combination does not consist essentially of or consist of SEQ ID NOs: 33 and 34 (or a combination of two sequences wherein each sequence has at least 90% identity to SEQ ID NOs: 33 or 34, respectively). In some embodiments, the antisense RNA comprises, consists essentially of, or consists of combinations of at least three of SEQ ID NOs: 5-35, or combinations of at least three sequences, wherein each of such sequences has at least 90% identity to any one of SEQ ID NOs: 5-35, or any combination thereof. In some embodiments, the antisense RNA comprises, consists essentially of, or consists of combinations of at least three of SEQ ID NOs: 5-18 or 20-34, or combinations of at least three sequences, wherein each of such sequences has at least 90% identity to any one of SEQ ID NOs: 5-18 or 20-34, or any combination thereof (e.g., a combination of SEQ ID NOs: 9 and 10 and a sequence having at least 90% identity to SEQ ID NO: 18; or a combination of SEQ ID NOs: 9, 10, and 18; or a combination of SEQ ID NOs: 27 and 28 and a sequence having at least 90% identity to SEQ ID NO: 33; or a combination of SEQ ID NOs: 27, 28, and 33; or a combination of SEQ ID NOs: 9, 10, and 33). In some embodiments, such combinations of antisense RNA comprise combinations of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 , 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35 of the antisense RNA described herein. In some embodiments, the antisense RNA comprises, consists essentially of, or consists of any one of SEQ ID NOs: 5-16 or 20-32 or a sequence having 100% identity to 12-18 consecutive nucleotides of any one of SEQ ID NOs: 5-16 or 20-32. In some embodiments, the antisense RNA comprises, consists essentially of, or consists of any one of SEQ ID NOs: 8-12 or 21, 23- 28, or 30-31 or a sequence having 100% identity to 12-18 consecutive nucleotides of any one of SEQ ID NOs: 8-12 or 21, 23-28, or 30-31. In some embodiments, an MSH3 splice modulator construct described above comprises any one of SEQ ID NOs: 38-76, with the proviso that such MSH3 splice modulator constructs do not include SEQ ID NOs: 52, 53, 72, or 73. In some embodiments, an MSH3 splice modulator construct described above comprises any one of SEQ ID NOs: 38-76, with the proviso that such MSH3 splice modulator constructs do not include SEQ ID NOs: 52, 53, 54, 72, 73, or 74. In some embodiments, MSH3 splice modulator constructs described above are used in combination, wherein such combinations comprise at least one of SEQ ID NOs: 38-76. In some embodiments, MSH3 splice modulator constructs described above are used in combination, wherein such combinations comprise at least one of SEQ ID NOs: 38-76, with the proviso that when such combinations consist of two MSH3 splice modulator constructs, the combination of two MSH3 splice modulator constructs does not consist essentially of or consist of a combination of two of SEQ ID NOs: 52, 53, 72, or 73. In some embodiments, MSH3 splice modulator constructs described above are used in combination wherein such combinations comprise at least one of SEQ ID NOs: 38-76, with the proviso that when such combinations consist of two MSH3 splice modulator constructs, the combination of two MSH3 splice modulator constructs does not consist essentially of or consist of a combination of two of SEQ ID NOs: 52, 53, 54, 72, 73, or 74. In some embodiments, MSH3 splice modulator constructs described above are used in combination, wherein such combinations comprise at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 , 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35 of the MSH3 splice modulator constructs described. In some embodiments, the MSH3 splice modulator construct comprises any one of SEQ ID NOs: 38-51, 54-71, or 74-76. In some embodiments, the MSH3 splice modulator construct comprises any one of SEQ ID NOs: 42, 43, 44, 46, 47, 50, 51, 55, 56, 64, 65, or 74. In some embodiments, MSH3 splice modulator constructs described above are used in combination, wherein such combinations comprise at least one of SEQ ID NOs: 42, 43, 44, 46, 47, 50, 51, 55, 56, 64, 65, or 74. In some embodiments, MSH3 splice modulator constructs described above are used in combination, wherein such combinations comprise at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 of SEQ ID NOs: 42, 43, 44, 46, 47, 50, 51, 55, 56, 64, 65, or 74. In some embodiments, the antisense RNA comprises, operatively linked in a 5’ to 3’ direction: (a) a sequence that targets the 3’ exon-intron junction; and (b) a sequence that targets the 5’ intron-exon junction of exon 7. In some embodiments, the antisense RNA that targets both the 5’ intron-exon junction and the 3’ exon-intron junction of exon 7 comprises SEQ ID NOs: 7 and 13, SEQ ID NOs: 7 and 18, SEQ ID NOs: 17 and 13, or SEQ ID NOs: 17 and 18. In some embodiments, the antisense RNA that targets both the 5’ intron-exon junction and the 3’ exon- intron junction of exon 7 comprises SEQ ID NOs: 7 and 13, SEQ ID NOs: 7 and 18, or SEQ ID NOs: 17 and 13. In some embodiments, the antisense RNA that targets both the 5’ intron-exon junction and the 3’ exon-intron junction of exon 7 comprises SEQ ID NOs: 7 and 13. In some embodiments, the MSH3 splice modulator construct comprises any one of SEQ ID NOs: 56 (SEQ ID NO: 13 + SEQ ID NO: 7 + SEQ ID NO: 2 + SEQ ID NO: 3) or 54 (SEQ ID NO: 18 + SEQ ID NO: 17 + SEQ ID NO: 2 + SEQ ID NO: 3) or a combination of SEQ ID NO: 7 + SEQ ID NO: 18 + SEQ ID NO: 2 + SEQ ID NO: 3 arranged in 5’ to 3’ order, a combination of SEQ ID NO: 17 + SEQ ID NO: 13 + SEQ ID NO: 2 + SEQ ID NO: 3 arranged in 5’ to 3’ order, a combination of SEQ ID NO: 18 + SEQ ID NO: 7 + SEQ ID NO: 2 + SEQ ID NO: 3 arranged in 5’ to 3’ order, or a combination of SEQ ID NO: 13 + SEQ ID NO: 17 + SEQ ID NO: 2 + SEQ ID NO: 3 arranged in 5’ to 3’ order. In some embodiments, an MSH3 splice modulator construct encoding antisense RNA comprising a sequence that targets the 3’ exon-intron junction of exon 7 can be used in combination with an MSH3 splice modulator construct encoding antisense RNA comprising a sequence that targets the 5’ intron-exon junction of exon 7. In some embodiments, such combinations of MSH3 splice modulator constructs comprise SEQ ID NOs: 40 (SEQ ID NO: 7 + SEQ ID NO: 2 + SEQ ID NO: 3) and 46 (SEQ ID NO: 13 + SEQ ID NO: 2 + SEQ ID NO: 3); SEQ ID NOs: 40 (SEQ ID NO: 7 + SEQ ID NO: 2 + SEQ ID NO: 3) and 51 (SEQ ID NO: 18 + SEQ ID NO: 2 + SEQ ID NO: 3); or SEQ ID NOs: 50 (SEQ ID NO: 17 + SEQ ID NO: 2 + SEQ ID NO: 3) and 46 (SEQ ID NO: 13 + SEQ ID NO: 2 + SEQ ID NO: 3), or SEQ ID NOs: 50 (SEQ ID NO: 17 + SEQ ID NO: 2 + SEQ ID NO: 3) and 51 (SEQ ID NO: 18 + SEQ ID NO: 2 + SEQ ID NO: 3), or any combination thereof. In some embodiments, the antisense RNA comprises, operatively linked in a 5’ to 3’ direction: (a) a sequence that targets the 3’ exon-intron junction; (b) a linker sequence of at least 15 nucleotides that does not anneal to the target exon; and (c) a sequence that targets the 5’ intron-exon junction of exon 7. In some embodiments, the linker sequence is less than 50% complementary to all sequences of the target exon of the same length as the linker. An exemplary linker sequence is set forth in SEQ ID NO: 80. It will be recognized that many variants of linker sequences may be utilized in embodiments of the present disclosure. In some embodiments, the antisense RNA that targets both the 5’ intron-exon junction and the 3’ exon- intron junction of exon 7 comprises SEQ ID NOs: 7 and 13, SEQ ID NOs: 7 and 18, or SEQ ID NOs: 17 and 13. In some embodiments, the antisense RNA that targets both the 5’ intron-exon junction and the 3’ exon-intron junction of exon 7 comprises SEQ ID NOs: 7 and 13. In some embodiments, the MSH3 splice modulator construct comprises any one of SEQ ID NOs: 55 (SEQ ID NO: 13 + SEQ ID NO: 80 + SEQ ID NO: 7 + SEQ ID NO: 2 + SEQ ID NO: 3) or a combination of SEQ ID NO: 7 + SEQ ID NO: 80 + SEQ ID NO: 18 + SEQ ID NO: 2 + SEQ ID NO: 3 arranged in 5’ to 3’ order, a combination of SEQ ID NO: 17 + SEQ ID NO: 80 + SEQ ID NO: 13 + SEQ ID NO: 2 + SEQ ID NO: 3 arranged in 5’ to 3’ order, a combination of SEQ ID NO: 18 + SEQ ID NO: 80 + SEQ ID NO: 7 + SEQ ID NO: 2 + SEQ ID NO: 3 arranged in 5’ to 3’ order, or a combination of SEQ ID NO: 13 + SEQ ID NO: 80 + SEQ ID NO: 17 + SEQ ID NO: 2 + SEQ ID NO: 3 arranged in 5’ to 3’ order. In some embodiments, the antisense RNA comprises, operatively linked in a 5’ to 3’ direction: (a) a sequence that targets the 3’ exon-intron junction; and (b) a sequence that targets the 5’ intron-exon junction of exon 15. In some embodiments, the antisense RNA that targets both the 5’ intron-exon junction and the 3’ exon-intron junction of exon 15 comprises SEQ ID NOs: 22 and 29, SEQ ID NOs: 22 and 34, SEQ ID NOs: 33 and 29, or SEQ ID NOs: 33 and 34. In some embodiments, the antisense RNA that targets both the 5’ intron-exon junction and the 3’ exon- intron junction of exon 15 comprises SEQ ID NOs: 22 and 29, SEQ ID NOs: 22 and 34, or SEQ ID NOs: 33 and 29. In some embodiments, the antisense RNA that targets both the 5’ intron- exon junction and the 3’ exon-intron junction of exon 15 comprises SEQ ID NOs: 22 and 29. In some embodiments, the MSH3 splice modulator construct comprises any one of SEQ ID NOs: 76 (SEQ ID NO: 29 + SEQ ID NO: 22 + SEQ ID NO: 2 + SEQ ID NO: 3) or 74 (SEQ ID NO: 34 + SEQ ID NO: 33 + SEQ ID NO: 2 + SEQ ID NO: 3), a combination of SEQ ID NO: 22 + SEQ ID NO: 34 + SEQ ID NO: 2 + SEQ ID NO: 3 arranged in 5’ to 3’ order, a combination of SEQ ID NO: 33 + SEQ ID NO: 29 + SEQ ID NO: 2 + SEQ ID NO: 3 arranged in 5’ to 3’ order, a combination of SEQ ID NO: 34 + SEQ ID NO: 22 + SEQ ID NO: 2 + SEQ ID NO: 3 arranged in 5’ to 3’ order, or a combination of SEQ ID NO: 29 + SEQ ID NO: 33 + SEQ ID NO: 2 + SEQ ID NO: 3 arranged in 5’ to 3’ order. In some embodiments, the antisense RNA comprises, operatively linked in a 5’ to 3’ direction: (a) a sequence that targets the 3’ exon-intron junction; (b) a linker sequence of at least 15 nucleotides that does not anneal to the target exon; and (c) a sequence that targets the 5’ intron-exon junction of exon 15. In some embodiments, the linker sequence is less than 50% complementary to all sequences of the target exon of the same length as the linker. In some embodiments, the antisense RNA that targets both the 5’ intron-exon junction and the 3’ exon- intron junction of exon 15 comprises SEQ ID NOs: 22 and 29, SEQ ID NOs: 22 and 34, or SEQ ID NOs: 33 and 29. In some embodiments, the antisense RNA that targets both the 5’ intron- exon junction and the 3’ exon-intron junction of exon 15 comprises SEQ ID NOs: 22 and 29. In some embodiments, the MSH3 splice modulator construct comprises any one of SEQ ID NOs: 75 (SEQ ID NO: 29 + SEQ ID NO: 80 + SEQ ID NO: 22 + SEQ ID NO: 2 + SEQ ID NO: 3) or a combination of SEQ ID NO: 22 + SEQ ID NO: 80 + SEQ ID NO: 34 + SEQ ID NO: 2 + SEQ ID NO: 3 arranged in 5’ to 3’ order, a combination of SEQ ID NO: 33 + SEQ ID NO: 80 + SEQ ID NO: 29 + SEQ ID NO: 2 + SEQ ID NO: 3 arranged in 5’ to 3’ order, a combination of SEQ ID NO: 34 + SEQ ID NO: 80 + SEQ ID NO: 22 + SEQ ID NO: 2 + SEQ ID NO: 3 arranged in 5’ to 3’ order, or a combination of SEQ ID NO: 29 + SEQ ID NO: 80 + SEQ ID NO: 33 + SEQ ID NO: 2 + SEQ ID NO: 3 arranged in 5’ to 3’ order. In some embodiments, the antisense RNA comprises a sequence that targets or binds to an exon sequence of a target exon (e.g., exon 7 or exon 15) without targeting or binding to an intron sequence flanking the target exon. Such asRNA sequences include, for example, SEQ ID NOs: 8-12, which can target or bind to exon 7 sequences without binding intron 6 or intron 7 sequences. Such asRNA sequences also include, for example, SEQ ID NOs: 23-28, which can target or bind to exon 15 sequences without binding intron 14 or intron 15 sequences. Also disclosed herein are MSH3 splice modulator construct vectors comprising at least one of the MSH3 splice modulator constructs and MSH3 splice modulator constructs comprising at least one of the MSH3 antisense RNA described above. In some embodiments, at least one of the MSH3 splice modulator construct / s is / are comprised on a single vector. In some embodiments, the single vector is an AAV vector. In some embodiments, the MSH3 splice modulator construct comprises any one of SEQ ID NOs: 38-51, 54-71, or 74-76. In some embodiments, the MSH3 splice modulator construct comprises any one of SEQ ID NOs: 42, 43, 44, 46, 47, 50, 51, 55, 56, 64, 65, or 74. In some embodiments, the AAV vector is a scAAV or ssAAV vector. The present inventors identified effective MSH3 splice modulator constructs that specifically target sequence regions of exons or intron / exon junctions of 7 and 15. Some of the MSH3 splice modulator constructs tested exhibited a particularly high degree of reduction in MSH3 expression levels. See, e.g., FIGs.2-7. Western blots probed with antibodies to visualize MSH3 indicated that MSH3 protein knockdown levels correspond with the RNA exon skipping efficiency profiles. Sequences of the tested MSH3 splice modulators are set forth in, e.g., SEQ ID NOs: 38, 43, 50, 51, 53, 57, 65, 66, 73, and 74; 77 (negative control). See, e.g., FIG.8A-C. In some embodiments, MSH3 splice modulators disclosed herein may be used alone. In some embodiments, MSH3 splice modulators disclosed herein may be used in conjunction with other therapeutic agents that target other genes associated with trinucleotide repeat expansion disorders / diseases. In some embodiments, MSH3 splice modulators disclosed herein may be administered alone or in combination with other suitable therapeutics to treat or prevent a trinucleotide repeat expansion disorders / diseases. Compositions and methods described herein involve therapeutic molecules (MSH3 splice modulators and MSH3 splice modulator constructs) that knock down expression of MSH3. The MSH3 splice modulator constructs can be used alone in therapeutic methods or can be used in combination with other therapeutic agents, such as other therapeutic agents that are designed to treat trinucleotide repeat expansion disorders. The compositions and methods described herein employ MSH3 splice modulator constructs for gene therapy (e.g., in vivo gene therapy, as, e.g., delivered by adeno-associated virus) to treat diseases caused by a trinucleotide repeat expansion in a gene in which such expansion is associated with a trinucleotide repeat expansion disorder (e.g., expanded CAG trinucleotide repeat in HTT, which is associated with HD). The compositions and methods described herein also employ MSH3 splice modulator constructs for gene therapy (e.g., in vivo gene therapy) in combination with other therapeutic agents described herein to treat diseases caused by or associated with a trinucleotide repeat expansion disorder. Huntington’s Disease (HD) is an example of a trinucleotide repeat expansion disorder wherein an expanded CAG trinucleotide repeat in exon 1 of the HTT gene leads to HD. Other examples of repeat expansion diseases include myotonic dystrophy 1, myotonic dystrophy 2, Fuchs endothelial corneal dystrophy, fragile X syndrome, Friedreich ataxia, C9orf72 ALS / FTD, SCA1, SCA2, SCA3, SCA6, SCA7, SCA8, SCA10, SCA17, SCA31, or spinal and bulbar muscular atrophy. Huntington’s Disease As described herein, HD is an inherited progressive neurodegenerative disorder, for which only palliative therapy is available. Such therapy includes drugs, physical therapy, and counseling, which interventions provide some symptomatic relief. Although presentation of HD varies, the disease is characterized by a progressive loss in the ability to control movement, regulate emotions, and maintain cognitive attributes. HD typically presents in people in their 30s and 40s. The disease is associated with loss of pyramidal neurons in the cortex, loss of medium spiny neurons in the striatum, and loss of hypothalamic neurons. The genetic cause of HD is the autosomal dominant inheritance of an expanded CAG trinucleotide repeat in exon 1 of the HTT gene, wherein the presence of over 40 repeats of CAG (SEQ ID NO: 87) in this region is disease-causing. The HTT locus is large, spanning 180 kb and consisting of 67 exons. Expression of the HTT gene is required for normal development. Although HTT protein is widely expressed, the brain is most severely impacted by pathological expansion of CAG trinucleotide repeats, with early pathological effects observed in the striatum and motor cortex. The underlying mechanism of HD pathogenesis is the somatic CAG repeat expansion in HTT that occurs in affected brain regions (e.g., striatum) of HD patients. Human genetic evidence implicates genes in the DNA mismatch repair pathway (ex. MSH2, MSH3, FAN1, MLH1) in controlling this process and modifying the clinical outcome of HD. Despite considerable effort directed to developing HD therapeutics, there are currently no disease-modifying treatments for HD. The present inventors sought to address this need using a variety of different modalities, each of which may be implemented alone or in combination to provide therapeutic intervention for HD. Myotonic Dystrophy 1 (DM1) Myotonic dystrophy causes muscle weakness, early onset of cataracts, and myotonia, which is delayed relaxation of muscles after contraction. Other organs affected include the heart, lungs, gastrointestinal tract, skin, and brain. Insulin resistance can also occur. DM1 usually begins in the muscles of the hands, feet, neck, or face. It slowly progresses to involve other muscle groups, including the heart. Other DM1 symptoms include problems with executive function (e.g., organization, concentration, word-finding), hypersomnia, abnormalities in the electrical activity of the heart, which can include arrhythmias, conduction blocks, and dilated cardiomyopathy. Symptoms onset any time from birth to adulthood. The earlier the disease onset, the greater the variety of possible signs and symptoms. DM1 is caused by a microsatellite expansion of cytosine-thymine-guanine (CTG) triplet repeats, classifying DM1 as a trinucleotide repeat disorder. This expansion occurs at the end of the DMPK gene, in the 3' untranslated region. DMPK is located on the long arm of chromosome 19. DMPK codes for myotonic dystrophy protein kinase, a protein expressed predominantly in skeletal muscle. Between 5 and 37 repeats is considered normal; between 38 and 49 repeats is considered pre-mutation; greater than 50 repeats is considered a mutation and almost invariably is symptomatic, with some noted exceptions. Longer repeats are usually associated with earlier onset and more severe disease. DMPK alleles with greater than 37 repeats are unstable and additional trinucleotide repeats may be inserted during cell division in mitosis and meiosis. Consequently, the children of individuals with premutations or mutations inherit DMPK alleles which are longer than their parents and therefore are more likely to be affected or display an earlier onset and greater severity of the condition, a phenomenon known as anticipation. The RNA from the expanded trinucleotide repeat region of DMPK forms intranucleoplasmic hairpin loops due to the extensive hydrogen bonding between C-G base pairs, and it has been demonstrated that these sequester the splicing regulator MBNL1 to form distinctive foci. Sequestration of RNA-binding proteins causes dysregulated RNA splicing, which is toxic to skeletal, cardiac, and smooth muscle. Animal model data suggest that inhibition of MSH3 expression could be an effective treatment of DM1. DM1 model transgenic mice with CTG expansions were crossed with Msh3- deficient mice and CTG repeats were analyzed after maternal and paternal transmissions, and it was found that Msh3 plays a key role in the formation of expansions over successive generations. Foiry et al., Human Genetics 119:530-26 (2006). Furthermore, the absence of one Msh3 allele in mice was sufficient to decrease the formation of expansions, indicating that Msh3 is rate- limiting in this process. Another study suggested that reduced MSH3 expression levels reduce somatic expansion and improve phenotype in both Huntington’s disease and DM1. Flower et al., Brain 142:1876-86 (2019). A transcriptome-wide association study in a Huntington’s disease cohort found increased MSH3 and DHFR expression are associated with disease progression. These results suggest that variation in the MSH3 exon 1 repeat region influences somatic expansion and disease phenotype in Huntington’s disease and myotonic dystrophy type 1 and suggests a common DNA repair mechanism operates in both repeat expansion diseases. In some embodiments, a method of treating DM1 may involve delivery of an MSH3 splice modulator construct of the present disclosure into affected cells, such as skeletal, cardiac, or smooth muscle cells. Myotonic Dystrophy 2 (DM2) Myotonic dystrophy causes muscle weakness, early onset of cataracts, and myotonia, which is delayed relaxation of muscles after contraction. Other organs affected include the heart, lungs, gastrointestinal tract, skin, and brain. Insulin resistance can also occur. The microsatellite expansion responsible for DM2 is of cytosine-cytosine-thymine-guanine (CCTG) repeats, classifying it as a tetranucleotide repeat disorder. This expansion occurs in the first intron CNBP gene on chromosome 3. The repeat expansion for DM2 is much larger than for DM1, ranging from 75 to over 11,000 repeats. Like DM1, the size of the microsatellite repeat array lengthens from generation to generation. Unlike DM1, anticipation does not result, as the degree of repeat expansion beyond 75 repeats does not affect the age of onset or disease severity. The repeat expansion produces an RNA transcript that binds to RNA-binding proteins such as MBNL1, as in DM1. Also, repeat expansion likely reduces expression of CNBP, loss of which causes muscle toxicity. In some embodiments, a method of treating DM2 may involve delivery of an MSH3 splice modulator construct of the present disclosure into affected cells, such as skeletal, cardiac, or smooth muscle cells. Fragile X Syndrome The fragile X-related disorders result from expansion of a CGG / CCG microsatellite in the 5’ UTR of the FMR1 gene. The MSH2 / MSH3 complex, MutSβ, that is important for mismatch repair, is essential for almost all expansions in a mouse model of these disorders. The expansion occurs from an unstable premutation (PM) allele that contains 55–200 repeats. The repeat is prone to expansion in germ line and somatic cells in humans and in a FXD mouse model with a targeted insertion of ~130 FX-repeats. Moderate expansions can result in larger PM alleles that modulate the risk of Fragile X-associated tremor / ataxia syndrome and Fragile X-associated primary ovarian insufficiency, two clinical conditions that affect PM carriers. More extensive expansions into the full mutation range (>200 repeats) result in Fragile X syndrome, a form of intellectual disability. FMR1 encodes FMRP, an RNA-binding protein important for learning and memory. The repeat tract is expansion prone, tending to gain repeats with each successive generation, with symptoms of FXS only becoming apparent when the repeat number exceeds 200. Such alleles are known as full mutation (FM) alleles and the symptoms of this disorder arise because the FM allele undergoes a process of repeat-mediated gene silencing that results in a deficit of FMRP. FM alleles originate from maternally transmitted alleles with 54–200 repeats. These alleles, known as premutation (PM) alleles, are not associated with intellectual disability, but do confer the risk of a form of ovarian dysfunction known as fragile X-associated primary ovarian insufficiency. Both male and female PM carriers are also at risk of an adult-onset form of neurodegeneration known as fragile X-associated tremor / ataxia syndrome. PM pathology is thought to result from the deleterious consequences of having long CGG-repeat tracts in the FMR1 transcript. The disorders seen in carriers of PM and FM alleles are known collectively as the FMR1 disorders, the fragile X spectrum disorders, or the fragile X related disorders (FXDs) for the fragile site that once served as a diagnostic feature of FXS. Friedreich Ataxia Friedreich ataxia (FRDA or FA) is an autosomal-recessive genetic disease that causes difficulty walking, a loss of coordination in the arms and legs, and impaired speech that worsens over time. FRDA can involve hypertrophic cardiomyopathy. As the disease progresses, complications may include loss of sight and hearing, scoliosis, and diabetes. FRDA is caused by mutations in the FXN gene on chromosome 9, which makes a protein called frataxin. In FRDA, cells produce less frataxin. Degeneration of nerve tissue in the spinal cord causes the ataxia; particularly affected are the sensory neurons essential for directing muscle movement of the arms and legs through connections with the cerebellum. The spinal cord becomes thinner, and nerve cells lose some myelin sheath. Most cases of FRDA are caused by a trinucleotide repeat expansion, in which the FXN gene has 90–1,300 GAA trinucleotide repeat (SEQ ID NO: 88) expansions in intron 1 of both alleles. This expansion causes epigenetic changes and formation of heterochromatin near the repeat. The length of the shorter GAA repeat is correlated with the age of onset and disease severity. The formation of heterochromatin results in reduced transcription of the gene and low levels of frataxin. People with FDRA might have 5-35% of the frataxin protein compared to healthy individuals. Heterozygous carriers of the mutant FXN gene have 50% lower frataxin levels, but this decrease is not enough to cause symptoms. The GAA repeats are dynamic in FRDA patients, presenting both somatic and intergenerational GAA repeat instability. Somatic GAA repeat expansion takes place progressively in many different tissues throughout life, particularly in the DRG and cerebellum. These findings indicate that GAA repeat expansion dynamics might perform a critical role in FRDA disease progression, and hence finding approaches to prevent GAA repeat expansions or induce repeat contractions could be an effective strategy to treat this disorder. Two lines of human FRDA YAC transgenic mice, YG8 and YG22, containing GAA repeat expansion mutations within the FXN transgene have been generated. Investigation of YG8 and YG22 transgenic mice has revealed the age dependence and tissue selectivity of somatic GAA repeat expansions, particularly in cerebellum and DRG tissues. It has been shown that shRNA knockdown of MSH2 in FRDA iPSCs, which also knocks down MSH3 protein levels, results in a reduced rate of triplet repeat expansion. Du et al., J Biological Chemistry 287:P29861-72 (2012). Knockdown of MSH3 in another cell culture model slowed GAA-TCC expansion, indicating that therapeutic methods of reducing MSH3 may be effective against FRDA. Halabi et al. J Biological Chemistry 287:P29958-67 (2012). C9orf72 ALS / FTD Amyotrophic lateral sclerosis (ALS) is a rapidly progressing neurodegenerative disorder affecting motor neurons in the brain, brainstem, and spinal cord, which is usually fatal within 3–5 years from symptom onset. ALS overlaps significantly with frontotemporal dementia (FTD), the most common form of early-onset dementia (under 60 years of age) that primarily affects the frontal and temporal lobes of the brain. The same genes can be mutated and similar neuropathological features can be present in both conditions, implying that these two disorders are part of a common disease spectrum, with pure ALS at one end of the spectrum, and pure FTD at the opposite end. Repeat expansions in chromosome 9 open reading frame 72 (C9ORF72) are the most common known genetic cause of ALS, FTD, and motor neuron disease (MND). It has been proposed that these diseases result from the formation of toxic RNA foci when repeats are transcribed, from the generation of aggregating dipeptide-repeat proteins due to non-ATG translation, and / or from a loss-of-function of the C9ORF72 protein. In healthy individuals, up to 25 GGGGCC repeats (SEQ ID NO: 89) are present, whereas ALS / FTD patients can harbor from hundreds to thousands of these repeats. Spinocerebellar Ataxia (SCA) Spinocerebellar ataxia (SCA) is a genetic disorder characterized by slowly progressive incoordination of gait and is often associated with poor coordination of hands, speech, and eye movements. Other, non-cerebellar features may be present, including parkinsonism, chorea, pyramidalism, cognitive impairment, peripheral neuropathy, and seizures, among others. As with other forms of ataxia, SCA frequently results in atrophy of the cerebellum, loss of fine coordination of muscle movements leading to unsteady and clumsy motion, and other symptoms. SCA1, SCA2, SCA3, SCA6, SCA7, SCA8, SCA10, SCA17, and SCA31 are caused by trinucleotide repeat expansions in various genes. CAG trinucleotide repeat expansions are present in open reading frames of the genes responsible for SCA1, SCA2, SCA3, SCA6, and SCA7. Similar involvement of MSH3-mediated mismatch repair mechanisms in the SCAs caused by trinucleotide repeat expansions as in Huntington’s disease is hypothesized. Bettencourt et al., Ann Neurol 79:983-80 (2016). Thus, knockdown of MSH3 in these disorders is expected to be effective therapy to delay or prevent onset and / or inhibit disease progression. Spinal and Bulbar Muscular Atrophy Spinal and bulbar muscular atrophy (SBMA), also known as Kennedy's disease, is a rare, adult- onset, X-linked recessive lower motor neuron disease caused by trinucleotide CAG repeat expansions in exon 1 of the androgen receptor (AR) gene, which results in both loss of AR function and toxic gain of function. In men, the disease slowly progresses over decades with bulbar and lower motor neuron loss, muscle denervation, and direct skeletal muscle involvement. The disease causes progressive muscle loss with weakness, fasciculations, and cramps. Weakness of the bulbar muscles follows causing difficulties in speech (dysarthria) and swallowing (dysphagia). Neuromuscular symptoms include muscle weakness and wasting of the limb, bulbar and respiratory muscles, tremor, fasciculations, muscle cramps, speech and swallowing difficulties, decreased or absent deep tendon reflexes, and sensory neuropathy. Other manifestations of SBMA include androgen insensitivity (gynecomastia, erectile dysfunction, reduced fertility, testicular atrophy), and metabolic impacts (glucose resistance, hyperlipidemia, fatty liver disease). SBMA is caused by a trinucleotide repeat expansion in the first exon of the androgen receptor (AR) gene. The AR gene, located in the X chromosome, contains a CAG repeat that encodes a polyglutamine tract in the androgen receptor protein. The tract normally varies from about 11 to 33 repeats; however, in SBMA patients, the tract contains 38 to 68 CAG repeats (SEQ ID NO: 90). The expanded series of CAG repeats in SBMA results in production of a toxic androgen receptor protein with an expanded polyglutamine tract called polyQ-AR. The repeat expansion likely causes a toxic gain of function in the receptor protein, since loss of receptor function in androgen insensitivity syndrome does not cause motor neuron degeneration. A similar MSH3- dependent mechanism of trinucleotide expansion as that proposed in HD and other polyglutamine diseases is thought to underlie disease onset and progression in SBMA, and MSH3 knockdown is expected to be an effective therapy to delay or prevent onset and / or inhibit disease