Recombinant manufacture of santalol using a dioxygenase

Abstract

The present invention concerns the field of manufacture of a composition comprising santalol or related products. Specifically, the present invention relates to a method for the manufacture of a composition comprising santalol, the method comprising the step of converting at least one santalene into at least one santalol, wherein the conversion is carried out by at least one polypeptide having cumene dioxygenase activity and a composition comprising a mixture of alpha-santalol and beta-santalol obtainable thereby. The present invention further pertains to a cumene dioxygenase variant converting santalene into santalol and use of a polypeptide having cumene dioxygenase activity for the manufacture of a composition comprising at least one santalol and a kit for the manufacture of a composition comprising at least one santalol comprising said polypeptide having cumene dioxygenase activity.

Description

[0001]Recombinant manufacture of santalol using a dioxygenaseThe present invention concerns the field of manufacture of a composition comprising santalol orrelated products. Specifically, the present invention relates to a method for the manufacture of a composition comprising santalol, the method comprising the step of converting at least one santalene into at least one santalol, wherein the conversion is carried out by at least one polypeptide having cumene dioxygenase activity comprising an amino acid sequence selectedfrom the group consisting of: a) an amino acid sequence comprising a single point deletion atthe amino acid position corresponding to position 288 of SEQ ID NO.1 (amino acid sequence from oxygenase alpha subunit CumA1 of wildtype cumene dioxygenase from Pseudomonasfluorescens IP01); b) an amino acid sequence comprising a single point deletion at the aminoacid position corresponding to position 288 of SEQ ID NO.1 and an Alanine to Threoninesubstitution at the amino acid position corresponding to position 321 of SEQ ID NO.1 (A321T); c) an amino acid sequence comprising a single point deletion at the amino acid position corresponding to position 288 of SEQ ID NO.1 and an Asparagine to Threonine substitution at the amino acid position corresponding to position 279 of SEQ ID NO.1 (N279T) and an Alanine to Threonine substitution at the amino acid position corresponding to position 321 of SEQ IDNO. 1 (A321T); d) an amino acid sequence which is at least 60%, at least 70%, at least 80%, atleast 85%, at least 90%, at least 95%, at least 98% or at least 99% identical to the amino acidsequence of SEQ ID NO. 1 and has a single point deletion at the amino acid positioncorresponding to position 288 of SEQ ID NO. 1; e) an amino acid sequence which is at least60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or atleast 99% identical to the amino acid sequence of SEQ ID NO.1 and has a single point deletionat the amino acid position corresponding to position 288 of SEQ ID NO.1 and an Alanine to Threonine substitution at the amino acid position corresponding to position 321 of SEQ ID NO.1 (A321T); f) an amino acid sequence which is at least 60%, at least 70%, at least 80%, at least85%, at least 90%, at least 95%, at least 98% or at least 99% identical to the amino acidsequence of SEQ ID NO. 1 and has a single point deletion at the amino acid positioncorresponding to position 288 of SEQ ID NO.1 and an Asparagine to Threonine substitution at the amino acid position corresponding to position 279 of SEQ ID NO.1 (N279T) and an Alanine to Threonine substitution at the amino acid position corresponding to position 321 of SEQ IDNO. 1 (A321T); and g) a fragment of the amino acid sequence of a), b) or c), said fragmentexhibiting cumene dioxygenase activity. The present invention further pertains to a cumenedioxygenase variant converting santalene into santalol, comprising an amino acid sequenceselected from the group consisting of: a) an amino acid sequence comprising a single pointdeletion at the amino acid position corresponding to position 288 of SEQ ID NO.1 and an Alanine to Threonine substitution at the amino acid position corresponding to position 321 ofSEQ ID NO. 1 (A321T); b) an amino acid sequence comprising a single point deletion at theamino acid position corresponding to position 288 of SEQ ID NO.1 and an Asparagine to Threonine substitution at the amino acid position corresponding to position 279 of SEQ ID NO. 1 (N279T) and an Alanine to Threonine substitution at the amino acid position corresponding toposition 321 of SEQ ID NO. 1 (A321T); c) an amino acid sequence which is at least 60%, atleast 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99%identical to the amino acid sequence of SEQ ID NO.1 and has a single point deletion at the amino acid position corresponding to position 288 of SEQ ID NO.1 and an Alanine to Threonine substitution at the amino acid position corresponding to position 321 of SEQ ID NO.1 (A321T); d) an amino acid sequence which is at least 60%, at least 70%, at least 80%, at least 85%, atleast 90%, at least 95%, at least 98% or at least 99% identical to the amino acid sequence ofSEQ ID NO.1 and has a single point deletion at the amino acid position corresponding toposition 288 of SEQ ID NO.1 and an Asparagine to Threonine substitution at the amino acid position corresponding to position 279 of SEQ ID NO.1 (N279T) and an Alanine to Threonine substitution at the amino acid position corresponding to position 321 of SEQ ID NO.1 (A321T); and e) a fragment of the amino acid sequence of a) or b), said fragment exhibiting cumene dioxygenase activity. The Sandalwood or Chandan (Santalum album L.) is known worldwide for its fragrant oil content that has a pleasant and woody odour. The essential oil obtained from the well matured S. album tree is represented by a mixture of sesquiterpenes such as: (Z)-α-santalol, (Z)-β-santalol, (Z)- epi-β-santalol, (Z)-α-trans-bergamotol, α-bisabolene alcohol, (Z)-lanceol, sesquisabinene hydrate and (E,E)-farnesol, along with small amounts (up to 2%) of corresponding precursor sesquiterpene hydrocarbons. The essential oil of sandalwood, usually obtained by steam distillation of chips and billets cut from the heartwood, is widely used for several purposes such as in perfumery, cosmetics, aromatherapy, as an antidepressant, anti-inflammatory, antifungal, astringent, sedative, insecticide, anti-septic and in sacred unguents.The Sandalwood trees are not ready for harvesting until they are about 30 years old. Theirexistence is highly endangered by overexploitation. The sandalwood tree is therefore on the Red List of the International Union for Conservation of Nature (IUCN). However, the demand forthe popular scent of sandalwood oil remains unchecked. Accordingly, there is an urgent needfor finding alternatives to sandalwood oil in order to protect the existence of the highlyendangered sandalwood trees.(Z)-α-santalol and (Z)-β-santalol constitute the major active components of sandalwood oil, with(Z)-β-santalol representing the major fragrance impact ingredient of sandalwood oil. In light ofthis, santalol is a highly interesting product in the flavour and fragrance industry, due to its flavour and fragrance properties. The first committed step in sandalwood sesquiterpenoid biosynthesis is the cyclization of farnesyl diphosphate (FPP) by sesquiterpene synthases to yield sesquiterpene hydrocarbons, which are subsequently converted to corresponding sesquiterpene alcohols by cytochrome P450 mediated hydroxylation at cis allylic methyl group of the side chain (Srivastava et al., Sci Rep.2015; 5: 10095). Biosynthetic enzymes used in biotechnological production of santalenes and santalols inheterologous hosts thus include sesquiterpene synthases, such as santalene synthases (STSs),and cytochrome P450 monooxygenases (CYPs). Sesquiterpene synthases cyclize theubiquitous precursor farnesyl pyrophosphate (FPP), by a unique proton transfer cascade. The outcome of the cyclization reaction is determined by the identity of the terpene synthase. Genesencoding plant terpene synthases can be deployed, e.g., in microbial production of terpenes.Microbial production of santalenes, including alpha santalene, trans-alpha bergamotene and beta santalene, has been demonstrated (US2020 / 0010822 A1), by using a santalene synthasefrom Cinnamomum camphora, or from Santalum album. WO 2023 / 110729 describes a methodfor the manufacture of a composition comprising at least one santalene comprising the step of converting farnesyl pyrophosphate into at least one santalene, wherein said conversion iscarried out by a polypeptide exhibiting santalene synthase activity. Moreover, it contemplates acomposition comprising a mixture of beta-santalene and alpha-santalene with an excess of beta-santalene obtainable by the method of the invention.Santalene can then be further hydroxylated by the CYP450 system to generate respectivesesquiterpene alcohol santalol. In one study, alpha santalol and beta santalol has been generated by monohydroxylation of the hydrocarbons alpha santalene and beta santaleneproduced by e.g. biochemical pathways with a cytochrome P450 monooxygenase(CN105555959A).Oxyfunctionalized sesquiterpenoids like santalol have diverse applications not only in theflavour sector, but also as building blocks for pharmaceuticals and precursors for pheromones.Their oxyfunctionalization still faces challenges like controlling regio- and stereoselectivityduring monohydroxylation reactions, though. However, metalloenzymes such as cytochromesP450 and Rieske non-heme iron dependent oxygenases have been shown to catalyze an arrayof extremely challenging oxidative transformations with a high degree of selectivity and catalytic efficiency.Rieske non-heme iron dioxygenases (RHOs or ROs) possess active site loops that showinfluence on regio- and stereoselectivity (B. M. Nestl, B. Hauer, ACS Catal. 2014, 4, 3201–3211). Rieske non-heme iron oxygenases are capable of performing both allylicmonohydroxylations and cis-dihydroxylations, leading to a potentially higher variety of oxygenation products than, for example, the well-studied P450 monooxygenases. ROs usually consist of an NAD(P)H-oxidizing reductase, an oxygenase, and in many cases a ferredoxin,which is part of the electron transfer chain. The oxygenase consists of the catalytic alpha-subunit and the structurally stabilizing beta-subunit. The alpha-subunit harbours the name-giving Rieske [2Fe-2S] iron-sulfur cluster, which accepts electrons from the ferredoxin or reductase and shuttles them over an aspartate bridge to the mononuclear non-heme iron withinthe active site of another alpha-subunit, where catalysis takes place. Rieske non-heme ironoxygenases are also accepting a multitude of substrate classes, containing aromatics, olefins,heterocycles and monoterpenes.In a recent study, Heinemann et al. reported the engineering of hot-spots in loops of thecumene dioxygenase from Pseudomonas fluorescens IP01 with high impact on activity, regio- and enantioselectivity (P. M. Heinemann, D. Armbruster, B. Hauer, Nat. Commun.2021, 12, 1–Although new biochemical pathways, enzyme modifications and genetically engineered cellshave been developed in the recent past, there is still a need for the identification of means andmethods for production of oxyfunctionalized sesquiterpenoids, such as santalol. Further, it isdesirable finding biochemical pathways for producing cis-isomers of santalol, for instance, (Z)-^-santalol, (Z)-ß-santalol, or (Z)-epi-ß-santalol since sandalwood oil is mostly composed of the (Z)stereoisomers of santalol.The technical problem underlying the present invention shall be seen as the provision of means and methods complying with the aforementioned needs. The technical problem is solved by the embodiments characterized in the claims and herein below. Method for the manufacture of a composition comprising santalol of the invention The present invention relates to a method for the manufacture of a composition comprising santalol, the method comprising the step of converting at least one santalene into at least one santalol, wherein the conversion is carried out by at least one polypeptide having cumene dioxygenase activity comprising an amino acid sequence selected from the group consisting of:a) an amino acid sequence, preferably the amino acid sequence of SEQ ID NO.1, comprisinga single point deletion at the amino acid position corresponding to position 288 of SEQ ID NO.1(amino acid sequence from oxygenase alpha subunit CumA1 of wildtype cumene dioxygenase from Pseudomonas fluorescens IP01);b) an amino acid sequence, preferably the amino acid sequence of SEQ ID NO.1, comprisinga single point deletion at the amino acid position corresponding to position 288 of SEQ ID NO.1 and an Alanine to Threonine substitution at the amino acid position corresponding to position 321 of SEQ ID NO.1 (A321T);c) an amino acid sequence, preferably the amino acid sequence of SEQ ID NO.1, comprisinga single point deletion at the amino acid position corresponding to position 288 of SEQ ID NO.1 and an Asparagine to Threonine substitution at the amino acid position corresponding to position 279 of SEQ ID NO.1 (N279T) and an Alanine to Threonine substitution at the amino acid position corresponding to position 321 of SEQ ID NO.1 (A321T); d) an amino acid sequence which is at least 60%, at least 70%, at least 80%, at least 85%, atleast 90%, at least 95%, at least 98% or at least 99% identical to the amino acid sequence ofSEQ ID NO.1 and has a single point deletion at the amino acid position corresponding to position 288 of SEQ ID NO.1;e) an amino acid sequence which is at least 60%, at least 70%, at least 80%, at least 85%, atleast 90%, at least 95%, at least 98% or at least 99% identical to the amino acid sequence of SEQ ID NO.1 and has a single point deletion at the amino acid position corresponding to position 288 of SEQ ID NO.1 and an Alanine to Threonine substitution at the amino acid position corresponding to position 321 of SEQ ID NO.1 (A321T);f) an amino acid sequence which is at least 60%, at least 70%, at least 80%, at least 85%, atleast 90%, at least 95%, at least 98% or at least 99% identical to the amino acid sequence ofSEQ ID NO.1 and has a single point deletion at the amino acid position corresponding to position 288 of SEQ ID NO.1 and an Asparagine to Threonine substitution at the amino acid position corresponding to position 279 of SEQ ID NO.1 (N279T) and an Alanine to Threonine substitution at the amino acid position corresponding to position 321 of SEQ ID NO.1 (A321T); andg) a fragment of the amino acid sequence of a), b) or c), said fragment exhibiting cumenedioxygenase activity.The method for the manufacture of a composition comprising santalol of the invention mayeither consist of the aforementioned steps or may comprise additional steps. Such additionalsteps may be steps of pre-treatments or purification steps which are well known in the art. Theskilled person is well aware of suitable pre-treatment and / or purification steps depending on thegiven circumstances under which the methods may be carried out. Purification techniques to beenvisaged may be extraction techniques, chromatography, such as LC, GC or HPLC, size- exclusion chromatography, affinity chromatography, distillation, centrifugation, filtration and the like. Pre-treatment steps to be envisaged may be harvesting, heat treatment, ultra-sonic treatment, treatment with chemicals and / or enzymes, and the like. As shown in the Examples, this study demonstrates a novel loop engineering strategy for synthesizing oxyfunctionalized sesquiterpenes and sheds light on the influences of loops onligand transport and selectivity of a Rieske non-heme iron oxygenase.Specifically, the present inventors successfully achieved the selective monohydroxylation of thesesquiterpene santalene to santalol with the cumene dioxygenase (CDO) derived fromPseudomonas fluorescens IP01. They chose an active-site loop for targeting an insertion anddeletion strategy, and with just a single point deletion of the Isoleucine (I) at position 288(named I288del, I288DEL, or I288Del herein) of SEQ ID NO. 1 (corresponding to the amino acidsequence of the wildtype oxygenase alpha subunit CumA1 of the cumene dioxygenase from Pseudomonas fluorescens IP01) completely modified the activity and regioselectivity from ring- hydroxylation to tail hydroxylation. Molecular dynamics simulations revealed changes in substrate orientation during the entry into the enzyme, changes in tunnel radius and a differentpositioning in the active site of the enzyme. Advantageously, it was found that I288del couldalso monohydroxylate bergamotene to bergamotol, and valencene to nootkatol. In contrast,wildtype (wt) cumene dioxygenase derived from Pseudomonas fluorescens IP01 did not showany formation of santalol, bergamotol or nootkatol.As the present inventors wanted to investigate how far they could maximize the productformation to investigate the boundaries of the aforementioned cumene dioxygenase (CDO),they performed iterative saturation mutagenesis on active site positions of the CDO. As theactive site was not touched yet, they wanted to fine tune the positioning of the substrate tofurther enhance