Method for producing nucleic acid oligomer

By using fluoride ions with specific additives to deprotect triisopropylsilyloxymethyl-protected nucleic acid oligomers, the method enhances the purity of nucleic acid oligomers, addressing the purity issues in existing production methods.

WO2026048956A1PCT designated stage Publication Date: 2026-03-05SUMITOMO CHEM CO LTD
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
PCT/JP2025/030349
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-08-29
Filing Date
2025-08-28
Publication Date
2026-03-05

AI Technical Summary

Technical Problem

The purity of nucleic acid oligomers produced using phosphoramidite compounds with a triisopropylsilyloxymethyl group protection at the 2'-position of ribose is not satisfactory.

Method used

Contacting nucleic acid oligomers with fluoride ions in the presence of specific additives to deprotect the triisopropylsilyloxymethyl group, using compounds like ammonia, methylamine, or nitrogen-containing heterocyclic compounds, to enhance the deprotection efficiency.

Benefits of technology

This method improves the purity of nucleic acid oligomers by effectively removing the triisopropylsilyloxymethyl group, leading to higher quality products.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure JPOXMLDOC01-APPB-C000001
    Figure JPOXMLDOC01-APPB-C000001
  • Figure JPOXMLDOC01-APPB-C000002
    Figure JPOXMLDOC01-APPB-C000002
  • Figure JPOXMLDOC01-APPB-C000003
    Figure JPOXMLDOC01-APPB-C000003
Patent Text Reader

Abstract

The present invention provides an efficient method for producing a nucleic acid oligomer, in particular, the method for efficiently deprotecting a triisopropylsilyloxymethyl group of a ribose in which a hydroxyl group at a 2'-position in a nucleic acid oligomer has been protected by the triisopropylsilyloxymethyl group. Additionally, the present invention provides the method for producing a nucleic acid oligomer, the method including a step for contacting, with fluoride ions, in the presence of a specific additive, a nucleic acid oligomer that contains ribose having the hydroxyl group at the 2'-position protected by the triisopropylsilyloxymethyl group, to deprotect the triisopropylsilyloxymethyl group, wherein the additive is a compound, etc. represented by formula (A).
Need to check novelty before this filing date? Find Prior Art

Description

Method for producing nucleic acid oligomers

[0001] This patent application claims priority under the Paris Convention to and the benefit of Japanese Patent Application No. 2024-147571 (filed August 29, 2024), the entire contents of which are incorporated herein by reference. The present invention relates to a method for producing a nucleic acid oligomer.

[0002] In recent years, there has been growing interest in the application of nucleic acid oligomers in the medical field, including antisense nucleic acids, aptamers, ribozymes, and nucleic acids that induce RNA interference (RNAi), such as siRNA, which are called nucleic acid drugs.

[0003] Nucleic acid oligomers can be produced by solid-phase synthesis. Specifically, nucleic acid oligomers can be produced by solid-phase synthesis based on the phosphoramidite method. In the phosphoramidite method, a phosphoramidite compound in which the hydroxyl group at the 2'-position of ribose is protected with a protecting group can be used as a starting material. Post-treatment in solid-phase synthesis includes a step of cleaving the nucleic acid oligomer from the solid support and a step of deprotecting the protecting group of the hydroxyl group at the 2'-position of ribose constituting the nucleic acid oligomer cleaved from the solid support.

[0004] The protecting group for the hydroxyl group at the 2'-position of ribose can be, for example, a triisopropylsilyloxymethyl group (TOM group). However, when a nucleic acid oligomer is produced using a phosphoramidite compound in which the hydroxyl group at the 2'-position of ribose is protected with a triisopropylsilyloxymethyl group, the purity of the produced nucleic acid oligomer is not necessarily satisfactory.

[0005] HELVETICA CHIMICA ACTA, 2001, Vol. 84, 3773-3795

[0006] An object of the present invention is to provide an efficient method for producing a nucleic acid oligomer.

[0007] As a result of extensive research aimed at solving the above-mentioned problems, the present inventors have discovered that by contacting a nucleic acid oligomer containing ribose, the 2'-hydroxyl group of which is protected with a triisopropylsilyloxymethyl group, with fluoride ions in the presence of a specific additive, the triisopropylsilyloxymethyl group can be efficiently deprotected. As a result, the present invention can provide an efficient method for producing a nucleic acid oligomer.