progression. Fuchs Endothelial Corneal Dystrophy Fuchs endothelial corneal dystrophy (FECD) is a progressive disease of the cornea characterized by the slow deterioration of endothelial cells. FECD is often inherited in an autosomal dominant manner, but spontaneous mutations in a variety of genes associated with FECD have been linked to sporadic cases in subjects with no family history of the disease. Late- onset FECD is a common condition that affects approximately 4 percent of people over the age of 40 in the United States. It is more prevalent in females than males. The association between FECD and common polymorphisms situated within transcription factor 4 (TCF4) gene has been confirmed by numerous genetic and molecular studies which have identified an intronic CTG trinucleotide repeat (CTG18.1) expansion as a causal variant in the majority of FECD patients. In unaffected people, the "CTG" set of consecutive nucleotides at this specific location in the TCF4 gene typically repeats approximately 10 to 20 times. In contrast, the ‘CTG’ triplet repeats at least 40 to 50 times (SEQ ID NO: 91) in people with FECD. The average number of repeats in people with FECD is close to 100. In FECD, dysfunction of the endothelial layer of the cornea leads to corneal swelling, which causes reduced visual acuity. The damage to the cornea observed in FECD patients can be painful and so severe that it leads to corneal blindness. At present, a corneal transplant is the only viable therapeutic approach available to FECD patients. A shortage of suitable donor tissue to treat corneal endothelial cell failure, however, serves as a rate limiting factor for patient access. Patient-derived primary and immortalized corneal endothelial cell lines are used as model systems in which to study FECD disease mechanisms and test targeted therapies. Such cell lines facilitate the investigation of the downstream cellular consequences of the CTG18.1 expansion within a relevant genomic and cellular context. Induced pluripotent stem cells (iPSCs) and induced embryonic stem (ES) cells have also been used to generate corneal endothelial cell monolayers in the hopes of providing a more plentiful source of transplant grade tissue. Stem cell induced cell lines also offer a potential source of easily accessible model systems in which to test therapeutic agents. Exemplary nucleotide repeat disorders are summarized in Table 1 below: TABLE 1 Indication (Gene) Repeat Location Somatic Instability? Myotonic Dystrophy 1 (DMPK) CTG 3‘ UTR Yes Proof-of-mechanism in iCell GlutaNeurons To confirm and corroborate the efficacy of aforementioned molecules in additional cell systems in vitro, iCell GlutaNeurons [FujiFilm; human glutamatergic-enriched cortical neurons derived from induced pluripotent stem (iPS) cells] offer a system in which to explore the effects of MSH3 splice modulators further with respect to conditions such as, for example, HD, wherein disease manifests in glutamatergic-enriched cortical neurons. Exemplary molecules may be packaged in AAV2.7m8 and used for transduction to express molecules of interest in the iCell GlutaNeurons. Embodiments directed to inhibition of somatic CAG repeat expansion Without wanting to be bound by theory, for HD and many other repeat expansion disorders, the underlying mechanism of pathogenesis is thought to be somatic expansion of the repeat tract. As detailed herein, human genetic evidence strongly supports the idea that HD clinical outcome can be explained, at least in part, by somatic instability due to somatic expansion of the CAG repeat tracts. Hence, inhibiting the underlying mechanism of pathogenesis that arises from somatic instability should alter the disease course and offer a potential therapeutic for HD and scores of other repeat disorders. Pursuant to the objective of targeting this aspect of HD pathology, the present inventors have designed and tested strategies to treat HD at an earlier stage of pathogenesis by inhibiting somatic CAG expansion. Embodiments described herein, such as those described for inhibiting somatic CAG expansion, may be used alone or in conjunction with other therapeutics designed to treat or provide palliative care for HD patients. Inhibition of somatic expansion alone is expected to have a positive therapeutic effect on HD, at least by preventing further expansion of somatic CAG repeats, which in turn could delay onset of disease and / or severity of disease. Indeed, it is hypothesized that if expansion of somatic CAG repeats beyond 180 CAG repeats (SEQ ID NO: 92) can prevented, disease pathogenesis might be halted. As described herein, mechanisms controlling nucleotide repeat expansion involve cellular machinery, for example, DNA mismatch repair enzymes, including MSH2 and MSH3. MSH3 is speculated to be a good target to inhibit somatic CAG repeat expansion. Here, the present inventors outline ongoing approaches designed to reduce MSH3 levels and inhibit somatic CAG repeat expansion. MSH3 reduction by splice modulation using small nuclear RNA-based (e.g., U7SmOPT) asRNA against MSH3: In some embodiments, MSH3 is inactivated by incorporating sequences that are complementary to MSH3 splice junctions, or exon sequences, or intron sequences into small nuclear RNA (snRNA) sequences, such as, e.g., the U7 snRNA, which may act by, e.g., preventing exon inclusion. In some embodiments, MSH3 is inactivated by incorporating sequences that are complementary to MSH3 exons into snRNA sequences, such as, e.g., the U7 snRNA, which may act by, e.g., preventing exon inclusion. See, e.g., FIGs.1-7. In some embodiments, the splice modulation is vectorized, i.e., delivered by an AAV. Animal Models BAC-CAG Mouse Model: This animal model is a human genomic BAC transgenic mouse model of HD that expresses human mutant huntingtin (mHTT) comprising long uninterrupted and somatically unstable CAG repeats (120-130 pure CAG repeats (SEQ ID NO: 93)) and exhibits progressive disease-related phenotypes. Unlike other mHTT transgenic models having stable, CAA-interrupted, polyglutamine-encoding repeats, BAC-CAG mice present with robust striatum-selective nuclear inclusions and transcriptional dysregulation also observed in HD patients and huntingtin knockin models. BAC-CAG are described in detail in Gu et al. (2022, Neuron 110:1173; the content of which is incorporated herein in its entirety) and commercially available. As described therein, the striatal transcriptionopathy in HD models is correlated with their uninterrupted CAG repeat length rather than the polyglutamine length. As also described therein, somatic CAG repeat instability and nuclear mHTT aggregation are best correlated with early-onset striatum-selective molecular pathogenesis and locomotor and sleep deficits, whereas repeat RNA-associated pathologies and repeat-associated non-AUG (RAN) translation may impact less selective or late pathogenic roles, respectively. In some embodiments, therapeutic efficacy of mouse equivalents of the MSH3 splice modulators described herein and constructs encoding same may be measured in the context of the BAC-CAG mouse model by at least one of a reduction in disease progression as compared to untreated control animals, as measured by, e.g., a rotarod test, a decrease in mutant HTT aggregation, a decrease in forebrain atrophy, a decrease of expansion (e.g., absence) of the somatically unstable CAG repeats, or a decrease in striatum-specific transcriptionopathy as compared to untreated control animals, or any combination thereof. A mouse strain (e.g., a derivative of BAC-CAG strain) could also be engineered to express a humanized MSH3, wherein the MSH3 splice modulators described herein and constructs encoding same could be used to reduce levels of humanized MSH3. When performed in the context of, e.g., a derivative of BAC-CAG strain comprising a humanized MSH3, the therapeutic efficacy of the MSH3 splice modulators described herein and constructs encoding same may be measured by at least one of a reduction in disease progression as compared to untreated control animals, as measured by, e.g., a rotarod test, a decrease in mutant HTT aggregation, a decrease in forebrain atrophy, a decrease of expansion (e.g., absence) of the somatically unstable CAG repeats, or a decrease in striatum-specific transcriptionopathy as compared to untreated control animals, or any combination thereof I. Definitions As used herein, the term “operably linked” or “operatively linked” refers to an arrangement of elements, wherein the components so described are configured so as to perform their usual function. A nucleic acid is “operably linked” to another nucleic acid sequence when it is placed into a functional relationship with the other nucleic acid sequence. Elements need not be contiguous to be operably linked. Thus, for example, intervening sequences can be present between operably linked sequences. As used herein, the term “coding domain” refers to a nucleic acid sequence (e.g., an RNA sequence, a DNA sequence, or combination of RNA and DNA) that encodes a portion of a protein. Thus, a coding domain may include one or more functional exons (e.g., a sequence of functional exons). In some instances, one or more functional exons of a coding domain are not separated by introns (e.g., as in endogenous pre-mRNA) but adjacent to one another (e.g., as cDNA). In some instances, a coding domain can include one or more introns (e.g., native introns) or untranslated regions (UTRs, e.g., native UTRs) between or otherwise adjacent to (e.g., upstream or downstream of) exons. As used herein, “complementarity,” and grammatical variations thereof, refers to the percentage of nucleotide bases of a given sequence that pairs through hydrogen bonding with a reference sequence. As used herein, a given sequence is “100% complementary to,” or has “100% complementarity” with a reference sequence (e.g., an endogenous pre-mRNA binding site) if each of the nucleotide bases of the given sequence pairs through hydrogen bonding with the reference sequence, thereby hybridizing to form a double-stranded sequence (e.g., through Watson-Crick base-pairing, e.g., each A pairs with a T or U, and each C pairs with a G). For instance, an RNA sequence that is in an anti-sense orientation to a target site of a pre-mRNA is complementary to the target site. RNA pairing includes G pairing with U; therefore, an asRNA binding domain having G-U pairing with its target site can be 100% complementary with the target site. Accordingly, an asRNA that is exactly the reverse complement of its target site (i.e., A's of the asRNA are paired with U’s of the target site) can be modified to replace any one or more of the A's with G’s or C’s with T’s without substantially affecting binding. As used herein, a given sequence (e.g., an asRNA sequence) is “at least X% complementary to,” or has “X% complementarity” with a reference sequence (e.g., an endogenous pre-mRNA binding site) if X% of the nucleotide bases of the given sequence pairs through hydrogen bonding with the reference sequence, e.g., hybridizing to form a double-stranded sequence (e.g., through Watson-Crick base-pairing, e.g., A pairs with T or U, and C pairs with G). For instance, a sequence having a length of 150 bases is at least 90% complementary to a second sequence having a length of 150 bases if at least 135 of its 150 residues pair through hydrogen bonding with the second sequence through Watson-Crick base pairing, leaving 15 or fewer mismatched nucleotides. With respect to sequences presented herein and in the accompanying Sequence Listing, it is understood that RNA transcripts encoded by DNA sequences comprise a uridine (U) at positions corresponding to thymidine (T) as listed in the corresponding DNA sequence. In some instances, sequences of splice modulator components are disclosed herein as DNA sequences. For any sequence disclosed herein as a DNA sequence, an RNA sequence with U substituted for each T in the sequence is also contemplated. Thus, if a given SEQ ID NO is identified as having a sequence that may be included in a splice modulator, a version of the SEQ ID NO with U substituted for each T is also contemplated. As used herein, the term “mutation” may be used to refer to any aberrant nucleic acid sequence that encodes a defective RNA or protein product (e.g., a non-functional protein product, a non- biologically active protein, a protein product having reduced function, a protein product having pathogenic or aberrant function, and / or a protein product that is produced in less than normal or greater than normal quantities). Mutations include base pair mutations (e.g., single nucleotide polymorphisms), duplications, missense mutations, frameshift mutations, deletions, insertions, trinucleotide repeat expansion beyond wildtype levels, and splice mutations. In some embodiments, a mutation refers to a nucleic acid sequence that is different in one or more portions of its sequence than a corresponding wildtype nucleic acid sequence or functional variant thereof. In some embodiments, a mutation refers to a nucleic acid sequence that encodes a protein having an amino acid sequence that is different from a corresponding wildtype protein or functional variant thereof. A “mutated exon” (e.g., a mutated HTT exon) refers to an exon containing a mutation or an exon sequence that reflects a mutation in a different region, such as a cryptic exon resulting from a mutation in an intron. The term “HTT” (Huntingtin) refers to any native HTT from any vertebrate source, including mammals such as primates (e.g., human, African green monkeys, and cynomolgus monkeys) and rodents (e.g., mice and rats), unless otherwise indicated, as well as functionally equivalent or improved variants (e.g., natural or synthetic variants), mutants, muteins, analogs, subunits, receptor complexes, isotypes, splice variants, and fragments thereof. Functionally equivalent and improved variants can be determined on the basis of known HTT signaling. HTT encompasses full-length, unprocessed HTT, as well as any form of HTT that results from native processing in the cell. An exemplary human HTT sequence is provided as National Center for Biotechnology Information (NCBI) Reference Sequence: NG_009378. As used herein, a “variant” refers to a polynucleotide that differs in at least one nucleic acid residue from the reference polynucleotide sequence, such as a naturally occurring polynucleotide sequence, or a polypeptide (e.g., an AAV capsid sequence) that differs in at least one amino acid residue from the reference polypeptide sequence, such as a naturally occurring polypeptide sequence or, e.g., any of the rAAV sequences described herein. In this context, the difference in at least one residue may include, for example, a substitution of a nucleic acid residue to another nucleic acid, a deletion, or an insertion, or a substitution of an amino acid residue to another amino acid. A variant may be a homolog, isoform, or transcript variant of a polynucleotide as defined herein, wherein the homolog, isoform or transcript variant is characterized by a degree of identity or homology, respectively, as defined herein. In some instances, a variant of a polynucleotide or polypeptide includes at least one nucleic acid substitution (e.g., 1-100 nucleic acid or amino acid substitutions, 1-50 nucleic acid or amino acid substitutions, 1-20 nucleic acid or amino acid substitutions, 1-10 nucleic acid or amino acid substitutions, e.g., 1 nucleic acid or amino acid substitution, 2 nucleic acid or amino acid substitutions, 3 nucleic acid or amino acid substitutions, 4 nucleic acid or amino acid substitutions, 5 nucleic acid or amino acid substitutions, 6 nucleic acid or amino acid substitutions, 7 nucleic acid or amino acid substitutions, 8 nucleic acid or amino acid substitutions, 9 nucleic acid or amino acid substitutions, or 10 nucleic acid or amino acid substitutions). Nucleic acid substitutions that result in the expressed polypeptide having an exchanged amino acid from the same class are referred to herein as conservative substitutions. In particular, these are amino acids having aliphatic side chains, positively or negatively charged side chains, or aromatic groups in the side chains, the side chains of which can form hydrogen bridges, e.g., side chains which have a hydroxyl function. By conservative substitution, e.g., an amino acid having a polar side chain may be replaced by another amino acid having a corresponding polar side chain, or, for example, an amino acid characterized by a hydrophobic side chain may be substituted by another amino acid having a corresponding hydrophobic side chain (e.g., serine (threonine) by threonine (serine) or leucine (isoleucine) by isoleucine (leucine)). In some instances, insertions, deletions, and / or non-conservative substitutions are also encompassed by the term variant, e.g., at those positions that do not cause a substantial modification of the three-dimensional structure of the protein. Modifications to a three- dimensional structure by insertion(s) or deletion(s) can readily be determined by a person of skill in the art, e.g., using CD spectra (circular dichroism spectra). The term “homologous” refers to the degree of identity between sequences of two nucleic acid sequences. The homology of sequences is determined by comparing two sequences aligned under standard conditions over the sequence length to be compared. The sequences to be compared herein may have an addition or deletion (for example, gap and the like) in the optimum alignment of the two sequences. In some embodiments, sequence homology is calculated by creating an alignment using, for example, the ClustalW algorithm (Nucleic Acid Res., 1994, 22(22): 46734680). Commonly available sequence analysis software, such as, Vector NTI, GENETYX, BLAST, or analysis tools provided by public databases may also be used. The term “AAV” or “AAV serotype” as used herein refers to the dozens of naturally occurring and available adeno-associated viruses, as well as artificial AAVs. Among the AAVs isolated or engineered from human or non-human primates (NHP) and well characterized, human AAV2 is the first AAV that was developed as a gene transfer vector; it has been widely used for efficient gene transfer experiments in different target tissues and animal models. AAV9, AAV-retro, AAV1, AAV4, AAV8, AAV5, AAV-PHP.eB, for example, are among the AAV serotypes that are neurotropic in nature. As used herein, relating to AAV, the term variant means any AAV sequence which is derived from a known AAV sequence, including those sharing at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% or greater sequence identity over the amino acid or nucleic acid sequence. In another embodiment, the AAV capsid includes variants which may include up to about 10% variation from any described or known AAV capsid sequence. That is, the AAV capsid shares about 90% identity to about 99.9% identity, about 95% to about 99% identity or about 97% to about 98% identity to an AAV capsid provided herein and / or known in the art. In one embodiment, the AAV capsid shares at least 95% identity with an AAV capsid. When determining the percent identity of an AAV capsid, the comparison may be made over any of the variable proteins (e.g., vp1, vp2, or vp3). The ITRs or other AAV components may be readily isolated or engineered using techniques available to those of skill in the art from an AAV. Such AAV may be isolated, engineered, or obtained from academic, commercial, or public sources (e.g., the American Type Culture Collection, Manassas, Va.). Alternatively, the AAV sequences may be engineered through synthetic or other suitable means by reference to published sequences such as are available in the literature or in databases such as, e.g., GenBank, PubMed, or the like. AAV viruses may be engineered by conventional molecular biology techniques, making it possible to optimize these particles for cell specific delivery of nucleic acid sequences, for minimizing immunogenicity, for tuning stability and particle lifetime, for efficient degradation, and / or for accurate delivery to the nucleus, etc. As used herein, the term “subject,” “individual,” or “patient” includes any mammal in need of these methods of treatment or prophylaxis, including primates, such as humans. Other mammals in need of such treatment or prophylaxis include non-human primates (NHP; e.g., cynomolgus monkeys and African green monkeys), dogs, cats, or other domesticated animals, horses, livestock, laboratory animals, etc. The individual may be male or female. In one embodiment, the individual has a disease or disorder caused by a mutation in the HTT gene (e.g., HD). In another embodiment, the individual is at risk for developing a disease or disorder caused by a mutation in the HTT gene. In another embodiment, the individual has shown clinical signs of a disease or disorder caused by a mutation in the HTT gene, such as HD. In some embodiments, the individual has a disease or disorder caused by a mutation in DMPK, CNBP, FMR1, FXN, C9ORF72, AR, or TCF4. In some embodiments, the individual has a disease or disorder caused by or exacerbated by repeat expansion mediated by MSH3 activity. In some embodiments, the individual has been diagnosed as being at risk for developing a repeat expansion disorder. In some embodiments, the repeat expansion disorder is myotonic dystrophy 1, myotonic dystrophy 2, Fuchs endothelial corneal dystrophy, fragile X syndrome, Friedreich ataxia, C9orf72 ALS / FTD, SCA1, SCA2, SCA3, SCA6, SCA7, SCA8, SCA10, SCA17, SCA31, or spinal and bulbar muscular atrophy. The individual may be any age during which treatment or prophylactic therapy may be beneficial. For example, in some embodiments, the individual is 0-5 years of age, 5-10 years of age, 10-20 years of age, 20-30 years of age, 30-40 years of age, 30-50 years of age, 40-50 years of age, 50-60 years of age, 60-70 years of age, or more than 70 years of age. As used herein, the terms “disorder associated with a mutation” or “mutation associated with a disorder” refer to a correlation between a disorder and a mutation. In some embodiments, a disorder associated with a mutation is known or suspected to be wholly or partially, or directly or indirectly, caused by the mutation. For example, an individual having the mutation may be at risk of developing the disorder, and the risk may additionally depend on other factors, such as other (e.g., independent) mutations (e.g., in the same or a different gene), or environmental factors. As used herein, the term “treatment,” or a grammatical derivation thereof, is defined as reducing the progression of a disease, reducing the severity of a disease symptom, retarding progression of a disease symptom, removing a disease symptom, or delaying onset of a disease. In some embodiments, the term “treatment” is used to refer to a persistent or durable effect of a therapeutic agent such as an MSH3 splice modulator described herein. As used herein, the term “prevention” of a disorder, or a grammatical derivation thereof, is defined as reducing the risk of onset of a disease, e.g., as a prophylactic therapy for an individual who is at risk for developing a disorder associated with a mutation. An individual can be characterized as “at risk” for developing a disorder by identifying a mutation or other condition associated with the disorder, according to any suitable method known in the art or described herein. In some embodiments, an individual who is at risk for developing a disorder has one or more HTT, DMPK, CNBP, FMR1, FXN, C9ORF72, AR, or TCF4 mutations associated with the disorder. Additionally, or alternatively, an individual can be characterized as “at risk” for developing a disorder if the individual has a family history of the disorder. Treating or preventing a disorder in an individual can be performed by directly administering the MSH3 splice modulator (e.g., within a vector, e.g., an AAV vector or AAV particle) to the individual. Alternatively, host cells containing the MSH3 splice modulator may be administered to the individual. The term “administering” or a grammatical derivation thereof, as used in the methods described herein, refers to delivering a MSH3 splice modulator (e.g., within a vector, e.g., an AAV vector or AAV particle) or a composition thereof, or an ex vivo-treated cell, to the individual in need thereof, e.g., an individual having a mutation or defect in HTT, DMPK, CNBP, FMR1, FXN, C9ORF72, AR, or TCF4. For example, in one embodiment in which striatal cells (e.g., medium spiny neurons) or cells in the cortex (e.g., pyramidal neurons) are targeted, the method involves delivering a MSH3 splice modulator (e.g., within a vector, e.g., an AAV vector or AAV particle) or a composition thereof to the individual by intracerebral (IC) delivery (e.g., slow delivery injection or convection-enhanced diffusion injection), intracerebroventricular (ICV) delivery, or intrathecal delivery. In some embodiments, IC injections involve stereotaxic implantation of microinjection guide sleeves to improve delivery to a specific locus in the brain. In another embodiment, the composition is administered systemically (e.g., intravenously). Still other methods of administration may be selected by one of skill in the art, in view of this disclosure. In embodiments in which eye cells (e.g., corneal endothelial cells) are targeted, the method may involve delivering a MSH3 splice modulator (e.g., within a vector, e.g., an AAV vector or AAV particle) or a composition thereof to the individual by intracameral (IC) injection, which delivers the MSH3 splice modulator directly into the anterior chamber of the eye. In non-human primates (NHP), for example, IC delivery of AAV has been shown to transduce corneal endothelial cells. The terms “exon-intron junction” and “intron-exon junction” refer to a location on a pre-mRNA molecule that defines a border between an exon sequence and an intron sequence. Typically “intron-exon” junction is used to refer to the border located at the 5’ end of an exon and “exon- intron” junction is used to refer to the border located at the 3’ end of an exon. However, unless otherwise specified, “exon-intron junction” can refer to either the 5’ or 3’ border, and “intron-exon junction” can refer to either the 5’ or 3’ border. A DNA or RNA sequence can be referred to herein as a “first” sequence, a “second” sequence, a “third” sequence and so on. Unless indicated otherwise, labeling a sequence as a “first,” “second,” or “third” sequence, and so on, does not imply any particular order of the respective sequences when operably linked. For example, a “first” sequence can be either upstream or downstream of a “second” or “third” sequence, unless specifically indicated otherwise. The term “carrier” refers to a diluent, adjuvant, excipient, or vehicle with which a therapeutic molecule (e.g., an MSH3 splice modulator / s or vector comprising same) is administered. Examples of suitable pharmaceutical carriers are described in “Remington's Pharmaceutical Sciences,” Mack Publishing Co., Easton, PA., 18th edition. Certain embodiments are described herein as having, for example, a certain number of nucleotides “or less.” In such instances, embodiments may have the indicated number of nucleotides or less than the indicated number of nucleotides. Embodiments that are described as having “no more than” a certain number of nucleotides can have the indicated number of nucleotides or less than the indicated number of nucleotides. The terms “a” and “an” mean “one or more of.” For example, “a gene” is understood to represent one or more such genes. As such, the terms “a” and “an,” “one or more of a (or an),” and “at least one of a (or an)” are used interchangeably herein. As used herein, the term “about” refers to a value within ± 10% variability from the reference value, unless otherwise specified. 