catalysis. In the first round, the mutation A321T was identified, which lead tovariant I288del_A321T (V1), with a slight increase in product formation from 1.25 mM ofsubstrate beta-bisabolene to 1.35 mM, compared to I288del. Variant I288del_A321T (V1) hasan amino acid sequence comprising a single point deletion at the amino acid position corresponding to position 288 of SEQ ID NO.1 (I288del) and an Alanine to Threoninesubstitution at the amino acid position corresponding to position 321 of SEQ ID NO.1. As thepresent inventors know by now that loop and tunnel mutagenesis can be beneficial, theyadditionally decided to target tunnel and loop residues. This lead to the final variantN279T_I288del_A321T (V2), with a product formation of 1.58 mM. VariantN279T_I288del_A321T (V2) has an amino acid sequence comprising a single point deletion atthe amino acid position corresponding to position 288 of SEQ ID NO.1 (I288del) and anAsparagine to Threonine substitution at the amino acid position corresponding to position 279 of SEQ ID NO.1 (N279T) and an Alanine to Threonine substitution at the amino acid position corresponding to position 321 of SEQ ID NO.1 (A321T). In addition, the variantsI288del_A321T (V1) and N279T_I288del_A321T (V2) have been found active towards thesubstrates santalene and bergamotene.This is the first reported activity of Rieske non-heme iron oxygenases towards the stericallydemanding sesquiterpenes santalene, bergamotene and valencene.Compared to the extraction of sandalwood trees, such a biocatalytic approach is beneficial as it is more sustainable, with a lower CO2foodprint and no trees have to be killed. Moreover, the use of a single enzyme for a turnover from santelene to santalol, from bergamotene to bergamotol, from valencene to nootkatol, or from bisabolene to bisabolenealcohol, as in the methods of the invention can lead to highly selective production of santalol,bergamotol, nootkatol or bisabolene alcohol, if pure substrate is used.What is more, with selective variants for just one of the santalene isomers, enantiopure santalolcan be produced out of an isomeric mixture of santalene as well. Similarly, with selectivevariants for just one of the bergamotene isomers, enantiopure bergamotol can be produced outof an isomeric mixture of bergamotene, too. With selective variants for just one of the valenceneisomers, also enantiopure nootkatol can be produced out of an isomeric mixture of valencene.And with selective variants for just one of the bisabolene isomers, also enantiopure bisabolenealcohol can be produced out of an isomeric mixture of bisabolene.Rieske non-heme iron-dependent oxygenases (ROs) are a class of enzymes primary known for the incorporation of molecular oxygen in aromatic compounds, resulting in cis-dihydroxylated, non-aromatic products (Chakraborty J, Ghosal D, Dutta A, Dutta TK. An insight into the origin and functional evolution of bacterial aromatic ring-hydroxylating oxygenases. J. Biomol. Struct. Dyn.2012;30:419–436; Ferraro DJ, Gakhar L, Ramaswamy S. Rieske business: structure– function of Rieske non-heme oxygenases. Biochem. Biophys. Res. Commun.2005;338:175–190). ROs are multicomponent systems consisting of a NAD(P)H-oxidizing reductase, anoxygenase and often a ferredoxin for electron transfer (Dong X, et al. Crystal structure of the terminal oxygenase component of cumene dioxygenase from Pseudomonas fluorescens IP01. J. Bacteriol.2005;187:2483–2490). The oxygenase comprises catalytically-active α-subunits and usually a corresponding number of structurally important β-subunits that form a (αxβx)- heteromer. The α-subunit contains the Rieske-type [2Fe-2S] iron-sulfur cluster as an electron acceptor and an active-site non-heme iron (Dong et al., loc. cit.). Their large substrate scope, containing aromatics (Bui VP, Hansen TV, Stenstrøm Y, Hudlicky T, Ribbons DW. A study of substrate specificity of toluene dioxygenase in processing aromatic compounds containing benzylic and / or remote chiral centers. N. J. Chem.2001;25:116–124), heterocycles (Overwin H, et al. An aryl dioxygenase shows remarkable double dioxygenation capacity for diverse bis-aryl compounds, provided they are carbocyclic. Appl. Microbiol. Biotechnol.2016;100:8053–8061), olefins (Gally C, Nestl BM, Hauer B. Engineering rieske non-heme iron oxygenases for the asymmetric dihydroxylation of alkenes. Angew. Chem. Int. Ed.2015;54:12952–12956; ), andterpenes (Gally et al., loc. cit.; , Halder JM, Nestl BM, Hauer B. Semirational engineering of thenaphthalene dioxygenase from Pseudomonas sp. NCIB 9816-4 towards selective asymmetric dihydroxylation. ChemCatChem.2018;10:178–182), combined with their broad reaction spectrum of cis-dihydroxylations (Bui et al., loc. cit.), allylic monohydroxylations(Gally et al., loc. cit.), desaturations (Gibson DT, et al. Desaturation, dioxygenation, and monooxygenation reactions catalyzed by naphthalene dioxygenase from Pseudomonas sp. strain 9816-4. J. Bacteriol.1995;177:2615–2621), and sulfoxidations (Boyd DR, et al. Dioxygenase-catalysed oxidation of alkylaryl sulfides: sulfoxidation versus cis -dihydrodiol formation. Org. Biomol.Chem.2004;2:2530–2537) makes ROs attractive biocatalysts for the synthesis of biologically-active products and fine chemicals (Hudlicky T, Luna H, Barbiera G, Kwart LD. Enantioselective synthesis through microbial oxidation of arenes.1. efficient preparation of terpene andprostanoid synthons. J. Am. Chem. Soc. 1988;110:4735–4741; Hudlicky T, et al. Toluenedioxygenase-mediated cis-dihydroxylation of aromatics in enantioselective synthesis. Asymmetric total syntheses of pancratistatin and 7-deoxypancratistatin, promising antitumor agents. J. Am. Chem. Soc.1996;118:10752–10765; Finn KJ, Collins J, Hudlicky T. Toluene dioxygenase-mediated oxidation of dibromobenzenes. Absolute stereochemistry of new metabolites and synthesis of (−)-conduritol E. Tetrahedron.2006;62:7471–7476). Althoughknown for a long time for their interesting features, ROs were not subject of such intensiveengineering approaches as the related P450s (Wei Y, Ang EL, Zhao H. Recent developments in the application of P450 based biocatalysts. Curr. Opin. Chem. Biol.2018;43:1–7). The group of Gibson was among the first to evaluate the influences of specific active-site residues of the naphthalene dioxygenase (NDO) from Pseudomonas sp. strain NCIB 9816-4 and the toluene dioxygenase (TDO) from Pseudomonas putida F1 on activity and selectivity. Cumene dioxygenase (CumDO) is an initial enzyme in the cumene degradation pathway ofPseudomonas fluorescens IP01. It is a Rieske non-heme iron oxygenase (RO) that comprisestwo electron transfer components (reductase [CumDO-R] and Rieske-type ferredoxin [CumDO- F]) and one catalytic component (α3β3-type oxygenase [CumDO-O]). Catalysis is triggered byelectrons that are transferred from NAD(P)H to CumDO-O by CumDO-R and CumDO-F. Thestudy by Tsai et al. (Appl Environ Microbiol.2022 Aug; 88(15): e00835-22) found that the α- andβ-subunit boundary at the stem of the mushroom-like α3β3-type oxygenase component ofRieske Non-Heme Iron Oxygenases is the Rieske-type ferredoxin-binding site.Heinemann et al. reported the engineering of hot-spots in loops of the cumene dioxygenasefrom Pseudomonas fluorescens IP01 with high impact on activity, regio- and enantioselectivity.Libraries based on alanine scan, sequence alignments, and deletions along with a novel insertion approach result in up to 16-fold increases in activity and the formation of novel products and enantiomers. CAVER analysis suggests possible increases in the active pocketvolume and formation of new active-site tunnels, suggesting additional degrees of freedom ofthe substrate in the pocket (Heinemann et al., Active-site loop variations adjust activity andselectivity of the cumene dioxygenase, Nat Commun.2021; 12: 1095). Compared to thecommon planar substrates of other ROs, cumene as the natural substrate of the CDO from Pseudomonas fluorescens IP01 is sterically more demanding, suggesting a larger active-site pocket and thus, an ideal starting point for further engineering approaches (Dong et al., loc. cit.). Previous studies showed allylic monohydroxylation, as well as dihydroxylation of a broad substrate scope including aromatics and monoterpenes, catalyzed by the CDO (Gally et al., loc. cit.)). Based on literature reports and structures, as well as sequence comparisons of the α-subunit of the CDO oxygenase with other ROs, Heinemann et al. (loc.cit.) selected the twoloops for this study, both located at the outer surface of the quaternary structure. The larger loop 1 (residues G236-N264) contributes mainly to an active-site tunnel while implying to form a cap over the buried active-site (Dong et al., loc. cit.; Chovancova E, et al. CAVER 3.0: a tool for the analysis of transport pathways in dynamic protein structures. PLoS Comput. Biol. 2012;8:23–30; Chothia C, Gough J, Vogel C, Teichmann SA. Evolution of the protein repertoire.Science. 2003;300:1701–1703). The b-factor values of loop 2 (F278-G290, Fig. 1c / d ofHeinemann et al., loc. cit.)) with up to 31.7 Å2 for the backbone of L284 indicates a high flexibility of the α-helix, compared to an average b-factor of 24.6 Å2 for the loop 2 backbone, orthe average b-factor of 21 Å2 for the whole α-subunit. The b-factor values of the backbone ofloop 1 peak in P260 with 57.6 Å2 (whole loop: 36.9 Å2), the highest value of the whole α-subunit. A sequence alignment with oxygenases from previously described ROs, like TDO, NDO, and novel ROs from Phenylobacterium immobile E, indicates very low conservation of the loops thatare framed by highly conserved motifs (see Fig.1e and Supplementary Fig.1 of Heinemann etal., loc. cit.). The 42 loop residues were subjected to an alanine scan, with wild-type alanine residues mutated to glycine. The generated variants were tested with styrene (1), (R)-(+)-limonene (2), and 2-phenylpyridine (3) as substrate panel, illuminating various aspects of thenew biocatalysts. They represent the different compound classes small aromatics (styrene), monoterpenes ((R)-(+)-limonene), and N-heterocycles (2-phenylpyridine). Furthermore, they were supposed to give further insights into changes of the chemoselectivity (allylic monohydroxylation vs. dihydroxylation), regioselectivity (aromatic ring vs. alkene side chain)and activity increases for a poorly accepted substrate (2-phenylpyridine); see Fig.2,Supplementary Figs.4–6 and Supplementary Table 1 of Heinemann et al. (loc. cit.).The plasmid pIP107D harboring the genes for cumene dioxygenase (CDO) from Pseudomonasfluorescens IP01, i.e. the CDO oxygenase, ferredoxin and reductase, can be found underGenbank accession number D37828.1 and was also described by Gally et al. (loc. cit.) and Aoki H, et al. (Cloning, nucleotide sequence, and characterization of the genes encoding enzymes involved in the degradation of cumene to 2-hydroxy-6-oxo-7-methylocta-2, 4-dienoic acid inPseudomonas fluorescens IP01. J. Ferment. Bioeng. 1996;81:187–196). SEQ ID NO: 1 showsthe amino acid sequence of the wildtype oxygenase alpha subunit CumA1 of the cumenedioxygenase from Pseudomonas fluorescens IP01, and SEQ ID NO: 5 the nucleic acidsequence encoding the wildtype oxygenase alpha subunit CumA1 of the cumene dioxygenasefrom Pseudomonas fluorescens IP01. SEQ ID NO: 2 shows the amino acid sequence of theoxygenase alpha subunit CumA1 I288Del of the cumene dioxygenase from Pseudomonasfluorescens IP01, and SEQ ID NO: 6 the nucleic acid sequence encoding the amino acidsequence of the oxygenase alpha subunit CumA1 I288Del of the cumene dioxygenase fromPseudomonas fluorescens IP01. SEQ ID NO: 3 shows the amino acid sequence of theoxygenase alpha subunit CumA1 I288Del_A321T of the cumene dioxygenase fromPseudomonas fluorescens IP01, and SEQ ID NO: 7 the nucleic acid sequence encoding theamino acid sequence of the oxygenase alpha subunit CumA1 I288Del_A321T of the cumenedioxygenase from Pseudomonas fluorescens IP01. SEQ ID NO: 4 shows the amino acidsequence of the oxygenase alpha subunit CumA1 N279T_I288Del_A321T of the cumenedioxygenase from Pseudomonas fluorescens IP01, and SEQ ID NO: 8 the nucleic acidsequence encoding the amino acid sequence of the oxygenase alpha subunit CumA1N279T_I288Del_A321T of the cumene dioxygenase from Pseudomonas fluorescens IP01. Theposition numbering of an amino acid residue used herein refers to the amino acid sequence of the wildtype oxygenase alpha subunit CumA1 of the cumene dioxygenase from Pseudomonasfluorescens IP01 depicted in SEQ ID NO: 1, if not indicated otherwise herein. Further, SEQ IDNO: 9 shows the amino acid sequence of the oxygenase beta subunit CumA2 of the wildtype cumene dioxygenase from Pseudomonas fluorescens IP01. SEQ ID NO: 10 shows the aminoacid sequence of the ferredoxin subunit CumA3 of the wildtype cumene dioxygenase fromPseudomonas fluorescens IP01. SEQ ID NO: 11 shows the amino acid sequence of thereductase subunit CumA4 of the wildtype cumene dioxygenase from Pseudomonas fluorescens IP01. The methods for the manufacture of a composition comprising santalol, bergamotol, nootkatolor bisabolene alcohol of the present invention use a polypeptide having cumene dioxygenaseactivity. The term “cumene dioxygenase activity” as used herein comprises or refers to or is anactivity of the enzyme that allows for converting at least one santalene into at least one santalol, and / or for converting at least one bergamotene into at least one bergamotol, and / or forconverting at least one valencene into at least one nootkatol and / or for converting at least onebisabolene into at least bisabolene alcohol. The activity and regioselectivity of the polypeptidehaving cumene dioxygenase activity is converted from ring-hydroxylation to tail hydroxylation,so the activity and regioselectivity of the polypeptide having cumene dioxygenase activitycomprises or is tail hydroxylation. Said conversion of at least one santalene into at least onesantalol comprises or is a monohydroxylation of the at least one santalene, monohydroxylationof the at least one bergamotene into at least one bergamotol, monohydroxylation of the at leastone valencene into at least one nootkatol, and / or monohydroxylation of the at least onebisabolene into at least one bisabolene alcohol, by said cumene dioxygenase activity. The term“cumene dioxygenase activity” can encompass further enzymatic activities, such as reductaseactivity and / or ferredoxin activity and / or oxygenase beta subunit CumA2 activity. For instance, the method for the manufacture of a composition comprising santalol uses at leastone polypeptide having cumene dioxygenase activity as defined herein, for converting at leastone santalene into at least one santalol. Said at least one polypeptide having cumenedioxygenase activity preferably comprises an amino selected from the group consisting of:a) an amino acid sequence, preferably the amino acid sequence of SEQ ID NO. 1, comprisinga single point deletion at the amino acid position corresponding to position 288 of SEQ ID NO.1 (amino acid sequence from oxygenase alpha subunit CumA1 of wildtype cumene dioxygenase from Pseudomonas fluorescens IP01);b) an amino acid sequence, preferably the amino acid sequence of SEQ ID NO. 1, comprisinga single point deletion at the amino acid position corresponding to position 288 of SEQ ID NO. 1and an Alanine to Threonine substitution at the amino acid position corresponding to position 321 of SEQ ID NO.1 (A321T);c) an amino acid sequence, preferably the amino acid sequence of SEQ ID NO. 1, comprisinga single point deletion at the amino acid position corresponding to position 288 of SEQ ID NO.1 and an Asparagine to Threonine substitution at the amino acid position corresponding to position 279 of SEQ ID NO.1 (N279T) and an Alanine to Threonine substitution at the amino acid position corresponding to position 321 of SEQ ID NO.1 (A321T); d) an amino acid sequence which is at least 60%, at least 70%, at least 80%, at least 85%, atleast 90%, at least 95%, at least 98% or at least 99% identical to the amino acid sequence ofSEQ ID NO.1 and has a single point deletion at the amino acid position corresponding to position 288 of SEQ ID NO.1;e) an amino acid sequence which is at least 60%, at least 70%, at least 80%, at least 85%, atleast 90%, at least 95%, at least 98% or at least 99% identical to the amino acid sequence of SEQ ID NO.1 and has a single point deletion at the amino acid position corresponding to position 288 of SEQ ID NO.1 and an Alanine to Threonine substitution at the amino acid position corresponding to position 321 of SEQ ID NO.1 (A321T);f) an amino acid sequence which is at least 60%, at least 70%, at least 80%, at least 85%, atleast 90%, at least 95%, at least 98% or at least 99% identical to the amino acid sequence of SEQ ID NO.1 and has a single point deletion at the amino acid position corresponding to position 288 of SEQ ID NO.1 and an Asparagine to Threonine substitution at the amino acid position corresponding to position 279 of SEQ ID NO.1 (N279T) and an Alanine to Threonine substitution at the amino acid position corresponding to position 321 of SEQ ID NO.1 (A321T); andg) a fragment of the amino acid sequence of a), b) or c), said fragment exhibiting cumenedioxygenase