[0008] The present invention was completed based on these findings and includes, but is not limited to, the following embodiments. [1] A method for producing a nucleic acid oligomer, comprising the step of contacting a nucleic acid oligomer containing ribose, the hydroxyl group at the 2'-position of which is protected with a triisopropylsilyloxymethyl group, with a fluoride ion in the presence of an additive to deprotect the triisopropylsilyloxymethyl group, wherein the additive is at least one selected from the group consisting of a compound represented by the following formula (A), a compound represented by the following formula (B), a compound represented by the following formula (C), a compound represented by the following formula (D), a compound represented by the following formula (E), a compound represented by the following formula (F), the following nitrogen-containing heterocyclic compounds, and amidines. Formula (A) R a -NH 2 (In the formula, R a represents a hydrogen atom, a methyl group, an ethyl group, an n-propyl group, an isopropyl group, an n-butyl group, an isobutyl group, a sec-butyl group, a tert-butyl group, an n-pentyl group, an n-hexyl group, a cyclopropyl group, a cyclobutyl group, a cyclopentyl group, a cyclohexyl group, a phenyl group, or a benzyl group. b -NH-R c (In the formula, R b and R c are the same or different and each represent a methyl group, an ethyl group, an n-propyl group, an isopropyl group, an n-butyl group, an isobutyl group, a sec-butyl group, a tert-butyl group, an n-pentyl group, an n-hexyl group, a cyclopropyl group, a cyclobutyl group, a cyclopentyl group, a cyclohexyl group, a phenyl group, or a benzyl group. b -OH (wherein, R bis as defined in formula (B) above.) Formula (D) R d -SH (wherein, R d represents a methyl group, an ethyl group, an n-propyl group, an isopropyl group, an n-butyl group, an isobutyl group, a sec-butyl group, a tert-butyl group, an n-pentyl group, an n-hexyl group, an n-heptyl group, an n-octyl group, an n-nonyl group, an n-decyl group, an n-undecyl group, an n-dodecyl group, a cyclobutyl group, a cyclopentyl group, a cyclohexyl group, a cycloheptyl group, a cyclooctyl group, a phenyl group, or a benzyl group. b -NO 2 (In the formula, R b is as defined in formula (B) above.) Formula (F) R e - (CH 2 -R f -CH 2 ) n -R g (In the formula, R e and R g are the same or different, and NH 2 , OH, SH, or COOH; R f is a single bond, CH 2 , C.H. 2 -O-CH 2 or an oxygen atom, and n represents an integer of 1 to 3. e and R gand (b) do not both become COOH.) The nitrogen-containing heterocyclic compound is a nitrogen-containing five-membered ring compound or a nitrogen-containing six-membered ring compound, the nitrogen-containing five-membered ring compound is pyrrolidine, 3-pyrroline, 2-pyrroline, 2H-pyrrole, 3H-pyrrole, pyrazolidine, imidazolidine, 2-pyrazoline, 2-imidazolidine, pyrazole, imidazole, 1,2,4-triazole, 1,2,3-triazole, 1H-tetrazole, 1-methylimidazole, oxazole, isoxazole, isothiazole, or thiazole, the nitrogen-containing six-membered ring compound is piperidine, piperazine, pyridine, pyridazine, pyrimidine, pyrazine, 1,2,4-triazine, 1,3,5-triazine, 2,6-lutidine, 3,5-lutidine, 4-dimethylaminopyridine, 2-dimethylaminopyridine, morpholine, or thiomorpholine, The amidine is benzamidine, formamidine, guanidine, benzamidine, or acetamidine. [2] In the presence of an additive, a compound represented by the following formula (3): (In the formula, G 4 represents a protecting group for a hydrogen atom or a hydroxyl group; 9 represents an ammonium ion, an alkylammonium ion, an alkali metal ion, a hydrogen ion, or a hydroxyalkylammonium ion; B care each independently the same or different and represent a nucleic acid base; R are each independently the same or different and represent a hydrogen atom, a fluorine atom, or an OQ group; Q are each independently the same or different and represent a triisopropylsilyloxymethyl group, a methyl group, a 2-methoxyethyl group, a methylene group bonded to the carbon atom at the 4' position of ribose, an ethylene group bonded to the carbon atom at the 4' position of ribose, or an ethylidene group bonded to the carbon atom at the 4' position of ribose; Y are each independently the same or different and represent an oxygen atom or a sulfur atom; m represents an integer of 2 to 400; W and X are defined as either (a) or (b) below; (a) when W is a hydroxyl group, X are each independently the same or different and represent a hydrogen atom, a fluorine atom, or an OQ' group; Q' are each independently the same or different and represent a triisopropylsilyloxymethyl group, a methyl group, a 2-methoxyethyl group, a methylene group bonded to the 4' carbon atom of ribose, an ethylene group bonded to the 4' carbon atom of ribose, an ethylidene group bonded to the 4' carbon atom of ribose, or a tert-butyldimethylsilyl group. (b) When X is a hydroxyl group, W represents an OV group, and V represents a triisopropylsilyloxymethyl group, a tert-butyldimethylsilyl group, a methyl group, or a 2-methoxyethyl group. However, at least one group among R represents a hydroxyl group protected with a triisopropylsilyloxymethyl group. When m is an integer of 3 or