5’ Regulatory Domains In some instances, the MSH3 splice modulator is operatively linked to a 5’ regulatory domain. Useful promoters include, for example, snRNA promoters: U1, U2, U4, U4atac, U5, U7, U11, and U12. In some embodiments, the promoter is a U1 promoter or a U7 promoter. In some embodiments, the AAV may further comprise a 5’ regulatory domain which comprises a constitutive promoter. A 5’ regulatory domain can include a promoter (e.g., a constitutive promoter, e.g., CMV promoter or an EF1-alpha promoter). In some instances, the 5’ regulatory domain includes a promoter (e.g., a constitutive promoter, e.g., CMV / CMV promoter) operatively linked to a construct within the AAV. In some embodiments, the CMV promoter is replaced by a CAGGS promoter, wherein the CAGGS promoter is used to drive expression of a construct within the AAV. snRNA-based antisense RNA In some embodiments, MSH3 expression is reduced by snRNA-based antisense RNA, which modulates MSH3 pre-mRNA processing and can, e.g., induce exon skipping during MSH3 pre- mRNA processing. In some embodiments, the antisense RNA construct comprises one or more of SEQ ID NOs: 5-18 or 20-34 or a sequence having at least 90% identity to any one of SEQ ID NOs: 5-18 or 20-34. In some embodiments, the antisense RNA construct comprises one or more of SEQ ID NOs: 5-16 or 20-32 or a sequence having at least 90% identity to any one of SEQ ID NOs: 5-16 or 20-32. In some embodiments, the antisense RNA construct comprises combinations of SEQ ID NOs: 5-35 or combinations of sequences, wherein each of such sequences has at least 90% identity to any one of SEQ ID NOs: 5-35. In some embodiments, the antisense RNA construct comprises, combinations of SEQ ID NOs: 5-35 or combinations of sequences, wherein each of such sequences has at least 90% identity to any one of SEQ ID NOs: 5-18 or 20-34, with the proviso that when such combinations consist of two sequences, the combination does not consist essentially of or consist of SEQ ID NOs: 17 and 18 (or a combination of two sequences wherein each sequence has at least 90% identity to SEQ ID NOs: 17 or 18, respectively); or the combination does not consist essentially of or consist of SEQ ID NOs: 33 and 34 (or a combination of two sequences wherein each sequence has at least 90% identity to SEQ ID NOs: 33 or 34, respectively). In some embodiments, the antisense RNA construct comprises combinations of at least three of SEQ ID NOs: 5-35, or combinations of at least three sequences, wherein each of such sequences has at least 90% identity to any one of SEQ ID NOs: 5-35, or any combination thereof. In some embodiments, the antisense RNA comprises, consists essentially of, or consists of combinations of at least three of SEQ ID NOs: 5-18 or 20-34, or combinations of at least three sequences, wherein each of such sequences has at least 90% identity to any one of SEQ ID NOs: 5-18 or 20-34, or any combination thereof (e.g., a combination of SEQ ID NOs: 9 and 10 and a sequence having at least 90% identity to SEQ ID NO: 18; or a combination of SEQ ID NOs: 9, 10, and 18; or a combination of SEQ ID NOs: 27 and 28 and a sequence having at least 90% identity to SEQ ID NO: 33; or a combination of SEQ ID NOs: 27, 28, and 33; or a combination of SEQ ID NOs: 9, 10, and 33). In some embodiments, such combinations of antisense RNA comprise combinations of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 , 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35 of the antisense RNA described herein. In some embodiments, the antisense RNA construct comprises any one of SEQ ID NOs: 5-16 or 20-32 or a sequence having 100% identity to 12-18 consecutive nucleotides of any one of SEQ ID NOs: 5-16 or 20-32, or any combination thereof. In some embodiments, the antisense RNA construct comprises any one of SEQ ID NOs: 8-12 or 21, 23-28, or 30-31 or a sequence having 100% identity to 12-18 consecutive nucleotides of any one of SEQ ID NOs: 8-12 or 21, 23-28, or 30-31, or any combination thereof. In some embodiments, one, two, three, four, five, or more of the above asRNA constructs are used (e.g., administered to a patient) in conjunction. In some embodiments, e.g., a construct targeting an exon sequence of exon 7 and a construct targeting an exon sequence of exon 15 are used in conjunction; or a construct targeting a first exon sequence of exon 7 and a construct targeting a second exon sequence of exon 7 are used in conjunction; or a construct targeting a first exon sequence of exon 15 and a construct targeting a second exon sequence of exon 15 are used in conjunction; or a construct targeting an exon sequence of exon 7 and a construct targeting an intron – exon junction of exon 15 (e.g., SEQ ID NO: 22 or 29) are used in conjunction. In some embodiments, a single asRNA construct that targets two exon sequences, or two intron – exon junctions, or an exon sequence and an intron – exon junction is used. In some embodiments, the asRNA construct includes a sequence that is at least partially complementary to an exon sequence, such as, for example, an exon sequence of about 24 -36 nucleotides of the exon sequence. Such constructs may target, for example, exon sequences in either of MSH3 exons 7 or 15. In some embodiments, the asRNA construct is a U7SmOPT construct comprising two of SEQ ID NOs: 9, 10, 11, 13, 14, 17, 18, 27, or 28 (which target exemplary exon sequences) or intron – exon junctions (SEQ ID NOs: 17 and 18), with the proviso that the combination of two SEQ ID NOs: does not consist of SEQ ID NOs: 17 and 18. In some embodiments, a linker (e.g., an unstructured linker) is positioned between the two asRNA sequences, thereby joining these sequences. Such linkers may comprise, consist essentially of, or consist of SEQ ID NO: 80. Some embodiments of MSH3 splice modulator constructs include, operatively linked, a sequence encoding a small nuclear RNA (snRNA) sequence (e.g., a U7 Sm OPT sequence or a U2 snRNA sequence) and a sequence encoding an antisense RNA that, e.g., promotes exon skipping of a target exon of MSH3 pre-mRNA. The exon skipping may introduce frameshifts and / or premature stop codons, which may induce nonsense mediated decay or otherwise impair production of functional MSH3 mRNA. The antisense RNA that promotes exon skipping of a target exon may target a region of a target exon or may target one or both of the 5’ intron-exon junction / s and a 3’ exon-intron junction / s of the target exon / s of the MSH3 pre-mRNA. As used herein, an antisense RNA is said to “target” a particular exon sequence or exon-intron junction if it has sufficient complementarity to the exon sequence or a sequence surrounding the exon- intron junction that it is capable of, e.g., promoting skipping of the target exon during pre-mRNA processing. An antisense RNA that “targets” a target exon may, for example, have complementarity (e.g., at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementarity) to a pre-mRNA sequence that is entirely within an exon sequence of the target exon, to a sequence that is entirely within an intron sequence, or to a sequence that includes an intron-exon junction (i.e., that includes both intron and exon sequences). Embodiments in which an antisense RNA has complementarity only to an exon sequence and not to an intron sequence or exon-intron junction are said to target a sequence “within” a particular exon sequence (e.g., SEQ ID NO: 96 or 86). Embodiments in which an antisense RNA has complementarity only to an intron sequence and not to an exon sequence or exon-intron junction are said to target a sequence “within” a particular exon sequence (e.g., SEQ ID NO: 100, 101, 104, or 105). Embodiments in which an antisense RNA has complementarity to a sequence that includes an exon-intron junction (i.e., that in includes both intron and exon sequences) is said to target a sequence “within” a particular sequence that includes an exon-intron junction (e.g., SEQ ID NOs: 98, 99, 102, or 103). In some embodiments, an antisense RNA sequence includes a contiguous stretch of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, or 50 nucleotides that is 100% complementary to a contiguous stretch of nucleotides of the same length on the pre- mRNA that includes a region of an exon or an exon-intron junction. In some embodiments, an antisense RNA sequence includes a contiguous stretch of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, or 50 nucleotides that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% complementary to a contiguous stretch of nucleotides of the same length on the pre-mRNA that includes a region of an exon or an exon-intron junction. In some embodiments, an antisense RNA sequence includes a contiguous stretch of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, or 50 nucleotides that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% complementary to a contiguous stretch of nucleotides of the same length on the pre-mRNA that includes a region of an exon or an exon- intron junction or is within 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides of an exon-intron junction. A skilled person will understand that when less than full complementarity is present, exon skipping functionality may be enhanced by increasing the length of the contiguous stretch of partially complementary nucleotides. A skilled person will also understand that GC content of the exon sequence or the sequence surrounding an exon-intron junction may influence the ability of an antisense RNA sequence to effectively target the region of an exon or the exon-intron junction and induce skipping. A higher GC content increases the strength of annealing, which may lead to a smaller required stretch of complementarity. In some embodiments, an MSH3 splice modulator comprises an antisense RNA sequence that targets two exon sequences. In some embodiments, such an antisense RNA sequence comprises an antisense sequence that comprises a sequence that anneals to a first region of an exon sequence of a pre-mRNA and an antisense sequence that comprises a sequence that anneals to a second region of an exon sequence of a pre-mRNA. In some embodiments, the antisense RNA is 100% complementary to the region of the exon sequence. In some embodiments, the antisense RNA is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% complementary to the pre- mRNA exon sequence. In some embodiments, such exon sequences are at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length or more. In some embodiments, such exon sequences are at least 24-36 nucleotides in length or more. In some embodiments, a linker (e.g., an unstructured linker) is positioned between the two asRNA sequences, thereby joining these sequences. Such linkers may comprise, consist essentially of, or consist of SEQ ID NO: 80. In some embodiments, any of the MSH3 splice modulators disclosed herein may be used in combination with another therapeutic agent used to treat a nucleotide repeat disorder. In some embodiments, the MSH3 splice modulators disclosed herein are used alone. Any of the MSH3 splice modulators described herein may be used independently in methods of treating trinucleotide repeat expansion disorders. In some embodiments, multiple constructs are encoded on a single vector, such as, for example, an AAV vector. Any of the MSH3 splice modulators or asRNA sequences described herein can be combined on a single vector. In some embodiments, two or more of an MSH3 splice modulators or asRNA constructs are encoded on a single vector. In some embodiments, the MSH3 splice modulator and / or asRNA, as applicable, target the same gene. Various other well-known modifications to the nucleic acid molecules can be introduced as a means of increasing intracellular stability and half-life (see also above for oligonucleotides). Possible modifications are known to the art. Modifications, which may be made to the structure of synthetic MSH3 splice modulators include backbone modifications. Cell Line Assays In some instances, MSH3 splice modulators described herein are tested in cultured cell lines. To screen, select, and improve functionality of MSH3 splice modulators, cultured cell lines may be acquired or engineered to express the target MSH3 pre-mRNA at a sufficient level. Other exemplary cell line model systems include PSCs and ES cells induced to differentiate to different cell types (e.g., corneal endothelial cell monolayers, brain cells, motor neurons, cardiac muscle cells, smooth muscle cells, or skeletal muscle cells) that are target cell types, wherein disease pathology manifests. Patient-derived cells and cell lines derived therefrom (e.g. immortalized patient-derived cells) also offer model systems in which to test therapeutic agents, such as, e.g., MSH3 splice modulators. II. Vectors MSH3 splice modulators can be delivered to target cells of an individual using various techniques, e.g., using recombinant adeno-associated virus (AAV) vectors or other vector modalities, such as non-viral vectors. Thus, provided herein are vectors comprising / encoding MSH3 splice modulators (e.g., viral or non-viral vectors comprising / encoding MSH3 splice modulators, e.g., DNA vectors comprising / encoding MSH3 splice modulators). Any suitable nucleic acid vector may be used in conjunction with the present compositions and methods to design and assemble the components of the MSH3 splice modulators and a recombinant AAV. In one embodiment, the vector is a recombinant AAV carrying the MSH3 splice modulator driven by a promoter that expresses the MSH3 splice modulator in selected cells of an individual. Methods for assembly of the recombinant vectors are known in the art. See, e.g., Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1989; Kay, M. A. et al., Nat. Medic, 2001, 7(l):33-40; and Walther W. and Stein U., Drugs 2000, 60(2):249-71. In certain embodiments described herein, the MSH3 splice modulator or a construct comprising same is delivered to the selected cells, e.g., neuronal cells, in need of treatment by means of an AAV vector. A variety of naturally occurring serotypes of AAV are available. Many natural variants in the AAV capsid exist, allowing identification and use of an AAV with properties specifically suited for neuronal cells. Artificial AAV vectors may be engineered by conventional molecular biology techniques, making it possible to optimize these particles for cell specific delivery of the MSH3 splice modulators and nucleic acids encoding same, for minimizing immunogenicity, for tuning stability and particle lifetime, for efficient degradation, for accurate delivery to the nucleus, etc. For example, such artificial capsids may be generated by any suitable technique, using a selected AAV sequence (e.g., a fragment of a vp1 capsid protein) in combination with heterologous sequences which may be obtained from a different selected AAV, non-contiguous portions of the same AAV, from a non-AAV viral source, or from a non-viral source. An artificial AAV may be, without limitation, a pseudotyped AAV, a chimeric AAV capsid, a recombinant AAV capsid, or a “humanized” AAV capsid. Pseudotyped vectors, wherein the capsid of one AAV is replaced with a heterologous capsid protein, are useful for delivering MSH3 splice modulators described herein and nucleic acids encoding same. The expression of MSH3 splice modulators described herein can be achieved in the selected cells through delivery by recombinantly engineered AAVs or artificial AAVs that contain sequences comprising / encoding the desired MSH3 splice modulators. The use of AAVs is a common mode of exogenous delivery of DNA as it is relatively non-toxic, provides efficient gene transfer, and can be easily optimized for specific purposes. Among the well-characterized serotypes of AAVs isolated from human or non-human primates, human serotype 2 has been widely used for efficient gene transfer experiments in different target tissues and animal models. In some embodiments, the AAV is AAV1 or a variant thereof (e.g., SEQ ID NO: 6 or 64 of US20030138772 or SEQ ID NO: 11 or 27 of US20150159173), AAV2 or a variant thereof (e.g., SEQ ID NO: 7 or 70 of US20030138772, SEQ ID NO: 7 or 23 of US20150159173, or SEQ ID NO: 7 of US20150159173), AAV2G9 or a variant thereof, AAV3 or a variant thereof (e.g., SEQ ID NO: 8 or 71 of US20030138772), AAV3a or a variant thereof, AAV3b or a variant thereof (e.g., SEQ ID NO: 1 and 10 of U.S. Pat. No.6,156,303), AAV3-3 or a variant thereof (e.g., SEQ ID NO: 200 and 217 of WO2005033321), AAV4 or a variant thereof (e.g., SEQ ID NO: 63 of US20030138772), AAV4-4 or a variant thereof (e.g., SEQ ID NO: 201 or 218 of WO2005033321), AAV5 or a variant thereof (e.g., SEQ ID NO: 114 of US20030138772), AAV6 or a variant thereof (e.g., SEQ ID NO: 65 of US20030138772), AAV6.1 or a variant thereof (e.g., SEQ ID NO: 29 of US20150159173), AAV6.2 or a variant thereof, AAV6.1.2 or a variant thereof, AAV7 or a variant thereof (e.g., SEQ ID NO: 1-3 of US20030138772), AAV7.2 or a variant thereof, AAV8 or a variant thereof (e.g., SEQ ID NO: 4 and 95 of US20030138772 or AAV8(b)), AAV9 or a variant thereof (e.g., SEQ ID NO: 5 and 100 of US20030138772), AAV9.9 or a variant thereof, AAV9.11 or a variant thereof, AAV9.13 or a variant thereof, AAV9.16 or a variant thereof, AAV9.24 or a variant thereof, AAV9.45 or a variant thereof, AAV9.47 or a variant thereof, AAV9.61 or a variant thereof, AAV9.68 or a variant thereof, AAV9.84 or a variant thereof (see, e.g., N. Pulicherla et al. Molecular Therapy 19(6):1070-1078 (2011), herein incorporated by reference in its entirety), AAV10 or a variant thereof (e.g., SEQ ID NO: 117 of US20030138772), AAV11 or a variant thereof (e.g., SEQ ID NO: 118 of US20030138772), AAV12 or a variant thereof (e.g., SEQ ID NO: 119 of US20030138772), AAV16.3 or a variant thereof, AAV24.1 or a variant thereof, AAV27.3 or a variant thereof, AAV42.12 or a variant thereof, AAV42-1b or a variant thereof, AAV42-2 or a variant thereof, AAV42-3a or a variant thereof, AAV42-3b or a variant thereof, AAV42-4 or a variant thereof, AAV42-5a or a variant thereof, AAV42-5b or a variant thereof, AAV42-6b or a variant thereof, AAV42-8 or a variant thereof, AAV42-10 or a variant thereof, AAV42-11 or a variant thereof, AAV42-12 or a variant thereof, AAV42-13 or a variant thereof, AAV42-15 or a variant thereof, AAV42-aa or a variant thereof, AAV43-1 or a variant thereof, AAV43-12 or a variant thereof, AAV43-20 or a variant thereof, AAV43-21 or a variant thereof, AAV43-23 or a variant thereof, AAV43-25 or a variant thereof, AAV43-5 or a variant thereof, AAV44.1 or a variant thereof, AAV44.2 or a variant thereof, AAV44.5 or a variant thereof, AAV223.1 or a variant thereof, AAV223.2 or a variant thereof, AAV223.4 or a variant thereof, AAV223.5 or a variant thereof, AAV223.6 or a variant thereof, AAV223.7 or a variant thereof, AAV1-7 / rh.48 or a variant thereof, AAV1-8 / rh.49 or a variant thereof, AAV2-15 / rh.62 or a variant thereof, AAV2-3 / rh.61 or a variant thereof, AAV2- 4 / rh.50 or a variant thereof, AAV2-5 / rh.51 or a variant thereof, AAV3.1 / hu.6 or a variant thereof, AAV3.1 / hu.9 or a variant thereof, AAV3-9 / rh.52 or a variant thereof, AAV3-11 / rh.53 or a variant thereof, AAV4-8 / rh.64 or a variant thereof, AAV4-9 / rh.54 or a variant thereof (e.g., SEQ ID NO: 116 of WO2005033321), AAV4-19 / rh.55 or a variant thereof (e.g., SEQ ID NO: 117 of WO2005033321), AAV5-3 / rh.57 or a variant thereof, AAV5-22 / rh.58 or a variant thereof, AAV7.3 / hu.7 or a variant thereof, AAV16.8 / hu.10 or a variant thereof, AAV16.12 / hu.11 or a variant thereof, AAV29.3 / bb.1 or a variant thereof, AAV29.5 / bb.2 or a variant thereof, AAV106.1 / hu.37 or a variant thereof, AAV114.3 / hu.40 or a variant thereof, AAV127.2 / hu.41 or a variant thereof, AAV127.5 / hu.42 or a variant thereof, AAV128.3 / hu.44 or a variant thereof, AAV130.4 / hu.48 or a variant thereof, AAV145.1 / hu.53 or a variant thereof, AAV145.5 / hu.54 or a variant thereof, AAV145.6 / hu.55 or a variant thereof, AAV161.10 / hu.60 or a variant thereof, AAV161.6 / hu.61 or a variant thereof, AAV33.12 / hu.17 or a variant thereof, AAV33.4 / hu.15 or a variant thereof, AAV33.8 / hu.16 or a variant thereof, AAV52 / hu.19 or a variant thereof, AAV52.1 / hu.20 or a variant thereof, AAV58.2 / hu.25 or a variant thereof, AAVA3.3 or a variant thereof, AAVA3.4 or a variant thereof, AAVA3.5 or a variant thereof, AAVA3.7 or a variant thereof, AAVC1 or a variant thereof, AAVC2 or a variant thereof, AAVC5 or a variant thereof, AAV-DJ or a variant thereof (e.g., SEQ ID NO: 2 or 3 of US20140359799), AAV-DJ8 or a variant thereof, AAVF3 or a variant thereof, AAVF5 or a variant thereof, AAVH2 or a variant thereof, AAVH6 or a variant thereof, AAVLK03 or a variant thereof, AAVH-1 / hu.1 or a variant thereof, AAVH-5 / hu.3 or a variant thereof, AAVLG-10 / rh.40 or a variant thereof, AAVLG-4 / rh.38 or a variant thereof, AAVLG-9 / hu.39 or a variant thereof, AAVN721-8 / rh.43 or a variant thereof, AAVCh.5 or a variant thereof (e.g., SEQ ID NO 46 of US20150159173), AAVCh.5R1 or a variant thereof, AAVcy.2 or a variant thereof, AAVcy.3 or a variant thereof, AAVcy.4 or a variant thereof, AAVcy.5 or a variant thereof (e.g., SEQ ID NO: 8 and 24 of US20150159173), AAVCy.5R1 or a variant thereof, AAVCy.5R2 or a variant thereof, AAVCy.5R3 or a variant thereof, AAVCy.5R4 or a variant thereof, AAVcy.6 or a variant thereof, AAVhu.1 or a variant thereof (e.g., SEQ ID NO: 144 of WO2005033321), AAVhu.2 or a variant thereof (e.g., SEQ ID NO: 143 of WO2005033321), AAVhu.3 or a variant thereof (e.g., SEQ ID NO: 145 of WO2005033321), AAVhu.4 or a variant thereof (e.g., SEQ ID NO: 141 of WO2005033321), AAVhu.5 or a variant thereof, AAVhu.6 or a variant thereof (e.g., SEQ ID NO: 84 of WO2005033321), AAVhu.7 or a variant thereof (e.g., SEQ ID NO: 150 of WO2005033321), AAVhu.9 or a variant thereof (e.g., SEQ ID NO: 155 of WO2005033321), AAVhu.10 or a variant thereof (e.g., SEQ ID NO: 156 of WO2005033321), AAVhu.11 or a variant thereof (e.g., SEQ ID NO: 153 of WO2005033321), AAVhu.13 or a variant thereof (SEQ ID NO: 16 and 32 of US20150159173), AAVhu.15 or a variant thereof (e.g., SEQ ID NO: 147 of WO2005033321), AAVhu.16 or a variant thereof (e.g., SEQ ID NO: 148 of WO2005033321), AAVhu.17 or a variant thereof (e.g., SEQ ID NO: 83 of WO2005033321), AAVhu.18 or a variant thereof (e.g., SEQ ID NO: 149 of WO2005033321), AAVhu.19 or a variant thereof (e.g., SEQ ID NO: 133 of WO2005033321), AAVhu.20 or a variant thereof (e.g., SEQ ID NO: 134 of WO2005033321), AAVhu.21 or a variant thereof (e.g., SEQ ID NO: 135 of WO2005033321), AAVhu.22 or a variant thereof (e.g., SEQ ID NO: 138 of WO2005033321), AAVhu.23.2 or a variant thereof (e.g., SEQ ID NO: 137 of WO2005033321), AAVhu.24 or a variant thereof (e.g., SEQ ID NO: 136 of WO2005033321), AAVhu.25 or a variant thereof (e.g., SEQ ID NO: 146 of WO2005033321), AAVhu.26 or a variant thereof (e.g., SEQ ID NO: 17 and 33 of US20150159173), AAVhu.27 or a variant thereof (e.g., SEQ ID NO: 140 of WO2005033321), AAVhu.28 or a variant thereof (e.g., SEQ ID NO: 42 of US20150159173), AAVhu.29 or a variant thereof (e.g., SEQ ID NO: 132 of WO2005033321), AAVhu.29R or a variant thereof, AAVhu.31 or a variant thereof (e.g., SEQ ID NO: 121 of WO2005033321), AAVhu.32 or a variant thereof (SEQ ID NO: 122 of WO2005033321), AAVhu.34 or a variant thereof (e.g., SEQ ID NO: 125 of WO2005033321), AAVhu.35 or a variant thereof (e.g., SEQ ID NO: 164 of WO2005033321), AAVhu.37 or a variant thereof (e.g., SEQ ID NO: 18 and 34 of US20150159173), AAVhu.39 or a variant thereof (e.g., SEQ ID NO: 102 of WO2005033321), AAVhu.40 or a variant thereof (e.g., SEQ ID NO: 87 of WO2005033321), AAVhu.41 or a variant thereof (e.g., SEQ ID NO: 91 of WO2005033321), AAVhu.42 or a variant thereof (e.g., SEQ ID NO: 85 of WO2005033321), AAVhu.43 or a variant thereof (e.g., SEQ ID NO: 160 of WO2005033321), AAVhu.44 or a variant thereof (e.g., SEQ ID NO: 45 of US20150159173), AAVhu.44R1 or a variant thereof, AAVhu.44R2 or a variant thereof, AAVhu.44R3 or a variant thereof, AAVhu.45 or a variant thereof (e.g., SEQ ID NO: 127 of WO2005033321), AAVhu.46 or a variant thereof (e.g., SEQ ID NO: 159 of WO2005033321), AAVhu.47 or a variant thereof (e.g., SEQ ID NO: 128 of WO2005033321), AAVhu.48 or a variant thereof (e.g., SEQ ID NO: 38 of US20150159173), AAVhu.48R1 or a variant thereof, AAVhu.48R2 or a variant thereof, AAVhu.48R3 or a variant thereof, AAVhu.49 or a variant thereof (e.g., SEQ ID NO: 189 of WO2005033321), AAVhu.51 or a variant thereof (e.g., SEQ ID NO: 190 of WO2005033321), AAVhu.52 or a variant thereof (e.g., SEQ ID NO: 191 of WO2005033321), AAVhu.53 or a variant thereof (e.g., SEQ ID NO: 19 and 35 of US20150159173), AAVhu.54 or a variant thereof (e.g., SEQ ID NO: 188 of WO2005033321), AAVhu.55 or a variant thereof (e.g., SEQ ID NO: 187 of WO2005033321), AAVhu.56 or a variant thereof (e.g., SEQ ID NO: 192 of WO2005033321), AAVhu.57 or a variant thereof (e.g., SEQ ID NO: 193 of WO2005033321), AAVhu.58 or a variant thereof (e.g., SEQ ID NO: 194 of WO2005033321), AAVhu.60 or a variant thereof (e.g., SEQ ID NO: 184 of WO2005033321), AAVhu.61 or a variant thereof (e.g., SEQ ID NO: 185 of WO2005033321), AAVhu.63 or a variant thereof (e.g., SEQ ID NO: 195 of WO2005033321), AAVhu.64 or a variant thereof (e.g., SEQ ID NO: 196 of WO2005033321), AAVhu.66 or a variant thereof (e.g., SEQ ID NO: 197 of WO2005033321), AAVhu.67 or a variant thereof (e.g., SEQ ID NO: 198 of WO2005033321), AAVhu.14 / 9 or a variant thereof, AAVhu.t 19 or a variant thereof, AAVrh.2 or a variant thereof (e.g., SEQ ID NO: 39 of US20150159173), AAVrh.2R or a variant thereof, AAVrh.8 or a variant thereof (e.g., SEQ ID NO: 41 of US20150159173), AAVrh.8R or a variant thereof, AAVrh.10 or a variant thereof (e.g., SEQ ID NO: 9 and 25 of US20150159173), AAVrh.12 or a variant thereof, AAVrh.13 or a variant thereof (e.g., SEQ ID NO: 10 and 26 of US20150159173), AAVrh.13R or a variant thereof, AAVrh.14 or a variant thereof, AAVrh.17 or a variant thereof, AAVrh.18 or a variant thereof, AAVrh.19 or a variant thereof, AAVrh.20 or a variant thereof (e.g., SEQ ID NO: 1 of US20150159173), AAVrh.21 or a variant thereof, AAVrh.22 or a variant thereof, AAVrh.23 or a variant thereof, AAVrh.24 or a variant thereof, AAVrh.25 or a variant thereof, AAVrh.31 or a variant thereof, AAVrh.32 or a variant thereof, AAVrh.33 or a variant thereof, AAVrh.34 or a variant thereof, AAVrh.35 or a variant thereof, AAVrh.36 or a variant thereof, AAVrh.37 or a variant thereof (e.g., SEQ ID NO: 40 of US20150159173), AAVrh.37R2 or a variant thereof, AAVrh.38 or a variant thereof (e.g., SEQ ID NO: 86 of WO2005033321), AAVrh.39 or a variant thereof (e.g., SEQ ID NO: 3, 20, or 36 of US20150159173), AAVrh.40 or a variant thereof (e.g., SEQ ID NO: 92 of WO2005033321), AAVrh.43 or a variant thereof (e.g., SEQ ID NO: 21 and 37 of US20150159173), AAVrh.46 or a variant thereof (e.g., SEQ ID NO: 4 and 22 of US20150159173), AAVrh.48 or a variant thereof (e.g., SEQ ID NO: 44 of US20150159173), AAVrh.48.1 or a variant thereof (e.g., SEQ ID NO: 44 of US20150159173), AAVrh.48.1.2 or a variant thereof, AAVrh.48.2 or a variant thereof, AAVrh.49 or a variant thereof (e.g., SEQ ID NO: 103 of WO2005033321), AAVrh.50 or a variant thereof (e.g., SEQ ID NO: 108 of WO2005033321), AAVrh.51 or a variant thereof (e.g., SEQ ID NO: 104 of WO2005033321), AAVrh.52 or a variant thereof (e.g., SEQ ID NO: 96 of WO2005033321), AAVrh.53 or a variant thereof (e.g., SEQ ID NO: 97 of WO2005033321), AAVrh.54 or a variant thereof (e.g., SEQ ID NO: 49 of US20150159173), AAVrh.56 or a variant thereof (e.g., SEQ ID NO: 152 of WO2005033321), AAVrh.57 or a variant thereof (e.g., SEQ ID NO: 105 of WO2005033321), AAVrh.58 or a variant thereof (e.g., SEQ ID NO: 48 of US20150159173), AAVrh.61 or a variant thereof (e.g., SEQ ID NO: 107 of WO2005033321), AAVrh.62 or a variant thereof (e.g., SEQ ID NO: 114 of WO2005033321), AAVrh.64 or a variant thereof (e.g., SEQ ID NO: 43 of US20150159173), AAVrh.64R1 or a variant thereof, AAVrh.64R2 or a variant thereof, AAVrh.67 or a variant thereof (e.g., SEQ ID NO: 47 of US20150159173), AAVrh.73 or a variant thereof (e.g., SEQ ID NO: 5 of US20150159173), or AAVrh.74 or a variant thereof (e.g., SEQ ID NO: 6 of US2015015917). Non-limiting examples of variants include SEQ ID Nos: 9, 27-45, 47-62, 66-69, 73-81, 84-94, 96, 97, 99, and 101-113 of US20030138772, the contents of which are herein incorporated by reference in its entirety, and SEQ ID Nos: 1, 2, 4-82, 89, 90, 93-95, 98, 100, 101, 109-113, 118-120, 124, 126, 131, 139, 142, 151, 154, 158, 161, 162, 165-183, 202, 204-212, 215, 219, and 224-236 of WO2005033321, the contents of which are herein incorporated by reference in its entirety. In one embodiment, the AAV serotype is any of those described in U.S.2021 / 0189430, the contents of which is herein incorporated by reference in its entirety. The amino acid sequence of the AAV may include one or more amino acid substitutions in an AAV capsid protein at one or more positions that interacts with a heparan sulfate proteoglycan or at one or more positions corresponding to amino acids 484, 487, 527, 532, 585, or 588, numbering based on VP1 numbering of AAV2. Unless otherwise specified, the AAV ITRs, and other selected AAV components described herein, may be readily selected from among any AAV serotype, including, without limitation, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9 or other known and unknown AAV serotypes. In one embodiment, the ITRs are from AAV2. These ITRs or other AAV components may be readily isolated using techniques available to those of skill in the art from an AAV serotype. Such AAV may be isolated or obtained from academic, commercial, or public sources (e.g., the American Type Culture Collection, Manassas, VA). Alternatively, the AAV sequences may be obtained through synthetic or other suitable means by reference to published sequences such as are available in the literature or in databases such as, e.g., GenBank, PubMed, or the like. Desirable AAV fragments for assembly into vectors include the cap proteins, including the vp1, vp2, vp3, and hypervariable regions, the rep proteins, including rep 78, rep 68, rep 52, and rep 40, and the sequences encoding these proteins. These fragments may be readily utilized in a variety of vector systems and host cells. Such fragments may be used alone, in combination with other AAV serotype sequences or fragments, or in combination with elements from other AAV or non-AAV viral sequences. As used herein, artificial AAV serotypes include, without limitation, AAV with a non-naturally occurring capsid protein. Such an artificial capsid may be generated by any suitable technique, using a selected AAV sequence (e.g., a fragment of a vp1 capsid protein) in combination with heterologous sequences which may be obtained from a different selected AAV serotype, non-contiguous portions of the same AAV serotype, from a non-AAV viral source, or from a non-viral source. An artificial AAV serotype may be, without limitation, a pseudotyped AAV, a chimeric AAV capsid, a recombinant AAV capsid, or a “humanized” AAV capsid. Pseudotyped vectors, wherein the capsid of one AAV is utilized with the ITRs from an AAV having a different capsid protein, are useful as described herein. In one embodiment, the AAV is AAV2 / 5 (i.e., an AAV having AAV2 ITRs and an AAV5 capsid). In another embodiment, the AAV is AAV2 / 8 (i.e., an AAV having AAV2 ITRs and an AAV8 capsid). In one embodiment, the AAV includes an AAV8 capsid. Such AAV8 capsid includes the amino acid sequence found under NCBI Reference Sequence: YP_077180.1. In another embodiment, the AAV8 capsid includes a capsid encoded by nt 2121 to 4337 of GenBank accession: AF513852.1. In one embodiment, the vectors useful in compositions and methods described herein contain, at a minimum, sequences encoding a selected AAV serotype capsid, e.g., an AAV2 capsid, or a fragment thereof. In another embodiment, useful vectors contain, at a minimum, sequences encoding a selected AAV serotype rep protein, e.g., AAV2 rep protein, or a fragment thereof. Optionally, such vectors may contain both AAV cap and rep proteins. In vectors in which both AAV rep and cap are provided, the AAV rep and AAV cap sequences can both be of one serotype origin, e.g., an AAV2 origin. Alternatively, vectors may be used in which the rep sequences are from an AAV serotype which differs from that which is providing the cap sequences. In one embodiment, the rep and cap sequences are expressed from separate sources (e.g., separate vectors, or a host cell and a vector). In another embodiment, these rep sequences are fused in frame to cap sequences of a different AAV serotype to form a chimeric AAV vector, such as those described in U.S. Patent No.7,282,199, which is incorporated by reference herein. A suitable recombinant AAV (rAAV) is generated by culturing a host cell which contains a nucleic acid sequence encoding an AAV serotype capsid protein, or fragment thereof, as defined herein; a functional rep gene; a minigene composed of, e.g., AAV ITRs and an MSH3 splice modulator nucleic acid sequence; and sufficient helper functions to permit packaging of the minigene into the AAV capsid protein. The components required to be cultured in the host cell to package an AAV minigene in an AAV capsid may be provided to the host cell in trans. Alternatively, any one or more of the required components (e.g., minigene, rep sequences, cap sequences, and / or helper functions) may be provided by a stable host cell which has been engineered to contain one or more of the required components using methods known to those of skill in the art. In one embodiment, the AAV includes a promoter (or a functional fragment of a promoter). The selection of the promoter to be employed in the rAAV may be made from among a wide number of constitutive or inducible promoters that can express the selected transgene in the desired target cell. See, e.g., the list of promoters identified in International Patent Publication No. WO 2014 / 012482, incorporated by reference herein. In one embodiment, the promoter is cell- specific. The term “cell-specific” means that the particular promoter selected for the recombinant vector can direct expression of the selected transgene in a particular cell type. In some embodiments, the promoter is specific for expression of the transgene in neuronal cells. In some embodiments, the promoter is specific for expression in cortical neurons (e.g., pyramidal neurons of the cortex). In some embodiments, the promoter is specific for expression of the transgene in striatal neurons (medium spiny neurons of the striatum). In some embodiments, the promoter is specific for expression of the transgene in hypothalamic neurons. In some embodiments, the transgene is expressed in at least one of the cell types or cells such as, for example, brain cells, motor neurons, cardiac muscle cells, smooth muscle cells, skeletal muscle cells, or corneal endothelial cells. In another embodiment, the promoter is the native promoter for a target gene to be expressed. Useful promoters include, for example, snRNA