activity. The “sequence identity” referred to herein above defines a relationship between amino acid sequences or nucleic acid sequences and can be determined by comparing those sequences. Usually, sequence identities are determined by comparing two sequences over the whole length of the sequences but may also be compared only for a part of the sequences aligning with each other. Preferably, the sequence identities are compared over the whole length of the sequences, herein. Sequence identity refers to the degree of relatedness between polypeptide sequences or nucleic acid sequences. It will be expressed in the percentage of identical amino acids or nucleotides in two sequences compared to each other. Accordingly, upon aligning two sequences, the number of matching amino acids or nucleotides between those sequences is, in general, determined and put into relation to the total number of amino acids or nucleotides in the aligned sequence or sequence part. For instance, variant sequences may be defined by their sequence identity when compared to a parent sequence. Such variant sequences are, forinstance, amino acid sequences as shown in any one of SEQ ID NO: 2, 3, or 4, or nucleic acidsequences encoding said amino acid sequences shown in any one of SEQ ID NO: 6, 7, or 8.The corresponding parent sequence is the amino acid sequence as shown in SEQ ID NO: 1, orthe nucleic acid sequence encoding said amino acid sequence shown in SEQ ID NO: 5. Todetermine the percent-identity between two sequences in a first step a pairwise sequence alignment is generated between those two sequences, wherein the two sequences are aligned over their complete, entire or full length (i.e., a pairwise global alignment). The alignment is generated with a program or software described herein. The preferred alignment for the purpose of this invention is that alignment, from which the highest sequence identity can bedetermined. Further, a sequence alignment as referred to herein means preferably a sequencealignment over the entire length of two or more nucleic acid or protein sequences, if not indicated otherwise herein. Sequence alignments can be generated with a number of software tools, such as Needlemanand Wunsch algorithm - Needleman, Saul B. & Wunsch, Christian D. (1970). "A general methodapplicable to the search for similarities in the amino acid sequence of two proteins". Journal ofMolecular Biology 48 (3): 443–453. This algorithm is, for example, implemented into the“NEEDLE” program, which performs a global alignment of two sequences. The NEEDLE program, is contained within, for example, the European Molecular Biology Open Software Suite(EMBOSS). EMBOSS - a collection of various programs: The European Molecular BiologyOpen Software Suite (EMBOSS), Trends in Genetics 16 (6), 276 (2000). BLOSUM (BLOcksSUbstitution Matrix) - typically generated on the basis of alignments of conserved regions, e.g.,of protein domains (Henikoff S, Henikoff JG: Amino acid substitution matrices from protein blocks. Proceedings of the National Academy of Sciences of the USA.1992 Nov 15; 89(22): 10915-9). One out of the many BLOSUMs is “BLOSUM62”, which is often the “default” setting for many programs, when aligning protein sequences. BLAST (Basic Local Alignment SearchTool) – consists of several individual programs (BlastP, BlastN) which are mainly used to searchfor similar sequence in large sequence databases. BLAST programs also create local alignments. Typically used is the “BLAST” interface provided by NCBI (National Centre for Biotechnology Information), which is the improved version (“BLAST2”). The “original” BLAST: Altschul, S.F., Gish, W., Miller, W., Myers, E.W. & Lipman, D.J. (1990) "Basic local alignmentsearch tool." J. Mol. Biol.215:403-410; BLAST2: Altschul, Stephen F., Thomas L. Madden,Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res.25:3389-3402. Sequence identity as used herein is, preferably, the value as determined by the EMBOSS Pairwise Alignment Algorithm "Needle". In particular, the NEEDLE program from the EMBOSS package can be used (version 2.8.0 or higher, EMBOSS: The European Molecular BiologyOpen Software Suite - Rice, P., et al. Trends in Genetics (2000) 16: 276-277;http: / / emboss.bioinformatics.nl) using the NOBRIEF option ('Brief identity and similarity' to NO) which calculates the "longest­ identity". The identity between the two aligned sequences is calculated in such a case as follows: Number of corresponding positions in the alignment showing an identical amino acid in both sequences divided by the total length of the alignmentafter subtraction of the total number of gaps in the alignment. For alignment of amino acidsequences the default parameters are: Matrix = Blosum62; Open Gap Penalty = 10.0; Gap Extension Penalty = 0.5. For alignment of nucleic acid sequences the default parameters are: Matrix = DNAfull; Open Gap Penalty = 10.0; Gap Extension Penalty = 0.5. Variant amino acid or nucleic acid sequences as referred to herein may be naturally occurring variations such as allelic variants or orthologous, paralogous or homologous variants. Alternatively, such sequences may be artificially generated, e.g., in an attempt to improve a property of the enzyme or nucleic acid (e.g., improved expression of the enzyme or increased enzymatic activity of the enzyme) by a biological technique known to the skilled person in the art, such as, e.g., molecular evolution or rational design, or by using a mutagenesis technique known in the art and described elsewhere herein (random mutagenesis, site-directed mutagenesis, directed evolution, gene recombination, etc.). Typically, variants of the polypeptides with cumene dioxygenase activity as defined herein used in the methods of the invention are polypeptides with one or several amino acid substitutions and / or one or moredeletions, compared to the amino acid sequence of SEQ ID NO, 2, 3, or 4, preferably, artificialamino acid sequences known in the art.Variant nucleic acid sequences of the nucleic acid sequence of SEQ ID NO: 6, 7, or 8, orencoding an amino acid sequence as shown in SEQ ID NO: 2, 3, or 4, or an amino acidsequence encoded by a nucleic acid sequence which is at least 60%, at least 65%, at least70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least97%, at least 98%, or at least 99% identical to the nucleic acid sequence as shown in SEQ IDNO: 6, 7, or 8 may differ from said nucleic acid sequence due to at least one nucleotidesubstitution, addition and / or deletion. It will be understood that polynucleotides comprising such variant nucleic acid sequences as referred to herein, preferably, are capable of hybridizing to each other under stringent hybridization conditions. Stringent hybridization conditions as referred to herein are, preferably, 6 x sodium chloride / sodium citrate (SSC) at approximately 45°C, followed by one or more wash steps in 0.2 x SSC, 0.1% SDS at 50 to 65°C. The skilled worker knows that these hybridization conditions differ depending on the type of nucleic acid and, for example when organic solvents are present, with regard to the temperature and concentration of the buffer. For example, under “standard hybridization conditions” the temperature differs depending on the type of nucleic acid between 42°C and 58°C in aqueous buffer with a concentration of 0.1 to 5 x SSC (pH 7.2). If organic solvent is present in the abovementioned buffer, for example 50% formamide, the temperature under standard conditions is approximately 42°C. The hybridization conditions for DNA: DNA hybrids are, preferably, 0.1 x SSC and 20°C to 45°C, preferably between 30°C and 45°C. The hybridization conditions for DNA:RNA hybrids are, preferably, 0.1 x SSC and 30°C to 55°C, preferably between 45°C and 55°C. The abovementioned hybridization temperatures are determined for example for a nucleic acid with approximately 100 bp (= base pairs) in length and a G + C content of 50% in the absence of formamide. The skilled worker knows how to determine the hybridization conditions required by referring to textbooks such as the textbook mentioned above, or the following textbooks: Sambrook et al., "Molecular Cloning”, Cold Spring Harbor Laboratory, 1989; Hames and Higgins (Ed.) 1985, ”Nucleic Acids Hybridization: A Practical Approach”, IRL Press at Oxford University Press, Oxford; Brown (Ed.) 1991, "Essential Molecular Biology: A Practical Approach”, IRL Press at Oxford University Press, Oxford. Thus, variant nucleic acid sequences can be derived from polynucleotides which are capable of hybridizing under stringent hybridization conditions to nucleic acid sequences encoding an amino acid sequence encoded by a nucleic acid sequence as shown in SEQ ID NO: 6, 7, or 8, or an amino acid sequence encoded by a nucleic acid sequence which is at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identical to the nucleic acid sequence as shown in SEQ ID NO: 6, 7, or 8.The invention further relates to a method for preparing a variant polypeptide having cumenedioxygenase activity as defined herein, comprising the steps of:(a) selecting a nucleic acid according to any one of SEQ ID NO: 6, 7, or 8; (b) modifying the selected nucleic acid to obtain at least one mutant nucleic acid; (c) transforming host cells or unicellular organisms as defined herein with the mutant nucleic acid sequence to express a polypeptide encoded by the mutant nucleic acid sequence; (d) screening the polypeptide for at least one modified property; and,(e) optionally, if the polypeptide has no desired cumene dioxygenase activity as defined herein,repeating the process steps (a) to (d) until a polypeptide with a desired cumene dioxygenaseactivity as defined herein is obtained; (f) optionally, if a polypeptide having a desired cumene dioxygenase activity was identified in step (d), isolating the corresponding mutant nucleic acid obtained in step (c). A fragment as referred to above may be a polypeptide consisting of any amino acid sequence ofthe above-mentioned sequences and sequence variants that is of sufficient length of exhibitinga cumene dioxygenase activity specified herein. It is, thus, preferably envisaged that a fragment having the aforementioned biological activity of the polypeptide comprises the amino acid sequence of the catalytically active region of a cumene dioxygenase, preferably the catalytically active region of the oxygenase alpha subunit CumA1 of the cumene dioxygenase from Pseudomonas fluorescens IP01. Typically, a fragment consists of at least 20, at least 30, at least 40, at least 50, at least 100, at least 150 or at least 200 contiguous amino acids in length from the above-mentioned sequences or sequence variants.The aforementioned polypeptide exhibiting cumene dioxygenase activity as defined herein mayalso be comprised by a fusion polypeptide. Such a fusion polypeptide comprises, in addition tothe amino acid sequence of the polypeptide exhibiting cumene dioxygenase activity as definedherein, one or more additional amino acid sequences. Said additional amino acid sequencesmay be polypeptides having other enzymatic activities, such as farnesyl pyrophosphatesynthases or cytochrome P450 monooxygenases or polypeptides or peptides having marker orlabel functions for, e.g., monitoring proper expression or for purification purposes, such as tags (e.g., MYC tag, FLAG tag, His tag, etc.) or fluorescent proteins (e.g., GFP, BFP, YFP or CFP). The tag peptide is preferably selected from the group of nitrogen utilization proteins (NusA), thioredoxins (Trx), maltose-binding proteins (MBP), Glutathione S-transferases (GST), Small Ubiquitin-like Modifier (SUMO) or Calcium-binding proteins (Fh8), and functional homologues thereof. As used herein, a functional homologue of a tag peptide is a tag peptide having at leastabout the same effect on the solubility of the tagged enzyme, compared to the non-taggedenzyme. Typically, the homologue differs in that one or more amino acid residues have been inserted, substituted, deleted from, or extended to the peptide of which it is a homologue. The homologue may in particular comprise one or more substitutions of a hydrophilic amino acid for another hydrophilic amino acid, or of a hydrophobic amino acid for another. The homologue may, in particular, have a sequence identity of at least 40 %, more in particular of at least 50 %,preferably of at least 55 %, more preferably of at least 60 %, at least 70 %, at least 75 %, atleast 80 %, at least 85 %, at least 90 %, at least 95 %, at least 98 %, or at least 99 % sequence identity with the sequence of a NusA, Trx, MBP, GST, SUMO or Fh8. Particularly suitable is maltose-binding protein from Escherichia coli, or a functional homologue thereof.The use of a tagged enzyme in the method for the manufacture of a composition comprisingsantalol of the invention, is in particular advantageous in that it may contribute to an increasedproduction, especially increased cellular production of a santalol. For improved solubility of the tagged enzyme (compared to the enzyme without the tag), the first segment of the enzyme is preferably bound at its C-terminus to the N-terminus of the second segment. Alternatively, the first segment of the tagged enzyme is bound at its N-terminus to the C-terminus of the second segment. Further, the present invention is directed to a nucleic acid comprising a nucleotide sequence encoding a polypeptide, the polypeptide comprising a first segment comprising a tag peptide, preferably an MBP, a NusA, a Trx, a GST, a SUMO or anFh8-tag, or a functional homologue of any of these, and a second segment comprising a polypeptide having cumene dioxygenase activity as defined herein. The second segment may, for instance, comprise an amino acid sequence as shown in any one of SEQ ID NO: 2, 3, or 4, or a functional analogue thereof.Santalene is one example for a substrate that can be used as by the polypeptide exhibiting acumene dioxygenase activity specified herein. Santalene relates to a tri-cyclic sequiterpeneselected from the group consisting of alpha-santalene (CAS number 512-61-8; 6,7-Dimethyl-7-(4-methylpent-3-enyl)- 2,3,4,5-tetrahydro-1H-tricyclo [2.2.1.02,6] heptan; molecular formulaC15H24), beta-santalene (CAS number 511-59-1, (1R,3R,4S)- 3-Methyl-2-methyliden-3- (4-methylpent-3-enyl) bicycle [2.2.1] heptan; molecular formula C15H24), and epi-beta-santalene(CAS number 25532-78-9; (3S)-3-Methyl-2- methyliden-3- (4-methylpent-3-enyl)bicycle [2.2.1]heptan; molecular formula C15H24). Preferably, said santalene is beta-santalene (CAS number 511-59-1, molecular formula C15H24). Formula I Formula I is a representation of (-)-b-santalene (CAS number 511-59-1; hereinafter referred to as beta-santalene)The “at least one santalene” referred to in accordance with the present invention is alpha-santalene, beta-santalene, a mixture of alpha-santalene and beta-santalene, or an isomericmixture of santalene. Preferably, it is a mixture of beta-santalene and alpha-santalene, whereinbeta-santalene is present in the composition in a relative amount to total santalenes of at leastabout 10%, preferably, between about 12% and about 35%, or between about 15% and about 30%. Total santalenes as referred to herein encompass all santalenes found in the composition.Preferably, these are alpha-santalene, beta-santalene, and bergamotene such as trans alphabergamotene. Other minor santalenes may occur as well.The composition manufactured by the method for manufacturing of a composition comprisingsantalol of the invention, comprises at least one santalol as defined herein, such as (Z)-α-santalol, (Z)-β-santalol, or (Z)-epi-β-santalol, or a mixture comprising (Z)-α-santalol and (Z)-β-santalol.In a preferred embodiment of the method for the manufacture of a composition comprisingsantalol of the invention, said at least one santalene is alpha-santalene, beta-santalene, amixture of alpha-santalene and beta-santalene, or an isomeric mixture of santalene. Preferably,the mixture is a mixture of beta-santalene and alpha-santalene, wherein beta-santalene ispresent in the composition in a relative amount to total santalenes of at least about 10%,preferably, between about 12% and about 35%, or between about 15% and about 30%. Totalsantalenes as referred to herein encompass preferably all santalenes found in the composition.The mixture can encompass one or more further sesquiterpenes such as bergamotene, e.g.trans alpha bergamotene, or others as set forth above, in addition to alpha-santalene and beta-santalene.In another preferred embodiment of the method for the manufacture of a compositioncomprising santalol of the invention, said conversion of at least one santalene into at least onesantalol comprises or is monohydroxylation of the at least one santalene.In a further preferred embodiment of the method for the manufacture of a compositioncomprising santalol of the invention, the activity and regioselectivity of the polypeptide havingcumene dioxygenase activity is converted from ring-hydroxylation to tail hydroxylation, in comparison to the activity of wildtype cumene dioxygenase from Pseudomonas fluorescensIP01. So the activity and regioselectivity of the polypeptide having cumene dioxygenase activityused in said method comprises or is tail hydroxylation.In still