greater, non-nucleotide linkers may be incorporated in place of p nucleotides (where p is a positive integer satisfying the formula: m-1>p) between the 5'- and 3'-terminal nucleotides. ) is contacted with fluoride ions, (wherein, each R' is independently the same or different and represents a hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethoxy group, or an OQ" group; each Q" is independently the same or different and represents a methylene group bonded to the carbon atom at the 4' position of ribose, an ethylene group bonded to the carbon atom at the 4' position of ribose, or an ethylidene group bonded to the carbon atom at the 4' position of ribose; G 4 , G 9 , B c , Y and m are as defined in the formula (3), 0 is a hydroxyl group, a methoxy group, or a 2-methoxyethoxy group, and X 0 has the same definition as the R' group, and when m is an integer of 3 or more, a non-nucleotide linker may be incorporated in place of p nucleotides (wherein p is a positive integer satisfying the formula: m-1>p) between each of the 5'-terminal and 3'-terminal nucleotides, wherein the additive is at least one selected from the group consisting of a compound represented by the following formula (A), a compound represented by the following formula (B), a compound represented by the following formula (C), a compound represented by the following formula (D), a compound represented by the following formula (E), a compound represented by the following formula (F), and the following nitrogen-containing heterocyclic compound. a -NH 2 (In the formula, R a represents a hydrogen atom, a methyl group, an ethyl group, an n-propyl group, an isopropyl group, an n-butyl group, an isobutyl group, a sec-butyl group, a tert-butyl group, an n-pentyl group, an n-hexyl group, a cyclopropyl group, a cyclobutyl group, a cyclopentyl group, a cyclohexyl group, a phenyl group, or a benzyl group. b -NH-R c (In the formula, R b and R care the same or different and each represent a methyl group, an ethyl group, an n-propyl group, an isopropyl group, an n-butyl group, an isobutyl group, a sec-butyl group, a tert-butyl group, an n-pentyl group, an n-hexyl group, a cyclopropyl group, a cyclobutyl group, a cyclopentyl group, a cyclohexyl group, a phenyl group, or a benzyl group. b -OH (wherein, R b is as defined in formula (B) above.) Formula (D) R d -SH (wherein, R d represents a methyl group, an ethyl group, an n-propyl group, an isopropyl group, an n-butyl group, an isobutyl group, a sec-butyl group, a tert-butyl group, an n-pentyl group, an n-hexyl group, an n-heptyl group, an n-octyl group, an n-nonyl group, an n-decyl group, an n-undecyl group, an n-dodecyl group, a cyclobutyl group, a cyclopentyl group, a cyclohexyl group, a cycloheptyl group, a cyclooctyl group, a phenyl group, or a benzyl group. b -NO 2 (In the formula, R b is as defined in formula (B) above.) Formula (F) R e - (CH 2 -R f -CH 2 ) n -R g (In the formula, R e and R g are the same or different, and NH 2 , OH, SH, or COOH; R f is a single bond, CH 2 , C.H. 2 -O-CH 2 or an oxygen atom, and n represents an integer of 1 to 3. e and R gare not both COOH.) The nitrogen-containing heterocyclic compound is a nitrogen-containing five-membered ring compound or a nitrogen-containing six-membered ring compound, the nitrogen-containing five-membered ring compound is pyrrolidine, 3-pyrroline, 2-pyrroline, 2H-pyrrole, 3H-pyrrole, pyrazolidine, imidazolidine, 2-pyrazoline, 2-imidazolidine, pyrazole, imidazole, 1,2,4-triazole, 1,2,3-triazole, 1H-tetrazole, 1-methylimidazole, oxazole, isoxazole, isothiazole, or thiazole, and the nitrogen-containing six-membered ring compound is piperidine, piperazine, pyridine, pyridazine, pyrimidine, pyrazine, 1,2,4-triazine, 1,3,5-triazine, 2,6-lutidine, 3,5-lutidine, 4-dimethylaminopyridine, 2-dimethylaminopyridine, morpholine, or thiomorpholine. [3] The method according to [2], wherein the non-nucleotide linker is a linker having an amino acid backbone. [4] The method according to [3], wherein the linker having an amino acid backbone has a structure represented by the following formula (A14-1), (A14-2), or (A14-3): (In the formula, 5' and 3' represent the 5'-end and 3'-end of the nucleic acid oligomer, respectively, and G 9 and Y are as defined in [2].) [5] In formula (3), W represents a hydroxyl group, and X are each independently the same or different and represent a hydrogen atom, a fluorine atom, or an OQ′ group; and in formula (4), W 0 represents a hydroxyl group, and X 0represents an R' group. [6] The method according to any one of [1] to [5], wherein the fluoride ion source is at least one selected from the group consisting of tetraalkylammonium fluoride, trialkylamine hydrofluoride, hydrogen fluoride pyridine, and ammonium fluoride. [7] The method according to [6], wherein the tetraalkylammonium fluoride is tetra-n-butylammonium fluoride. [8] The method according to [6], wherein the trialkylamine hydrofluoride is triethylamine trihydrofluoride. [9] The method according to any one of [1] to [5], wherein the fluoride ion source is at least one selected from the group consisting of tetra-n-butylammonium fluoride, triethylamine trihydrofluoride, and hydrogen fluoride pyridine.