promoters: U1, U2, U4, U4atac, U5, U7, U11, and U12. Other useful promoters for inclusion in a vector comprising a snRNA construct described herein include, without limitation, the promoter and neuronal specific promoters, including, without limitation, a human synapsin 1 gene promoter, a neuron-specific enolase (NSE) promoter, human synapsin 1 promoter, a CaMK kinase promoter, or an MeCP2 promoter. Other suitable promoters comprise inducible promoters, wherein such promoters initiate transcription only when the host cell is exposed to a stimulus which acts as a trigger for activating the promoter. Other tissue-specific promoters that may be useful include, for example, ocular cell-specific promoters such as rhodopsin kinase 1, interphotoreceptor retinoid binding protein promoters, rhodopsin, arrestin, blue opsin, red / green opsin, or RPE65 promoters. In some embodiments, muscle-specific promoters, such as any one of the ACTA1, HSA, MCK, MHCK7, dMCK, tMCK, DES, MLC2v, cTnT, MLC, SPc5-12, SP-301, MH, Sk-CRM, or Sk-CRM4 promoters may be used. Other conventional regulatory sequences contained in the mini-gene or rAAV are also disclosed in documents such as WO 2014 / 124282 and others cited and incorporated by reference herein. One of skill in the art may select among these, and other, expression control sequences without departing from the scope described herein. The selected genetic element may be delivered by any suitable method, including those described herein. The methods used to construct any embodiment described herein are known to those with skill in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY. Similarly, methods of generating rAAV virions are well known and the selection of a suitable method is not a limitation on methods and constructs described herein. See, e.g., K. Fisher et al., J. Virol., 199370: 520- 532 and U.S. Patent 5,478,745, each of which is incorporated by reference herein. In some embodiments, the MSH3 splice modulator is included in a proviral plasmid, such as those disclosed in International Patent Publication No. WO 2012 / 158757, incorporated herein by reference. Such a proviral plasmid contains a modular recombinant AAV genome comprising in operative association: a wildtype 5’ AAV2 ITR sequence flanked by unique restriction sites that permit ready removal or replacement of said ITR; a promoter comprising a 49-nucleic acid cytomegalovirus sequence upstream of a cytomegalovirus (CMV)-chicken beta actin sequence, or a neuron-specific promoter / enhancer, the promoter flanked by unique restriction sites that permit ready removal or replacement of the entire promoter sequence, and the upstream sequence flanked by unique restriction sites that permit ready removal or replacement of only the upstream CMV or enhancer sequence, from the promoter sequence. An MSH3 splice modulator described herein can be inserted into the site of a multi-cloning poly linker, wherein the MSH3 splice modulator is operably linked to, and under the regulatory control of, the promoter. A bovine growth hormone polyadenylation sequence flanked by unique restriction sites that permit ready removal or replacement of the poly A sequence; and a wildtype 3’ AAV2 ITR sequence flanked by unique restriction sites that permit ready removal or replacement of the 3’ ITR; are also part of such a plasmid. The plasmid backbone comprises the elements necessary for replication in bacterial cells, e.g., a kanamycin resistance gene, and is itself flanked by transcriptional terminator / insulator sequences. In some embodiments, a proviral plasmid comprises: (a) a modular recombinant AAV genome comprising in operative association: (i) a wildtype 5’ AAV2 ITR sequence flanked by unique restriction sites that permit ready removal or replacement of said ITR; (ii) a promoter comprising (A) a 49-nucleic acid CMV sequence upstream of a CMV-chicken beta actin sequence or (B) a neuronal cell-specific promoter / enhancer. The promoter is flanked by unique restriction sites that permit ready removal or replacement of the entire promoter sequence, and the upstream sequence flanked by unique restriction sites that permit ready removal or replacement of only the upstream CMV or enhancer sequence, from the promoter sequence. Also part of this proviral plasmid is a multi-cloning polylinker sequence that permits insertion of an MSH3 splice modulator sequence including any of those described herein, wherein the MSH3 splice modulator is operably linked to, and under the regulatory control of, the promoter; a bovine growth hormone polyadenylation sequence flanked by unique restriction sites that permit ready removal or replacement of said poly A sequence; and a wildtype 3’ AAV2 ITR sequence flanked by unique restriction sites that permit ready removal or replacement of the 3’ ITR. The proviral plasmid also contains a plasmid backbone comprising the elements necessary for replication in bacterial cells, and further comprising a kanamycin resistance gene, said plasmid backbone flanked by transcriptional terminator / insulator sequences. The proviral plasmid described herein may also contain in the plasmid backbone a non-coding lambda phage 5.1 kb stuffer sequence to increase backbone length and prevent reverse packaging of non-functional AAV genomes. In yet a further aspect, a promoter included in a proviral plasmid comprising a snRNA construct described herein is modified to reduce the size of the promoter to permit larger MSH3 splice modulator sequences or more MSH3 splice modulator sequences to be inserted in the rAAV. These proviral plasmids are then employed in currently conventional packaging methodologies to generate a recombinant virus expressing the MSH3 splice modulator carried by the proviral plasmids. Suitable production cell lines are readily selected by one of skill in the art. For example, a suitable host cell can be selected from any biological organism, including prokaryotic (e.g., bacterial) cells, and eukaryotic cells, including insect cells, yeast cells and mammalian cells. Briefly, the proviral plasmid is transfected into a selected packaging cell, where it may exist transiently. Alternatively, the minigene or gene expression cassette with its flanking ITRs is stably integrated into the genome of the host cell, either chromosomally or as an episome. Suitable transfection techniques are known and may readily be utilized to deliver the recombinant AAV genome to the host cell. Typically, the proviral plasmids are cultured in the host cells which express the cap and / or rep proteins. In the host cells, the minigene consisting of the MSH3 splice modulator / s with flanking AAV ITRs is rescued and packaged into the capsid protein or envelope protein to form an infectious viral particle. Thus, a recombinant AAV infectious particle is produced by culturing a packaging cell carrying the proviral plasmid in the presence of sufficient viral sequences to permit packaging of the gene expression cassette viral genome into an infectious AAV envelope or capsid. Alternatively, MSH3 splice modulators can be delivered using a non-AAV vector, e.g., a non- viral vector. Any suitable non-viral vector technology known in the art or described herein may be used. Such non-viral vectors amenable for delivery of MSH3 splice modulators include liposomes (e.g., cationic liposomes, unilamellar liposomes, or multilamellar liposomes), nanoparticles (e.g., polymeric nanoparticles, lipid nanoparticles (LNPs), PEGylated nanoparticles (e.g., PEGylated LNPs), peptide nanoparticles, metal nanoparticles, and the like), dendrimers (e.g., cationic dendrimers, e.g., polypropylenimine dendrimers), exosomes (e.g., immunologically inert and / or targeted exosomes, e.g., made using techniques described in Alvarez-Erviti, et al., 2011, Nat. Biotechnol.29:341), and microvesicles. In some instances, the MSH3 splice modulators described herein may be delivered using cell penetrating peptides (CPPs), which can translocate the plasma membrane of a target cell and facilitate the delivery of a MSH3 splice modulator / s to the interior of the target cell. IV. Pharmaceutical Compositions and Kits Provided herein are pharmaceutical compositions including a MSH3 splice modulator, a proviral plasmid, or a rAAV comprising any of the MSH3 splice modulators described herein. In some embodiments, the pharmaceutical composition includes any of the MSH3 splice modulators described herein. Such pharmaceutical compositions may be prepared to be free of contamination and of sufficient purity to be suitable for in vivo administration. The pharmaceutical compositions described herein may be assessed for contamination by conventional methods and then formulated into a pharmaceutical composition intended for a suitable route of administration. Still other compositions containing the MSH3 splice modulator, e.g., naked DNA, may be formulated similarly with a suitable carrier. Such formulation involves the use of a pharmaceutically and / or physiologically acceptable vehicle or carrier, particularly directed for administration to the target cell (e.g., a neuron). In one embodiment, carriers suitable for administration to the target cells include buffered saline, an isotonic sodium chloride solution, or other buffers, e.g., HEPES, to maintain pH at appropriate physiological levels, and, optionally, other medicinal agents, pharmaceutical agents, stabilizing agents, buffers, carriers, adjuvants, diluents, etc. In some embodiments, the carrier is a liquid for injection. Exemplary physiologically acceptable carriers include sterile, pyrogen-free water and sterile, pyrogen-free, phosphate buffered saline. A variety of such known carriers are provided in U.S. Patent No.7,629,322, incorporated herein by reference. In one embodiment, the carrier is an isotonic sodium chloride solution. In another embodiment, the carrier is a balanced salt solution. In one embodiment, the carrier includes Tween. If the virus is to be stored long-term, it may be frozen in the presence of glycerol or TWEEN®20. In other embodiments, compositions containing MSH3 splice modulators described herein include a surfactant. Useful surfactants, such as Pluronic F68 (Poloxamer 188, also known as LUTROL® F68) may be included as they prevent AAV from sticking to inert surfaces and thus ensure delivery of the desired dose. As an example, one illustrative composition designed for the treatment of HD described herein comprises a recombinant adeno-associated vector carrying a nucleic acid sequence encoding a MSH3 splice modulator as described herein, under the control of regulatory sequences which express the MSH3 splice modulator in a neuronal cell of a mammalian subject, and a pharmaceutically acceptable carrier. The carrier is isotonic sodium chloride solution and includes a surfactant Pluronic F68. In one embodiment, the MSH3 splice modulator is any of those described herein. In yet another exemplary embodiment, the composition comprises a rAAV virus comprising any of the MSH3 splice modulators described herein for reducing MSH3 expression levels, the nucleic acid sequence under the control of a promoter which directs expression of the MSH3 splice modulator in neuronal cells of the brain (e.g., neurons in the cortex, striatum, and / or hypothalamus), wherein the composition is formulated with a carrier and additional components suitable for intracerebral delivery (e.g., via slow delivery or convection-enhanced infusion) or intracerebroventricular delivery. In some embodiments, the nucleic acid sequence is under the control of a promoter which directs expression of the MSH3 splice modulator in motor neuron cells, wherein the composition is formulated with a carrier and additional components suitable for delivery to motor neurons. In some embodiments, the nucleic acid sequence is under the control of a promoter which directs expression of the MSH3 splice modulator in muscle cells (e.g., cardiac muscle, smooth muscle, or skeletal muscle), wherein the composition is formulated with a carrier and additional components suitable for delivery to muscle cells. In some embodiments, the nucleic acid sequence is under the control of a promoter which directs expression of the MSH3 splice modulator in ocular cells (e.g., retinal cells, cones, rods, corneal endothelial cells, or corneal epithelium cells), wherein the composition is formulated with a carrier and additional components suitable for delivery to ocular cells. In still another embodiment, the composition or components for production or assembly of this composition, including carriers, rAAV particles, surfactants, and / or the components for generating the rAAV, as well as suitable laboratory hardware to prepare the composition, may be incorporated into a kit. Such kits may further include instructions for administering the composition to an individual, e.g., as a treatment for HD. Additionally provided herein are kits containing a pharmaceutical composition comprising a MSH3 splice modulator (e.g., wherein the MSH3 splice modulator is packaged in any AAV vector described herein). In some embodiments, the kit includes instructions for mixing the pharmaceutical composition prior to administration. V. Methods and Uses The MSH3 splice modulators (e.g., MSH3 splice modulators and MSH3 splice modulator- encoding vectors or constructs) and compositions described above are useful for reducing MSH3 expression in a target cell (e.g., a neuron, e.g., pyramidal neurons of the cortex, medium spiny neurons in the striatum, and / or hypothalamic neurons, motor neurons, cardiac muscle cells, skeletal muscle cells, smooth muscle cells, or ocular cells, e.g., corneal endothelial cells) of an individual in, e.g., methods for treating diseases or disorders associated with nucleotide repeat disorders, such as HD, including delaying or ameliorating symptoms associated with HD. Some embodiments of treatment methods described herein, or of constructs and / or molecules for use in methods of treatment or in the preparation of medicaments for treatment, involve targeting MSH3 only. Some embodiments involve methods of treating or preventing trinucleotide repeat expansion disorders by administering to a subject a therapeutic agent that reduces MSH3 expression. In some embodiments, the trinucleotide repeat expansion disorder is a polyglutamine disease. In some embodiments, the polyglutamine disease is dentatorubropallidoluysian atrophy, Huntington’s disease, spinal and bulbar muscular atrophy, spinocerebellar ataxia type 1, spinocerebellar ataxia type 2, spinocerebellar ataxia type 3, spinocerebellar ataxia type 6, spinocerebellar ataxia type 7, spinocerebellar ataxia type 17, or Huntington’s disease-like 2. In some embodiments, the trinucleotide repeat expansion disorder is Huntington’s disease. In some embodiments, the trinucleotide repeat expansion disorder is a non-polyglutamine disease. In some embodiments, the non-polyglutamine disease is fragile X syndrome, fragile X-associated tremor / ataxia syndrome, fragile XE mental retardation, Friedreich’s ataxia, myotonic dystrophy type 1, spinocerebellar ataxia type 8, spinocerebellar ataxia type 12, oculopharyngeal muscular dystrophy, Fragile X-associated premature ovarian failure, FRA2A syndrome, FRA7A syndrome, or early infantile epileptic encephalopathy. Exemplary nucleotide repeat expansion disorders include the following: Myotonic Dystrophy 1 (DMPK), Myotonic Dystrophy 2 (CNBP), Fuchs Endothelial Corneal Dystrophy (TCF4), Fragile X Syndrome (FMR1), Friedreich Ataxia (FXN), C9orf72 ALS / FTD (C9orf72), SCA1, 2, 3, 6, 7, 8, 10, 17, and 31, Spinal and bulbar muscular atrophy (AR). In some embodiments, symptoms of HD include, without limitation, involuntary jerking or writhing movements (chorea); muscle problems, such as rigidity or muscle contracture (dystonia); slow or unusual eye movements; impaired gait, posture and balance; difficulty with speech or swallowing. In some embodiments, symptoms of HD include, the following categories: muscular (e.g., abnormality walking, increased muscle activity, involuntary movements, problems with coordination, loss of muscle, and / or muscle spasms); cognitive (e.g., amnesia, delusion, lack of concentration, mental confusion, slowness in activity, and / or difficulty thinking and understanding); behavioral (e.g., compulsive behavior, fidgeting, irritability, or lack of restraint); psychological (e.g., delirium, depression, hallucination, and / or paranoia); and mood (e.g., anxiety, apathy, and / or mood swings). Additional symptoms commonly observed in HD patients include memory loss, tremor, and / or weight loss. In some embodiments, other symptoms of repeat disorders discussed herein can also be prevented or treated by administering. The MSH3 splice modulators (e.g., MSH3 splice modulators and MSH3 splice modulator- encoding vectors or constructs) and compositions described above are furthermore useful for reducing MSH3 expression in a target cell (e.g., a neuron, e.g., pyramidal neurons of the cortex, medium spiny neurons in the striatum, and / or hypothalamic neurons, motor neurons, cardiac muscle cells, skeletal muscle cells, smooth muscle cells, or ocular cells, e.g., corneal endothelial cells) of an individual as applied, e.g., to their use for treating diseases or disorders associated with nucleotide repeats, such as HD, myotonic dystrophy 1, myotonic dystrophy 2, Fuchs endothelial corneal dystrophy, fragile X syndrome, Friedreich ataxia, C9orf72 ALS / FTD, SCA1, SCA2, SCA3, SCA6, SCA7, SCA8, SCA10, SCA17, SCA31, or spinal and bulbar muscular atrophy, including delaying or ameliorating symptoms associated with HD, myotonic dystrophy 1, myotonic dystrophy 2, Fuchs endothelial corneal dystrophy, fragile X syndrome, Friedreich ataxia, C9orf72 ALS / FTD, SCA1, SCA2, SCA3, SCA6, SCA7, SCA8, SCA10, SCA17, SCA31, or spinal and bulbar muscular atrophy as described herein or to their use in the preparation of a medicament for the treatment of diseases or disorders associated with nucleotide repeats, such as HD, myotonic dystrophy 1, myotonic dystrophy 2, Fuchs endothelial corneal dystrophy, fragile X syndrome, Friedreich ataxia, C9orf72 ALS / FTD, SCA1, SCA2, SCA3, SCA6, SCA7, SCA8, SCA10, SCA17, SCA31, or spinal and bulbar muscular atrophy, including delaying or ameliorating symptoms associated with HD, myotonic dystrophy 1, myotonic dystrophy 2, Fuchs endothelial corneal dystrophy, fragile X syndrome, Friedreich ataxia, C9orf72 ALS / FTD, SCA1, SCA2, SCA3, SCA6, SCA7, SCA8, SCA10, SCA17, SCA31, or spinal and bulbar muscular atrophy as described herein. Such methods and uses involve contacting a target MSH3 gene (e.g., MSH3 pre-mRNA) with a MSH3 splice modulator as described herein [e.g., a MSH3 splice modulator, or a mixture of MSH3 splice modulators as described herein, a composition (e.g., a pharmaceutical composition) comprising same or a medicament comprising same], under conditions in which the MSH3 asRNA portion of the MSH3 splice modulator binds to the region of the target MSH3 pre-mRNA for which it is complementary, thereby inducing altered splicing (e.g., exon skipping) in the targeted MSH3 pre-mRNA, which in turn induces NMD of MSH3 pre-mRNA, which reduces MSH3 expression levels in the target cell. Thus, the methods and compositions are used to treat pathologies associated with the nucleotide repeats in target genes that are causative in nucleotide repeat disorders. In some embodiments, the methods and compositions are used to treat the HD pathologies or other nucleotide repeat diseases associated with the specific mutations such as, e.g., CAG repeats in excess of 40 repeats (SEQ ID NO: 87) on the genomic level and polyglutamine stretches in excess of 40 glutamines (SEQ ID NO: 94) in proteins transcribed and translated from genomic CAG repeats in excess of 40 repeats (SEQ ID NO: 87) (disease causing expansion of genomic CAG repeats). In some embodiments, provided herein are methods of reducing MSH3 expression in a target cell, by contacting (e.g., transducing) the target cell with any of the MSH3 splice modulators, vectors (e.g., AAV vectors), or compositions described herein. In one embodiment, the contacting involves direct administration of the composition (e.g., pharmaceutical composition) to the affected individual. In another embodiment, the contacting may occur ex vivo with a cultured cell (e.g., a neuronal cell or precursor thereof) and the treated cultured cell reimplanted in the individual. In another embodiment, the method involves administering an rAAV carrying any of the MSH3 splice modulators or any combination thereof. In some embodiments, the methods include selecting one or more MSH3 splice modulators for treating an individual having a disorder associated with mutation / s in HTT, DMPK, CNBP, FMR1, FXN, C9ORF72, AR, or TCF4. In some embodiments, use of one or more MSH3 splice modulators for treating an individual having a disorder associated with mutation / s in HTT (e.g., expansion of genomic CAG repeats, particularly in excess of 40 genomic CAG repeats (SEQ ID NO: 87)), DMPK, CNBP, FMR1, FXN, C9ORF72, AR, or TCF4, or use of same in the preparation of a medicament for the treatment of an individual having a disorder associated with mutation / s in HTT, DMPK, CNBP, FMR1, FXN, C9ORF72, AR, or TCF4 is encompassed herein. Such methods and uses include selecting one or more MSH3 splice modulators for treating an individual having a disorder associated with a mutation in HTT, DMPK, CNBP, FMR1, FXN, C9ORF72, AR, or TCF4 or for use of such selected one or more MSH3 splice modulators in treating an individual having a disorder associated with a mutation in HTT, DMPK, CNBP, FMR1, FXN, C9ORF72, AR, or TCF4 or for use of such selected one or more MSH3 splice modulators or constructs comprising same in the preparation of a medicament for the treatment of an individual having a disorder associated with mutation / s in HTT, DMPK, CNBP, FMR1, FXN, C9ORF72, AR, or TCF4. Such selection can be based on the genotype of the individual. In some embodiments, a disorder associated with HTT, DMPK, CNBP, FMR1, FXN, C9ORF72, AR, or TCF4 may be an autosomal dominant disorder. In some instances, the individual is homozygous or compound heterozygous for mutation / s in HTT, DMPK, CNBP, FMR1, FXN, C9ORF72, AR, or TCF4. Methods of screening for and identifying particular mutations in HTT, DMPK, CNBP, FMR1, FXN, C9ORF72, AR, and TCF4 are known in the art. As described herein, the causative mutations associated with HD comprise the pathological expansion [greater than 35 (SEQ ID NO: 95) (incomplete penetrance of HD) or greater than 40 (SEQ ID NO: 87) (adult-onset HD or juvenile-onset HD) CAG repeats] of the CAG repeats in exon 1 of the HTT gene. Thus, in some embodiments, methods of the invention include administering a single MSH3 splice modulator to delay (relative to an untreated control), reduce (relative to an untreated control), or prevent the pathological expansion [greater than 35 (SEQ ID NO: 95) (incomplete penetrance of HD) or greater than 40 (SEQ ID NO: 87) (adult-onset HD or juvenile-onset HD) CAG repeats] of the CAG repeats in exon 1 of the HTT gene, e.g., without regard to the location of any other mutations that may exist in the other allele. Additionally presented are methods involving selecting a single MSH3 splice modulator to correct the pathological expansion [greater than 35 (SEQ ID NO: 95) (incomplete penetrance of HD) or greater than 40 (SEQ ID NO: 87) (adult-onset HD or juvenile-onset HD) CAG repeats] of the CAG repeats in exon 1 of the HTT pre-mRNA and reduce levels of MSH3, such that a single MSH3 splice modulator capable of being packaged in an AAV vector is capable of reducing levels of cellular MSH3 to slow (relative to an untreated control), reduce (relative to an untreated control), or inhibit expansion of the CAG repeats in HTT gene in the genome. MSH3 splice modulators described herein and vectors, proviral plasmids, and AAV comprising same, as well as compositions comprising such MSH3 splice modulators and vectors, proviral plasmids, and AAV comprising same are for use in medical treatment, in particular for use in the treatment of HD or other nucleotide repeat expansion disorders described herein. In some embodiments, when using, e.g., an AAV vector (or other gene therapy vector) the AAV vector may be administered via direct infusion into the brain. In some embodiments, direct infusion comprises an intrathecal infusion of the AAV vector into the cerebrospinal fluid. Intrathecal infusion offers an efficient delivery mode into the CNS, wherein neurons can be targeted. In some embodiments, striatal and cortical structures may be targeted via intrastriatal convection enhanced diffusion (CED) delivery via injections into the striatum. In some embodiments, injections may be directed to the striatum and the thalamus to provide greater coverage of the structures of the brain implicated in HD. In some embodiments, AAV vectors may be delivered intrastriatally or intrastriatally and intrathalamically via CED injections into the striatum or the striatum and the thalamus. Such injections may be performed using magnetic resonance imaging-guided injections. Such methods for treatment are particularly useful for human subjects having HD. Such treatment involves human subjects having HD, including those having a genetic predisposition for developing HD that do not exhibit symptoms of HD. Accordingly, in some embodiments, treatment of human subjects with HD may include the treatment of any human subject carrying a Huntingtin allele with more than 35 CAG repeats (SEQ ID NO: 95). In some embodiments, when using, e.g., an AAV vector (or other gene therapy vector) the AAV vector may be administered systemically or via infusion near or direct infusion into a target tissue / organ having significance in connection with a nucleotide repeat expansion disorder such as, e.g., motor neurons, cardiac muscle cells, skeletal muscle cells, smooth muscle cells, or ocular cells, e.g., corneal endothelial cells. In some embodiments, an effective concentration of a recombinant adeno-associated virus carrying a MSH3 splice modulator as described herein ranges between about 108and 1013vector genomes per milliliter (vg / mL). The rAAV infectious units are measured as described in McLaughlin et al., J. Virol.1988, 62: 1963. In another embodiment, the concentration ranges between 109and 1013vg / mL. In another embodiment, the effective concentration is about 1.5 x 1011vg / mL. In another embodiment, the effective concentration is about 5 x 1011vg / mL. In one embodiment, the effective concentration is about 1.5 x 1010vg / mL. In another embodiment, the effective concentration is about 2.8 x 1011vg / mL. In yet another embodiment, the effective concentration is about 1.5 x 1012vg / mL. In another embodiment, the effective concentration is about 1.5 x 1013vg / mL. It is desirable that the lowest effective dosage (total genome copies delivered) of virus be utilized in order to reduce the risk of undesirable effects, such as toxicity, and other issues related to administration to the brain. An effective dosage of a recombinant adeno-associated virus carrying a MSH3 splice modulator as described herein ranges between about 108and 1013vector genomes (vg) per dose (i.e., per injection). In one embodiment, the dosage ranges between 109and 1013vg. In another embodiment, the effective dosage is about 1.5 x 1011vg. In another embodiment, the effective dosage is about 5 x 1011vg. In one embodiment, the effective dosage is about 1.5 x 1010vg. In another embodiment, the effective dosage is about 2.8 x 1011vg. In yet another embodiment, the effective dosage is about 1.5 x 1012vg. In another embodiment, the effective concentration is about 1.5 x 1013vg. Still other dosages in these ranges or in other units may be selected by the attending physician, taking into account the physical state of the individual being treated, including the age of the individual; the composition being administered, and the particular disorder; the targeted cell and the degree to which the disorder, if progressive, has developed. In some embodiments, the composition may be delivered in a volume of from about 50 μL to about 1 mL, including all numbers within the range, depending on the size of the area to be treated, the viral titer used, the route of administration, the age of the recipient, and the desired effect of the method. In one embodiment, the volume is about 50 μL. In another embodiment, the volume is about 70 μL. In another embodiment, the volume is about 100 μL. In another embodiment, the volume is about 125 μL. In another embodiment, the volume is about 150 μL. In another embodiment, the volume is about 175 μL. In yet another embodiment, the volume is about 200 μL. In another embodiment, the volume is about 250 μL. In another embodiment, the volume is about 300 μL. In another embodiment, the volume is about 350 μL. In another embodiment, the volume is about 400 μL. In another embodiment, the volume is about 450 μL. In another embodiment, the volume is about 500 μL. In another embodiment, the volume is about 600 μL. In another embodiment, the volume is about 750 μL. In another embodiment, the volume is about 850 μL. In another embodiment, the volume is about 1,000 μL. In some instances, treatments and uses described herein reduce MSH3 mRNA or MSH3 expression by 10% or more in the target cell (e.g., 11% or more of the MSH3 mRNA or MSH3 expression in the target cell(s), 12% or more of the MSH3 mRNA or MSH3 expression in the target cell(s), 13% or more of the MSH3 mRNA or MSH3 expression in the target cell(s), 14% or more of the MSH3 mRNA or MSH3 expression in the target cell(s), 15% or more of the MSH3 mRNA or MSH3 expression in the target cell(s), 16% or more of the MSH3 mRNA or MSH3 expression in the target cell(s), 17% or more of the MSH3 mRNA or MSH3 expression in the target cell(s), 18% or more of the MSH3 mRNA or MSH3 expression in the target cell(s), 19% or more of the MSH3 mRNA or MSH3 expression in the target cell(s). In some instances, treatments and uses described herein reduce MSH3 mRNA or MSH3 expression by 20% or more in the target cell (e.g., 21% or more of MSH3 mRNA or MSH3 expression in the target cell(s), 22% or more of MSH3 mRNA or MSH3 expression in the target cell(s), 23% or more of MSH3 mRNA or MSH3 expression in the target cell(s), 24% or more of MSH3 mRNA or MSH3 expression in the target cell(s), 25% or more of MSH3 mRNA or MSH3 expression in the target cell(s), 26% or more of MSH3 mRNA or MSH3 expression in the target cell(s), 27% or more of MSH3 mRNA or MSH3 expression in the target cell(s), 28% or more of MSH3 mRNA or MSH3 expression in the target cell(s), 29% or more of MSH3 mRNA or MSH3 expression in the target cell(s), 30% or more of MSH3 mRNA or MSH3 expression in the target cell(s), 31% or more of MSH3 mRNA or MSH3 expression in the target cell(s), 32% or more of MSH3 mRNA or MSH3 expression in the target cell(s), 33% or more of MSH3 mRNA or MSH3 expression in the target cell(s), 34% or more of MSH3 mRNA or MSH3 expression in the target cell(s), 35% or more of MSH3 mRNA or MSH3 expression in the target cell(s), 36% or more of MSH3 mRNA or MSH3 expression in the target cell(s), 37% or more of MSH3 mRNA or MSH3 expression in the target cell(s), 38% or more of MSH3 mRNA or MSH3 expression in the target cell(s), 39% or more of MSH3 mRNA or MSH3 expression in the target cell(s), 40% or more of MSH3 mRNA or MSH3 expression in the target cell(s), 41% or more