another embodiment of the method for the manufacture of a composition comprisingsantalol of the invention, said at least one santalol is alpha-santalol, preferably (Z)-alphasantalol, beta-santalol, preferably (Z)-beta santalol, a mixture of alpha-santalol and beta-santalol, preferably a mixture comprising (Z)-alpha santalol and (Z)-beta santalol, or whereinsaid at least one santalol is preferably enantiopure alpha-santalol or enantiopure beta-santalol,more preferably enantiopure (Z)-alpha santalol, or enantiopure (Z)-beta santalol. The mixturecan encompass also one or more further sesquiterpene alcohols such as Z-lanceol andbergamotol.In a further preferred embodiment of the method for the manufacture of a compositioncomprising santalol of the invention, the step of converting at least one santalene into at leastone santalol is carried out in vitro or in a host cell. The aforementioned conversion step may be carried out in vitro, i.e. in a suitable reaction vial containing all components required for the conversion as described above. The skilled person is well aware of how to adjust the reaction conditions such that the reaction will be carried out efficiently. For example, suitable buffers may be used to provide the components in an environment having a suitable pH and suitable salt concentrations. A suitable temperature in such a setting can be applied as well without further ado. Alternatively, the conversion step may be carried out in a host cell as described elsewhere herein. It is to be understood that the host cell shall be capable of producing santalol. If necessary, the host cell needs to be genetically modified in order to express enzymes orproteins required for the santalol synthesis including the aforementioned polypeptide havingcumene dioxygenase activity as defined herein. For instance, the host cell shall be cultivated under conditions and for a time sufficient to allow expression of the aforementioned enzymes and for conversion of farnesyl pyrophosphate into at least one santalene. Particular preferred conditions are also described in the accompanying Examples, below, or known to those skilled in the art.The host cell as used herein relates to a prokaryotic or eukaryotic cell which is capable ofconverting at least one santalene into at least one santalol, wherein said conversion is carriedout by a polypeptide exhibiting cumene dioxygenase activity as defined herein. Thus, the hostcell is capable of expressing the polypeptide exhibiting cumene dioxygenase activity as defined herein. Preferably, said polypeptide exhibiting cumene dioxygenase activity as defined herein may be encoded by the heterologous polynucleotide or vector or gene construct described elsewhere herein. The host cell is, typically transformed with said heterologous polynucleotide, vector or gene construct such that the polypeptide exhibiting cumene dioxygenase activity as defined herein can be expressed. The transformed vector or gene construct may be maintained as a non-integrated vector, for example, a plasmid, or alternatively, may be integrated into the host cell genome as specified elsewhere herein in more detail.In one aspect of the invention, the host cell is a transgenic cell, i.e. transgenic for the nucleicacid encoding the polypeptide exhibiting cumene dioxygenase as defined herein, preferably a transgenic non-plant cell such as a transgenic microorganism cell.A host cell as used herein may be produced based on standard genetic and molecular biologytechniques that are generally known in the art, e.g., as described in Sambrook, J., and Russell, D.W. "Molecular Cloning: A Laboratory Manual" 3d ed., Cold Spring Harbor Laboratory Press,Cold Spring Harbor, NY, (2001); and F.M. Ausubel et al, eds., "Current protocols in molecularbiology", John Wiley and Sons, Inc., New York (1987), and later supplements thereto. The host cell can be selected from any one of the following organisms: Bacteria: The bacterial host cell can, for example, be selected from the group consisting of the genera Escherichia, Klebsiella, Helicobacter, Bacillus, Lactobacillus, Streptococcus, Amycolatopsis,Rhodobacter, Pseudomonas, Paracoccus, Lactococcus, Ensifer or Pantoea.gram positive: Bacillus, Streptomyces: Useful gram positive bacterial host cells include, but arenot limited to, a Bacillus cell, e.g., Bacillus alkalophius, Bacillus amyloliquefaciens, Bacillusbrevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Bacillus firmus, Bacillus Jautus, Bacillus lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus pumilus, Bacillusstearothermophilus, Bacillus subtilis, and Bacillus thuringiensis. Most preferred, the prokaryoteis a Bacillus cell, preferably, a Bacillus cell of Bacillus subtilis, Bacillus pumilus, Bacilluslicheniformis, or Bacillus lentus.Some other preferred bacteria include strains of the order Actinomycetales, preferably,Streptomyces, preferably Streptomyces spheroides (ATTC 23965), Streptomycesthermoviolaceus (IFO 12382), Streptomyces lividans or Streptomyces murinus orStreptoverticillum verticillium ssp. verticillium. Other preferred bacteria include Rhodobacter sphaeroides, Rhodomonas palustri, Streptococcus lactis. Further preferred bacteria include strains belonging to Myxococcus, e.g., M. virescens. gram negative: Escherichia, Pseudomonas, Rhodobacter, Paracoccus, Ensifer or Pantoea species: Preferred gram negative bacteria are Escherichia coli, Pseudomonas sp., preferably, Pseudomonas purrocinia (ATCC 15958) or Pseudomonas fluorescens (NRRL B-11) or Pseudomonas denitrificans, Rhodobacter capsulatus or Rhodobacter sphaeroides, Paracoccus carotinifaciens, Paracoccus zeaxanthinifaciens, Pantoea ananatis, or Sinorhizobium melilotialso known as Ensifer meliloti.Fungi: Aspergillus, Fusarium, Trichoderma: The host cell may be a fungal cell. "Fungi" as used hereinincludes the phyla Ascomycota, Basidiomycota, Chytridiomycota, and Zygomycota as well asthe Oomycota and Deuteromycotina and all mitosporic fungi. Representative groups ofAscomycota include, e.g., Neurospora, Eupenicillium (=Penicillium), Emericella (=Aspergillus),Eurotium (=Aspergillus), and the true yeasts listed below. Examples of Basidiomycota includemushrooms, rusts, and smuts. Representative groups of Chytridiomycota include, e.g.,Allomyces, Blastocladiella, Coelomomyces, and aquatic fungi. Representative groups ofOomycota include, e.g. Saprolegniomycetous aquatic fungi (water molds) such as Achlya.Examples of mitosporic fungi include Aspergillus, Penicillium, Candida, and Alternaria.Representative groups of Zygomycota include, e.g., Rhizopus and Mucor.Some preferred fungi include strains belonging to the subdivision Deuteromycotina, class Hyphomycetes, e.g., Fusarium, Humicola, Tricoderma, Myrothecium, Verticillum, Arthromyces,Caldariomyces, Ulocladium, Embellisia, Cladosporium or Dreschlera, in particular Fusariumoxysporum (DSM 2672), Humicola insolens, Trichoderma resii, Myrothecium verrucana (IFO6113), Verticillum alboatrum, Verticillum dahlie, Arthromyces ramosus (FERM P-7754),Caldariomyces fumago, Ulocladium chartarum, Embellisia alli or Dreschlera halodes. Otherpreferred fungi include strains belonging to the subdivision Basidiomycotina, classBasidiomycetes, e.g. Coprinus, Phanerochaete, Coriolus or Trametes, in particular Coprinuscinereus f. microsporus (IFO 8371), Coprinus macrorhizus, Phanerochaete chrysosporium (e.g.NA-12) or Trametes (previously called Polyporus), e.g. T. versicolor (e.g. PR428-A).Further preferred fungi include strains belonging to the subdivision Zygomycotina, classMycoraceae, e.g. Rhizopus or Mucor, in particular Mucor hiemalis.Yeast, Pichia, Saccharomyces: The fungal host cell may be a yeast cell. Yeast as used hereinincludes ascosporogenous yeast (Endomycetales), basidiosporogenous yeast, and yeastbelonging to the Fungi lmperfecti (Blastomycetes). The ascosporogenous yeasts are dividedinto the families Spermophthoraceae and Saccharomycetaceae. The latter is comprised of foursubfamilies, Schizosaccharomycoideae (e.g., genus Schizosaccharomyces), Nadsonioideae,Lipomycoideae, and Saccharomycoideae (e.g. genera Kluyveromyces, Pichia, andSaccharomyces). The basidiosporogenous yeasts include the genera Leucosporidim,Rhodosporidium, Sporidiobolus, Filobasidium, and Filobasidiella. Yeasts belonging to the Fungilmperfecti are divided into two families, Sporobolomycetaceae (e.g., genera Sporobolomycesand Bullera) and Cryptococcaceae (e.g. genus Candida). Eukaryotes: Eukaryotic host cells further include, without limitation, a non-human animal cell, a non-human mammal cell, an avian cell, reptilian cell, insect cell or a plant cell.Preferably, the host cell is selected from the group consisting of: a bacterial cell, a yeast cell, afungal cell, an algal cell or a cyanobacterial cell, a non-human animal cell or a non-human mammalian cell, and a plant cell.Most preferably, the host cell is a bacterial host cell, in particular, a Rhodobacter host cell.Yet, the conversion step of the method for the manufacture of a composition comprising santalolof the present invention may also be carried out in an organism, typically a multi-cellular organism such as the transgenic non-human organism referred to elsewhere herein. Typically, said organism is genetically modified such that the enzymes required for conversion of farnesyl pyrophosphate into at least one santalene are also expressed. The skilled person is, however, well aware of what conditions need to be applied depending on the choice of a given non- human transgenic organism.In case, the method for the manufacture of a composition comprising santalol of the invention iscarried out in vivo, i.e. in a host cell or a non-human transgenic organism it will be understood that the said host cell or non-human transgenic organism shall express the polypeptideexhibiting cumene dioxygenase activity as specified herein, such that the conversion of at leastone santalene into at least one santalol can be carried out in said host cell or non-humantransgenic organism. Preferably, said polypeptide exhibiting cumene dioxygenase activity asspecified herein is encoded by a heterologous polynucleotide, a vector or a gene constructdefined elsewhere herein.In a still further preferred embodiment of the method for the manufacture of a compositioncomprising santalol of the invention, the step of converting at least one santalene into at leastone santalol is carried out in a non-human transgenic organism. Preferably, said non-humantransgenic organism is a microorganism such as a Rhodobacter bacterium, a plant or a non-human animal, or a non-human animal to be sacrificed. In accordance with the latter, methodsof treating animals are not encompassed within the methods of the present invention.The transgenic non-human organism as used herein refers to an organism which has beengenetically modified in order to comprise the polynucleotide, vector or gene construct as specified elsewhere in this text. Said genetic modification may be the result of any kind of homologous or heterologous recombination event, mutagenesis or gene editing process. Accordingly, the transgenic non-human organism shall differ from its non-transgenic counterpart in that it comprises the non-naturally occurring (i.e. heterologous) polynucleotide, vector or gene construct in its genome. Non-human organisms envisaged as transgenic non-human organisms are, preferably, multi-cellular organisms. Moreover, the non-human organisms are, preferably, animals or plants. Preferred animals are mammals, in particular laboratory animals such as rodents, e.g., mice, rats, rabbits or the like, or farming animals such as sheep, goat, cows, horses or the like. Preferred plants are crop plants or vegetables, in particular, selected from the group consisting of Arabidopsis spp., Nicotiana spp, Cichorum intybus, Lactuca sativa, Mentha spp, Artemisia annua, tuber forming plants, oil crops, e.g. Brassica spp. or Brassica napus, flowering plants (angiosperms) which produce fruits, and trees. Methods for the production of transgenic non-human organisms are well known in the art; see, e.g. Lee-Yoon Low et al., Transgenic Plants: Gene constructs, vector and transformation method.2018. DOI.10.5772 / intechopen.79369; Pinkert, C. A. (ed.) 1994. Transgenic animal technology: A laboratory handbook. Academic Press, Inc., San Diedo, Calif.; Monastersky G. M. and Robl, J. M. (ed.) (1995) Strategies in Transgenic Animal Science. ASM Press. Washington D.C); Sambrook, loc.cit, Ausubel, loc.cit).In another preferred embodiment of the method for the manufacture of a compositioncomprising santalol of the invention, said polypeptide exhibiting cumene dioxygenase activity asdefined herein is encoded by a heterologous polynucleotide, a vector or a gene construct asdefined below.A heterologous polypeptide as used herein means that the polynucleotide encoding thepolypeptide exhibiting or having cumene dioxygenase activity as defined herein is not naturallyoccurring in the host cell or organism into which it is introduced. Thus, a heterologous polynucleotide originates from a first species or is an artificially modified polynucleotide, while the host cell or non-human transgenic organism is from a second species that differs from said first species. A heterologous polynucleotide may be comprised in a vector or gene construct as specified herein. Alternatively, it may be introduced into the genome of a host cell or non-human transgenic organism such that upon integration into the genome the polypeptide exhibitingcumene dioxygenase activity as defined herein encoded by said heterologous polynucleotidewill be expressed. Typically, the heterologous polynucleotide shall be integrated into the genome of the host cell or non-human transgenic organism at a locus that allows expression of the heterologous polynucleotide, e.g., in proximity to an endogenous promoter.A vector as used herein encompasses phage, plasmid, cosmids, viral vectors as well as artificialchromosomes, such as bacterial or yeast artificial chromosomes (YAC). The vector encompassing the polynucleotide encoding the polypeptide exhibiting cumene dioxygenase activity as defined herein, preferably, further comprises selectable markers for propagation and / or selection in a host. The vector may be incorporated into a host cell by various techniques well known in the art. If introduced into a host cell, the vector may reside in the cytoplasm or may be incorporated into the genome. In the latter case, it is to be understood that the vector may further comprise nucleic acid sequences which allow for homologous recombination or heterologous insertion. Vectors can be introduced into prokaryotic or eukaryotic cells via conventional transformation or transfection techniques. The terms “transformation” and “transfection”, conjugation and transduction, as used in the present context, are intended to comprise a multiplicity of prior-art processes for introducing foreign nucleic acid (for example DNA) into a host cell, including calcium phosphate, rubidium chloride or calcium chloride co- precipitation, DEAE-dextran-mediated transfection, lipofection, f-mating, natural competence,carbon-based clusters, chemically mediated transfer, electroporation or particle bombardment.Suitable methods for the transformation or transfection of host cells, including plant cells, can be found in Sambrook et al. (loc. cit.) and other laboratory manuals, such as Methods in Molecular Biology, 1995, Vol.44, Agrobacterium protocols, Ed.: Gartland and Davey, Humana Press, Totowa, New Jersey. Alternatively, a plasmid vector may be introduced by heat shock or electroporation techniques. Should the vector be a virus, it may be packaged in vitro using an appropriate packaging cell line prior to application to host cells. Preferably, the vector referred to herein is suitable as a cloning vector, i.e. replicable in microbial systems. Such vectors ensure efficient cloning in bacteria and, preferably, yeasts or fungi and make possible the stable transformation of plants. Those which must be mentioned are, in particular, various binary and co-integrated vector systems which are suitable for the T DNA-mediated transformation. Such vector systems are, as a rule, characterized in that they contain at least the vir genes, which are required for the Agrobacterium-mediated transformation, and the sequences which delimit the T-DNA (T-DNA border). These vector systems, preferably, also comprise further cis-regulatory regions such as promoters and terminators and / or selection markers with which suitable transformed host cells or organisms can be identified. While co-integrated vector systems have vir genes and T DNA sequences arranged on the same vector, binary systems are based on at least two vectors, one of which bears vir genes, but no T-DNA, while a second one bears T DNA, but no vir gene. As a consequence, the last-mentioned vectors are relatively small, easy to manipulate and can be replicated both in E. coli and in Agrobacterium. These binary vectors include vectors from the pBIB-HYG, pPZP, pBecks, pGreen series. Preferably used in accordance with the invention are Bin19, pBI101, pBinAR, pGPTV and pCAMBIA. An overview of binary vectors and their use can be found in Hellens et al, Trends in Plant