[10] The production method according to any one of [1] to [9], wherein the compound represented by formula (A) is ammonia, methylamine, ethylamine, n-propylamine, isopropylamine, n-butylamine, isobutylamine, sec-butylamine, tert-butylamine, n-pentylamine, n-hexylamine, cyclopropylamine, cyclobutylamine, cyclopentylamine, cyclohexylamine, aniline, or benzylamine.

[11] The production method according to any one of [1] to [9], wherein the compound represented by formula (A) is ammonia or methylamine.

[12] The production method according to any one of [1] to

[11] , wherein the compound represented by formula (B) is dimethylamine, diethylamine, di-n-propylamine, diisopropylamine, di-n-butylamine, diisobutylamine, di-sec-butylamine, di-tert-butylamine, di-n-pentylamine, di-n-hexylamine, dicyclopropylamine, dicyclobutylamine, dicyclopentylamine, dicyclohexylamine, diphenylamine, dibenzylamine, N-methylethylamine, N-methylpropylamine, N-methylisopropylamine, N-methylbutylamine, N-methylpentylamine, N-methylhexylamine, N-methylcyclohexylamine, N-methylaniline, or N-methylbenzylamine.

[13] The production method according to any one of [1] to

[11] , wherein the compound represented by formula (B) is diethylamine.

[14] The production method according to any one of [1] to

[13] , wherein the compound represented by formula (C) is methanol, ethanol, n-propanol, isopropanol, n-butanol, isobutanol, sec-butanol, tert-butanol, n-pentanol, n-hexanol, cyclopropanol, cyclobutanol, cyclopentanol, cyclohexanol, phenol, or benzyl alcohol.

[15] The production method according to any one of [1] to

[13] , wherein the compound represented by formula (C) is methanol or ethanol.

[16] The method according to any one of [1] to

[15] , wherein the compound represented by formula (D) is methanethiol, ethanethiol, 1-propanethiol, 2-propanethiol, 1-butanethiol, 2-butanethiol, 2-methyl-1-propanethiol, 2-methyl-2-propanethiol, 1-pentanethiol, 1-hexanethiol, 1-heptanethiol, 1-octanethiol, 1-nonanethiol, 1-decanethiol, 1-undecanethiol, 1-dodecanethiol, cyclobutanethiol, cyclopentanethiol, cyclohexanethiol, cycloheptanethiol, cyclooctanethiol, phenylthiol, or benzylthiol.

[17] The method according to any one of [1] to

[15] , wherein the compound represented by formula (D) is 1-dodecanethiol.

[18] The production method according to any one of [1] to

[17] , wherein the compound represented by formula (E) is nitromethane, nitroethane, 1-nitropropane, 2-nitropropane, 1-nitrobutane, 1-nitropentane, or 1-nitrohexane.

[19] The production method according to any one of [1] to

[17] , wherein the compound represented by formula (E) is nitromethane.

[20] The production method according to any one of [1] to

[19] , wherein the compound represented by formula (F) is ethylenediamine, ethanolamine, 2-mercaptoethanol, 3-mercapto-1-propanol, 4-mercapto-1-butanol, 6-mercapto-1-hexanol, 2-mercaptoethyl ether, or 3-mercaptopropionic acid.

[21] The production method according to any one of [1] to

[19] , wherein the compound represented by formula (F) is ethylenediamine or 3-mercaptopropionic acid.

[22] The production method according to any one of [1] to

[21] , wherein the nitrogen-containing heterocyclic compound is 1-methylimidazole, piperazine, or morpholine.

[23] The production method according to any one of [1] to [9], wherein the additive is at least one selected from the group consisting of ammonia, methylamine, diethylamine, methanol, ethanol, 1-dodecanethiol, nitromethane, ethylenediamine, 3-mercaptopropionic acid, 1-methylimidazole, piperazine, and morpholine.

[24] G. 4 represents a protecting group for a hydroxyl group, the protecting group is (In the formula, R 1 , R 2 and R 3

[25] The method according to any one of [1] to

[23] , wherein R 1 and R 2 is a methoxy group, and R 3

[26] The method according to any one of [2] to

[25] , wherein m is an integer of 50 to 200.

[0009] The present invention provides an efficient method for producing nucleic acid oligomers, which is expected to improve the purity of the produced nucleic acid oligomers.

[0010] As a mode for carrying out the present invention, the following embodiments will be described, but the present invention is not limited to the following embodiments.

[0011] Hereinafter, as a first embodiment of the present invention, a "method for producing a nucleic acid oligomer, comprising a step of contacting a nucleic acid oligomer containing ribose, the hydroxyl group of which is protected with a triisopropylsilyloxymethyl group, with fluoride ions in the presence of an additive, to deprotect the triisopropylsilyloxymethyl group" will be described. Furthermore, as a second embodiment of the present invention, a "method for producing a nucleic acid oligomer represented by formula (4), which comprises contacting a nucleic acid oligomer represented by formula (3) with fluoride ions in the presence of an additive" will be described. In this specification, unless otherwise specified, the first and second embodiments will be collectively referred to as the "method of the present invention."

[0012] The term "nucleic acid oligomer" as used herein includes, for example, nucleic acid oligomers having chain lengths of 2 mers or more, 10 mers or more, 20 mers or more, 40 mers or more, 50 mers or more, 60 mers or more, 80 mers or more, 100 mers or more, 200 mers or more, 300 mers or more, 2 to 400 mers, 2 to 300 mers, 2 to 200 mers, 2 to 150 mers, 50 to 400 mers, 50 to 300 mers, 50 to 200 mers, 50 to 150 mers, 100 to 400 mers, 100 to 300 mers, 100 to 200 mers, and 100 to 150 mers. The sugar constituting the nucleic acid oligomer may be ribose only, or may be both ribose and deoxyribose. The 2'-position of ribose may be a hydroxyl group, a hydroxyl group protected by a protecting group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethoxy group, or an OQ" group. Q" represents a methylene group bonded to the 4'-carbon atom of ribose, an ethylene group bonded to the 4'-carbon atom of ribose, or an ethylidene group bonded to the 4'-carbon atom of ribose. The bond between nucleotides constituting the nucleic acid oligomer may be a phosphodiester bond or a phosphorothioate bond. Examples of nucleosides constituting the nucleic acid oligomer include various nucleosides described in Xiulong, Shen et al., Nucleic Acids Research, 2018, Vol. 46, No. 46, 1584-1600, and Daniel O'Reilly et al., Nucleic Acids Research, 2019, Vol. 47, No. 2, 546-558.