of MSH3 mRNA or MSH3 expression in the target cell(s), 42% or more of MSH3 mRNA or MSH3 expression in the target cell(s), 43% or more of MSH3 mRNA or MSH3 expression in the target cell(s), 44% or more of MSH3 mRNA or MSH3 expression in the target cell(s), 45% or more of MSH3 mRNA or MSH3 expression in the target cell(s), 46% or more of MSH3 mRNA or MSH3 expression in the target cell(s), 47% or more of MSH3 mRNA or MSH3 expression in the target cell(s), 48% or more of MSH3 mRNA or MSH3 expression in the target cell(s), 49% or more of MSH3 mRNA or MSH3 expression in the target cell(s), or 50% or more of the MSH3 mRNA or MSH3 expression in the target cell(s)). In some instances, treatments and uses described herein replace 50% or more of MSH3 mRNA or MSH3 expression in the target cell. In some instances, treatments and uses described herein replace about 50% or up to 50% of MSH3 mRNA or MSH3 expression in the target cell. For each of the described methods and uses, the treatment or use may be used to prevent the occurrence of further damage or to rescue tissue having mild, moderate, or advanced disease. As used herein, the term “rescue” means to prevent progression of the disease, prevent spread of damage to uninjured cells, and / or to improve damage in injured cells. Thus, in some embodiments, the composition is administered before disease onset. In some embodiments, the composition is administered prior to the development of symptoms. In some embodiments, the composition is administered after development of symptoms. In some embodiments, the composition is administered when less than 90% of the target cells are functioning or remaining, e.g., as compared to a reference tissue. In some embodiments, the composition is administered when more than 10% of the target cells are functioning or remaining, e.g., as compared to a reference tissue. In some embodiments, the composition is administered when more than 20% of the target cells are functioning or remaining. In some embodiments, the composition is administered when more than 30% of the target cells are functioning or remaining. In some embodiments, the composition is administered when more than 40% of the target cells are functioning or remaining. In some embodiments, the composition is administered when more than 50% of the target cells are functioning or remaining. In some embodiments, the composition is administered when more than 60% of the target cells are functioning or remaining. In some embodiments, the composition is administered when more than 70% of the target cells are functioning or remaining. In some embodiments, the composition is administered when more than 80% of the target cells are functioning or remaining. In some embodiments, the composition is administered when more than 90% of the target cells are functioning or remaining. In some embodiments, the composition is administered when more than 95% of the target cells are functioning or remaining. In some embodiments, any of the above-described methods or uses is performed in combination with another, or secondary, therapy. The therapy may be any now known, or yet unknown, therapy which helps prevent, arrest or ameliorate these mutations or defects or any of the effects associated therewith. The secondary therapy can be administered before, concurrent with, or after administration of a pharmaceutical composition described above. In one embodiment, a secondary therapy involves non-specific approaches for maintaining the health of neuronal cells, such as administration of neurotrophic factors, anti-oxidants, and / or anti- apoptotic agents. The non-specific approaches are achieved through injection of proteins, recombinant DNA, recombinant viral vectors, stem cells, fetal tissue, or genetically modified cells. The latter could include genetically modified cells that are encapsulated. For use in these methods, the volume and viral titer of each injection is determined individually and may be the same or different from other injections performed in, e.g., the brain. The dosages, administrations, and regimens may be determined by the attending physician given the teachings of this disclosure. VI. Examples The examples that follow do not limit the scope of the embodiments described herein. One skilled in the art will appreciate that modifications can be made in the following examples which are intended to be encompassed by the spirit and scope of the invention. Example 1: MSH3 Knockdown Constructs MSH3 knockdown by small nuclear RNA (snRNA)-based antisense RNA (asRNA) was tested (FIGs.1-7). MSH3 can be inactivated by antisense RNAs encoded in a snRNA scaffold that anneal to MSH3 specific exon sequences or exon / intron splice junctions, which leads to altered processing of MSH3 pre-mRNA, which in some embodiments promotes exon skipping / prevents exon inclusion. In some embodiments, altered processing of MSH3 pre-mRNA via, e.g., exon skipping, leads to the generation of a premature stop codon, ultimately causing NMD of the MSH3 transcript. In summary, MSH3 exon 7 and exon 15 splice modulators reduced MSH3 RNA and protein levels (FIGs.3-8). Briefly, HEK293 cells were transfected with snRNA-based splice modulators designed to skip MSH3 exon 7 or exon 15. Cells were harvested 48 hours post-transfection, assayed for MSH3 knockdown by RT-qPCR (FIGs.3-7) or subjected to Western Blot analysis (FIG.8A). FIGs.8B and 8C portray ddPCR analysis of the same samples subjected to Western Blot in FIG.8A. FIG.8, therefore, demonstrates that reduction in MSH3 protein levels parallels the reduction observed for MSH3 transcripts. A U7 SmOPT asRNA scan against MSH3 exons 7 and 15 was used to determine whether there are specific sites within either exon that can be targeted by asRNA encoded in a U7 SmOPT scaffold, whereby such targeting promotes a statistically significant reduction in MSH3 transcripts. The present inventors refer to such specific exon sequences in either exon 7 or 15 as exon skipping hot spots. Within exon 7, asRNA encoded by any one of SEQ ID NOs: 9, 10, or 11 promoted a particularly significant reduction in MSH3 transcripts. Accordingly, SEQ ID NOs: 42, 43, and 44 serve as exemplary MSH3 splicing modulator constructs comprising each of SEQ ID NOs: 9, 10, or 11, respectively. See FIGs.3A and 4A. The present inventors also identified specific intron sequences in intron 7 as exon skipping hot spots. Within intron 7, asRNA encoded by SEQ ID NO: 14 promoted a particularly significant reduction in MSH3 transcripts. SEQ ID NO: 47, therefore, serves as exemplary MSH3 splicing modulator construct comprising SEQ ID NO: 14. See FIGs.3A and 4A. The present inventors also identified specific exon / intron junction sequences of exon 7 as exon skipping hot spots. With respect to exon / intron junction sequences of exon 7, asRNA encoded by any one of SEQ ID NOs: 13, 17, or 18 promoted a particularly significant reduction in MSH3 transcripts. Thus, SEQ ID NOs: 46, 50, and 51 serve as exemplary MSH3 splicing modulator constructs comprising each of SEQ ID NOs: 13, 17, or 18, respectively. See FIGs.3A and 4A. These results were surprising at least because single asRNA molecules, particularly those that target exon skipping hot spots, were sufficient to effectuate a dramatic and statistically significant reduction in MSH3 transcripts. With respect to exon 15, asRNA encoded by either one of SEQ ID NOs: 27 or 28 promoted a particularly significant reduction in MSH3 transcripts. Accordingly, SEQ ID NOs: 64 and 65 serve as exemplary MSH3 splicing modulator constructs comprising each of SEQ ID NO: 27 or 28, respectively. See FIGs.3B and 4B. These results were surprising at least because single asRNA molecules, particularly those that target exon skipping hot spots, were sufficient to effectuate a dramatic and statistically significant reduction in MSH3 transcripts. Additional experimental analysis of exon skipping hot spots employed asRNAs of different sizes (24nt or 36nt long), which targeted overlapping sites, to determine whether asRNA length affects efficiency of MSH3 transcript reduction. With respect to exon / intron junction sequences of exon 7, asRNA encoded by any one of SEQ ID NOs: 13, 17, or 18 promoted a particularly significant reduction in MSH3 transcripts. SEQ ID NOs: 46, 50, and 51 thus serve as exemplary MSH3 splicing modulator constructs comprising each of SEQ ID NOs: 13, 17, or 18, respectively. A comparison of activity of SEQ ID NOs: 46 and 51 revealed that overlapping 24mer (encoded by SEQ ID NO: 46) and 36mer (encoded by SEQ ID NO: 51) asRNA to the 5’ exon / intron junction exhibited comparable and significant reduction in MSH3 transcripts. A comparison of activity of SEQ ID NOs: 40 and 50 revealed that overlapping 24mer (encoded by SEQ ID NO: 40) and 36mer (encoded by SEQ ID NO: 50) asRNA to the 3’ intron / exon junction exhibited differential, but significant reduction in MSH3 transcripts, wherein the 36mer reduced MSH3 transcripts to a greater extent than the overlapping 24mer. See, e.g., FIGs.3A, 4A, and 5A. With respect to exon / intron junction sequences of exon 15, asRNA encoded by any one of SEQ ID NOs: 22, 29, 33, or 34 promoted a significant reduction in MSH3 transcripts. SEQ ID NOs: 59, 66, 70, and 71 serve as exemplary MSH3 splicing modulator constructs comprising each of SEQ ID NOs: 22, 29, 33, or 34, respectively. A comparison of activity of SEQ ID NOs: 22 and 33 revealed that overlapping 24mer (encoded by SEQ ID NO: 59) and 36mer (encoded by SEQ ID NO: 70) asRNA to the 5’ exon / intron junction exhibited comparable and significant reduction in MSH3 transcripts. A comparison of activity of SEQ ID NOs: 29 and 34 revealed that overlapping 24mer (encoded by SEQ ID NO: 66) and 36mer (encoded by SEQ ID NO: 71) asRNA to the 3’ intron / exon junction exhibited comparable and significant reduction in MSH3 transcripts. See, e.g., FIGs.3B, 4B, and 5B. Molecules consisting of dual asRNAs targeting the 3’ss and 5’ss of each of exon 7 and 15 were assessed with and without intervening linker sequences between the dual asRNAs to determine whether the presence of a linker sequence affects efficiency of MSH3 transcript reduction. See, e.g., FIG.2. With respect to targeting the 3’ss and 5’ss of exon 7, SEQ ID NOs: 55 (24mers with linker) and 56 (24mers without linker) each exhibited comparable and significant reduction in MSH3 transcripts. With respect to targeting the 3’ss and 5’ss of exon 7, SEQ ID NOs: 53 (36mers with linker) and 54 (36mers without linker) each exhibited comparable and significant reduction in MSH3 transcripts. Of these dual asRNA constructs, SEQ ID NOs: 55 (24mers with linker) and 56 (24mers without linker) exhibited significantly more reduction in MSH3 transcripts than their 36 mer counterparts. See, e.g., FIGs.3A, 6A, and 7A. With respect to targeting the 3’ss and 5’ss of exon 15, SEQ ID NOs: 75 (24mers with linker) and 76 (24mers without linker) each exhibited comparable and significant reduction in MSH3 transcripts. With respect to targeting the 3’ss and 5’ss of exon 15, SEQ ID NOs: 73 (36mers with linker) and 74 (36mers without linker) each exhibited comparable and significant reduction in MSH3 transcripts, but SEQ ID NO: 74 exhibited an enhanced ability to reduce MSH3 transcripts relative to that of SEQ ID NO: 73. Of these dual asRNA constructs, SEQ ID NOs: 74 (36mers without linker) exhibited significantly more reduction in MSH3 transcripts than any of SEQ ID NOs: 73, 75, or 76. See, e.g., FIGs.3B, 6B, and 7B. FIG.7 presents a summary of the variables examined: asRNA size, single vs dual asRNAs, and presence of a linker sequence in a dual asRNA context. These results suggest that, in general, a single, shorter asRNA can be used to achieve the same MSH3 transcript reduction as dual asRNAs, even those consisting of 36nt asRNAs. Exemplary MSH3 exon 7 and exon 15 splice modulators are described herein. Notably, some of these exemplary MSH3 splice modulators comprise a single, shorter asRNA, which offers benefits at least with respect to the size of MSH3-targeting U7 SmOPT molecules. Indeed, a reduction in size could facilitate inclusion of additional features (e.g., a plurality of asRNA or a plurality of MSH3 splice modulator constructs) in a single vector (e.g., an AAV vector). Results presented herein also reveal that the targeted location of exemplary single, shorter asRNAs described herein along the exon can improve splice modulating efficiency, possibly indicating the presence of an exonic splice enhancer that, when masked by the asRNA, results in increased skipping of the exon. Identification of these areas, also referred to herein as exon skipping hot spots, significantly advances the solution to the problem of how to reduce MSH3 expression, thereby delaying progression of a trinucleotide repeat disorder in a patient in need thereof and possibly even preventing further disease progression in a patient with a trinucleotide repeat disorder or preventing disease in a patient at risk for developing a trinucleotide repeat disorder. Example 2: MSH3 Knockdown Construct Activity in Model Systems To corroborate and complement results described in Example 1, the present inventors examined the activity of MSH3 splice modulators in additional relevant cell and tissue types, including human iPSC-derived glutamatergic neurons, human iPSC-derived skeletal muscle cells, striatal neurons from healthy human iPSC, striatal neurons differentiated from Huntington’s Disease patient-derived iPSC, and the non-human primate (NHP) brain. MSH3 splice modulators tested in these studies include SEQ ID NO: 53 (SEQ ID 17 + SEQ ID 80 + SEQ ID 18 + SEQ ID 2 + SEQ ID 3) as well as splice modulators that were designed to include a hnRNPA1 tail at the 5’ end of the splice modulator to enhance exon skipping. Three splice modulators containing asRNA sequences SEQ ID NO: 9, SEQ ID NO: 10, and SEQ ID NO: 28 were designed to include binding sites for the splicing silencer hnRNPA1 (SEQ ID NO: 81). The resulting splice modulators are SEQ ID NO: 82 (which is, from 5’ to 3’, SEQ ID NO: 81, SEQ ID NO: 9, SEQ ID NO: 2, and SEQ ID NO: 3), SEQ ID NO: 83 (which is, from 5’ to 3’, SEQ ID NO: 81, SEQ ID NO: 10, SEQ ID NO: 2, and SEQ ID NO: 3), and SEQ ID NO: 84 (which is, from 5’ to 3’, SEQ ID NO: 81, SEQ ID NO: 28, SEQ ID NO: 2, and SEQ ID NO: 3). These molecules were tested in relevant cell types by AAV transduction. Splice modulators of SEQ ID NOs: 53, 82, 83, and 84, along with a scrambled asRNA control (SEQ ID NO: 77) were packaged in a particular in vitro AAV transducer (AAV2.7m8) that was identified as well suited to the transduction parameters of the cell types listed above (FIGs.9- 12) or AAV9 for the NHP study (FIG.13). FIGs.9A and 9B show that the splice modulators of SEQ ID NOs: 53, 82, 83, and 84 reduce MSH3 mRNA and protein levels, respectively, in glutamatergic neurons differentiated from human iPSCs derived from a healthy donor. FIGs. 10A and 10B show that the splice modulator of SEQ ID NO: 84 reduces MSH3 mRNA and protein levels in skeletal muscle cells differentiated from human iPSCs derived from a healthy donor. FIGs.11A and 11B show that the splice modulator of SEQ ID NO: 53 reduces MSH3 mRNA and protein levels in striatal neurons differentiated from human iPSCs derived from a healthy donor. FIGs.12A and 12B show that the splice modulator of SEQ ID NO: 53 reduces MSH3 mRNA and protein levels in striatal neurons differentiated from human iPSCs derived from a Huntington’s Disease patient. FIGs.13A and 13B show that the splice modulator of SEQ ID NO: 53 reduces MSH3 mRNA and protein levels in the parietal cortex of African Green Monkey. The present inventors envision packaging splice modulators in exemplary known AAV serotypes that have biodistribution to the target tissues of interest (for example, AAV5, AAV9 or other next generation neurotropic capsids for CNS targeting, AAVrh74 or other next generation muscle-tropic capsids for muscle targeting). Splice modulators may also be delivered by other viral or non-viral methods. Example 3: MSH3 Knockdown Construct Effect on Somatic Instability To test the effect of MSH3 knockdown by an MSH3 splice modulator, the splice modulator of SEQ ID NO: 84 (which is, from 5’ to 3’, SEQ ID NO: 81, SEQ ID NO: 28, SEQ ID NO: 2, and SEQ ID NO: 3) or a scrambled asRNA control (SEQ ID NO: 77) were delivered to striatal neurons differentiated from human iPSCs derived from a Huntington’s Disease patient. Numbers of genomic CAG repeats were tested after 50 and 76 days of culture. FIG.14 shows that the MSH3 splice modulator inhibited CAG repeat expansion. These results indicate that MSH3 knockdown by splice modulators of the present disclosure can affect disease progression in repeat expansion disorders. Example 4: Effect of hnRNPA1 Binding Sequence Location Splice modulator constructs were made with the hnRNPA1 binding sequence (SEQ ID NO: 81) in either a 5’ “tail” position or an internal “linker” position and compared to each other and to constructs having the same asRNA sequences but lacking an hnRNPA1 binding sequence. The MSH3 splice modulator designed to induce skipping of exon 7 that had no hnRNPA1 binding sequence was SEQ ID NO: 55 (5’ to 3’: SEQ ID NO: 13 + SEQ ID NO: 80 + SEQ ID NO: 7 + SEQ ID NO: 2 + SEQ ID NO: 3). The MSH3 splice modulator designed to induce skipping of exon 7 that had an hnRNPA1 binding sequence in a 5’ “tail” position and SEQ ID NO: 80 as a linker was, 5’ to 3’: SEQ ID NO: 81 + SEQ ID NO: 13 + SEQ ID NO: 80 + SEQ ID NO: 7 + SEQ ID NO: 2 + SEQ ID NO: 3. The MSH3 splice modulator designed to induce skipping of exon 7 that had an hnRNPA1 binding sequence in the “linker” position between two asRNAs was, from 5’ to 3’: SEQ ID NO: 13 + SEQ ID NO: 81 + SEQ ID NO: 7 + SEQ ID NO: 2 + SEQ ID NO: 3. The MSH3 splice modulator designed to induce skipping of exon 15 that had no hnRNPA1 binding sequence was SEQ ID NO: 75 (5’ to 3’: SEQ ID NO: 29 + SEQ ID NO: 80 + SEQ ID NO: 22 + SEQ ID NO: 2 + SEQ ID NO: 3). The MSH3 splice modulator designed to induce skipping of exon 15 that had an hnRNPA1 binding sequence in a 5’ “tail” position and SEQ ID NO: 80 as a linker was, 5’ to 3’: SEQ ID NO: 81 + SEQ ID NO: 29 + SEQ ID NO: 80 + SEQ ID NO: 22 + SEQ ID NO: 2 + SEQ ID NO: 3. The MSH3 splice modulator designed to induce skipping of exon 15 that had an hnRNPA1 binding sequence in the “linker” position between two asRNAs was, from 5’ to 3’: SEQ ID NO: 29 + SEQ ID NO: 81 + SEQ ID NO: 22 + SEQ ID NO: 2 + SEQ ID NO: 3. The indicated splice modulator constructs, along with a scrambled asRNA control, were transfected into HEK293 cells. Cells were harvested 48 hours post-transfection and assayed for MSH3 knockdown by RT-qPCR. The results in FIGs.15A and 15B show that the constructs with hnRNPA1 in an internal position were surprisingly more effective at exon skipping than those with hnRNPA1 in the 5’ “tail” position. In all of the Examples above, the sequences associated with the SEQ ID NO references in descriptions of splice modulator constructs are DNA sequences (i.e., they have T nucleotides and not U nucleotides). However, it will be understood that the RNA forms of the MSH3 splice modulators would have the same sequences as the sequences associated with the indicated SEQ ID NO references, except that U would be substituted for each T in the sequence. While preferred embodiments of the present disclosure have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the disclosure. It should be understood that, various alternatives to the embodiments of the present disclosure may be employed in practicing the present disclosure. It is intended that the following embodiments define the scope of the present disclosure and that methods and structures within the scope of these embodiments and their equivalents be covered thereby. VII. SEQUENCES SEQ ID Description Sequence (5' to 3') NO: G G G C G A C t asRNA TAACATTTTCCTTATTTTCAGAGA asRNA AAATGTTGCCCTTTTTTTTGTCCC T T A T A C C T A T C asRNA + TGCACAGAAGATAGCTGGTAGAAGAATTTTTGGAGCAGGTTT U7SmOPT TCTGACTTCGGTCGGAAAACCCCT T G T T T G T T A A C A T T T C T G T T T T asRNA + ACTGTCACATATTGTGCAGAAGGAAATTTTTGGAGCAGGTTT U7SmOPT TCTGACTTCGGTCGGAAAACCCCT G T T T G G T A C A T T T A G T G T A A U7SmOPT::h TATGATAGGGACTTAGGGTGTGCACAGAAGATAGCTGG nRNPA1tail_ TAGAAGAATTTTTGGAGCAGGTTTTCTGACTTCGGTCG MSH3 e7 84 GAAAACCCCT G G A G U C U C u a u A g a adjacent to exon 15 105 MSH3 intron uaau ucaa cuuacuuuuauuuucuauua uuuuacucua ua aa A VIII. ENUMERATED EMBODIMENTS Group I Numbered Embodiments: 1. An MSH3 splice modulator construct comprising, operatively linked: (a) a sequence encoding at least one antisense RNA that promotes exon skipping of a target exon of MSH3 pre-mRNA, wherein the target exon is any one of MSH3 exon 7 or MSH3 exon 15, or a combination thereof, wherein the target exon comprises a 5’ intron-exon junction, an exon sequence, and a 3’ exon-intron junction sequence; and (b) a sequence encoding a small nuclear RNA (snRNA) sequence. 2. The MSH3 splice modulator construct of embodiment 1, wherein the at least one antisense RNA comprises at least one antisense RNA that targets the 5’ intron-exon junction, at least one antisense RNA that targets the exon sequence, or at least one antisense RNA that targets the 3’ exon-intron junction, or any combination thereof. 3. The MSH3 splice modulator construct of embodiment 1, wherein the at least one antisense RNA comprises at least one antisense RNA that targets the exon sequence. 4. The MSH3 splice modulator construct of any one of embodiments 1-3, further comprising a U1 promoter and a U1 terminator operatively linked to (a) and (b). 5. The MSH3 splice modulator construct of any one of embodiments 1-4, wherein the snRNA is a modified snRNA. 6. The MSH3 splice modulator construct of embodiment 5, wherein the modified snRNA comprises a U7 Sm OPT sequence or a U2 snRNA sequence. 7. The MSH3 splice modulator construct of any one of embodiments 1-6, wherein the at least one antisense RNA comprises, consists essentially of, or consists of at least one of SEQ ID NOs: 5-18 or 20-34; or a sequence having at least 90% identity to the at least one of SEQ ID NOs: 5-18 or 20-34; or any combination thereof. The MSH3 splice modulator construct of embodiment 7, wherein the at least one antisense RNA consists essentially of or consists of at least one of SEQ ID NOs: 5-18 or 20-34; or a sequence having at least 90% identity to the at least one of SEQ ID NOs: 5-18 or 20-34; or any combination thereof, with the proviso that when the any combination thereof consists of two sequences, the any combination thereof does not consist of SEQ ID NOs: 17 and 18; or a combination of two sequences wherein each sequence has at least 90% identity to SEQ ID NOs: 17 or 18, respectively; or the any combination thereof does not consist of SEQ ID NOs: 33 and 34; or a combination of two sequences wherein each sequence has at least 90% identity to SEQ ID NOs: 33 or 34, respectively. The MSH3 splice modulator construct of embodiment 8, wherein the at least one antisense RNA consists essentially of or consists of at least one of SEQ ID NOs: 5-16 or 20-32; or a sequence having at least 90% identity to the at least one of SEQ ID NOs: 5-18 or 20-34; or any combination thereof, with the proviso that when the any combination thereof consists of two sequences, the any combination thereof does not consist of SEQ ID NOs: 7 and 13; or a combination of two sequences wherein each sequence has at least 90% identity to SEQ ID NOs: 7 or 13, respectively; or the any combination thereof does not consist of SEQ ID NOs: 22 and 29 or a combination of two sequences wherein each sequence has at least 90% identity to SEQ ID NOs: 22 or 29, respectively. The MSH3 splice modulator construct of embodiment 9, wherein the at least one antisense RNA consists essentially of or consists of at least one of SEQ ID NOs: 5, 6, 8-12, 14-16, 19, 20, 21, 23-28, or 30-32; or a sequence having at least 90% identity to the at least one of SEQ ID NOs: 5, 6, 8-12, 14-16, 19, 20, 21, 23-28, or 30-32; or any combination thereof. The MSH3 splice modulator construct of any one of embodiments 1-10, further comprising a linker. The MSH3 splice modulator construct of embodiment 11, wherein the linker is positioned between antisense RNA when the MSH3 splice modulator construct comprises more than one antisense RNA. The MSH3 splice modulator construct of embodiment 12, comprising operatively linked in a 5’ to 3’ direction: SEQ ID NO: 7, the linker, and SEQ ID NO: 13; or a sequence having at least 90% identity to SEQ ID NO: 7, the linker, and a sequence having at least 90% identity to SEQ ID NO: 13; or SEQ ID NO: 7, the linker, and a sequence having at least 90% identity to SEQ ID NO: 13; or a sequence having at least 90% identity to SEQ ID NO: 7, the linker, and SEQ ID NO: 13; or SEQ ID NO: 22, the linker, and SEQ ID NO: 29; or a sequence having at least 90% identity to SEQ ID NO: 22, the linker, and a sequence having at least 90% identity to SEQ ID NO: 29; or SEQ ID NO: 22, the linker, and a sequence having at least 90% identity to SEQ ID NO: 29; or a sequence having at least 90% identity to SEQ ID NO: 22, the linker, and SEQ ID NO: 29; or SEQ ID NO: 13, the linker, and SEQ ID NO: 7; or a sequence having at least 90% identity to SEQ ID NO: 13, the linker, and a sequence having at least 90% identity to SEQ ID NO: 7; or SEQ ID NO: 13, the linker, and a sequence having at least 90% identity to SEQ ID NO: 7; or a sequence having at least 90% identity to SEQ ID NO: 13, the linker, and SEQ ID NO: 7; or SEQ ID NO: 29, the linker, and SEQ ID NO: 22; or a sequence having at least 90% identity to SEQ ID NO: 29, the linker, and a sequence having at least 90% identity to SEQ ID NO: 22; or SEQ ID NO: 29, the linker, and a sequence having at least 90% identity to SEQ ID NO: 22; or a sequence having at least 90% identity to SEQ ID NO: 29, the linker, and SEQ ID NO: 22. 14. The MSH3 splice modulator construct of embodiment 7, comprising operatively linked in a 5’ to 3’ direction: SEQ ID NO: 7 and SEQ ID NO: 13; or a sequence having at least 90% identity to SEQ ID NO: 7 and a sequence having at least 90% identity to SEQ ID NO: 13; or SEQ ID NO: 7 and a sequence having at least 90% identity to SEQ ID NO: 13; or a sequence having at least 90% identity to SEQ ID NO: 7 and SEQ ID NO: 13; or SEQ ID NO: 22 and SEQ ID NO: 29; or a sequence having at least 90% identity to SEQ ID NO: 22 and a sequence having at least 90% identity to SEQ ID NO: 29; or SEQ ID NO: 22 and a sequence having at least 90% identity to SEQ ID NO: 29; or a sequence having at least 90% identity to SEQ ID NO: 22 and SEQ ID NO: 29; or SEQ ID NO: 13 and SEQ ID NO: 7; or a sequence having at least 90% identity to SEQ ID NO: 13 and a sequence having at least 90% identity to SEQ ID NO: 7; or SEQ ID NO:13 and a sequence having at least 90% identity to SEQ ID NO: 7; or a sequence having at least 90% identity to SEQ ID NO: 13 and SEQ ID NO: 7; or SEQ ID NO: 29 and SEQ ID NO: 22; or a sequence having at least 90% identity to SEQ ID NO: 29 and a sequence having at least 90% identity to SEQ ID NO: 22; or SEQ ID NO: 29 and a sequence having at least 90% identity to SEQ ID NO: 22; or a sequence having at least 90% identity to SEQ ID NO: 29 and SEQ ID NO: 22. 15. The MSH3 splice modulator construct of embodiment 7, comprising operatively linked in a 5’ to 3’ direction: SEQ ID NO: 17 and SEQ ID NO: 18; or a sequence having at least 90% identity to SEQ ID NO: 17 and a sequence having at least 90% identity to SEQ ID NO: 18; or SEQ ID NO: 17 and a sequence having at least 90% identity to SEQ ID NO: 18; or a sequence having at least 90% identity to SEQ ID NO: 17 and SEQ ID NO: 18; or SEQ ID NO: 33 and SEQ ID NO: 34; or a sequence having at least 90% identity to SEQ ID NO: 33 and a sequence having at least 90% identity to SEQ ID NO: 34; or SEQ ID NO: 33 and a sequence having at least 90% identity to SEQ ID NO: 34; or a sequence having at least 90% identity to SEQ ID NO: 33 and SEQ ID NO: 34; or SEQ ID NO: 18 and SEQ ID NO: 17; or a sequence having at least 90% identity to SEQ ID NO: 18 and a sequence having at least 90% identity to SEQ ID NO: 17; or SEQ ID NO: 18 and a sequence having at least 90% identity to SEQ ID NO: 17; or a sequence having at least 90% identity to SEQ ID NO: 18 and SEQ ID NO: 17; or SEQ ID NO: 34 and SEQ ID NO: 33; or a sequence having at least 90% identity to SEQ ID NO: 34 and a sequence having at least 90% identity to SEQ ID NO: 33; or SEQ ID NO: 34 and a sequence having at least 90% identity to SEQ ID NO: 33; or a sequence having at least 90% identity to SEQ ID NO: 34 and SEQ ID NO: 33. The MSH3 splice modulator construct of any one of embodiments 1-6, wherein the at least one antisense RNA comprises, consists essentially of, or consists of one of SEQ ID NOs: 5-16 or 20-32; or a sequence having 100% identity to 12-18 consecutive nucleotides of any one of SEQ ID NOs: 5-16 or 20-32. The MSH3 splice modulator construct of any one of embodiments 1-6, wherein the at least one antisense RNA comprises, consists essentially of, or consists of one of SEQ ID NOs: 8-12, 21, 23-28, or 30-31; or a sequence having 100% identity to 12-18 consecutive nucleotides of any one of SEQ ID NOs: 8-12, 21, 23-28, or 30-31. The MSH3 splice modulator construct of any one of embodiments 1-6, wherein the at least one antisense RNA comprises, consists essentially of, or consists of one of SEQ ID NOs: 5-18 or 20-34; or a sequence having at least 90% identity to the one of SEQ ID NOs: 5-18 or 20-34. The MSH3 splice modulator construct of embodiment 16, wherein the at least one antisense RNA comprises, consists essentially of, or consists of one of SEQ ID NOs: 9, 10, 11, 13, 14, 17, 18, 27, 28, or 29; or a sequence having at least 90% identity to the one of SEQ ID NOs: 9, 10, 11, 13, 14, 17, 18, 27, 28, or 29. The MSH3 splice modulator construct of embodiment 18, wherein the at least one antisense RNA comprises, consists essentially of, or consists of one of SEQ ID NOs: 9, 10, 11, 13, 14, 27, or 28; or a sequence having at least 90% identity to the one of SEQ ID NOs: 9, 10, 11, 13, 14, 27, or 28. 21. The MSH3 splice modulator construct of embodiment 19, comprising any one of SEQ ID NOs: 42, 43, 44, 46, 47, 50, 51, 64, 65, or 66. 22. The MSH3 splice modulator construct of embodiment 18, comprising any one of SEQ ID NOs: 42, 43, 44, 46, 47, 64, or 65. 23. The MSH3 splice modulator construct of embodiment 8, comprising any one of SEQ ID NOs: 55, 56, or 74. 24. A combination of MSH3 splice modulator constructs comprising at least two of the MSH3 splice modulator constructs of embodiments 7-23, with the proviso that when the combination thereof consists of two MSH3 splice modulator constructs, the combination thereof does not consist of SEQ ID NOs: 53 and 73. 25. A vector comprising the MSH3 splice modulator construct or constructs of any one of embodiments 1-24. 26. The vector of embodiment 25, further comprising a 5’ regulatory domain. 27. The vector of embodiment 26, wherein the 5’ regulatory domain comprises a constitutive promoter or a tissue specific promoter. 28. The vector of embodiment 27, wherein the constitutive promoter is a CMV promoter or a CAGGS promoter. 29. A proviral plasmid comprising the MSH3 splice modulator construct or constructs of any one of embodiments 1-24. 30. An adeno-associated virus (AAV) comprising the MSH3 splice modulator construct or constructs of any one of embodiments 1-24. 31. The AAV of embodiment 30, further comprising a 5’ regulatory domain. 