Science (2000) 5, 446–451. Furthermore, by using appropriate cloning vectors, the polynucleotides can be introduced into host cells or organisms such as plants or animals and, thus, be used in the transformation of plants, such as those which are published, and cited, in: Plant Molecular Biology and Biotechnology (CRC Press, Boca Raton, Florida), chapter 6 / 7, pp.71-119 (1993); F.F. White, Vectors for Gene Transfer in Higher Plants; in: Transgenic Plants, vol.1, Engineering and Utilization, Ed.: Kung and R. Wu, Academic Press, 1993, 15-38; B. Jenes et al., Techniques for Gene Transfer, in: Transgenic Plants, vol.1, Engineering and Utilization, Ed.: Kung and R. Wu, Academic Press (1993), 128- 143; Potrykus 1991, Annu. Rev. Plant Physiol. Plant Molec. Biol.42, 205225.More preferably, the vector is an expression vector. In such an expression vector, i.e. a vectorwhich comprises the polynucleotide encoding the polypeptide exhibiting cumene dioxygenaseactivity as defined herein having the nucleic acid sequence operatively linked to an expressioncontrol sequence (also called “expression cassette”) allowing expression in prokaryotic or eukaryotic cells or isolated fractions thereof. Suitable expression vectors are known in the art such as Okayama-Berg cDNA expression vector pcDV1 (Pharmacia), pCDM8, pRc / CMV, pcDNA1, pcDNA3 (Invitrogen) or pSPORT1 (GIBCO BRL). Further examples of typical fusion expression vectors are pGEX (Pharmacia Biotech Inc; Smith 1988, Gene 67:31-40), pMAL (New England Biolabs, Beverly, MA) and pRIT5 (Pharmacia, Piscataway, NJ), where glutathione S transferase (GST), maltose E-binding protein and protein A, respectively, are fused with the recombinant target protein. Examples of suitable inducible nonfusion E. coli expression vectors are, inter alia, pTrc (Amann 1988, Gene 69:301-315) and pET 11d (Studier 1990, Methods in Enzymology 185, 60-89). The tar-get gene expression of the pTrc vector isbased on the transcription from a hybrid trp-lac fusion promoter by host RNA polymerase. Thetarget gene expression from the pET 11d vector is based on the transcription of a T7-gn10-lac fusion promoter, which is mediated by a co-expressed viral RNA polymerase (T7 gn1). This viral polymerase is provided by the host strains BL21 (DE3) or HMS174 (DE3) from a resident lambda-prophage which harbours a T7 gn1 gene under the transcriptional control of the lacUV 5 promoter. The skilled worker is familiar with other vectors which are suitable in prokaryotic organisms; these vectors are, for example, in E. coli, pLG338, pACYC184, the pBR series such as pBR322, the pUC series such as pUC18 or pUC19, the M113mp series, pKC30, pRep4, pHS1, pHS2, pPLc236, pMBL24, pLG200, pUR290, pIN-III113-B1, lambdagt11 or pBdCl, inStreptomyces plJ101, plJ364, plJ702 or plJ361, in Bacillus pUB110, pC194 or pBD214, inCorynebacterium pSA77 or pAJ667. Examples of vectors for expression in the yeast S.cerevisiae comprise pYep Sec1 (Baldari 1987, Embo J.6:229-234), pMFa (Kurjan 1982, Cell 30:933-943), pJRY88 (Schultz 1987, Gene 54:113-123) and pYES2 (Invitrogen Corporation, San Diego, CA). Vectors and pro-cesses for the construction of vectors which are suitable for use in other fungi, such as the filamentous fungi, comprise those which are described in detail in: van den Hondel, C.A.M.J.J., & Punt, P.J. (1991) “Gene transfer systems and vector development for filamentous fungi, in: Applied Molecular Genetics of fungi, J.F. Peberdy et al., Ed., pp.1-28, Cambridge University Press: Cambridge, or in: More Gene Manipulations in Fungi (J.W. Bennett & L.L. Lasure, Ed., pp.396-428: Academic Press: San Diego). Further suitable yeast vectors are, for example, pAG-1, YEp6, YEp13 or pEMBLYe23. As an alternative, thepolynucleotides can be also expressed in insect cells using baculovirus expression vectors.Baculovirus vectors which are available for the expression of proteins in cultured insect cells (for example Sf9 cells) comprise the pAc series (Smith 1983, Mol. Cell Biol.3:2156-2165) and the pVL series (Lucklow 1989, Virology 170:31-39). Yet the vector may be an integration vector. An integration vector refers to a DNA molecule, linear or circular, that can be incorporated, e.g., into a microorganism's genome, such as a bacteria’s genome, and provides for stable inheritance of a gene encoding a polypeptide of interest, such as the polypeptide having cumene dioxygenase activity as defined herein. The integration vector generally comprises one or more segments comprising a gene sequence encoding a polypeptide of interest under the control of (i.e., operably linked to) additional nucleic acid segments that provide for its transcription. Such additional segments may include promoter and terminator sequences, and one or more segments that drive the incorporation of the gene of interest into the genome of the target cell, usually by the process of homologous recombination. Typically, the integration vector will be one which can be transferred into the target cell, but which has a replicon which is non­functional in that organism. Integration of the segment comprising the gene of interest may be selected if an appropriate marker is included within that segment. One or more nucleic acid sequences encoding appropriate signal peptides that are not naturally associated with apolypeptide to be expressed in a host cell can be incorporated into (expression) vectors. Forexample, a DNA sequence for a signal peptide leader can be fused in-frame to a nucleic acid sothat is initially translated as a fusion protein comprising the signal peptide. Depending on thenature of the signal peptide, the expressed polypeptide will be targeted differently. A secretory signal peptide that is functional in the intended host cells, for instance, enhances extracellular secretion of the expressed polypeptide. Other signal peptides direct the expressed polypeptide to certain organelles, like the chloroplasts, mitochondria and peroxisomes. The signal peptide can be cleaved from the polypeptide upon transportation to the intended organelle or from the cell. It is possible to provide a fusion of an additional peptide sequence at the amino or carboxyl terminal end of the polypeptide. The term “gene construct” as used herein refers to polynucleotides comprising the polynucleotide encoding the polypeptide exhibiting cumene dioxygenase activity as definedherein and additional functional nucleic acid sequences. A gene construct as used herein is,preferably, a linear DNA molecule. Typically, a gene construct used in accordance with thepresent invention may be a targeting construct which allows for random or site- directedintegration of the targeting construct into genomic DNA. Such target constructs, preferably, comprise DNA of sufficient length for either homologous or heterologous recombination as described in detail below. In both cases, the construct must be, preferably, impeccable, with structures to control gene expression, such as a promoter, a site of transcription initiation, a site of polyadenylation, and a site of transcription termination. The present invention further pertains to a composition comprising a mixture of alpha-santaloland beta-santalol obtainable by the method of the invention, preferably a mixture comprising(Z)-alpha santalol and (Z)-beta santalol, more preferably a mixture wherein (Z)-alpha santaloland (Z)-beta santalol is present in the composition in a relative amount to total santalol of atleast about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60 %, at least about 70%, at least about 80%, at least about 90%, orbetween about 30% and about 99%, between about 40% and about 95%, between about 50%and about 90%, between about 60% and about 85%, or between about 65% and about 80%. The present invention also relates to a method for manufacturing a composition comprising atleast one santalol, comprising: a) producing a composition comprising at least one santalol bythe method for the manufacture of a composition comprising santalol of the invention; and b)formulating said composition comprising at least one santalol. For instance, said composition may be formulated as a perfume composition, body care composition, hygiene article, cleaning composition, textile detergent composition, compositionfor scent dispensers, foods, food supplements, pharmaceutical composition, or crop protectioncomposition. The present invention further pertains to the use of the polypeptide having cumene dioxygenase activity as defined herein, the heterologous polynucleotide, the vector or gene construct, thehost cell or the non-human transgenic organism as specified herein, for the manufacture ofsantalol or for the manufacture of a composition comprising at least one santalol. Preferablysaid at least one santalol is a mixture comprising alpha-santalol and beta-santalol, morepreferably a mixture comprising (Z)-alpha santalol and (Z)-beta-santalol. Said mixture canencompass one or more other sesquiterpene alcohols as described elsewhere herein.In addition, the present invention provides a kit for the manufacture of a composition comprisingat least one santalol. Said kit comprises the polypeptide having cumene dioxygenase activity asdefined herein, the heterologous polynucleotide, the vector or gene construct, the host celland / or the non-human transgenic organism as specified herein. If the kit comprises a host cellas defined herein, said host cell is preferably a bacterial host cell, more preferably aRhodobacter cell as specified in this description.A kit as used herein refers to a collection of components required for carrying out the method forthe manufacture of a composition at least one santalol of the present invention. The kit shallinclude any of the aforementioned components either as a single component or any combinations thereof. Typically, the components of the kit are provided in separate containers or within a single container. The container also typically comprises instructions for carrying outthe method for manufacture of a composition comprising santalol of the present invention.Moreover, the kit may, preferably, comprise further components which are necessary forcarrying out the method for manufacture of a composition comprising santalol of the presentinvention such as incubation reagents, cultivation media, washing solutions, solvents, and / or reagents or means required for purification of the composition at least one santalol.The present invention also relates to a non-human host cell expressing a polypeptide exhibitingcumene dioxygenase activity as defined herein from the heterologous polynucleotide, the vectoror gene construct as specified herein.Moreover, the present invention pertains to a non-human transgenic organism expressing apolypeptide exhibiting cumene dioxygenase activity as defined herein from the heterologouspolynucleotide, the vector or gene construct as specified herein.Method for the manufacture of a composition comprising bergamotol of the inventionFurthermore, the present invention relates to a method for the manufacture of a compositioncomprising bergamotol, the method comprising the step of converting at least one bergamotene into at least one bergamotol, wherein the conversion is carried out by at least one polypeptide having cumene dioxygenase activity comprising an amino selected from the group consisting of:a) an amino acid sequence, preferably the amino acid sequence of SEQ ID NO. 1, comprisinga single point deletion at the amino acid position corresponding to position 288 of SEQ ID NO.1;b) an amino acid sequence, preferably the amino acid sequence of SEQ ID NO. 1, comprisinga single point deletion at the amino acid position corresponding to position 288 of SEQ ID NO.1 and an Alanine to Threonine substitution at the amino acid position corresponding to position 321 of SEQ ID NO.1 (A321T);c) an amino acid sequence, preferably the amino acid sequence of SEQ ID NO. 1, comprisinga single point deletion at the amino acid position corresponding to position 288 of SEQ ID NO.1 and an Asparagine to Threonine substitution at the amino acid position corresponding to position 279 of SEQ ID NO.1 (N279T) and an Alanine to Threonine substitution at the amino acid position corresponding to position 321 of SEQ ID NO.1 (A321T); d) an amino acid sequence which is at least 60%, at least 70%, at least 80%, at least 85%, atleast 90%, at least 95%, at least 98% or at least 99% identical to the amino acid sequence ofSEQ ID NO.1 and has a single point deletion at the amino acid position corresponding to position 288 of SEQ ID NO.1;e) an amino acid sequence which is at least 60%, at least 70%, at least 80%, at least 85%, atleast 90%, at least 95%, at least 98% or at least 99% identical to the amino acid sequence of SEQ ID NO.1 and has a single point deletion at the amino acid position corresponding to position 288 of SEQ ID NO.1 and an Alanine to Threonine substitution at the amino acid position corresponding to position 321 of SEQ ID NO.1 (A321T);f) an amino acid sequence which is at least 60%, at least 70%, at least 80%, at least 85%, atleast 90%, at least 95%, at least 98% or at least 99% identical to the amino acid sequence of SEQ ID NO.1 and has a single point deletion at the amino acid position corresponding to position 288 of SEQ ID NO.1 and an Asparagine to Threonine substitution at the amino acid position corresponding to position 279 of SEQ ID NO.1 (N279T) and an Alanine to Threonine substitution at the amino acid position corresponding to position 321 of SEQ ID NO.1 (A321T); andg) a fragment of the amino acid sequence of a), b) or c), said fragment exhibiting cumenedioxygenase activity. Bergamotene as used herein refers preferably to alpha-bergamotene which is a sesquiterpene consisting of a bicyclo[3.1.1]hept-2-ene skeleton substituted at positions 2 and 6 by methyl groups and at position 6 by a 4-methylpent-3-en-1-yl group. It has a role as a plant metabolite and a volatile oil component. It is a bridged compound, a sesquiterpene and a polycyclic olefin. Alpha-bergamotene can be found e.g. in Humulus lupulus or Pectis brevipedunculata. More preferably, alpha-bergamotene refers to trans-^-bergamotene (CAS number 13474-59-4; herein after also referred to as trans-alpha bergamotene).The composition produced by the method for manufacturing of a composition comprisingbergamotol of the invention, comprises at least one bergamotol as defined herein, preferablytrans-alpha-bergamotol, or derivatives of bergamotol, preferably bergamotenone or nor-transalpha bergamotenone. The definitions and embodiments set forth with respect to the polypeptide exhibiting a cumenedioxygenase activity as defined herein, heterologous polynucleotide, a vector or a geneconstruct, host cell, non-human transgenic organism, and uses made with respect to themethod for manufacturing of a composition comprising santalol of the invention, apply mutatismutandis to the method for manufacturing of a composition comprising bergamotol of theinvention. Method for the manufacture of a composition comprising nootkatol of the inventionFinally, the present invention pertains to a method for the manufacture of a compositioncomprising nootkatol, the method comprising the step of converting at least one valencene into at least one nootkatol, wherein the conversion is carried out by at least one polypeptide having cumene dioxygenase activity comprising an amino selected from the group consisting of: a) an amino acid sequence, preferably the amino acid sequence of SEQ ID NO.1, comprising a single point deletion at the amino acid position corresponding to position 288 of SEQ ID NO. 1; b) an amino acid sequence which is at least 60%, at least 70%, at least 80%, at least 85%, atleast 90%, at least 95%, at least 98% or at least 99% identical to the amino acid sequence ofSEQ ID NO.1 and has a single point deletion at the amino acid position corresponding toposition 288 of SEQ ID NO. 1; andc) a fragment of (a), said fragment encoding a polypeptide exhibiting cumene dioxygenaseactivity. Valencene can be used as substrate by the polypeptide exhibiting a cumene dioxygenase activity specified herein. Valencene relates to (+)-valencene which is a carbobicyclic compound and sesquiterpene that is 1,2,3,4,4a,5,6,7-octahydronaphthalene which is substituted a prop-1- en-2-yl group at position 3 and by methyl groups at positions 4a and 5 (the 3R,4aS,5R- diastereoisomer). It is a sesquiterpene, a carbobicyclic compound and a polycyclic olefin (CAS number 4630-07-3). Valencene is a natural product found in Humulus lupulus, Perilla frutescens, Vitis vinifera, Citrus sinensis, and other organisms. The composition manufactured by the method for manufacturing of a composition comprisingnootkatol of the invention, comprises at least one nootkatol as defined herein, preferably beta-nootkatol, or derivatives of nootkatol, preferably nootkatone.The definitions and embodiments set forth with respect to the polypeptide exhibiting a cumenedioxygenase activity as defined herein, heterologous polynucleotide, a vector or a geneconstruct, host cell, non-human transgenic organism, and uses made with respect to themethod for manufacturing of a composition comprising santalol of the invention, apply mutatismutandis to the method for manufacturing of a