[0013] The term "oligonucleotide" as used herein has the same meaning as the above-mentioned "nucleic acid oligomer."

[0014] The nucleic acid oligomer can be produced by solid-phase synthesis, specifically, by solid-phase synthesis based on the phosphoramidite method.

[0015] Examples of additives that can be used in the method of the present invention include at least one or more (e.g., two or three) of a compound represented by the following formula (A), a compound represented by the following formula (B), a compound represented by the following formula (C), a compound represented by the following formula (D), a compound represented by the following formula (E), a compound represented by the following formula (F), a nitrogen-containing heterocyclic compound, and an amidine. Examples include two or more of the respective components of the compound represented by the formula (A), a compound represented by the following formula (B), a compound represented by the following formula (C), a compound represented by the following formula (D), a compound represented by the formula (E), a compound represented by the following formula (F), a nitrogen-containing heterocyclic compound, or an amidine, and / or a combination of two or more of these. All of the above additives have the characteristic of being able to act as a nucleophile for by-products such as formaldehyde in the reaction of deprotecting a nucleic acid oligomer containing ribose, the hydroxyl group at the 2'-position of which is protected with a triisopropylsilyloxymethyl group, by contacting it with fluoride ions. For example, they have the characteristic of being able to perform a nucleophilic attack on the carbonyl carbon of a carbonyl compound.

[0016] Formula (A) R a -NH 2 (In the formula, R a represents a hydrogen atom, a methyl group, an ethyl group, an n-propyl group, an isopropyl group, an n-butyl group, an isobutyl group, a sec-butyl group, a tert-butyl group, an n-pentyl group, an n-hexyl group, a cyclopropyl group, a cyclobutyl group, a cyclopentyl group, a cyclohexyl group, a phenyl group, or a benzyl group.

[0017] Formula (B) R b -NH-R c (In the formula, R b and R c are the same or different and each represent a methyl group, an ethyl group, an n-propyl group, an isopropyl group, an n-butyl group, an isobutyl group, a sec-butyl group, a tert-butyl group, an n-pentyl group, an n-hexyl group, a cyclopropyl group, a cyclobutyl group, a cyclopentyl group, a cyclohexyl group, a phenyl group, or a benzyl group.

[0018] Formula (C) R b -OH (wherein, R b is as defined in formula (B) above.

[0019] Formula (D) R d -SH (wherein, R d represents a methyl group, an ethyl group, an n-propyl group, an isopropyl group, an n-butyl group, an isobutyl group, a sec-butyl group, a tert-butyl group, an n-pentyl group, an n-hexyl group, an n-heptyl group, an n-octyl group, an n-nonyl group, an n-decyl group, an n-undecyl group, an n-dodecyl group, a cyclobutyl group, a cyclopentyl group, a cyclohexyl group, a cycloheptyl group, a cyclooctyl group, a phenyl group, or a benzyl group.

[0020] Formula (E) R b -NO 2 (In the formula, R b is as defined in formula (B) above.

[0021] Formula (F) R e - (CH 2 -R f -CH 2 ) n -R g (In the formula, R e and R g are the same or different, and NH 2 , OH, SH, or COOH; R f is a single bond, CH 2 , C.H. 2 -O-CH 2 or an oxygen atom, and n represents an integer of 1 to 3. e and R g Both cannot be COOH.)

[0022] Examples of the compound represented by formula (A) that can be used as an additive in the method of the present invention include ammonia, methylamine, ethylamine, n-propylamine, isopropylamine, n-butylamine, isobutylamine, sec-butylamine, tert-butylamine, n-pentylamine, n-hexylamine, cyclopropylamine, cyclobutylamine, cyclopentylamine, cyclohexylamine, aniline, and benzylamine. Preferred examples include ammonia and methylamine.

[0023] Examples of the compound represented by formula (B) that can be used as an additive in the method of the present invention include dimethylamine, diethylamine, di-n-propylamine, diisopropylamine, di-n-butylamine, diisobutylamine, di-sec-butylamine, di-tert-butylamine, di-n-pentylamine, di-n-hexylamine, dicyclopropylamine, dicyclobutylamine, dicyclopentylamine, dicyclohexylamine, diphenylamine, dibenzylamine, N-methylethylamine, N-methylpropylamine, N-methylisopropylamine, N-methylbutylamine, N-methylpentylamine, N-methylhexylamine, N-methylcyclohexylamine, N-methylaniline, and N-methylbenzylamine. Diethylamine is preferred.

[0024] Examples of the compound represented by formula (C) that can be used as an additive in the method of the present invention include methanol, ethanol, n-propanol, isopropanol, n-butanol, isobutanol, sec-butanol, tert-butanol, n-pentanol, n-hexanol, cyclopropanol, cyclobutanol, cyclopentanol, cyclohexanol, phenol, and benzyl alcohol. Methanol and ethanol are preferred.