32. The AAV of any one of embodiments 31, wherein the 5’ regulatory domain comprises a constitutive promoter or a tissue specific promoter. 33. The AAV of embodiment 32, wherein the constitutive promoter is a CMV promoter or a CAGGS promoter. The AAV of any one of embodiments 30-33, wherein the AAV exhibits neuronal tropism. The AAV of any one of embodiments 30-34, wherein the AAV is AAV9, AAV8, AAV5, AAV2, AAV7, or AAV2.7m8, AAV-retro, AAV1, AAV4, or AAV-PHP.eB. A composition comprising the MSH3 splice modulator construct or constructs of any one of embodiments 1-24; the vector of any one of embodiments 25-28; the proviral plasmid of embodiment 29; or the AAV of any one of embodiments 30-35. he composition of embodiment 36, comprising a pharmaceutically acceptable excipient. A method of reducing expression of MSH3 in a target cell, the method comprising transfecting or transducing the target cell with the MSH3 splice modulator construct or constructs of any one of embodiments 1-24; the vector of any one of embodiments 25-28; the proviral plasmid of embodiment 29; or the AAV of any one of embodiments 30-35. The method of embodiment 38, wherein the expression of MSH3 in a target cell is reduced by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% relative to expression of MSH3 in a target cell that expresses wildtype levels of MSH3. The method of embodiment 38, wherein the expression of MSH3 in a target cell is reduced by about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, or about 50% relative to expression of MSH3 in a target cell that expresses wildtype levels of MSH3. A method of delaying or inhibiting nucleotide repeat expansion in a gene of a target cell, the method comprising transfecting or transducing the target cell with the MSH3 splice modulator construct or constructs of any one of embodiments 1-24; the vector of any one of embodiments 25-28; the proviral plasmid of embodiment 29; or the AAV of any one of embodiments 30-35. A method of treating nucleotide repeat expansion disorder in a subject in need thereof, the method comprising administering to the subject the MSH3 splice modulator construct or constructs of any one of embodiments 1-24; the vector of any one of embodiments 25-28; the proviral plasmid of embodiment 29; the AAV of any one of embodiments 30-35; or the composition of any one of embodiments 36-37 in a therapeutically effective amount. The method of claim 42, wherein the nucleotide repeat expansion disorder is Huntington’s disease, myotonic dystrophy 1, myotonic dystrophy 2, Fuchs endothelial corneal dystrophy, fragile X syndrome, Friedreich ataxia, C9orf72 ALS / FTD, SCA1, SCA2, SCA3, SCA6, SCA7, SCA8, SCA10, SCA17, SCA31, or spinal and bulbar muscular atrophy. The method of claim 42 or 43, wherein the subject has been diagnosed as having or as being at risk of developing myotonic dystrophy 1, myotonic dystrophy 2, Fuchs endothelial corneal dystrophy, fragile X syndrome, Friedreich ataxia, C9orf72 ALS / FTD, SCA1, SCA2, SCA3, SCA6, SCA7, SCA8, SCA10, SCA17, SCA31, or spinal and bulbar muscular atrophy. A method of treating Huntington’s disease in a subject in need thereof, the method comprising administering to the subject the MSH3 splice modulator construct or constructs of any one of embodiments 1-24; the vector of any one of embodiments 25-28; the proviral plasmid of embodiment 29; the AAV of any one of embodiments 30-35; or the composition of any one of embodiments 36-37 in a therapeutically effective amount. The method of any one of embodiments 42-45, the method comprising administration of the MSH3 splice modulator construct or constructs of any one of embodiments 1-24; the vector of any one of embodiments 25-28; the proviral plasmid of embodiment 29; the AAV of any one of embodiments 30-35; or the composition of any one of embodiments 36-37, indirectly or directly to the subject’s brain, nervous system, cardiac muscle, skeletal muscle, smooth muscle, or eye. The method of any one of embodiments 42-46, wherein the subject is a mammal, preferentially a rodent, non-human primate, or a human. The method of any one of embodiments 42-47, wherein the subject is genetically predisposed to have HD or has been diagnosed with HD. The MSH3 splice modulator construct or constructs of any one of embodiments 1-24; the vector of any one of embodiments 25-28; the proviral plasmid of embodiment 29; the AAV of any one of embodiments 30-35; or the composition of any one of embodiments 36-37 for use in preventing or treating HD in a subject in need thereof. The MSH3 splice modulator construct or constructs of any one of embodiments 1-24; the vector of any one of embodiments 25-28; the proviral plasmid of embodiment 29; the AAV of any one of embodiments 30-35; or the composition of any one of embodiments 36-37 for use in the preparation of a medicament for the treatment or prevention of HD in a subject in need thereof. 51. An MSH3 splice modulator construct comprising, operatively linked: (a) a sequence encoding at least one antisense RNA that promotes exon skipping of a target exon of MSH3 pre-mRNA, wherein the target exon is any one of MSH3 exon 7 or MSH3 exon 15, or a combination thereof, wherein the at least one antisense RNA targets an exon sequence of either of MSH3 exon 7 or MSH3 exon 15; and (b) a sequence encoding a small nuclear RNA (snRNA) sequence. Group II Numbered Embodiments: 1. An MSH3 splice modulator construct comprising, operatively linked: (a) a sequence encoding a first antisense RNA sequence that targets a target exon of MSH3 pre-mRNA, wherein the target exon is MSH3 exon 7 or MSH3 exon 15, and wherein the target exon comprises a 5’ exon-intron junction, an exon sequence, and a 3’ exon-intron junction, and (i) wherein the first antisense RNA targets a sequence that is entirely encompassed by the exon sequence; or (ii) wherein the first antisense RNA sequence comprises or consists of any one of SEQ ID NOs: 5, 6, 14-16, 20, 21, or 30-32 or a sequence having at least 90% identity to any one of SEQ ID NOs: 5, 6, 14-16, 20, 21, or 30-32; or (iii) wherein the first antisense RNA sequence comprises or consists of any one of SEQ ID NOs: 7, 13, 22, or 29 or a sequence having at least 90% identity to any one of SEQ ID NOs: 7, 13, 22, or 29, wherein the first antisense RNA sequence does not comprise any one of SEQ ID NOs: 17, 18, 33 or 34, or a sequence having at least 90% identity to any one of SEQ ID NOs: 17, 18, 33, or 34; and (b) a sequence encoding a small nuclear RNA (snRNA) sequence configured to promote exon skipping of the target exon. 2. The MSH3 splice modulator construct of embodiment 1, wherein the first antisense RNA targets a sequence that is entirely encompassed by the exon sequence, and wherein the first antisense RNA sequence comprises or consists of any one of SEQ ID NOs: 8-12 or 23-28 or a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 8- 12 or 23-28. 3. The MSH3 splice modulator construct of embodiment 1, wherein the first antisense RNA comprises or consists of a sequence having 100% identity to (a) 12-18 consecutive nucleotides of any one of SEQ ID NOs: 5, 9-11, 15, 16, 20, 24-27, 31, or 32; (b) a sequence having 100% identity to 12-18 consecutive nucleotides of SEQ ID NO: 8, 14, 23, or 30 wherein the 5’ end of SEQ ID NO: 8, 14, 23, or 30 is included in the 12-18 consecutive nucleotides; or (c) a sequence having 100% identity to 12-18 consecutive nucleotides of SEQ ID NO: 6, 12, 21, or 28, wherein the 3’ end of SEQ ID NO: 6, 12, 21, or 28 is included in the 12-18 consecutive nucleotides. 4. The MSH3 splice modulator construct of embodiment 3, wherein the first antisense RNA is at least 24 nucleotides in length. 5. The MSH3 splice modulator construct of any one of embodiments 1 to 4, further comprising a sequence encoding a second antisense RNA sequence that targets MSH3 exon 7 or MSH3 exon 15. 6. The MSH3 splice modulator construct of embodiment 5, wherein the second antisense RNA sequence comprises or consists of any one of SEQ ID NOs: 5-34 or a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 5-34. 7. The MSH3 splice modulator construct of any one of embodiments 1 to 6, wherein the first antisense RNA sequence consists of any one of SEQ ID NOs: 5-16 or 20-32 or a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 5-16 or 20- 32. 8. The MSH3 splice modulator construct of any one of embodiments 5 to 7, wherein the second antisense RNA sequence consists of any one of SEQ ID NOs: 5-34 or a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 5-34. 9. The MSH3 splice modulator construct of any one of embodiments 5 to 8, wherein the sequence encoding the first antisense RNA sequence is 5’ to the sequence encoding the second antisense RNA sequence. 10. The MSH3 splice modulator construct of any one of embodiments 5 to 9, further comprising a sequence encoding a linker between the first antisense RNA sequence and the second antisense RNA sequence. 11. The MSH3 splice modulator construct of any one of embodiments 5 to 9, wherein the MSH3 splice modulator construct does not include a sequence encoding a linker between the first antisense RNA sequence and the second antisense RNA sequence. 12. The MSH3 splice modulator construct of any one of embodiments 5 to 11, wherein the first antisense RNA sequence comprises or consists of SEQ ID NO: 7 or a sequence having at least 90% sequence identity to SEQ ID NO: 7, and wherein the second antisense RNA sequence comprises or consists of SEQ ID NO: 13 or a sequence having at least 90% identity to SEQ ID NO: 13. 13. The MSH3 splice modulator construct of any one of embodiments 5 to 11, wherein the first antisense RNA sequence comprises or consists of SEQ ID NO: 22 or a sequence having at least 90% sequence identity to SEQ ID NO: 22, and wherein the second antisense RNA sequence comprises or consists of SEQ ID NO: 29 or a sequence having at least 90% identity to SEQ ID NO: 29. 14. The MSH3 splice modulator construct of any one of embodiments 1 to 13, wherein the first antisense RNA or, when present, the second antisense RNA, comprises or consists of any one of SEQ ID NOs: 9-11, 13, 14, or 27-29, or a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 9-11, 13, 14, or 27-29. 15. The MSH3 splice modulator construct of any one of embodiments 1 to 14, further comprising a U1 promoter and a U1 terminator operatively linked to the first antisense RNA sequence, the sequence encoding the snRNA sequence, and, when present, the second antisense RNA sequence. 16. The MSH3 splice modulator construct of any one of embodiments 1 to 15, wherein the snRNA is a modified snRNA. 17. The MSH3 splice modulator construct of embodiment 16, wherein the modified snRNA comprises a U7 Sm OPT sequence or a U2 snRNA sequence. 18. The MSH3 splice modulator construct of any one of embodiments 1 or 15 to 17, comprising any one of SEQ ID NOs: 38-49, 55-69, 75, or 76 or a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 38-49, 55-69, 75, or 76. 19. The MSH3 splice modulator construct of any one of embodiments 1 or 15 to 17, comprising any one of SEQ ID NOs: 42-44, 46, 47, 55, 56, or 64-66. 20. An MSH3 splice modulator construct comprising, operatively linked: (a) a sequence encoding a first antisense RNA sequence, wherein the first antisense RNA sequence comprises any one of SEQ ID NOs: 17, 18, 33, or 34 or a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 17, 18, 33 or 34; (b) a sequence encoding a second antisense RNA sequence, wherein the second antisense RNA sequence comprises any one of SEQ ID NOs: 17, 18, 33, or 34 or a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 17, 18, 33 or 34; and (c) a sequence encoding a small nuclear RNA (snRNA) sequence configured to promote exon skipping of a target exon; wherein the splice modulator construct does not include a sequence encoding a linker between the first antisense RNA sequence and the second antisense RNA sequence. 21. The MSH3 splice modulator construct of embodiment 20, further comprising a U1 promoter and a U1 terminator operatively linked to the first antisense RNA sequence, the sequence encoding the snRNA sequence, and the second antisense RNA sequence. 22. The MSH3 splice modulator construct of embodiment 20 or 21, wherein the snRNA is a modified snRNA. 23. The MSH3 splice modulator construct of embodiment 22, wherein the modified snRNA comprises a U7 Sm OPT sequence or a U2 snRNA sequence. 24. The MSH3 splice modulator construct of any one of embodiments 20 to 23, wherein the first antisense RNA sequence comprises SEQ ID NO: 17 or a sequence having at least 90% sequence identity to SEQ ID NO: 17 and wherein the second antisense RNA sequence comprises SEQ ID NO: 18 or a sequence having at least 90% sequence identity to SEQ ID NO: 18. 25. The MSH3 splice modulator construct of embodiment 24, comprising SEQ ID NO: 54 or a sequence having at least 90% sequence identity to SEQ ID NO: 54. 26. The MSH3 splice modulator construct of any one of embodiments 20 to 23, wherein the first antisense RNA sequence comprises SEQ ID NO: 33 or a sequence having at least 90% sequence identity to SEQ ID NO: 33 and wherein the second antisense RNA sequence comprises SEQ ID NO: 34 or a sequence having at least 90% sequence identity to SEQ ID NO: 34. 27. The MSH3 splice modulator construct of embodiment 24, comprising SEQ ID NO: 74 or a sequence having at least 90% sequence identity to SEQ ID NO: 74. 28. An MSH3 splice modulator construct comprising any two or more of the MSH3 splice modulator constructs of embodiments 1 to 27 combined on a single polynucleotide molecule. 29. A composition comprising any two or more of the MSH3 splice modulator constructs of embodiments 1 to 27. 30. A composition comprising an RNA molecule encoded by the MSH3 splice modulator construct of any one of embodiments 1 to 28. 31. A vector comprising the MSH3 splice modulator construct of any one of embodiments 1- 28. 32. The vector of embodiment 31, further comprising a 5’ regulatory domain. 33. The vector of embodiment 32, wherein the 5’ regulatory domain comprises a constitutive promoter or a tissue specific promoter. 34. The vector of embodiment 33, wherein the constitutive promoter is a CMV promoter or a CAGGS promoter. 35. A proviral plasmid comprising the MSH3 splice modulator construct of any one of embodiments 1-28. 36. An adeno-associated virus (AAV) comprising the MSH3 splice modulator construct of any one of embodiments 1-28. 37. The AAV of embodiment 36, further comprising a 5’ regulatory domain. 38. The AAV of embodiment 37, wherein the 5’ regulatory domain comprises a constitutive promoter or a tissue specific promoter. 39. The AAV of embodiment 38, wherein the constitutive promoter is a CMV promoter or a CAGGS promoter. The AAV of any one of embodiments 36 to 39, wherein the AAV exhibits neuronal tropism. The AAV of any one of embodiments 36 to 40, wherein the AAV is AAV9, AAV8, AAV5, AAV2, AAV7, or AAV2.7m8, AAV-retro, AAV1, AAV4, or AAV-PHP.eB. A composition comprising the MSH3 splice modulator construct of any one of embodiments 1 to 28, the vector of any one of embodiments 31 to 34, the proviral plasmid of embodiment 35, or the AAV of any one of embodiments 36 to 41. The composition of embodiment 42, comprising a pharmaceutically acceptable excipient. A method of reducing expression of MSH3 in a target cell, the method comprising transfecting or transducing the target cell with the MSH3 splice modulator construct or constructs of any one of embodiments 1 to 28, the vector of any one of embodiments 31 to 34, the proviral plasmid of embodiment 35, or the AAV of any one of embodiments 36 to 41. The method of embodiment 44, wherein the expression of MSH3 in a target cell is reduced by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% relative to expression of MSH3 in a target cell that expresses wildtype levels of MSH3. The method of embodiment 44, wherein the expression of MSH3 in a target cell is reduced by about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, or about 50% relative to expression of MSH3 in a target cell that expresses wildtype levels of MSH3. The method of any one of embodiments 44 to 46, wherein the target cell is a brain cell, a motor neuron, a cardiac muscle cell, a smooth muscle cell, a skeletal muscle cell, or a corneal endothelial cell. A method of delaying or inhibiting nucleotide repeat expansion in a gene of a target cell, the method comprising transfecting or transducing the target cell with the MSH3 splice modulator construct of any one of embodiments 1 to 28, the vector of any one of embodiments 31 to 34, the proviral plasmid of embodiment 35, or the AAV of any one of embodiments 36 to 41. 49. The method of 48, wherein the target cell is a brain cell, a motor neuron, a cardiac muscle cell, a smooth muscle cell, a skeletal muscle cell, or a corneal endothelial cell. 50. A method of delaying or inhibiting nucleotide repeat expansion in a subject, the method comprising administering to the subject the MSH3 splice modulator construct of any one of embodiments 1 to 28, the vector of any one of embodiments 31 to 34, the proviral plasmid of embodiment 35, or the AAV of any one of embodiments 36 to 41. 51. The method of embodiment 50, wherein the subject has Huntington’s disease, myotonic dystrophy 1, myotonic dystrophy 2, Fuchs endothelial corneal dystrophy, fragile X syndrome, Friedreich ataxia, C9orf72 ALS / FTD, SCA1, SCA2, SCA3, SCA6, SCA7, SCA8, SCA10, SCA17, SCA31, or spinal and bulbar muscular atrophy or wherein the subject has been diagnosed as being at risk for Huntington’s disease, myotonic dystrophy 1, myotonic dystrophy 2, Fuchs endothelial corneal dystrophy, fragile X syndrome, Friedreich ataxia, C9orf72 ALS / FTD, SCA1, SCA2, SCA3, SCA6, SCA7, SCA8, SCA10, SCA17, SCA31, or spinal and bulbar muscular atrophy. 52. The method of embodiment 50 or 51, wherein the administering comprises contacting a neural, endothelial cell, or muscle cell of the subject with the MSH3 splice modulator construct of any one of embodiments 1 to 28, the vector of any one of embodiments 31 to 34, the proviral plasmid of embodiment 35, or the AAV of any one of embodiments 36 to 41. 53. A method of treating a repeat expansion disorder in a subject in need thereof, the method comprising administering to the subject the MSH3 splice modulator construct of any one of embodiments 1 to 28, the vector of any one of embodiments 31 to 34, the proviral plasmid of embodiment 35, the AAV of any one of embodiments 36 to 41, or the composition of embodiment 42 or 43 in a therapeutically effective amount. 54. The method of embodiment 53, wherein the trinucleotide repeat expansion disorder is Huntington’s disease, myotonic dystrophy 1, myotonic dystrophy 2, Fuchs endothelial corneal dystrophy, fragile X syndrome, Friedreich ataxia, C9orf72 ALS / FTD, SCA1, SCA2, SCA3, SCA6, SCA7, SCA8, SCA10, SCA17, SCA31, or spinal and bulbar muscular atrophy. 55. A method of treating Huntington’s disease in a subject in need thereof, the method comprising administering to the subject the MSH3 splice modulator construct of any one of embodiments 1 to 28, the vector of any one of embodiments 31 to 34, the proviral plasmid of embodiment 35, the AAV of any one of embodiments 36 to 41, or the composition of embodiment 42 or 43 in a therapeutically effective amount. 56. The method of any one of embodiments 50 to 55, the method comprising administration of the MSH3 splice modulator construct of any one of embodiments 1 to 28, the vector of any one of embodiments 31 to 34, the proviral plasmid of embodiment 35, the AAV of any one of embodiments 36 to 41, or the composition of embodiment 42 or 43 to the subject’s brain, cardiac muscle, skeletal muscle, or eye. 57. The method of any one of embodiments 50 to 56, wherein the subject is a mammal, preferentially a rodent, non-human primate, or a human. 58. The method of any one of embodiments 50 to 57, wherein the subject is genetically predisposed to have HD or has been diagnosed with HD. 59. The MSH3 splice modulator construct of any one of embodiments 1 to 28, the vector of any one of embodiments 31 to 34, the proviral plasmid of embodiment 35, the AAV of any one of embodiments 36 to 41, or the composition of embodiment 42 or 43, for use in preventing or treating HD, myotonic dystrophy 1, myotonic dystrophy 2, Fuchs endothelial corneal dystrophy, fragile X syndrome, Friedreich ataxia, C9orf72 ALS / FTD, SCA1, SCA2, SCA3, SCA6, SCA7, SCA8, SCA10, SCA17, SCA31, or spinal and bulbar muscular atrophy in a subject in need thereof. 60. The MSH3 splice modulator construct of any one of embodiments 1 to 28, the vector of any one of embodiments 31 to 34, the proviral plasmid of embodiment 35, the AAV of any one of embodiments 36 to 41, or the composition of embodiment 42 or 43 for use in the preparation of a medicament for the treatment or prevention of HD, myotonic dystrophy 1, myotonic dystrophy 2, Fuchs endothelial corneal dystrophy, fragile X syndrome, Friedreich ataxia, C9orf72 ALS / FTD, SCA1, SCA2, SCA3, SCA6, SCA7, SCA8, SCA10, SCA17, SCA31, or spinal and bulbar muscular atrophy in a subject in need thereof. Group III Numbered Embodiments: 1. An MSH3 splice modulator DNA construct comprising, operatively linked: (a) a first DNA sequence encoding a first antisense RNA that targets: (i) an exon sequence of a target exon of MSH3 pre-mRNA; (ii) an intron sequence flanking a target exon of MSH3 pre-mRNA; or (iii) an exon-intron junction sequence of a target exon of MSH3 pre-mRNA; wherein the target exon is MSH3 exon 7 or MSH3 exon 15; and (b) a second DNA sequence encoding a small nuclear RNA (snRNA) sequence. 2. The MSH3 splice modulator DNA construct of embodiment 1, wherein the target exon is MSH3 exon 7. 3. The MSH3 splice modulator DNA construct of embodiment 2, wherein the first antisense RNA targets an exon sequence of MSH3 exon 7. 4. The MSH3 splice modulator DNA construct of embodiment 3, wherein the first antisense RNA targets a sequence comprising at least 15 consecutive nucleotides within SEQ ID NO: 96. 5. The MSH3 splice modulator DNA construct of embodiment 3, wherein the first antisense RNA targets a sequence comprising at least 20 consecutive nucleotides within SEQ ID NO: 96. 6. The MSH3 splice modulator DNA construct of embodiment 3, wherein the first antisense RNA targets a sequence comprising at least 24 consecutive nucleotides within SEQ ID NO: 96. 7. The MSH3 splice modulator DNA construct of embodiment 3, wherein the first antisense RNA targets a sequence comprising at least 36 consecutive nucleotides within SEQ ID NO: 96. 8. The MSH3 splice modulator DNA construct of embodiment 3, wherein the first antisense RNA targets an MSH3 pre-mRNA sequence that is the reverse complement of SEQ ID NO: 8. 9. The MSH3 splice modulator DNA construct of embodiment 3, wherein the first antisense RNA targets an MSH3 pre-mRNA sequence that is the reverse complement of SEQ ID NO: 9. 10. The MSH3 splice modulator DNA construct of embodiment 3, wherein the first antisense RNA targets an MSH3 pre-mRNA sequence that is the reverse complement of SEQ ID NO: 10. 11. The MSH3 splice modulator DNA construct of embodiment 3, wherein the first antisense RNA targets an MSH3 pre-mRNA sequence that is the reverse complement of SEQ ID NO: 11. 12. The MSH3 splice modulator DNA construct of embodiment 3, wherein the first antisense RNA targets an MSH3 pre-mRNA sequence that is the reverse complement of SEQ ID NO: 12. 13. The MSH3 splice modulator DNA construct of any one of embodiments 8 to 12, wherein the first antisense RNA is not complementary to an MSH3 intron 6 sequence. 14. The MSH3 splice modulator DNA construct of any one of embodiments 8 to 13, wherein the first antisense RNA is not complementary to an MSH3 intron 7 sequence. 15. The MSH3 splice modulator DNA construct of embodiment 3, wherein the first antisense RNA comprises a sequence having at least 90% sequence identity to SEQ ID NO: 8 (with U substituted for T). 16. The MSH3 splice modulator DNA construct of embodiment 15, wherein the first antisense RNA comprises a sequence having at least 96% sequence identity to SEQ ID NO: 8 (with U substituted for T). 17. The MSH3 splice modulator DNA construct of embodiment 15, wherein the first antisense RNA comprises SEQ ID NO: 8 (with U substituted for T). 18. The MSH3 splice modulator DNA construct of embodiment 3, wherein the first antisense RNA comprises a sequence having at least 90% sequence identity to SEQ ID NO: 9 (with U substituted for T). 19. The MSH3 splice modulator DNA construct of embodiment 18, wherein the first antisense RNA comprises a sequence having at least 96% sequence identity to SEQ ID NO: 9 (with U substituted for T). 20. The MSH3 splice modulator DNA construct of embodiment 18, wherein the first antisense RNA comprises SEQ ID NO: 9 (with U substituted for T). 21. The MSH3 splice modulator DNA construct of embodiment 3, wherein the first antisense RNA comprises a sequence having at least 90% sequence identity to SEQ ID NO: 10 (with U substituted for T). 22. The MSH3 splice modulator DNA construct of embodiment 21, wherein the first antisense RNA comprises a sequence having at least 96% sequence identity to SEQ ID NO: 10 (with U substituted for T). 23. The MSH3 splice modulator DNA construct of embodiment 21, wherein the first antisense RNA comprises SEQ ID NO: 10 (with U substituted for T). 24. The MSH3 splice modulator DNA construct of embodiment 3, wherein the first antisense RNA comprises a sequence having at least 90% sequence identity to SEQ ID NO: 11 (with U substituted for T). 25. The MSH3 splice modulator DNA construct of embodiment 24, wherein the first antisense RNA comprises a sequence having at least 96% sequence identity to SEQ ID NO: 11 (with U substituted for T). 26. The MSH3 splice modulator DNA construct of embodiment 24, wherein the first antisense RNA comprises SEQ ID NO: 11 (with U substituted for T). 27. The MSH3 splice modulator DNA construct of embodiment 3, wherein the first antisense RNA comprises a sequence having at least 90% sequence identity to SEQ ID NO: 12 (with U substituted for T). 28. The MSH3 splice modulator DNA construct of embodiment 27, wherein the first antisense RNA comprises a sequence having at least 96% sequence identity to SEQ ID NO: 12 (with U substituted for T). 29. The MSH3 splice modulator DNA construct of embodiment 27, wherein the first antisense RNA comprises SEQ ID NO: 12 (with U substituted for T). 30. The MSH3 splice modulator DNA construct of embodiment 2, wherein the first antisense RNA targets an intron sequence flanking exon 7 of MSH3 pre-mRNA. 31. The MSH3 splice modulator DNA construct of embodiment 30, wherein the first antisense RNA targets an intron 6 sequence of MSH3 pre-mRNA. 32. The MSH3 splice modulator DNA construct of embodiment 31, wherein the first antisense RNA targets a sequence comprising at least 15 consecutive amino acids within SEQ ID NO: 100. 33. The MSH3 splice modulator DNA construct of embodiment 31, wherein the first antisense RNA targets a sequence comprising at least 20 consecutive amino acids within SEQ ID NO: 100. 34. The MSH3 splice modulator DNA construct of embodiment 31, wherein the first antisense RNA targets a sequence comprising at least 24 consecutive amino acids within SEQ ID NO: 100. 35. The MSH3 splice modulator DNA construct of embodiment 31, wherein the first antisense RNA targets a sequence comprising at least 36 consecutive amino acids within SEQ ID NO: 100. 36. The MSH3 splice modulator DNA construct of embodiment 31, wherein the first antisense RNA targets an MSH3 pre-mRNA sequence that is the reverse complement of SEQ ID NO: 5. 37. The MSH3 splice modulator DNA construct of embodiment 31, wherein the first antisense RNA targets an MSH3 pre-mRNA sequence that is the reverse complement of SEQ ID NO: 6. 38. The MSH3 splice modulator DNA construct of embodiment 31, wherein the first antisense RNA targets an MSH3 pre-mRNA sequence that is the reverse complement of SEQ ID NO: 16. 39. The MSH3 splice modulator DNA construct of any one of embodiments 31 to 38, wherein the first antisense RNA is not complementary to an MSH3 exon 7 sequence. 40. The MSH3 splice modulator DNA construct of embodiment 31, wherein the first antisense RNA comprises a sequence having at least 90% sequence identity to SEQ ID NO: 5 (with U substituted for T). 41. The MSH3 splice modulator DNA construct of embodiment 40, wherein the first antisense RNA comprises a sequence having at least 96% sequence identity to SEQ ID NO: 5 (with U substituted for T). 42. The MSH3 splice modulator DNA construct of embodiment 40, wherein the first antisense RNA comprises SEQ ID NO: 5 (with U substituted for T). 43. The MSH3 splice modulator DNA construct of embodiment 31, wherein the first antisense RNA comprises a sequence having at least 90% sequence identity to SEQ ID NO: 6 (with U substituted for T). 44. The MSH3 splice modulator DNA construct of embodiment 43, wherein the first antisense RNA comprises a sequence having at least 96% sequence identity to SEQ ID NO: 6 (with U substituted for T). 45. The MSH3 splice modulator DNA construct of embodiment 43, wherein the first antisense RNA comprises SEQ ID NO: 6 (with U substituted for T). 46. The MSH3 splice modulator DNA construct of embodiment 31, wherein the first antisense RNA comprises a sequence having at least 94% sequence identity to SEQ ID NO: 16 (with U substituted for T). 47. The MSH3 splice modulator DNA construct of embodiment 46, wherein the first antisense RNA comprises a sequence having at least 97% sequence identity to SEQ ID NO: 16 (with U substituted for T). 48. The MSH3 splice modulator DNA construct of embodiment 46, wherein the first antisense RNA comprises SEQ ID NO: 16 (with U substituted for T). 49. The MSH3 splice modulator DNA construct of embodiment 30, wherein the first antisense RNA targets an intron 7 sequence of MSH3 pre-mRNA. 50. The MSH3 splice modulator DNA construct of embodiment 49, wherein the first antisense RNA targets a sequence comprising at least 15 consecutive amino acids within SEQ ID NO: 101. 51. The MSH3 splice modulator DNA construct of embodiment 49, wherein the first antisense RNA targets a sequence comprising at least 20 consecutive amino acids within SEQ ID NO: 101. 52. The MSH3 splice modulator DNA construct of embodiment 49, wherein the first antisense RNA targets a sequence comprising at least 24 consecutive amino acids within SEQ ID NO: 101. 53. The MSH3 splice modulator DNA construct of embodiment 49, wherein the first antisense RNA targets a sequence comprising at least 36 consecutive amino acids within SEQ ID NO: 101. 54. The MSH3 splice modulator DNA construct of embodiment 49, wherein the first antisense RNA targets an MSH3 pre-mRNA sequence that is the reverse complement of SEQ ID NO: 14. 55. The MSH3 splice modulator DNA construct of embodiment 49, wherein the first antisense RNA targets an MSH3 pre-mRNA sequence that is the reverse complement of SEQ ID NO: 15. 56. The MSH3 splice modulator DNA construct of any one of embodiments 49 to 55, wherein the first antisense RNA is not complementary to an MSH3 exon 7 sequence. 57. The MSH3 splice modulator DNA construct of embodiment 49, wherein the first antisense RNA comprises a sequence having at least 90% sequence identity to SEQ ID NO: 14 (with U substituted for T). 58. The MSH3 splice modulator DNA construct of embodiment 57, wherein the first antisense RNA comprises a sequence having at least 96% sequence identity to SEQ ID NO: 14 (with U substituted for T). 