composition comprising nootkatol of theinvention.Cumene dioxygenase variants of the inventionThe present invention also relates to a cumene dioxygenase variant converting santalene intosantalol, wherein said cumene dioxygenase variant comprises an amino acid sequenceselected from the group consisting of:a) an amino acid sequence, preferably the amino acid sequence of SEQ ID NO. 1, comprisinga single point deletion at the amino acid position corresponding to position 288 of SEQ ID NO.1 and an Alanine to Threonine substitution at the amino acid position corresponding to position 321 of SEQ ID NO.1 (A321T);b) an amino acid sequence, preferably the amino acid sequence of SEQ ID NO. 1, comprisinga single point deletion at the amino acid position corresponding to position 288 of SEQ ID NO.1 and an Asparagine to Threonine substitution at the amino acid position corresponding to position 279 of SEQ ID NO.1 (N279T) and an Alanine to Threonine substitution at the aminoacid position corresponding to position 321 of SEQ ID NO.1 (A321T);c) an amino acid sequence which is at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identical to the amino acid sequence of SEQ ID NO.1 and has a single point deletion at the amino acid position corresponding to position 288 of SEQ ID NO.1 and an Alanine to Threonine substitution at the amino acid position corresponding to position 321 of SEQ ID NO.1 (A321T);d) an amino acid sequence which is at least 60%, at least 70%, at least 80%, at least 85%, atleast 90%, at least 95%, at least 98% or at least 99% identical to the amino acid sequence of SEQ ID NO.1 and has a single point deletion at the amino acid position corresponding to position 288 of SEQ ID NO.1 and an Asparagine to Threonine substitution at the amino acid position corresponding to position 279 of SEQ ID NO.1 (N279T) and an Alanine to Threonine substitution at the amino acid position corresponding to position 321 of SEQ ID NO.1 (A321T); ande) a fragment of the amino acid sequence of a) or b), said fragment exhibiting cumenedioxygenase activity .The amino acid sequence of the oxygenase alpha subunit CumA1 of the wildtype cumenedioxygenase from Pseudomonas fluorescens IP01 is shown in SEQ ID NO.1.In another preferred embodiment of the cumene dioxygenase variant of the invention, saidcumene dioxygenase variant converts santalene into santalol and comprises an amino acidsequence selected from the group consisting of: a) an amino acid sequence of SEQ ID NO.3 (amino acid sequence of the oxygenase alpha subunit CumA1 I288DEL_A321T of the cumene dioxygenase from Pseudomonas fluorescensIP01) or SEQ ID NO.4 (amino acid sequence of the oxygenase alpha subunit CumA1N279T_I288DEL_A321T of the cumene dioxygenase from Pseudomonas fluorescens IP01); and b) an amino acid sequence which is at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identical to SEQ ID NO.3 or 4. Preferably, the amino acid sequence which is at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identical to SEQ ID NO.3comprises a single point deletion at the amino acid position corresponding to position 288 ofSEQ ID NO.1, and an Alanine to Threonine substitution at the amino acid positioncorresponding to position 321 of SEQ ID NO.1. Further, it is able to convert santalene intosantalol, i.e. it exhibits cumene dioxygenase activity. Preferably, the amino acid sequence which is at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identical to SEQ ID NO.4comprises a single point deletion at the amino acid position corresponding to position 288 ofSEQ ID NO. 1 and an Asparagine to Threonine substitution at the amino acid positioncorresponding to position 279 of SEQ ID NO.1 (N279T) and an Alanine to Threonine substitution at the amino acid position corresponding to position 321 of SEQ ID NO.1. Further,it is able to convert santalene into santalol, i.e. it exhibits cumene dioxygenase activity.More preferably, the cumene dioxygenase variant of the invention is a polypeptide comprisingor consisting of the amino acid sequence depicted in SEQ ID NO: 3 (amino acid sequence of the oxygenase alpha subunit CumA1 I288DEL_A321T of the cumene dioxygenase from Pseudomonas fluorescens IP01), or SEQ ID NO: 4 (amino acid sequence of the oxygenase alpha subunit CumA1 N279T_I288DEL_A321T of the cumene dioxygenase from Pseudomonas fluorescens IP01. In another preferred embodiment of the cumene dioxygenase variant of the invention, the cumene dioxygenase variant of the invention converts also bisabolene to bisabolene alcohol, and / or bergamotene to bergamotol. The present invention also relates to the nucleic acid sequence encoding the cumenedioxygenase variant of the invention.Preferably, the nucleic acid sequence encoding the cumene dioxygenase variants of theinvention is selected from the group consisting of: a) a nucleic acid sequence as shown in SEQ ID NO.6 or 8; andb) a nucleic acid sequence which is at least 60%, at least 65%, at least 70%, at least 75%, atleast 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO.6 or 8, preferably over the entire length. SEQ ID NO.6 shows the nucleic acid sequence encoding the amino acid sequence of the oxygenase alpha subunit CumA1 I288Del_A321T of the cumene dioxygenase fromPseudomonas fluorescens IP01. SEQ ID NO.8 depicts the nucleic acid sequence encoding theamino acid sequence of the oxygenase alpha subunit CumA1 N279T_I288Del_A321T of the cumene dioxygenase from Pseudomonas fluorescens IP01. The present invention further provides for a heterologous polynucleotide, a vector or a geneconstruct comprising the nucleic acid sequence encoding the cumene dioxygenase variant ofthe invention. The present invention also relates to host cells and non-human transgenic organismscomprising a heterologous polynucleotide, a vector or a gene construct encoding the cumenedioxygenase variant of the invention.Appropriate heterologous polynucleotides, vectors, gene constructs, host cells and non-human transgenic organisms are set forth elsewhere herein.The present invention further relates to a method for the manufacture of a compositioncomprising santalol, the method comprising the step of converting at least one santalene into at least one santalol, wherein the conversion is carried out by at least one polypeptide having cumene dioxygenase activity comprising an amino selected from the group consisting of:a) the amino acid sequence of SEQ ID NO. 3 (amino acid sequence of the oxygenase alphasubunit CumA1 I288DEL_A321T of the cumene dioxygenase from Pseudomonas fluorescensIP01) or SEQ ID NO.4 (amino acid sequence of the oxygenase alpha subunit CumA1N279T_I288DEL_A321T of the cumene dioxygenase from Pseudomonas fluorescens IP01); and b) an amino acid sequence which is at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identical to SEQ ID NO.3 or 4. Preferably, the amino acid sequence which is at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identical to SEQ ID NO.3comprises a single point deletion at the amino acid position corresponding to position 288 ofSEQ ID NO.1, and an Alanine to Threonine substitution at the amino acid positioncorresponding to position 321 of SEQ ID NO.1. Further, it is able to convert santalene intosantalol, i.e. it exhibits cumene dioxygenase activity. Preferably, the amino acid sequence which is at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identical to SEQ ID NO.4comprises a single point deletion at the amino acid position corresponding to position 288 ofSEQ ID NO. 1 and an Asparagine to Threonine substitution at the amino acid positioncorresponding to position 279 of SEQ ID NO.1 (N279T) and an Alanine to Threonine substitution at the amino acid position corresponding to position 321 of SEQ ID NO.1. Further,it is able to convert santalene into santalol, i.e. it exhibits cumene dioxygenase activity.The present invention also relates to a method for the manufacture of a composition comprisingbisabolene alcohol, the method comprising the step of converting at least one bisabolene into at least one bisabolene alcohol, wherein the conversion is carried out by at least one polypeptide having cumene dioxygenase activity comprising an amino selected from the group consisting of:a) the amino acid sequence of SEQ ID NO. 3 (amino acid sequence of the oxygenase alphasubunit CumA1 I288DEL_A321T of the cumene dioxygenase from Pseudomonas fluorescensIP01) or SEQ ID NO. 4 (amino acid sequence of the oxygenase alpha subunit CumA1N279T_I288DEL_A321T of the cumene dioxygenase from Pseudomonas fluorescens IP01); and b) an amino acid sequence which is at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identical to SEQ ID NO.3 or 4. Preferably, the amino acid sequence which is at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identical to SEQ ID NO.3comprises a single point deletion at the amino acid position corresponding to position 288 ofSEQ ID NO.1, and an Alanine to Threonine substitution at the amino acid positioncorresponding to position 321 of SEQ ID NO.1. Further, it is able to convert bisabolene into bisabolene alcohol, i.e. it exhibits cumene dioxygenase activity. Preferably, the amino acid sequence which is at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identical to SEQ ID NO.4 comprises a single point deletion at the amino acid position corresponding to position 288 ofSEQ ID NO. 1 and an Asparagine to Threonine substitution at the amino acid positioncorresponding to position 279 of SEQ ID NO.1 (N279T) and an Alanine to Threonine substitution at the amino acid position corresponding to position 321 of SEQ ID NO.1. Further, it is able to convert bisabolene into bisabolene alcohol, i.e. it exhibits cumene dioxygenase activity.The present invention pertains also to a method for the manufacture of a compositioncomprising bergamotol, the method comprising the step of converting at least one bergamotene into at least one bergamotol, wherein the conversion is carried out by at least one polypeptide having cumene dioxygenase activity comprising an amino selected from the group consisting of:a) the amino acid sequence of SEQ ID NO. 3 (amino acid sequence of the oxygenase alphasubunit CumA1 I288DEL_A321T of the cumene dioxygenase from Pseudomonas fluorescensIP01) or SEQ ID NO. 4 (amino acid sequence of the oxygenase alpha subunit CumA1N279T_I288DEL_A321T of the cumene dioxygenase from Pseudomonas fluorescens IP01); and b) an amino acid sequence which is at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identical to SEQ ID NO.3 or 4. Preferably, the amino acid sequence which is at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identical to SEQ ID NO.3comprises a single point deletion at the amino acid position corresponding to position 288 ofSEQ ID NO.1, and an Alanine to Threonine substitution at the amino acid positioncorresponding to position 321 of SEQ ID NO.1. Further, it is able to convert bergamotene into bergamotol, i.e. it exhibits cumene dioxygenase activity. Preferably, the amino acid sequence which is at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identical to SEQ ID NO.4 comprises a single point deletion at the amino acid position corresponding to position 288 ofSEQ ID NO. 1 and an Asparagine to Threonine substitution at the amino acid positioncorresponding to position 279 of SEQ ID NO.1 (N279T) and an Alanine to Threonine substitution at the amino acid position corresponding to position 321 of SEQ ID NO.1. Further, it is able to convert bergamotene into bergamotol, i.e. it exhibits cumene dioxygenase activity. The present invention further pertains to the use of the cumene dioxygenase variant(s) of theinvention for manufacturing a composition comprising santalol, a composition comprisingbisabolene alcohol, or a composition comprising bergamotol, or a composition comprising amixture of santalol, bisabolene alcohol, and / or bergamotol.Definitions“%” in the context of the concentration of a solution as referred to herein means percentage(mol / mol) if not indicated otherwise. It is to be understood that in the specification and in the claims, “a” or “an” can mean one or more of the items referred to in the following depending upon the context in which it is used. Thus, for example, reference to “an” item can mean that at least one of said item can be utilized. As used in the following, the terms “have”, “comprise” or “include” are meant to have either anon-limiting meaning or a limiting meaning. Thus, having a limiting meaning these terms mayrefer to a situation in which, besides the feature introduced by these terms, no other features are present in an embodiment described, i.e. the terms have a limiting meaning in the sense of “consisting of” or “essentially consisting of”. Having a non-limiting meaning, the terms refer to a situation where besides the feature introduced by these terms, one or more other features arepresent in an embodiment described. The terms “having” (e.g. polypeptide having cumenedioxygenase activity) or exhibiting” (e.g. polypeptide exhibiting cumene dioxygenase activity) are used interchangeably herein. As used herein, the term “about” when qualifying a value of a stated item, number, percentage, or term refers to a range of plus or minus 10 percent, 9 percent, 8 percent, 7 percent, 6 percent, 5 percent, 4 percent, 3 percent, 2 percent or 1 percent of the value of the stated item, number, percentage, or term. Preferred is a range of plus or minus 10 percent.In case numerical ranges are used such as “in a concentration between 1 and 5 micromolar”,the range includes not only 1 and 5 micromolar, but also any numerical value in between 1 and 5 micromolar, for example, 2, 3 and 4 micromolar. Further, as used in the following, the terms “preferably”, “more preferably”, “most preferably”, "particularly", "more particularly", “typically”, and “more typically” are used in conjunction with features in order to indicate that these features are preferred features, i.e. the terms shall indicate that alternative features may also be envisaged in accordance with the invention. Further, it will be understood that the term “at least one” as used herein means that one or more of the items referred to following the term may be used in accordance with the invention. For example, if the term indicates that at least one item shall be used this may be understood as one item or more than one item, i.e. two, three, four, five or any other number. Depending on the item the term refers to the skilled person understands as to what upper limit the term may refer, if any. The term “manufacture” as used herein refers to the generation of a composition comprising at least one santalol, or at least one bergamotol, or at least one nootkatol, or at least one bisabolene alcohol. The manufacture may yield any degree of purity of the said at least one santalol, or at least one bergamotol, or at least one nootkatol, or at least one bisabolenealcohol, in the composition. The higher the degree of envisaged purity, the more additionalpurification will be required. The method may be carried out ex-vivo, e.g., in one or more reaction vials. Alternatively, the method may be carried out entirely or in part in an organism such as a microorganism including the host cells referred to herein elsewhere or a non-human transgenic organism, preferably a non-vertebrate transgenic organism, including plants or microorganisms. The term ”polypeptide” as used in accordance with the present invention refers to contiguous sequence of amino acid linked to each other by peptide bounds. A polypeptide according to the invention, typically, comprises at least 50, at least 100 or at least 200 amino acids in length such that the amino acid chain may form a three-dimensional structure required to exert the enzymatic activity or enzymatic activities referred to elsewhere herein. The term “protein” may be used interchangeably herein. The term “obtaining” as used herein refers to providing the composition comprising at least onesantalol, bergamotol, bisabolene alcohol and / or nootkatol at any degree of purity. Accordingly,the composition may essentially consist of the at least one santalol, bergamotol, bisabolenealcohol and / or nootkatol in essentially pure form or may be a mixture comprising additionalcomponents besides the at least one santalol, bergamotol, bisabolene alcohol and / or nootkatol.Thus, the methods of the invention may encompass one or more purification steps. Thepurification techniques which need to be applied depend on how the methods of the presentinvention have been carried out. For example, if the methods have been carried out in vitro, i.e.in reaction vials using isolated components such as isolated enzymes, adducts and auxiliary components such as reaction buffers, it will be understood that less purification is required. However, if the methods are carried out in vivo, i.e. in a host cell as defined elsewhere herein, further purification and pre-treatment steps may be necessary. Typically, the host cells need to be harvested and the harvested cells will be lysed in order to release the compositioncomprising the at least one santalol, bergamotol, bisabolene alcohol and / or nootkatol from saidcells. Subsequent purification steps shall remove the cell debris as well as aiming at purifyingthe at least one