[0025] Examples of the compound represented by formula (D) that can be used as an additive in the method of the present invention include methanethiol, ethanethiol, 1-propanethiol, 2-propanethiol, 1-butanethiol, 2-butanethiol, 2-methyl-1-propanethiol, 2-methyl-2-propanethiol, 1-pentanethiol, 1-hexanethiol, 1-heptanethiol, 1-octanethiol, 1-nonanethiol, 1-decanethiol, 1-undecanethiol, 1-dodecanethiol, cyclobutanethiol, cyclopentanethiol, cyclohexanethiol, cycloheptanethiol, cyclooctanethiol, phenylthiol, and benzylthiol. Preferably, 1-dodecanethiol is used.

[0026] Examples of the compound represented by formula (E) that can be used as an additive in the method of the present invention include nitromethane, nitroethane, 1-nitropropane, 2-nitropropane, 1-nitrobutane, 1-nitropentane, and 1-nitrohexane. Nitromethane is preferred.

[0027] Examples of the compound represented by formula (F) that can be used as an additive in the method of the present invention include ethylenediamine, ethanolamine, 2-mercaptoethanol, 3-mercapto-1-propanol, 4-mercapto-1-butanol, 6-mercapto-1-hexanol, 2-mercaptoethyl ether, and 3-mercaptopropionic acid. Preferred examples include ethylenediamine and 3-mercaptopropionic acid.

[0028] The nitrogen-containing heterocyclic compounds that can be used as additives in the method of the present invention are heterocyclic compounds containing at least one nitrogen atom among the atoms that form the ring, and examples thereof include nitrogen-containing five-membered ring compounds and nitrogen-containing six-membered ring compounds. Examples of nitrogen-containing five-membered ring compounds include pyrrolidine, 3-pyrroline, 2-pyrroline, 2H-pyrrole, 3H-pyrrole, pyrazolidine, imidazolidine, 2-pyrazoline, 2-imidazolidine, pyrazole, imidazole, 1,2,4-triazole, 1,2,3-triazole, 1H-tetrazole, 1-methylimidazole, oxazole, isoxazole, isothiazole, and thiazole. Examples of the nitrogen-containing six-membered ring compound include piperidine, piperazine, pyridine, pyridazine, pyrimidine, pyrazine, 1,2,4-triazine, 1,3,5-triazine, 2,6-lutidine, 3,5-lutidine, 4-dimethylaminopyridine, 2-dimethylaminopyridine, morpholine, and thiomorpholine. Preferred examples of the nitrogen-containing heterocyclic compound include 1-methylimidazole, piperazine, and morpholine.

[0029] Amidines that can be used as additives in the method of the present invention include, for example, benzamidine, formamidine, guanidine, benzamidine, and acetamidine.

[0030] The additives in the method of the present invention preferably include ammonia, methylamine, diethylamine, methanol, ethanol, 1-dodecanethiol, nitromethane, ethylenediamine, 3-mercaptopropionic acid, 1-methylimidazole, piperazine, and morpholine, or a mixture of two or more thereof.

[0031] The additive in the method of the present invention may be a mixture containing two or more additives. For example, a mixture of methylamine, which is a compound represented by formula (A), and ethanol, which is represented by formula (C), a mixture of ammonia, which is a compound represented by formula (A), and methylamine, which is a compound represented by formula (A), or a mixture of ammonia, which is a compound represented by formula (A), methylamine, which is a compound represented by formula (A), and ethanol, which is represented by formula (C), may be used.

[0032] The amount of additive used in the method of the present invention is not particularly limited, and may be, for example, 0.01 to 10,000 mol, 0.01 to 5,000 mol, 0.1 to 2,000 mol, 0.1 to 1,000 mol, 1 to 500 mol, 1 to 400 mol, 1 to 300 mol, 1 to 200 mol, 1 to 100 mol, 1 to 50 mol, 1 to 25 mol, 1 to 10 mol, or 1 to 5 mol per mol of triisopropylsilyloxymethyl groups.

[0033] In the method of the present invention, at least one selected from the group consisting of tetraalkylammonium fluoride, trialkylamine hydrofluoride, pyridine hydrogen fluoride, and ammonium fluoride can be used as a fluoride ion source. Examples of tetraalkylammonium fluoride include tetramethylammonium fluoride (TMAF), tetraethylammonium fluoride (TEAF), and tetra-n-butylammonium fluoride (TBAF). Preferred examples include tetra-n-butylammonium fluoride (TBAF). Preferred examples of trialkylamine hydrofluoride include triethylamine trihydrofluoride (TEA.3HF).

[0034] The amount of the fluoride ion source used in the method of the present invention is not particularly limited, and may be, for example, 1 to 1,000 mol, 1 to 500 mol, 2 to 400 mol, 4 to 300 mol, or 10 to 200 mol per 1 mol of triisopropylsilyloxymethyl group.