59. The MSH3 splice modulator DNA construct of embodiment 57, wherein the first antisense RNA comprises SEQ ID NO: 14 (with U substituted for T). 60. The MSH3 splice modulator DNA construct of embodiment 49, wherein the first antisense RNA comprises a sequence having at least 90% sequence identity to SEQ ID NO: 15 (with U substituted for T). 61. The MSH3 splice modulator DNA construct of embodiment 60, wherein the first antisense RNA comprises a sequence having at least 96% sequence identity to SEQ ID NO: 15 (with U substituted for T). 62. The MSH3 splice modulator DNA construct of embodiment 60, wherein the first antisense RNA comprises SEQ ID NO: 15 (with U substituted for T). 63. The MSH3 splice modulator DNA construct of embodiment 2, wherein the first antisense RNA targets an exon-intron junction sequence of MSH3 pre-mRNA. 64. The MSH3 splice modulator DNA construct of embodiment 63, wherein the first antisense RNA targets a sequence that includes the intron 6 – exon 7 junction of MSH3 pre-mRNA. 65. The MSH3 splice modulator DNA construct of embodiment 64, wherein the first antisense RNA targets a sequence comprising at least 15 consecutive amino acids within SEQ ID NO: 98. 66. The MSH3 splice modulator DNA construct of embodiment 64, wherein the first antisense RNA targets a sequence comprising at least 20 consecutive amino acids within SEQ ID NO: 98. 67. The MSH3 splice modulator DNA construct of embodiment 64, wherein the first antisense RNA targets a sequence comprising at least 24 consecutive amino acids within SEQ ID NO: 98. 68. The MSH3 splice modulator DNA construct of embodiment 64, wherein the first antisense RNA targets a sequence comprising at least 36 consecutive amino acids within SEQ ID NO: 98. 69. The MSH3 splice modulator DNA construct of embodiment 64, wherein the first antisense RNA targets an MSH3 pre-mRNA sequence that is the reverse complement of SEQ ID NO: 7. 70. The MSH3 splice modulator DNA construct of embodiment 64, wherein the first antisense RNA targets an MSH3 pre-mRNA sequence that is the reverse complement of SEQ ID NO: 17. 71. The MSH3 splice modulator DNA construct of embodiment 64, wherein the first antisense RNA comprises a sequence having at least 90% sequence identity to SEQ ID NO: 7 (with U substituted for T). 72. The MSH3 splice modulator DNA construct of embodiment 71, wherein the first antisense RNA comprises a sequence having at least 96% sequence identity to SEQ ID NO: 7 (with U substituted for T). 73. The MSH3 splice modulator DNA construct of embodiment 71, wherein the first antisense RNA comprises SEQ ID NO: 7 (with U substituted for T). 74. The MSH3 splice modulator DNA construct of any one of embodiments 63 to 73, wherein the first antisense RNA does not comprise or consist of SEQ ID NO: 17 (with U substituted for T) or a sequence having at least 90% sequence identity to SEQ ID NO: 17 (with U substituted for T). 75. The MSH3 splice modulator DNA construct of embodiment 64, wherein the first antisense RNA is 32 nucleotides or less and comprises a sequence having at least 96% sequence identity to SEQ ID NO: 7 (with U substituted for T). 76. The MSH3 splice modulator DNA construct of embodiment 64, wherein the first antisense RNA is 32 nucleotides or less and comprises SEQ ID NO: 7 (with U substituted for T). 77. The MSH3 splice modulator DNA construct of embodiment 64, wherein the first antisense RNA consists of SEQ ID NO: 7 (with U substituted for T). 78. The MSH3 splice modulator DNA construct of embodiment 63, wherein the first antisense RNA targets a sequence that includes the exon 7 – intron 7 junction of MSH3 pre-mRNA. 79. The MSH3 splice modulator DNA construct of embodiment 78, wherein the first antisense RNA targets a sequence comprising at least 15 consecutive amino acids within SEQ ID NO: 99. 80. The MSH3 splice modulator DNA construct of embodiment 78, wherein the first antisense RNA targets a sequence comprising at least 20 consecutive amino acids within SEQ ID NO: 99 81. The MSH3 splice modulator DNA construct of embodiment 78, wherein the first antisense RNA targets a sequence comprising at least 24 consecutive amino acids within SEQ ID NO: 99. 82. The MSH3 splice modulator DNA construct of embodiment 78, wherein the first antisense RNA targets a sequence comprising at least 36 consecutive amino acids within SEQ ID NO: 99. 83. The MSH3 splice modulator DNA construct of embodiment 78, wherein the first antisense RNA targets an MSH3 pre-mRNA sequence that is the reverse complement of SEQ ID NO: 13. 84. The MSH3 splice modulator DNA construct of embodiment 78, wherein the first antisense RNA targets an MSH3 pre-mRNA sequence that is the reverse complement of SEQ ID NO: 18. 85. The MSH3 splice modulator DNA construct of embodiment 78, wherein the first antisense RNA comprises a sequence having at least 90% sequence identity to SEQ ID NO: 13 (with U substituted for T). 86. The MSH3 splice modulator DNA construct of embodiment 86, wherein the first antisense RNA comprises a sequence having at least 96% sequence identity to SEQ ID NO: 13 (with U substituted for T). 87. The MSH3 splice modulator DNA construct of embodiment 86, wherein the first antisense RNA comprises SEQ ID NO: 13 (with U substituted for T). 88. The MSH3 splice modulator DNA construct of any one of embodiments 78 to 87, wherein the first antisense RNA does not comprise or consist of SEQ ID NO: 18 (with U substituted for T) or a sequence having at least 90% sequence identity to SEQ ID NO: 18 (with U substituted for T). 89. The MSH3 splice modulator DNA construct of embodiment 78, wherein the first antisense RNA is 32 nucleotides or less and comprises a sequence having at least 96% sequence identity SEQ ID NO: 13 (with U substituted for T). 90. The MSH3 splice modulator DNA construct of embodiment 78, wherein the first antisense RNA is 32 nucleotides or less and comprises SEQ ID NO: 13 (with U substituted for T). 91. The MSH3 splice modulator DNA construct of embodiment 78, wherein the first antisense RNA consists of SEQ ID NO: 13 (with U substituted for T). 92. The MSH3 splice modulator DNA construct of any one of embodiments 64 to 77, which further comprises a third DNA sequence encoding a second antisense RNA operatively linked to the first antisense RNA, wherein the second antisense RNA targets an exon 7 – intron 7 junction of MSH3 pre-mRNA. 93. The MSH3 splice modulator DNA construct of embodiment 92, wherein the second antisense RNA targets a sequence comprising at least 15 consecutive amino acids within SEQ ID NO: 99. 94. The MSH3 splice modulator DNA construct of embodiment 92, wherein the second antisense RNA targets a sequence comprising at least 20 consecutive amino acids within SEQ ID NO: 99 95. The MSH3 splice modulator DNA construct of embodiment 92, wherein the second antisense RNA targets a sequence comprising at least 24 consecutive amino acids within SEQ ID NO: 99. 96. The MSH3 splice modulator DNA construct of embodiment 92, wherein the second antisense RNA targets a sequence comprising at least 36 consecutive amino acids within SEQ ID NO: 99. 97. The MSH3 splice modulator DNA construct of embodiment 92, wherein the second antisense RNA targets an MSH3 pre-mRNA sequence that is the reverse complement of SEQ ID NO: 13. 98. The MSH3 splice modulator DNA construct of embodiment 92, wherein the second antisense RNA targets an MSH3 pre-mRNA sequence that is the reverse complement of SEQ ID NO: 18. 99. The MSH3 splice modulator DNA construct of embodiment 92, wherein the second antisense RNA comprises a sequence having at least 90% sequence identity to SEQ ID NO: 13 (with U substituted for T). 100. The MSH3 splice modulator DNA construct of embodiment 99, wherein the second antisense RNA comprises a sequence having at least 96% sequence identity to SEQ ID NO: 13 (with U substituted for T). 101. The MSH3 splice modulator DNA construct of embodiment 99, wherein the second antisense RNA comprises SEQ ID NO: 13 (with U substituted for T). 102. The MSH3 splice modulator DNA construct of any one of embodiments 92 to 101, wherein the second antisense RNA does not comprise or consist of SEQ ID NO: 18 (with U substituted for T) or a sequence having at least 90% sequence identity to SEQ ID NO: 18 (with U substituted for T). 103. The MSH3 splice modulator DNA construct of embodiment 92, wherein the second antisense RNA is 32 nucleotides or less and comprises a sequence having at least 96% sequence identity SEQ ID NO: 13 (with U substituted for T). 104. The MSH3 splice modulator DNA construct of embodiment 92, wherein the second antisense RNA is 32 nucleotides or less and comprises SEQ ID NO: 13 (with U substituted for T). 105. The MSH3 splice modulator DNA construct of embodiment 92, wherein the second antisense RNA consists of SEQ ID NO: 13 (with U substituted for T). 106. The MSH3 splice modulator DNA construct of embodiment 92, wherein the second antisense RNA comprises a sequence having at least 90% sequence identity to SEQ ID NO: 18 (with U substituted for T). 107. The MSH3 splice modulator DNA construct of embodiment 106, wherein the second antisense RNA comprises a sequence having at least 96% sequence identity to SEQ ID NO: 18 (with U substituted for T). 108. The MSH3 splice modulator DNA construct of embodiment 106, wherein the second antisense RNA comprises SEQ ID NO: 18 (with U substituted for T). 109. The MSH3 splice modulator DNA construct of any one of embodiments 92 to 108, further comprising a sequence encoding a linker or an hnRNPA1 binding sequence between the first antisense RNA sequence and the second antisense RNA sequence. 110. The MSH splice modulator DNA construct of embodiment 109, which comprises a sequence encoding a linker between the first antisense RNA sequence and the second antisense RNA sequence. 111. The MSH3 splice modulator DNA construct of embodiment 109 or 110, wherein the linker is at least 15 nucleotides in length and equal to or less than 70% complementary to any 15 consecutive nucleotides of the MSH3 exon 7 mRNA sequence (SEQ ID NO: 96). 112. The MSH3 splice modulator DNA construct of any one of embodiments 109 to 111, wherein the linker comprises SEQ ID NO: 80. 113. The MSH3 splice modulator DNA construct of embodiment 109, which comprises an hnRNPA1 binding sequence between the first antisense RNA sequence and the second antisense RNA sequence. 114. The MSH3 splice modulator DNA construct of embodiment 113, wherein the hnRNPA1 binding sequence comprises a sequence having at least 90% identity to SEQ ID NO: 81. 115. The MSH3 splice modulator DNA construct of embodiment 114, wherein the hnRNPA1 binding sequence comprises a sequence having at least 95% identity to SEQ ID NO: 81. 116. The MSH3 splice modulator DNA construct of embodiment 114, wherein the hnRNPA1 binding sequence comprises SEQ ID NO: 81. 117. The MSH3 splice modulator DNA construct of any one of embodiments 92 to 108, which does not comprise any nucleotides between the first DNA sequence and the third DNA sequence. 118. The MSH3 splice modulator DNA construct of any one of embodiments 92 to 117, wherein the third DNA sequence is operatively linked 5’ to the first DNA sequence. 119. The MSH3 splice modulator DNA construct of embodiment 92, which comprises, operatively linked in a 5’ to 3’ orientation, SEQ ID NO: 18 and SEQ ID NO: 17, wherein the DNA construct does not comprise SEQ ID NO: 80 between SEQ ID NO: 18 and SEQ ID NO: 17. 120. The MSH3 splice modulator DNA construct of embodiment 92, which comprises, operatively linked in a 5’ to 3’ orientation, SEQ ID NO: 13 and SEQ ID NO: 7, wherein the DNA construct does not comprise both of SEQ ID NO: 18 and SEQ ID NO: 17. 121. The MSH3 splice modulator DNA construct of embodiment 1, wherein the target exon is MSH3 exon 15. 122. The MSH3 splice modulator DNA construct of embodiment 121, wherein the first antisense RNA targets an exon sequence of MSH3 exon 15. 123. The MSH3 splice modulator DNA construct of embodiment 122, wherein the first antisense RNA targets a sequence comprising at least 15 consecutive nucleotides within SEQ ID NO: 97. 124. The MSH3 splice modulator DNA construct of embodiment 122, wherein the first antisense RNA targets a sequence comprising at least 20 consecutive nucleotides within SEQ ID NO: 97. 125. The MSH3 splice modulator DNA construct of embodiment 122, wherein the first antisense RNA targets a sequence comprising at least 24 consecutive nucleotides within SEQ ID NO: 97. 126. The MSH3 splice modulator DNA construct of embodiment 122, wherein the first antisense RNA targets a sequence comprising at least 36 consecutive nucleotides within SEQ ID NO: 97. 127. The MSH3 splice modulator DNA construct of embodiment 122, wherein the first antisense RNA targets an MSH3 pre-mRNA sequence that is the reverse complement of SEQ ID NO: 23. 128. The MSH3 splice modulator DNA construct of embodiment 122, wherein the first antisense RNA targets an MSH3 pre-mRNA sequence that is the reverse complement of SEQ ID NO: 24. 129. The MSH3 splice modulator DNA construct of embodiment 122, wherein the first antisense RNA targets an MSH3 pre-mRNA sequence that is the reverse complement of SEQ ID NO: 25. 130. The MSH3 splice modulator DNA construct of embodiment 122, wherein the first antisense RNA targets an MSH3 pre-mRNA sequence that is the reverse complement of SEQ ID NO: 26. 131. The MSH3 splice modulator DNA construct of embodiment 122, wherein the first antisense RNA targets an MSH3 pre-mRNA sequence that is the reverse complement of SEQ ID NO: 27. 132. The MSH3 splice modulator DNA construct of embodiment 122, wherein the first antisense RNA targets an MSH3 pre-mRNA sequence that is the reverse complement of SEQ ID NO: 28. 133. The MSH3 splice modulator DNA construct of any one of embodiments 127 to 132, wherein the first antisense RNA is not complementary to an MSH3 intron 14 sequence. 134. The MSH3 splice modulator DNA construct of any one of embodiments 127 to 133, wherein the first antisense RNA is not complementary to an MSH3 intron 15 sequence. 135. The MSH3 splice modulator DNA construct of embodiment 122, wherein the first antisense RNA comprises a sequence having at least 90% sequence identity to SEQ ID NO: 23 (with U substituted for T). 136. The MSH3 splice modulator DNA construct of embodiment 135, wherein the first antisense RNA comprises a sequence having at least 96% sequence identity to SEQ ID NO: 23 (with U substituted for T). 137. The MSH3 splice modulator DNA construct of embodiment 135, wherein the first antisense RNA comprises SEQ ID NO: 23 (with U substituted for T). 138. The MSH3 splice modulator DNA construct of embodiment 122, wherein the first antisense RNA comprises a sequence having at least 90% sequence identity to SEQ ID NO: 24 (with U substituted for T). 139. The MSH3 splice modulator DNA construct of embodiment 138, wherein the first antisense RNA comprises a sequence having at least 96% sequence identity to SEQ ID NO: 24 (with U substituted for T). 140. The MSH3 splice modulator DNA construct of embodiment 138, wherein the first antisense RNA comprises SEQ ID NO: 24 (with U substituted for T). 141. The MSH3 splice modulator DNA construct of embodiment 122, wherein the first antisense RNA comprises a sequence having at least 90% sequence identity to SEQ ID NO: 25 (with U substituted for T). 142. The MSH3 splice modulator DNA construct of embodiment 141, wherein the first antisense RNA comprises a sequence having at least 96% sequence identity to SEQ ID NO: 25 (with U substituted for T). 143. The MSH3 splice modulator DNA construct of embodiment 141, wherein the first antisense RNA comprises SEQ ID NO: 25 (with U substituted for T). 144. The MSH3 splice modulator DNA construct of embodiment 122, wherein the first antisense RNA comprises a sequence having at least 90% sequence identity to SEQ ID NO: 26 (with U substituted for T). 145. The MSH3 splice modulator DNA construct of embodiment 144, wherein the first antisense RNA comprises a sequence having at least 96% sequence identity to SEQ ID NO: 26 (with U substituted for T). 146. The MSH3 splice modulator DNA construct of embodiment 144, wherein the first antisense RNA comprises SEQ ID NO: 26 (with U substituted for T). 147. The MSH3 splice modulator DNA construct of embodiment 122, wherein the first antisense RNA comprises a sequence having at least 90% sequence identity to SEQ ID NO: 27 (with U substituted for T). 148. The MSH3 splice modulator DNA construct of embodiment 147, wherein the first antisense RNA comprises a sequence having at least 96% sequence identity to SEQ ID NO: 27 (with U substituted for T). 149. The MSH3 splice modulator DNA construct of embodiment 147, wherein the first antisense RNA comprises SEQ ID NO: 27 (with U substituted for T). 150. The MSH3 splice modulator DNA construct of embodiment 122, wherein the first antisense RNA comprises a sequence having at least 90% sequence identity to SEQ ID NO: 28 (with U substituted for T). 151. The MSH3 splice modulator DNA construct of embodiment 150, wherein the first antisense RNA comprises a sequence having at least 96% sequence identity to SEQ ID NO: 28 (with U substituted for T). 152. The MSH3 splice modulator DNA construct of embodiment 150, wherein the first antisense RNA comprises SEQ ID NO: 28 (with U substituted for T). 153. The MSH3 splice modulator DNA construct of embodiment 2, wherein the first antisense RNA targets an intron sequence flanking exon 15 of MSH3 pre-mRNA. 154. The MSH3 splice modulator DNA construct of embodiment 153, wherein the first antisense RNA targets an intron 14 sequence of MSH3 pre-mRNA. 155. The MSH3 splice modulator DNA construct of embodiment 154, wherein the first antisense RNA targets a sequence comprising at least 15 consecutive amino acids within SEQ ID NO: 104. 156. The MSH3 splice modulator DNA construct of embodiment 154, wherein the first antisense RNA targets a sequence comprising at least 20 consecutive amino acids within SEQ ID NO: 104. 157. The MSH3 splice modulator DNA construct of embodiment 154, wherein the first antisense RNA targets a sequence comprising at least 24 consecutive amino acids within SEQ ID NO: 104. 158. The MSH3 splice modulator DNA construct of embodiment 154, wherein the first antisense RNA targets a sequence comprising at least 36 consecutive amino acids within SEQ ID NO: 104. 159. The MSH3 splice modulator DNA construct of embodiment 154, wherein the first antisense RNA targets an MSH3 pre-mRNA sequence that is the reverse complement of SEQ ID NO: 20. 160. The MSH3 splice modulator DNA construct of embodiment 154, wherein the first antisense RNA targets an MSH3 pre-mRNA sequence that is the reverse complement of SEQ ID NO: 21. 161. The MSH3 splice modulator DNA construct of embodiment 154, wherein the first antisense RNA targets an MSH3 pre-mRNA sequence that is the reverse complement of SEQ ID NO: 32. 162. The MSH3 splice modulator DNA construct of any one of embodiments 154 to 161, wherein the first antisense RNA is not complementary to an MSH3 exon 15 sequence. 163. The MSH3 splice modulator DNA construct of embodiment 154, wherein the first antisense RNA comprises a sequence having at least 90% sequence identity to SEQ ID NO: 20 (with U substituted for T). 164. The MSH3 splice modulator DNA construct of embodiment 163, wherein the first antisense RNA comprises a sequence having at least 96% sequence identity to SEQ ID NO: 20 (with U substituted for T). 165. The MSH3 splice modulator DNA construct of embodiment 163, wherein the first antisense RNA comprises SEQ ID NO: 20 (with U substituted for T). 166. The MSH3 splice modulator DNA construct of embodiment 154, wherein the first antisense RNA comprises a sequence having at least 90% sequence identity to SEQ ID NO: 21 (with U substituted for T). 167. The MSH3 splice modulator DNA construct of embodiment 166, wherein the first antisense RNA comprises a sequence having at least 96% sequence identity to SEQ ID NO: 21 (with U substituted for T). 168. The MSH3 splice modulator DNA construct of embodiment 166, wherein the first antisense RNA comprises SEQ ID NO: 21 (with U substituted for T). 169. The MSH3 splice modulator DNA construct of embodiment 154, wherein the first antisense RNA comprises a sequence having at least 95% sequence identity to SEQ ID NO: 32 (with U substituted for T). 170. The MSH3 splice modulator DNA construct of embodiment 169, wherein the first antisense RNA comprises a sequence having at least 97% sequence identity to SEQ ID NO: 32 (with U substituted for T). 171. The MSH3 splice modulator DNA construct of embodiment 169, wherein the first antisense RNA comprises SEQ ID NO: 32 (with U substituted for T). 172. The MSH3 splice modulator DNA construct of embodiment 153, wherein the first antisense RNA targets an intron 15 sequence of MSH3 pre-mRNA. 173. The MSH3 splice modulator DNA construct of embodiment 172, wherein the first antisense RNA targets a sequence comprising at least 15 consecutive amino acids within SEQ ID NO: 105. 174. The MSH3 splice modulator DNA construct of embodiment 172, wherein the first antisense RNA targets a sequence comprising at least 20 consecutive amino acids within SEQ ID NO: 105. 175. The MSH3 splice modulator DNA construct of embodiment 172, wherein the first antisense RNA targets a sequence comprising at least 24 consecutive amino acids within SEQ ID NO: 105. 176. The MSH3 splice modulator DNA construct of embodiment 172, wherein the first antisense RNA targets a sequence comprising at least 36 consecutive amino acids within SEQ ID NO: 105. 177. The MSH3 splice modulator DNA construct of embodiment 172, wherein the first antisense RNA targets an MSH3 pre-mRNA sequence that is the reverse complement of SEQ ID NO: 30. 178. The MSH3 splice modulator DNA construct of embodiment 172, wherein the first antisense RNA targets an MSH3 pre-mRNA sequence that is the reverse complement of SEQ ID NO: 31. The MSH3 splice modulator DNA construct of any one of embodiments 172 to 178, wherein the first antisense RNA is not complementary to an MSH3 exon 15 sequence. The MSH3 splice modulator DNA construct of embodiment 172, wherein the first antisense RNA comprises a sequence having at least 90% sequence identity to SEQ ID NO: 30 (with U substituted for T). The MSH3 splice modulator DNA construct of embodiment 180, wherein the first antisense RNA comprises a sequence having at least 96% sequence identity to SEQ ID NO: 30 (with U substituted for T). The MSH3 splice modulator DNA construct of embodiment 180, wherein the first antisense RNA comprises SEQ ID NO: 30 (with U substituted for T). The MSH3 splice modulator DNA construct of embodiment 172, wherein the first antisense RNA comprises a sequence having at least 90% sequence identity to SEQ ID NO: 31 (with U substituted for T). The MSH3 splice modulator DNA construct of embodiment 183, wherein the first antisense RNA comprises a sequence having at least 96% sequence identity to SEQ ID NO: 31 (with U substituted for T). The MSH3 splice modulator DNA construct of embodiment 183, wherein the first antisense RNA comprises SEQ ID NO: 31 (with U substituted for T). The MSH3 splice modulator DNA construct of embodiment 121, wherein the first antisense RNA targets an exon-intron junction sequence of MSH3 pre-mRNA. The MSH3 splice modulator DNA construct of embodiment 186, wherein the first antisense RNA targets a sequence that includes the intron 14 – exon 15 junction of MSH3 pre- mRNA. The MSH3 splice modulator DNA construct of embodiment 186, wherein the first antisense RNA targets a sequence comprising at least 15 consecutive amino acids within SEQ ID NO: 102. The MSH3 splice modulator DNA construct of embodiment 186, wherein the first antisense RNA targets a sequence comprising at least 20 consecutive amino acids within SEQ ID NO: 102. 190. The MSH3 splice modulator DNA construct of embodiment 186, wherein the first antisense RNA targets a sequence comprising at least 24 consecutive amino acids within SEQ ID NO: 102. 191. The MSH3 splice modulator DNA construct of embodiment 186, wherein the first antisense RNA targets a sequence comprising at least 36 consecutive amino acids within SEQ ID NO: 102. 192. The MSH3 splice modulator DNA construct of embodiment 186, wherein the first antisense RNA targets an MSH3 pre-mRNA sequence that is the reverse complement of SEQ ID NO: 22. 193. The MSH3 splice modulator DNA construct of embodiment 186, wherein the first antisense RNA targets an MSH3 pre-mRNA sequence that is the reverse complement of SEQ ID NO: 33. 194. The MSH3 splice modulator DNA construct of embodiment 186, wherein the first antisense RNA comprises a sequence having at least 90% sequence identity to SEQ ID NO: 22 (with U substituted for T). 195. The MSH3 splice modulator DNA construct of embodiment 186, wherein the first antisense RNA comprises a sequence having at least 96% sequence identity to SEQ ID NO: 22 (with U substituted for T). 196. The MSH3 splice modulator DNA construct of embodiment 186, wherein the first antisense RNA comprises SEQ ID NO: 22 (with U substituted for T). 197. The MSH3 splice modulator DNA construct of any one of embodiments 185 to 196, wherein the first antisense RNA does not comprise or consist of SEQ ID NO: 33 (with U substituted for T) or a sequence having at least 90% sequence identity to SEQ ID NO: 33 (with U substituted for T). 198. The MSH3 splice modulator DNA construct of embodiment 186, wherein the first antisense RNA is 32 nucleotides or less and comprises a sequence having at least 96% sequence identity to SEQ ID NO: 22 (with U substituted for T). 199. The MSH3 splice modulator DNA construct of embodiment 186, wherein the first antisense RNA is 32 nucleotides or less and comprises SEQ ID NO: 22 (with U substituted for T). 200. The MSH3 splice modulator DNA construct of embodiment 186, wherein the first antisense RNA consists of SEQ ID NO: 22 (with U substituted for T). 201. The MSH3 splice modulator DNA construct of embodiment 186, wherein the first antisense RNA targets a sequence that includes the exon 15 – intron 15 junction of MSH3 pre- mRNA. 202. The MSH3 splice modulator DNA construct of embodiment 201, wherein the first antisense RNA targets a sequence comprising at least 15 consecutive amino acids within SEQ ID NO: 103. 203. The MSH3 splice modulator DNA construct of embodiment 201, wherein the first antisense RNA targets a sequence comprising at least 20 consecutive amino acids within SEQ ID NO: 103 204. The MSH3 splice modulator DNA construct of embodiment 201, wherein the first antisense RNA targets a sequence comprising at least 24 consecutive amino acids within SEQ ID NO: 103. 205. The MSH3 splice modulator DNA construct of embodiment 201, wherein the first antisense RNA targets a sequence comprising at least 36 consecutive amino acids within SEQ ID NO: 103. 206. The MSH3 splice modulator DNA construct of embodiment 201, wherein the first antisense RNA targets an MSH3 pre-mRNA sequence that is the reverse complement of SEQ ID NO: 29. 207. The MSH3 splice modulator DNA construct of embodiment 201, wherein the first antisense RNA targets an MSH3 pre-mRNA sequence that is the reverse complement of SEQ ID NO: 34. 208. The MSH3 splice modulator DNA construct of embodiment 201, wherein the first antisense RNA comprises a sequence having at least 90% sequence identity to SEQ ID NO: 29 (with U substituted for T). 209. The MSH3 splice modulator DNA construct of embodiment 208, wherein the first antisense RNA comprises a sequence having at least 96% sequence identity to SEQ ID NO: 29 (with U substituted for T). 210. The MSH3 splice modulator DNA construct of embodiment 208, wherein the first antisense RNA comprises SEQ ID NO: 29 (with U substituted for T). 211. The MSH3 splice modulator DNA construct of any one of embodiments 201 to 210, wherein the first antisense RNA does not comprise or consist of SEQ ID NO: 34 (with U substituted for T) or a sequence having at least 90% sequence identity to SEQ ID NO: 34 (with U substituted for T). 212. The MSH3 splice modulator DNA construct of embodiment 201, wherein the first antisense RNA is 32 nucleotides or less and comprises a sequence having at least 96% sequence identity to SEQ ID NO: 29 (with U substituted for T). 213. The MSH3 splice modulator DNA construct of embodiment 201, wherein the first antisense RNA is 32 nucleotides or less and comprises SEQ ID NO: 29 (with U substituted for T). 214. The MSH3 splice modulator DNA construct of embodiment 201, wherein the first antisense RNA consists of SEQ ID NO: 29 (with U substituted for T). 215. The MSH3 splice modulator DNA construct of any one of embodiments 187 to 200, which further comprises a third DNA sequence encoding a second antisense RNA operatively linked to the first antisense RNA, wherein the second antisense RNA targets an exon 15 – intron 15 junction of MSH3 pre-mRNA. 216. The MSH3 splice modulator DNA construct of embodiment 215, wherein the second antisense RNA targets a sequence comprising at least 15 consecutive amino acids within SEQ ID NO: 103. 217. The MSH3 splice modulator DNA construct of embodiment 215, wherein the second antisense RNA targets a sequence comprising at least 20 consecutive amino acids within SEQ ID NO: 103. 218. The MSH3 splice modulator DNA construct of embodiment 215, wherein the second antisense RNA targets a sequence comprising at least 24 consecutive amino acids within SEQ ID NO: 103. 219. The MSH3 splice modulator DNA construct of embodiment 215, wherein the second antisense RNA targets a sequence comprising at least 36 consecutive amino acids within SEQ ID NO: 103. 220. The MSH3 splice modulator DNA construct of embodiment 215, wherein the second antisense RNA targets an MSH3 pre-mRNA sequence that is the reverse complement of SEQ ID NO: 29. 221. The MSH3 splice modulator DNA construct of embodiment 215, wherein the second antisense RNA targets an MSH3 pre-mRNA sequence that is the reverse complement of SEQ ID NO: 34. The MSH3 splice modulator DNA construct of embodiment 215, wherein the second antisense RNA comprises a sequence having at least 90% sequence identity to SEQ ID NO: 29 (with U substituted for T). The MSH3 splice modulator DNA construct of embodiment 222, wherein the second antisense RNA comprises a sequence having at least 96% sequence identity to SEQ ID NO: 29 (with U substituted for T). The MSH3 splice modulator DNA construct of embodiment 222, wherein the second antisense RNA comprises SEQ ID NO: 29 (with U substituted for T). The MSH3 splice modulator DNA construct of any one of embodiments 215 to 224, wherein the second antisense RNA does not comprise or consist of SEQ ID NO: 34 (with U substituted for T) or a sequence having at least 90% sequence identity to SEQ ID NO: 34 (with U substituted for T). The MSH3 splice modulator DNA construct of embodiment 215, wherein the second antisense RNA is 32 nucleotides or less and comprises a sequence having at least 96% sequence identity SEQ ID NO: 29 (with U substituted for T). The MSH3 splice modulator DNA construct of embodiment 215, wherein the second antisense RNA is 32 nucleotides or less and comprises SEQ ID NO: 29 (with U substituted for T). The MSH3 splice modulator DNA construct of embodiment 215, wherein the second antisense RNA consists of SEQ ID NO: 29 (with U substituted for T). The MSH3 splice modulator DNA construct of embodiment 215, wherein the second antisense RNA comprises a sequence having at least 90% sequence identity to SEQ ID NO: 34 (with U substituted for T). The MSH3 splice modulator DNA construct of embodiment 2...