santalol, bergamotol, bisabolene alcohol and / or nootkatol from the remainingcomponents. Moreover, if the steps are carried out in vivo in animals or plants, even further pre- treatment and / or purification steps may be required. The skilled person is well aware of suitable pre-treatment and / or purification steps depending on the given circumstances under which themethods may be carried out. Purification techniques to be envisaged may be extractiontechniques, chromatography, such as LC, GC or HPLC, size-exclusion chromatography, affinity chromatography, distillation, centrifugation, filtration and the like. Pre-treatment steps to be envisaged may be harvesting, heat treatment, ultra-sonic treatment, treatment with chemicals and / or enzymes, and the like. The term “in vitro” denotes outside, or external to, the animal or human body. The term “in vitro” as used herein should be understood to include “ex vivo”. The term “ex vivo” typically refers to tissues or cells removed from an animal or human body and maintained or propagated outside the body, e.g., in a culture vessel. The term “in vivo” as used herein denotes inside, or internal to, the animal or human body. All references cited throughout this specification are herewith incorporated by reference in their entireties or with respect to the specifically mentioned disclosure content. FIGURES The Figures show: Figure 1: Plasmid map of the pIP107D construct, harbouring the oxygenase α-subunit (CumA1), the oxygenase β-subunit (CumA2), the ferredoxin (CumA3), an open reading frame (orf3), the reductase (CumA4), a lac Promotor (lacP) and an Ampicillin resistance (AmpR). Figure 2: Product distribution (stacked bar plot, grey) and total product formation in mM (black dot) for the biotransformations with santalene as substrate and the WT and variant I288del. Considered were only products who were identified as Santalol isomers with the ISOBIONICSSantalol as product standard. The total product formation is calculated as the sum of all santalolisomers identified with the standard. Products were quanitifed using the ECN method describedin the method section of the Examples.Figure 3: GC-FID chromatograms of santalene samples. A: Chromatogram of the biotransformation of santalene with variant I288del. B: Chromatogram of a measurement of the ISOBIONICS Santalol product sample. The four overlaying peaks are marked with arrows and numerated 1-4. Figure 4: Mass spectra measured on GC / MS for the products 1-4. Figure 5: Product distribution (stacked bar plot, grey) and relative product formation (Normalized area values, black dot) for the biotransformations with bergamotene as substrate and the WT and variants I288del, I288del_A321T and N279T_I288del_A321T. Products were not quantified or identified by mass spectra. Figure 6: GC-FID chromatogram of biotransformation of bergamotene with variant I288del. The internal standard biphenyl, the substrate bergamotene and the products are marked. Figure 7: Product distribution (stacked bar plot, grey) and relative product formation (Normalized area values, black dot) for the biotransformations with valencene as substrate and the WT and variants I288del, I288del_A321T and N279T_I288del_A321T. Products were not quantified or identified by mass spectra. Figure 8: GC-FID chromatogram of biotransformation of valencene with variant I288del. The internal standard biphenyl, the substrate valencene and the products are marked. The following sequences are referred to throughout the specification and in the accompanying sequence protocol:SEQ ID NO: 1: amino acid sequence of the oxygenase alpha subunit CumA1 of thewildtype cumene dioxygenase from Pseudomonas fluorescens IP01SEQ ID NO: 2: amino acid sequence of the oxygenase alpha subunit CumA1 I288DEL ofthe cumene dioxygenase from Pseudomonas fluorescens IP01SEQ ID NO: 3: amino acid sequence of the oxygenase alpha subunit CumA1I288DEL_A321T of the cumene dioxygenase from Pseudomonas fluorescens IP01SEQ ID NO: 4: amino acid sequence of the oxygenase alpha subunit CumA1N279T_I288DEL_A321T of the cumene dioxygenase from Pseudomonas fluorescens IP01SEQ ID NO: 5: nucleic acid sequence encoding the oxygenase alpha subunit CumA1 ofthe wildtype cumene dioxygenase from Pseudomonas fluorescens IP01SEQ ID NO: 6: nucleic acid sequence encoding the amino acid sequence of theoxygenase alpha subunit CumA1 I288DEL of the cumene dioxygenase from Pseudomonas fluorescens IP01SEQ ID NO: 7: nucleic acid sequence encoding the oxygenase alpha subunit CumA1I288DEL_A321T of the cumene dioxygenase from Pseudomonas fluorescens IP01SEQ ID NO: 8: nucleic acid sequence encoding the oxygenase alpha subunit CumA1N279T_I288DEL_A321T of the cumene dioxygenase from Pseudomonas fluorescens IP01SEQ ID NO: 9: amino acid sequence of the oxygenase beta subunit CumA2 of thewildtype cumene dioxygenase from Pseudomonas fluorescens IP01sequence of Genbank accession number D37828.1SEQ ID NO: 10: amino acid sequence of the ferredoxin subunit CumA3 of the wildtypecumene dioxygenase from Pseudomonas fluorescens IP01SEQ ID NO: 11: amino acid sequence of the reductase subunit CumA4 of the wildtypecumene dioxygenase from Pseudomonas fluorescens IP01SEQ ID NO: 12: I288del-fw primer sequenceSEQ ID NO: 13: I288del-re primer sequenceSEQ ID NO: 14: A321T-fw primer sequenceSEQ ID NO: 15: A321T-re primer sequenceSEQ ID NO: 16: A279T-fw primer sequenceSEQ ID NO: 17: A279T-re primer sequenceEXAMPLES The Examples shall merely illustrate the invention. They shall not, whatsoever, be construed as limiting the scope. 1. Material & Methods 1.1 Materials The chemicals and reagents used in this work were, if not noted otherwise, purchased in the highest grade available from the companies ISOBIONICS (Geleen, NL), Sigma Aldrich (St. Louis, US), Honeywell Fluka (Bucharest, RO), Alfa Aesar (Ward Hill, US) und Carl Roth (Karlsruhe, DE).2-Hydroxypropyl-β-cyclodextrine was purchased from Wacker Chemie (München, DE). 1.1.1 Buffers and media The media and buffers used in this work are summarized in Table 1. All growth media and solutions were autoclaved at 121 °C and 100 kPa for 25 min. Non-autoclavable solutions were sterile filtered (pore size 0.2 μl). Table 1 shows a list of buffers and media used in this work for protein production and biotransformations. Table 1: List of buffers and media used in this work for protein production and biotransformations Entry Buffer / Medium Components 1 Lysogeny broth (LB) 10 g / L tryptone, 5 g / L NaCl, 5 g / L yeast extract 2 Terrific broth (TB) 12 g / L tryptone, 24 g / L yeast extract, 5 g / L Glycerol 3 10x phosphate buffer 0.17 M KH2PO4, 0.72 M (KPi-buffer) K2HPO4, pH = 7.4 4 Reaction buffer 19.8 mM KH2PO4, 80.2 mM K2HPO4, 20 mM Glucose, 2%(v / v) 2-Hydroxypropyl- β-cyclodextrin, pH = 7.4 TB-medium and 10x phosphate buffer were autoclaved separately.10x phosphate buffer was added in a 1:10 ratio to the TB-medium before inoculation of main cultures. 1.1.2 Enzymes and plasmid Table 2 shows the plasmid characteristic of the pIP107D construct used in the santalene reaction. Table 2: Plasmid characteristic of the pIP107D construct used in the santalene reaction Plasmid Size [bp] Characteristics Source pIP107D 7670 AmpR Aoki, Hirobumi, Gene cluster of Kimura Toshiaki, cumene Habe Hiroshi, dioxygenase Yamane Hisakazu, derived from Kodama Tohru, O. Pseudomonas T. Cloning, fluorescens IP01 Nucleotide cumA1A2A3A4 Sequence, and (cumA1: α-subunit Characterization of of the oxygenase, the Genes cumA2: β-subunit Encoding of the oxygenase, Enzymes Involved cumA3: ferredoxin, in Degradation of cumA4: reductase) Cumene to 2- lac-promotor; Hydroxy-6-Oxo-7- Plasmid backbone Methylocta-2,4- of pUC118 Dienoic Acid in Pseudomonas fluorescens IP01. Journal of Fermentation and Bioengineering 81,187–196 (1996). Figure 1 shows the plasmid map of the pIP107D construct.1.1.3 E. coli strainsThe E. coli strains used in this work are listed in Table 3. Herein E. coli XL-1 blue was used ascloning strain and for plasmid production, while E. coli JM109(DE3) was used for expression and whole cell biotransformations.Table 3: E. coli strains used in this workName Genotype Origin E. coli XL-1 Blue recA1, endA1, gyrA96, Agilent Technologies thi-1, hsdR17, supE44, Deutschland GmbH & Co. relA1, lac [F´ proAB lacIqKG, Waldbronn, DE ZΔM15 Tn10 (Tetr)] E. coli JM109(DE3) endA1, recA1, gyrA96, Promega GmbH thi, hsdR17 (rk-, mk+) Mannheim, DE relA1, supE44, λ–, Δ(lac- proAB), [F´, traD36, proAB, lacIqZΔM15], lDE3 1.2 Molecular biological methods 1.2.1 Isolation of plasmid-DNA from E. coli Isolation of plasmids was done following the instructions of the ZyppyTM Plasmid Miniprep Kit. Plasmids were eluted with 30 μl of ddH2O and stored at -20 °C. The DNA concentration was measured with a NanoDrop-photometer (NanoDrop 2000, Peqlab Biotechnologie GmbH, Erlangen, DE) at a wavelength of 260 nm. The sample volume used for measurements was 1 μl. pIP107D was described in Gally, C., Nestl, B. M. & Hauer, B. Engineering rieske non-heme iron oxygenases for the asymmetric dihydroxylation of alkenes. Angew. Chem. Int. Ed.54, 12952–12956 (2015) and Aoki, Hirobumi, Kimura Toshiaki, Habe Hiroshi, Yamane Hisakazu, Kodama Tohru, O. T. Cloning, Nucleotide Sequence, and Characterization of the Genes Encoding Enzymes Involved in Degradation of Cumene to 2-Hydroxy-6-Oxo-7- Methylocta-2,4-Dienoic Acid in Pseudomonas fluorescens IP01. Journal of Fermentation andBioengineering 81, 187–196 (1996).1.2.2 Site directed mutagenesis by QuikChange®PCRMutations were introduced into the plasmid by using the QuikChange PCR from Agilent,according to the manufacturer’s instructions. Primers used are listed below. I288del-fw gatttcgcacttctgcaagccatgggtcctaaggttgtc (SEQ ID NO: 12)I288del-re gacaaccttaggacccatggcttgcagaagtgcgaaatc (SEQ ID NO: 13)A321T-fw gctgatcgcatggttACTcagcatatgacc (SEQ ID NO: 14) A321T-re ggtcatatgctgAGTaaccatgcgatcagc (SEQ ID NO: 15)N279T-fw gggaccggctggttcACTgacgatttcgcac (SEQ ID NO: 16)N279T-re gtgcgaaatcgtcAGTgaaccagccggtccc (SEQ ID NO: 17)Using these primer sets and the Quickchange kit, three variants of the plasmid pIP107D were generated, being pIP107D-I288del, pIP107D-I288del-A321T and pIP107D-I288del-A321T- N279T. SEQ ID NO: 2 shows the amino acid sequence of the oxygenase alpha subunit CumA1 I288Del of the cumene dioxygenase from Pseudomonas fluorescens IP01, and SEQ ID NO.6 the nucleic acid sequence encoding the amino acid sequence of the oxygenase alpha subunit CumA1I288Del of the cumene dioxygenase from Pseudomonas fluorescens IP01. SEQ ID NO: 3shows the amino acid sequence of the oxygenase alpha subunit CumA1 I288Del_A321T of the cumene dioxygenase from Pseudomonas fluorescens IP01, and SEQ ID NO.7 the nucleic acid sequence encoding the amino acid sequence of the oxygenase alpha subunit CumA1I288Del_A321T of the cumene dioxygenase from Pseudomonas fluorescens IP01. SEQ ID NO:4 shows the amino acid sequence of the oxygenase alpha subunit CumA1 N279T_I288Del_A321T of the cumene dioxygenase from Pseudomonas fluorescens IP01, and SEQ ID NO.8 the nucleic acid sequence encoding the amino acid sequence of the oxygenase alpha subunit CumA1 N279T_I288Del_A321T of the cumene dioxygenase from Pseudomonas fluorescens IP01. Plasmids were introduced into E. coli XL-1Blue using standard procedures for chemical transformation of E. coli, analysed by plasmid DNA sequencing, and introduced into strain JM109(DE3) by the same transformation methods. 1.3.2 Protein expression Single variants of the CDO were expressed in E. coli JM109(DE3) cells. Precultures containing 5 ml LB-medium with ampicillin (100 μg / ml) are inoculated from glycerol stocks and incubated at 37 °C and 180 rpm overnight. A main culture containing 50 ml TB-medium with ampicillin (100 μg / ml) in a 250 ml Erlenmeyer flask is inoculated with 6%(v / v) of preculture. Main cultures areincubated at 37 °C and 180 rpm until an OD600 of 0.5-0.7 is reached. JM109(DE3) cells areinduced with 1 mM of an IPTG solution (cStock = 1 M) and expression is done at 20 °C and 180 rpm for 20 h. Cells are harvested by centrifugation (4 °C, 3220 x g, 20 min) and the supernatant is discarded. Cells are then used for analytical biotransformations. 1.4 Analytical biotransformations in 20 ml reaction vials Harvested cells from expression in Erlenmeyer flasks were resuspended in reaction buffer (ccww = 0.05 g / ml) and 990 μl of cell suspension is transferred to 20 ml reaction vials and 10 μl of substrate / DMSO stock mixture (cStock = 200 mM, cEnd, substrate = 2 mM) was added directly to the cell suspension. As substrate, Santalene from Isobionics was used, which comprised 40% alpha santelene, 22% trans alpha bergamotene, 20% beta santalene, and a number of minor components each at lower than 5%. The vials were sealed gas-tight using screw caps and incubated at 30 °C at 180 rpm for 20 h. For extraction, the 1 ml reaction mixture is transferred into a 2 ml Eppendorf tube and extracted with 1 ml of a mixture of CH:EtOAc (1:1) with 0.01 mM biphenyl as internal standard by vortexing for 2 min. The phases are separated by centrifugation (RT, 7000 x g, 5 min) and the organic phase is transferred to a GC vial for further analysis by GC / MS or GC / FID. Samples are stored at -20 °C. 1.5 GC-MS analysis GC analysis was done on a Shimadzu GC-2010 GC system (Shimadzu, Kyoto, Japan) equipped with a Shimadzu QP2010 mass spectrometer and a ZB-5MSi column (30 m x 0.25 mm, 0.25 μm, Phenomenex, Aschaffenburg, DE) with helium as carrier gas and pressure (26.7 kPa) as control mode. Injections (1 μl) were done at 250 °C inlet temperature in split mode (split ratio 1:20). Ion source temperature was set to 200 °C and MS-detection was done by ionizationat 70 eV. Mass detection was done in scan mode. The temperature profile of each run included2 minutes initial temperature of 130°C, an increase at 15°C / min until 185°C, holding it there for2 min, increasing to 220°C at 15°C / min, followed by an increase to 300°C at 50°C / min, andholding it at this temperature for 2 minutes, and then cooling it to 130°C again. For quantification the relative response factor (RF) was used to determine the product concentrations using a reference standard, in this case biphenyl (Scanlon, J. T. & Willis, D. E. Calculation of flame ionization detector relative response factors using the effective carbon number concept. J. Chromatogr. Sci.23, 333–340 (1985). For this, the GC-FID system was equipped with a HP-5ms UI column (30 m x 0,25 mm x 0,25 μm, Agilent, Santa Clara, USA), all other instrument parameters were left the same. The previously described temperature profile was used. The RF-value is hereby calculated by dividing the effective carbon number (ECN) of the substance by the ECN of the standard. A calibration curve of biphenyl was measured and normalized by the calculated RF-values. The resulting RF-values for santalene and santalol are displayed in Table 4.Table 4: Calculated ECN and RF values of biphenyl as internal standard, santalene isomersand santalol isomers. Substance ECN RF-value Biphenyl 12 - Santalene isomers 14.7 1.225 Santalol isomers 14.2 1.183 2. Results 2.1 Biotransformation with I288del shows product formationSantalene was screened with E. coli cells expressing the pIP107D, pIP107D-I288del, pIP107D-I288del-A321T and pIP107D-I288del-A321T-N279T the CDO plasmids. The pIP107D did not show any product formation, while pIP107D-I288del displayed the highest product formationtowards santalene. The resulting product formations and distributions are shown in Fig.2.The wildtype (WT) shows no activity towards santalene at all, while the variant I288del formsfour products 1-4, which were identified as Santalol isomers by the ISOBIONICS Santalol as aproduct standard. Additionally, mass spectra were analyzed to verify the product mass of 220m / z. An exemplary chromatogram of the products and the product standard is displayed in Fig. 3. Additionally, the variants I288del_A321T and N279T_I288del_A321T are active towardssantalene, but lead to lower product formations of 0.49 mM and 0.42 mM, respectively.Besides the santalol isomers, there is only minor side products in low ratios. This is propably also due to the santalene not being a pure substrate. There is over nine different peaks in the substrate sample, leading to the assumption that it is contaminated with other sesquiterpenes, which are also potential substrates. Pure santalene as substrate would probably lead to higher selectivities and less side products. 2.2 Mass spectra analysis The resulting product 1-4 where analysed by GC / MS. The retention times are listed in Table 5, the respective mass spectra are shown in Fig.4. Table 5: Retention time of the products 1-4 resulting from chromatograms Product Retention time [s] 8.0 8.15 8.31 8.45 2.3 Bergamotene and valencene Biotransformations with the WT and the variants I288del, I288del_A321T and N279T_I288del_A321T and the substrates bergamotene and valencene were performed as described in the methods section.The resulting product formation for bergamotene are displayed in Fig.5.An exemplary chromatogram of bergamotene biotransformation is shown in Fig.6. The resulting product formation for valencene are shown in Fig.7. An exemplary chromatogram of the biotransformation of valencene is shown in Fig.8.