[0035] The method of the present invention is usually carried out in an organic solvent inert to the reaction. Examples of organic solvents inert to the reaction include sulfoxide solvents, nitrile solvents, ether solvents, amide solvents, ketone solvents, aliphatic hydrocarbon solvents, ester solvents, and aromatic solvents, or mixtures of two or more of these. Examples of sulfoxide solvents include dimethyl sulfoxide. Examples of nitrile solvents include acetonitrile and propionitrile. Examples of ether solvents include tetrahydrofuran. Examples of amide solvents include N-methyl-2-pyrrolidone and dimethylformamide. Examples of ketone solvents include acetone and methyl ethyl ketone. Examples of aliphatic hydrocarbon solvents include hexane and heptane. Examples of ester solvents include methyl acetate and ethyl acetate. Examples of aromatic solvents include toluene and pyridine. Preferred examples of the organic solvent inert to the reaction include dimethyl sulfoxide, a mixed solvent of dimethyl sulfoxide and acetonitrile, a mixed solvent of dimethyl sulfoxide and pyridine, and a mixed solvent of dimethyl sulfoxide, acetonitrile and pyridine.

[0036] The amount of organic solvent inert to the reaction used in the method of the present invention is not particularly limited, and may be, for example, 1 to 10,000 L, 5 to 8,000 L, 50 to 4,000 L, or 100 to 2,000 L per mole of nucleic acid oligomer containing ribose whose hydroxyl group at the 2'-position is protected with a triisopropylsilyloxymethyl group.

[0037] In the method of the present invention, a solution prepared by dissolving tetra-n-butylammonium fluoride, triethylamine trihydrofluoride, hydrogen fluoride pyridine, or ammonium fluoride in dimethyl sulfoxide, a mixed solvent of dimethyl sulfoxide and acetonitrile, a mixed solvent of dimethyl sulfoxide and pyridine, or a mixed solvent of dimethyl sulfoxide, acetonitrile, and pyridine can be used as a fluoride ion source. In this case, the solution may be used as a fluoride ion source after being dehydrated by adding a dehydrating agent. Examples of the dehydrating agent include molecular sieves and sulfates, with molecular sieve 4A being preferred.

[0038] The method of the present invention may be carried out, for example, by (i) adding a fluoride ion source to a mixture containing a nucleic acid oligomer containing ribose whose hydroxyl group at the 2'-position is protected with a triisopropylsilyloxymethyl group and an additive, (ii) adding a mixture containing a nucleic acid oligomer containing ribose whose hydroxyl group at the 2'-position is protected with a triisopropylsilyloxymethyl group and an additive to a fluoride ion source, (iii) adding a nucleic acid oligomer containing ribose whose hydroxyl group at the 2'-position is protected with a triisopropylsilyloxymethyl group to a mixture containing a fluoride ion source and an additive, or (iv) adding a nucleic acid oligomer containing ribose whose hydroxyl group at the 2'-position is protected with a triisopropylsilyloxymethyl group to a mixture containing a fluoride ion source and an additive. (v) a mixture containing a nucleic acid oligomer containing ribose whose 2'-hydroxyl group is protected with a triisopropylsilyloxymethyl group and an additive and a fluoride ion source may be added simultaneously to the reaction system; (vi) a mixture containing a fluoride ion source and an additive and a nucleic acid oligomer containing ribose whose 2'-hydroxyl group is protected with a triisopropylsilyloxymethyl group may be added simultaneously to the reaction system; or (vii) a fluoride ion source, an additive, and a nucleic acid oligomer containing ribose whose 2'-hydroxyl group is protected with a triisopropylsilyloxymethyl group may be added simultaneously to the reaction system. Of the above methods (i) to (vii), method (i) is preferred. In any of the above methods (i) to (vii), the nucleic acid oligomer containing ribose whose 2'-hydroxyl group is protected with a triisopropylsilyloxymethyl group, the additive, and the fluoride ion source may be dissolved in an organic solvent inert to the reaction. The method for adding the fluoride ion source is not particularly limited, but may be a method of adding it all at once, i.e., by pouring it in, or a method of adding it dropwise over a certain period of time. The time required to add the entire amount of the fluoride ion source is not particularly limited, but may be, for example, 1 minute or more, 5 minutes or more, 10 minutes or more, 15 minutes or more, 30 minutes or more, or 1 hour or more.The method for adding the solution containing the nucleic acid oligomer is not particularly limited, but may be a method of adding it all at once, i.e., by pouring it in, or a method of adding it dropwise over a certain period of time. The time required to add the entire amount of the solution containing the nucleic acid oligomer is not particularly limited, but may be, for example, 1 minute or more, 5 minutes or more, 10 minutes or more, 15 minutes or more, 30 minutes or more, or 1 hour or more. The method for adding the solution containing the additive is not particularly limited, but may be a method of adding it all at once, i.e., by pouring it in, or a method of adding it dropwise over a certain period of time. The time required to add the entire amount of the solution containing the additive is not particularly limited, but may be, for example, 1 minute or more, 5 minutes or more, 10 minutes or more, 15 minutes or more, 30 minutes or more, or 1 hour or more.