Claims

CLAIMS 1. An MSH3 splice modulator construct comprising, operatively linked: (a) a sequence encoding a first antisense RNA sequence that targets a target exon of MSH3 pre-mRNA, wherein the target exon is MSH3 exon 7 or MSH3 exon 15, and wherein the target exon comprises a 5’ exon-intron junction, an exon sequence, and a 3’ exon-intron junction, and (i) wherein the first antisense RNA targets a sequence that is entirely encompassed by the exon sequence; or (ii) wherein the first antisense RNA sequence comprises or consists of any one of SEQ ID NOs: 5, 6, 14-16, 20, 21, or 30-32 or a sequence having at least 90% identity to any one of SEQ ID NOs: 5, 6, 14-16, 20, 21, or 30-32; or (iii) wherein the first antisense RNA sequence comprises or consists of any one of SEQ ID NOs: 7, 13, 22, or 29 or a sequence having at least 90% identity to any one of SEQ ID NOs: 7, 13, 22, or 29, wherein the first antisense RNA sequence does not comprise any one of SEQ ID NOs: 17, 18, 33 or 34, or a sequence having at least 90% identity to any one of SEQ ID NOs: 17, 18, 33, or 34; and (b) a sequence encoding a small nuclear RNA (snRNA) sequence configured to promote exon skipping of the target exon.

2. The MSH3 splice modulator construct of claim 1, wherein the first antisense RNA targets a sequence that is entirely encompassed by the exon sequence, and wherein the first antisense RNA sequence comprises or consists of any one of SEQ ID NOs: 8-12 or 23-28 or a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 8-12 or 23- 28.

3. The MSH3 splice modulator construct of claim 1, wherein the first antisense RNA comprises or consists of a sequence having 100% identity to (a) 12-18 consecutive nucleotides of any one of SEQ ID NOs: 5, 9-11, 15, 16, 20, 24-27, 31, or 32; (b) a sequence having 100% identity to 12-18 consecutive nucleotides of SEQ ID NO: 8, 14, 23, or 30 wherein the 5’ end of SEQ ID NO: 8, 14, 23, or 30 is included in the 12-18 consecutive nucleotides; or (c) a sequence having 100% identity to 12-18 consecutive nucleotides of SEQ ID NO: 6, 12, 21, or 28, wherein the 3’ end of SEQ ID NO: 6, 12, 21, or 28 is included in the 12-18 consecutive nucleotides.

4. The MSH3 splice modulator construct of claim 3, wherein the first antisense RNA is at least 24 nucleotides in length.

5. The MSH3 splice modulator construct of any one of claims 1 to 4, further comprising a sequence encoding a second antisense RNA sequence that targets MSH3 exon 7 or MSH3 exon 15.

6. The MSH3 splice modulator construct of claim 5, wherein the second antisense RNA sequence comprises or consists of any one of SEQ ID NOs: 5-34 or a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 5-34.

7. The MSH3 splice modulator construct of any one of claims 1 to 6, wherein the first antisense RNA sequence consists of any one of SEQ ID NOs: 5-16 or 20-32 or a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 5-16 or 20-32.

8. The MSH3 splice modulator construct of any one of claims 5 to 7, wherein the second antisense RNA sequence consists of any one of SEQ ID NOs: 5-34 or a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 5-34.

9. The MSH3 splice modulator construct of any one of claims 5 to 8, wherein the sequence encoding the first antisense RNA sequence is 5’ to the sequence encoding the second antisense RNA sequence.

10. The MSH3 splice modulator construct of any one of claims 5 to 9, further comprising a sequence encoding a linker between the first antisense RNA sequence and the second antisense RNA sequence.

11. The MSH3 splice modulator construct of any one of claims 5 to 9, wherein the MSH3 splice modulator construct does not include a sequence encoding a linker between the first antisense RNA sequence and the second antisense RNA sequence.

12. The MSH3 splice modulator construct of any one of claims 5 to 11, wherein the first antisense RNA sequence comprises or consists of SEQ ID NO: 7 or a sequence having at least 90% sequence identity to SEQ ID NO: 7, and wherein the second antisense RNA sequence comprises or consists of SEQ ID NO: 13 or a sequence having at least 90% identity to SEQ ID NO:

13.

13. The MSH3 splice modulator construct of any one of claims 5 to 11, wherein the first antisense RNA sequence comprises or consists of SEQ ID NO: 22 or a sequence having at least 90% sequence identity to SEQ ID NO: 22, and wherein the second antisense RNA sequence comprises or consists of SEQ ID NO: 29 or a sequence having at least 90% identity to SEQ ID NO:

29.

14. The MSH3 splice modulator construct of any one of claims 1 to 13, wherein the first antisense RNA or, when present, the second antisense RNA, comprises or consists of any one of SEQ ID NOs: 9-11, 13, 14, or 27-29, or a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 9-11, 13, 14, or 27-29.

15. The MSH3 splice modulator construct of any one of claims 1 to 14, further comprising a U1 promoter and a U1 terminator operatively linked to the first antisense RNA sequence, thesequence encoding the snRNA sequence, and, when present, the second antisense RNA sequence.

16. The MSH3 splice modulator construct of any one of claims 1 to 15, wherein the snRNA is a modified snRNA.

17. The MSH3 splice modulator construct of claim 16, wherein the modified snRNA comprises a U7 Sm OPT sequence or a U2 snRNA sequence.

18. The MSH3 splice modulator construct of any one of claims 1 or 15 to 17, comprising any one of SEQ ID NOs: 38-49, 55-69, 75, or 76 or a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 38-49, 55-69, 75, or 76.

19. The MSH3 splice modulator construct of any one of claims 1 or 15 to 17, comprising any one of SEQ ID NOs: 42-44, 46, 47, 55, 56, or 64-66.

20. An MSH3 splice modulator construct comprising, operatively linked: (a) a sequence encoding a first antisense RNA sequence, wherein the first antisense RNA sequence comprises any one of SEQ ID NOs: 17, 18, 33, or 34 or a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 17, 18, 33 or 34; (b) a sequence encoding a second antisense RNA sequence, wherein the second antisense RNA sequence comprises any one of SEQ ID NOs: 17, 18, 33, or 34 or a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 17, 18, 33 or 34; and (c) a sequence encoding a small nuclear RNA (snRNA) sequence configured to promote exon skipping of a target exon; wherein the splice modulator construct does not include a sequence encoding a linker between the first antisense RNA sequence and the second antisense RNA sequence.

21. The MSH3 splice modulator construct of claim 20, further comprising a U1 promoter and a U1 terminator operatively linked to the first antisense RNA sequence, the sequence encoding the snRNA sequence, and the second antisense RNA sequence.

22. The MSH3 splice modulator construct of claim 20 or 21, wherein the snRNA is a modified snRNA.

23. The MSH3 splice modulator construct of claim 22, wherein the modified snRNA comprises a U7 Sm OPT sequence or a U2 snRNA sequence.

24. The MSH3 splice modulator construct of any one of claims 20 to 23, wherein the first antisense RNA sequence comprises SEQ ID NO: 17 or a sequence having at least 90% sequence identity to SEQ ID NO: 17 and wherein the second antisense RNA sequence comprises SEQ ID NO: 18 or a sequence having at least 90% sequence identity to SEQ ID NO: 18.

25. The MSH3 splice modulator construct of claim 24, comprising SEQ ID NO: 54 or a sequence having at least 90% sequence identity to SEQ ID NO:

54.

26. The MSH3 splice modulator construct of any one of claims 20 to 23, wherein the first antisense RNA sequence comprises SEQ ID NO: 33 or a sequence having at least 90% sequence identity to SEQ ID NO: 33 and wherein the second antisense RNA sequence comprises SEQ ID NO: 34 or a sequence having at least 90% sequence identity to SEQ ID NO:

34.

27. The MSH3 splice modulator construct of claim 24, comprising SEQ ID NO: 74 or a sequence having at least 90% sequence identity to SEQ ID NO:

74.

28. An MSH3 splice modulator construct consisting essentially of or consisting of SEQ ID NO:

53.

29. An MSH3 splice modulator construct comprising, operably linked from 5’ to 3’: (a) a sequence encoding an hnRNPA1 binding sequence; (b) a sequence encoding an antisense RNA sequence comprising any one of SEQ ID NOs: 9, 10, or 28 or a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 9, 10, or 28; and (c) a sequence encoding a small nuclear RNA (snRNA) sequence.

30. The MSH3 splice modulator construct of claim 29, wherein the sequence encoding the hnRNPA1 binding sequence comprises SEQ ID NO:

81.

31. The MSH3 splice modulator construct of claim 29, wherein the sequence encoding the snRNA sequence comprises SEQ ID NO:

106.

32. The MSH3 splice modulator construct of claim 29, which comprises SEQ ID NO: 82 or a sequence having at least 90% identity to SEQ ID NO:

82.

33. The MSH3 splice modulator construct of claim 29, which comprises SEQ ID NO: 83 or a sequence having at least 90% identity to SEQ ID NO:

83.

34. The MSH3 splice modulator construct of claim 29, which comprises SEQ ID NO: 84 or a sequence having at least 90% identity to SEQ ID NO:

84.

35. A splice modulator construct comprising, operably linked from 5’ to 3’: (a) a sequence encoding an antisense RNA that targets a 5’ exon-intron junction of a target exon; (b) a sequence encoding an hnRNPA1 binding sequence; and (c) a sequence encoding an antisense RNA that targets a 3’ intron-exon junction of the target exon.

36. The MSH3 splice modulator construct of claim 35, wherein the sequence encoding the hnRNPA1 binding sequence comprises SEQ ID NO:

81.

37. An MSH3 splice modulator construct comprising any two or more of the MSH3 splice modulator constructs of claims 1 to 36 combined on a single polynucleotide molecule.

38. A composition comprising any two or more of the MSH3 splice modulator constructs of claims 1 to 36.

39. A composition comprising an RNA molecule encoded by the MSH3 splice modulator construct of any one of claims 1 to 37.

40. A vector comprising the MSH3 splice modulator construct of any one of claims 1-37.

41. The vector of claim 40, further comprising a 5’ regulatory domain.

42. The vector of claim 41, wherein the 5’ regulatory domain comprises a constitutive promoter or a tissue specific promoter.

43. The vector of claim 42, wherein the constitutive promoter is a CMV promoter or a CAGGS promoter.

44. A proviral plasmid comprising the MSH3 splice modulator construct of any one of claims 1- 37.

45. An adeno-associated virus (AAV) comprising the MSH3 splice modulator construct of any one of claims 1-37.

46. The AAV of claim 45, further comprising a 5’ regulatory domain.

47. The AAV of claim 46, wherein the 5’ regulatory domain comprises a constitutive promoter or a tissue specific promoter.

48. The AAV of claim 47, wherein the constitutive promoter is a CMV promoter or a CAGGS promoter.

49. The AAV of any one of claims 45 to 48, wherein the AAV exhibits neuronal tropism.

50. The AAV of any one of claims 45 to 49, wherein the AAV is AAV9, AAV8, AAV5, AAV2, AAV7, or AAV2.7m8, AAV-retro, AAV1, AAV4, or AAV-PHP.eB.

51. A composition comprising the MSH3 splice modulator construct of any one of claims 1 to 37, the vector of any one of claims 40 to 43, the proviral plasmid of claim 44, or the AAV of any one of claims 45 to 50.

52. The composition of claim 51, comprising a pharmaceutically acceptable excipient.

53. A method of reducing expression of MSH3 in a target cell, the method comprising transfecting or transducing the target cell with the MSH3 splice modulator construct or constructs of any one of claims 1 to 37, the vector of any one of claims 40 to 43, the proviral plasmid of claim 44, or the AAV of any one of claims 45 to 50.

54. The method of claim 53, wherein the expression of MSH3 in a target cell is reduced by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% relative to expression of MSH3 in a target cell that expresses wildtype levels of MSH3.

55. The method of claim 53, wherein the expression of MSH3 in a target cell is reduced by about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, or about 50% relative to expression of MSH3 in a target cell that expresses wildtype levels of MSH3.

56. The method of any one of claims 53 to 55, wherein the target cell is a brain cell, a motor neuron, a cardiac muscle cell, a smooth muscle cell, a skeletal muscle cell, or a corneal endothelial cell.

57. A method of delaying or inhibiting nucleotide repeat expansion in a gene of a target cell, the method comprising transfecting or transducing the target cell with the MSH3 splice modulator construct of any one of claims 1 to 37, the vector of any one of claims 40 to 43, the proviral plasmid of claim 44, or the AAV of any one of claims 45 to 50.

58. The method of 57, wherein the target cell is a brain cell, a motor neuron, a cardiac muscle cell, a smooth muscle cell, a skeletal muscle cell, or a corneal endothelial cell.

59. A method of delaying or inhibiting nucleotide repeat expansion in a subject, the method comprising administering to the subject the MSH3 splice modulator construct of any one of claims 1 to 37, the vector of any one of claims 40 to 43, the proviral plasmid of claim 44, or the AAV of any one of claims 45 to 50.

60. The method of claim 59, wherein the subject has Huntington’s disease, myotonic dystrophy 1, myotonic dystrophy 2, Fuchs endothelial corneal dystrophy, fragile X syndrome, Friedreich ataxia, C9orf72 ALS / FTD, SCA1, SCA2, SCA3, SCA6, SCA7, SCA8, SCA10, SCA17, SCA31, or spinal and bulbar muscular atrophy or wherein the subject has been diagnosed as being at risk for Huntington’s disease, myotonic dystrophy 1, myotonic dystrophy 2, Fuchs endothelial corneal dystrophy, fragile X syndrome, Friedreich ataxia, C9orf72 ALS / FTD, SCA1, SCA2, SCA3, SCA6, SCA7, SCA8, SCA10, SCA17, SCA31, or spinal and bulbar muscular atrophy.

61. The method of claim 59 or 60, wherein the administering comprises contacting a neural, endothelial cell, or muscle cell of the subject with the MSH3 splice modulator construct ofany one of claims 1 to 37, the vector of any one of claims 40 to 43, the proviral plasmid of claim 44, or the AAV of any one of claims 45 to 50.

62. A method of treating a repeat expansion disorder in a subject in need thereof, the method comprising administering to the subject the MSH3 splice modulator construct of any one of claims 1 to 37, the vector of any one of claims 40 to 43, the proviral plasmid of claim 44, the AAV of any one of claims 45 to 50, or the composition of claim 51 or 52 in a therapeutically effective amount.

63. The method of claim 62, wherein the trinucleotide repeat expansion disorder is Huntington’s disease, myotonic dystrophy 1, myotonic dystrophy 2, Fuchs endothelial corneal dystrophy, fragile X syndrome, Friedreich ataxia, C9orf72 ALS / FTD, SCA1, SCA2, SCA3, SCA6, SCA7, SCA8, SCA10, SCA17, SCA31, or spinal and bulbar muscular atrophy.

64. A method of treating Huntington’s disease in a subject in need thereof, the method comprising administering to the subject the MSH3 splice modulator construct of any one of claims 1 to 37, the vector of any one of claims 40 to 43, the proviral plasmid of claim 44, the AAV of any one of claims 45 to 50, or the composition of claim 51 or 52 in a therapeutically effective amount.

65. The method of any one of claims 59 to 64, the method comprising administration of the MSH3 splice modulator construct of any one of claims 1 to 37, the vector of any one of claims 40 to 43, the proviral plasmid of claim 44, the AAV of any one of claims 45 to 50, or the composition of claim 51 or 52 to the subject’s brain, cardiac muscle, skeletal muscle, or eye.

66. The method of any one of claims 59 to 65, wherein the subject is a mammal, preferentially a rodent, non-human primate, or a human.

67. The method of any one of claims 59 to 66, wherein the subject is genetically predisposed to have HD or has been diagnosed with HD.

68. The MSH3 splice modulator construct of any one of claims 1 to 37, the vector of any one of claims 40 to 43, the proviral plasmid of claim 44, the AAV of any one of claims 45 to 50, or the composition of claim 51 or 52, for use in preventing or treating HD, myotonic dystrophy 1, myotonic dystrophy 2, Fuchs endothelial corneal dystrophy, fragile X syndrome, Friedreich ataxia, C9orf72 ALS / FTD, SCA1, SCA2, SCA3, SCA6, SCA7, SCA8, SCA10, SCA17, SCA31, or spinal and bulbar muscular atrophy in a subject in need thereof.

69. The MSH3 splice modulator construct of any one of claims 1 to 37, the vector of any one of claims 40 to 43, the proviral plasmid of claim 44, the AAV of any one of claims 45 to 50, or the composition of claim 51 or 52 for use in the preparation of a medicament for the treatment or prevention of HD, myotonic dystrophy 1, myotonic dystrophy 2, Fuchsendothelial corneal dystrophy, fragile X syndrome, Friedreich ataxia, C9orf72 ALS / FTD, SCA1, SCA2, SCA3, SCA6, SCA7, SCA8, SCA10, SCA17, SCA31, or spinal and bulbar muscular atrophy in a subject in need thereof.

Citation Information

Patent Citations

  • Compositions and uses for treatment thereof

    US20210062188A1

  • HTT trans-splicing molecules

    WO2024173719A1