Claims

1. Claims1. A method for the manufacture of a composition comprising santalol, the method comprisingthe step of converting at least one santalene into at least one santalol, wherein the conversion is carried out by at least one polypeptide having cumene dioxygenase activity comprising an amino acid sequence selected from the group consisting of: a) an amino acid sequence comprising a single point deletion at the amino acid position corresponding to position 288 of SEQ ID NO.1 (amino acid sequence from oxygenase alpha subunit CumA1 of wildtype cumene dioxygenase from Pseudomonas fluorescens IP01); b) an amino acid sequence comprising a single point deletion at the amino acid position corresponding to position 288 of SEQ ID NO.1 and an Alanine to Threonine substitution at the amino acid position corresponding to position 321 of SEQ ID NO.1 (A321T); c) an amino acid sequence comprising a single point deletion at the amino acid position corresponding to position 288 of SEQ ID NO.1 and an Asparagine to Threonine substitution at the amino acid position corresponding to position 279 of SEQ ID NO.1 (N279T) and an Alanine to Threonine substitution at the amino acid position corresponding to position 321 of SEQ ID NO.1 (A321T);d) an amino acid sequence which is at least 60%, at least 70%, at least 80%, at least 85%, atleast 90%, at least 95%, at least 98% or at least 99% identical to the amino acid sequence ofSEQ ID NO.1 and has a single point deletion at the amino acid position corresponding toposition 288 of SEQ ID NO.1;e) an amino acid sequence which is at least 60%, at least 70%, at least 80%, at least 85%, atleast 90%, at least 95%, at least 98% or at least 99% identical to the amino acid sequence ofSEQ ID NO.1 and has a single point deletion at the amino acid position corresponding toposition 288 of SEQ ID NO.1 and an Alanine to Threonine substitution at the amino acid position corresponding to position 321 of SEQ ID NO.1 (A321T);f) an amino acid sequence which is at least 60%, at least 70%, at least 80%, at least 85%, atleast 90%, at least 95%, at least 98% or at least 99% identical to the amino acid sequence ofSEQ ID NO.1 and has a single point deletion at the amino acid position corresponding toposition 288 of SEQ ID NO.1 and an Asparagine to Threonine substitution at the amino acid position corresponding to position 279 of SEQ ID NO.1 (N279T) and an Alanine to Threonine substitution at the amino acid position corresponding to position 321 of SEQ ID NO.1 (A321T); andg) a fragment of the amino acid sequence of a), b) or c), said fragment exhibiting cumenedioxygenase activity.

2. The method of claim 1, wherein said at least one santalene is alpha-santalene, beta-santalene, a mixture of alpha-santalene and beta-santalene, or an isomeric mixture of santalene.

3. The method of claim 1 or 2, wherein said conversion of at least one santalene into at leastone santalol is a monohydroxylation of the at least one santalene into the at least one santalol.

4. The method of claim 1, 2 or 3, wherein the activity and regioselectivity of the polypeptidehaving cumene dioxygenase activity is tail hydroxylation.

5. The method of any one of claims 1 to 4, wherein said at least one santalol is alpha-santalol,preferably (Z)-alpha santalol, beta-santalol, preferably (Z)-beta santalol, or a mixture of alpha- santalol and beta-santalol, preferably a mixture comprising (Z)-alpha santalol and (Z)-beta santalol, or wherein said at least one santalol is preferably enantiopure alpha-santalol or enantiopure beta-santalol, more preferably enantiopure (Z)-alpha santalol, or enantiopure (Z)- beta santalol.

6. The method of any one of claims 1 to 5, wherein the step of converting at least onesantalene into at least one santalol is carried out in a host cell.

7. The method of claim 6, wherein said host cell is selected from the group consisting of: abacterial cell, a yeast cell, a fungal cell, an algal cell or a cyanobacterial cell, a non-human animal cell or a non-human mammalian cell, and a plant cell.

8. The method of any one of claims 1 to 5, wherein the step of converting at least onesantalene into at least one santalol is carried out in a non-human transgenic organism.

9. The method of claim 8, wherein said non-human transgenic organism is a microorganismsuch as a bacterium, a plant, or a non-human animal.

10. The method of any one of claims 6 to 9, wherein said polypeptide having cumenedioxygenase activity is encoded by a heterologous polynucleotide, a vector or a gene construct.

11. A composition comprising a mixture of alpha-santalol and beta-santalol obtainable by themethod of any one of claims 1 to 10, preferably a mixture comprising (Z)-alpha santalol and (Z)-beta santalol, more preferably a mixture wherein (Z)-alpha santalol and (Z)-beta santalol ispresent in the composition in a relative amount to total santalol of at least 60 %, at least 70%, at least 80%, at least 90%, or between 60% and 85%, or between 65% and 80%.

12. Use of the polypeptide having cumene dioxygenase activity as defined in claim 1, theheterologous polynucleotide, the vector or gene construct as defined in claim 10, the host cellas defined in claim 6 or 7, or the non-human transgenic organism as defined in claim 8 or 9, forthe manufacture of a composition comprising at least one santalol, preferably a mixturecomprising alpha-santalol and beta-santalol, preferably (Z)-alpha-santalol and (Z)-beta-santalol.

13. A method for manufacturing a composition comprising at least one santalol, comprising:a) producing a composition comprising at least one santalol by the method of any one ofclaims 1 to 10; andb) formulating said composition comprising at least one santalol.

14. A kit for the manufacture of a composition comprising at least one santalol comprising thepolypeptide having cumene dioxygenase activity as defined in claim 1, the heterologouspolynucleotide, the vector or gene construct as defined in claim 10, the host cell as defined in claim 6 or 7, preferably a bacterial host cell .

15. A non-human host cell expressing a polypeptide having cumene dioxygenase activity asdefined in claim 1, from the heterologous polynucleotide, the vector or gene construct asdefined in claim 10.

16. A non-human transgenic organism expressing a polypeptide having cumene dioxygenaseactivity as defined in claim 1, from the heterologous polynucleotide, the vector or gene constructas defined in claim 10.

17. A cumene dioxygenase variant converting santalene into santalol, comprising an aminoacid sequence selected from the group consisting of: a) an amino acid sequence comprising a single point deletion at the amino acid position corresponding to position 288 of SEQ ID NO.1 and an Alanine to Threonine substitution at the amino acid position corresponding to position 321 of SEQ ID NO.1 (A321T); b) an amino acid sequence comprising a single point deletion at the amino acid position corresponding to position 288 of SEQ ID NO.1 and an Asparagine to Threonine substitution at the amino acid position corresponding to position 279 of SEQ ID NO.1 (N279T) and an Alanine to Threonine substitution at the amino acid position corresponding to position 321 of SEQ ID NO.1 (A321T); c) an amino acid sequence which is at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identical to the amino acid sequence of SEQ ID NO.1 and has a single point deletion at the amino acid position corresponding to position 288 of SEQ ID NO.1 and an Alanine to Threonine substitution at the amino acid position corresponding to position 321 of SEQ ID NO.1 (A321T);d) an amino acid sequence which is at least 60%, at least 70%, at least 80%, at least 85%, atleast 90%, at least 95%, at least 98% or at least 99% identical to the amino acid sequence of SEQ ID NO.1 and has a single point deletion at the amino acid position corresponding to position 288 of SEQ ID NO.1 and an Asparagine to Threonine substitution at the amino acidposition corresponding to position 279 of SEQ ID NO.1 (N279T) and an Alanine to Threoninesubstitution at the amino acid position corresponding to position 321 of SEQ ID NO.1 (A321T); ande) a fragment of the amino acid sequence of a) or b), said fragment exhibiting cumenedioxygenase activity.

18. A method for the manufacture of a composition comprising bergamotol, the methodcomprising the step of converting at least one bergamotene into at least one bergamotol, wherein the conversion is carried out by at least one polypeptide having cumene dioxygenase activity comprising an amino selected from the group consisting of:a) an amino acid sequence comprising a single point deletion at the amino acid position corresponding to position 288 of SEQ ID NO.1; b) an amino acid sequence comprising a single point deletion at the amino acid position corresponding to position 288 of SEQ ID NO.1 and an Alanine to Threonine substitution at the amino acid position corresponding to position 321 of SEQ ID NO.1 (A321T); c) an amino acid sequence comprising a single point deletion at the amino acid position corresponding to position 288 of SEQ ID NO.1 and an Asparagine to Threonine substitution at the amino acid position corresponding to position 279 of SEQ ID NO.1 (N279T) and an Alanine to Threonine substitution at the amino acid position corresponding to position 321 of SEQ ID NO.1 (A321T); d) an amino acid sequence which is at least 60%, at least 70%, at least 80%, at least 85%, atleast 90%, at least 95%, at least 98% or at least 99% identical to the amino acid sequence ofSEQ ID NO. 1 and has a single point deletion at the amino acid position corresponding toposition 288 of SEQ ID NO.1;e) an amino acid sequence which is at least 60%, at least 70%, at least 80%, at least 85%, atleast 90%, at least 95%, at least 98% or at least 99% identical to the amino acid sequence ofSEQ ID NO.1 and has a single point deletion at the amino acid position corresponding to position 288 of SEQ ID NO.1 and an Alanine to Threonine substitution at the amino acidposition corresponding to position 321 of SEQ ID NO. 1 (A321T);f) an amino acid sequence which is at least 60%, at least 70%, at least 80%, at least 85%, atleast 90%, at least 95%, at least 98% or at least 99% identical to the amino acid sequence ofSEQ ID NO.1 and has a single point deletion at the amino acid position corresponding toposition 288 of SEQ ID NO.1 and an Asparagine to Threonine substitution at the amino acid position corresponding to position 279 of SEQ ID NO.1 (N279T) and an Alanine to Threoninesubstitution at the amino acid position corresponding to position 321 of SEQ ID NO.1 (A321T);andg) a fragment of the amino acid sequence of a), b) or c), said fragment exhibiting cumenedioxygenase activity.

19. A method for the manufacture of a composition comprising nootkatol, the methodcomprising the step of converting at least one valencene into at least one nootkatol, wherein the conversion is carried out by at least one polypeptide having cumene dioxygenase activity comprising an amino selected from the group consisting of: a) an amino acid sequence, preferably the amino acid sequence of SEQ ID NO.1, comprising a single point deletion at the amino acid position corresponding to position 288 of SEQ ID NO. 1; b) an amino acid sequence which is at least 60%, at least 70%, at least 80%, at least 85%, atleast 90%, at least 95%, at least 98% or at least 99% identical to the amino acid sequence ofSEQ ID NO.1 and has a single point deletion at the amino acid position corresponding toposition 288 of SEQ ID NO. 1; andc) a fragment of (a), said fragment encoding a polypeptide exhibiting cumene dioxygenaseactivity.

Images