[0039] The reaction temperature in the method of the present invention is not particularly limited, and may be, for example, 80°C or lower, 70°C or lower, 60°C or lower, 50°C or lower, 40°C or lower, 35°C or lower, 30°C or lower, 25°C or lower, 20°C or lower, 15°C or lower, 10°C or lower, or 5°C or lower. Preferred temperatures include 5°C to 80°C, 10°C to 40°C, 10°C to 35°C, and 25°C to 35°C. When a fluoride ion source is added to a solution containing a nucleic acid oligomer, the reaction temperature may be appropriately changed after or during the addition of the fluoride ion source. For example, the fluoride ion source may be added to a solution containing a nucleic acid oligomer while maintaining the temperature of the solution at 5 to 25°C, and the temperature of the solution may be raised to 25 to 35°C after or during the addition of the fluoride ion source. When adding a solution containing a nucleic acid oligomer to a solution containing a fluoride ion source, the reaction temperature may be changed appropriately after or during the addition of the solution containing the nucleic acid oligomer. For example, the solution containing the nucleic acid oligomer may be added to the solution containing the fluoride ion source while maintaining the temperature of the solution at 5 to 25° C., and the temperature of the solution containing the fluoride ion source may be raised to 25 to 35° C. after or during the addition of the solution containing the nucleic acid oligomer.

[0040] The reaction time in the method of the present invention can be adjusted appropriately depending on the type of fluoride ion source used and the reaction temperature. For example, the reaction time may be 1 minute or more, 5 minutes or more, 10 minutes or more, 15 minutes or more, 30 minutes or more, 1 hour or more, 1 hour to 100 hours, 1 to 24 hours, 2 to 12 hours, or 3 to 6 hours. Furthermore, the fluoride ion source or additives may be added at any timing depending on the progress of the reaction.

[0041] The method of the present invention may be carried out by stirring the reaction solution. When the reaction solution is stirred, for example, the stirring power Pv is 0.0 to 0.5 kW / m 3 The stirring may be performed within a range of 0.1 to 0.3 kW / m 3 The mixture may be stirred within the range of .

[0042] The method of the present invention may be carried out in an inert gas atmosphere with an oxygen concentration adjusted to a certain level or less. An inert gas atmosphere with an oxygen concentration of a certain level or less may be prepared, for example, by preparing an inert gas with an oxygen concentration of a certain level or less, supplying it to the reaction system, and measuring and confirming that the oxygen concentration in the gas phase is within the predetermined oxygen concentration range. Specifically, the inert gas atmosphere can be adjusted by flowing a high-purity inert gas or an inert gas with an oxygen concentration adjusted to a certain level into the gas phase of the reaction system, or by replacing the gas phase atmosphere of the reaction system with the inert gas or an inert gas with an adjusted concentration. Examples of inert gases that can be used in the method of the present invention include, but are not limited to, nitrogen gas, argon gas, helium gas, and carbon dioxide. Preferred examples include nitrogen gas and argon gas. The reaction system atmosphere may be replaced by vacuum replacement, pressure replacement, flow replacement, bubbling replacement, or freeze-degassing replacement, and ultrasonic waves or heating may be applied during this process. Flow replacement or vacuum replacement is more preferred. Examples of the inert gas atmosphere having an oxygen concentration of a certain level or less include an inert gas atmosphere having an oxygen concentration of 15% or less, an inert gas atmosphere having an oxygen concentration of 10% or less, an inert gas atmosphere having an oxygen concentration of 5% or less, and an inert gas atmosphere having an oxygen concentration of 0%. The oxygen concentration can be measured using an oxygen concentration meter.

[0043] In the method of the present invention, a quenching agent may be used. Examples of quenching agents that can be used include aqueous ammonium acetate and Tris-HCl buffer. Quenching may be performed by adding the quenching agent to a solution containing the nucleic acid oligomer, additives, fluoride ions, and / or an organic solvent inert to the reaction.

[0044] Conventional methods can be used to separate and purify nucleic acid oligomers in which the triisopropylsilyloxymethyl groups have been deprotected, as produced by the methods of the present invention. Examples of such methods include extraction, concentration, neutralization, filtration, centrifugation, recrystallization, silica gel column chromatography, thin-layer chromatography, reverse-phase column chromatography, ion-exchange column chromatography, gel filtration column chromatography, hydrophobic interaction chromatography, hydrophilic interaction liquid chromatography, affinity chromatography, precipitation (e.g., precipitation of nucleic acid oligomers using ethanol, isopropanol, methanol, or polyethylene glycol), dialysis, and ultrafiltration. Purification of crude nucleic acid oligomers obtained by the methods of the present invention by reverse-phase column chromatography may be carried out according to the method described on pages 102-104 of "Synthesis of Therapeutic Oligonucleotides." Examples of packing materials for reverse-phase column chromatography include silica or polymers that serve as hydrophobic stationary phases, such as silica or polymers to which one or more groups selected from phenyl groups, alkyl groups having 1 to 20 carbon atoms, and cyanopropyl groups are immobilized. The silica or polymer filler may have a particle size of, for example, 2 μm or more, or 5 μm or more. A mobile phase containing an alkylammonium salt, a water-soluble organic solvent, and water can be used for reversed-phase column chromatography. As the alkylammonium salt, typically, a monoalkylammonium salt, a dialkylammonium salt, or a trialkylammonium salt is used; preferably, a monoalkylammonium salt or a dialkylammonium salt, and more preferably, a dialkylammonium salt. The monoalkylamine forming the monoalkylammonium salt preferably has 3 to 10 carbon atoms, more preferably 4 to 6 carbon atoms, and even more preferably hexylamine. The dialkylamine forming the dialkylammonium salt preferably has 4 to 10 carbon atoms, more preferably 5 to 9 carbon atoms. A preferred dialkylamine is di-n-butylamine.The trialkylamine forming the trialkylammonium salt preferably has 6 to 12 carbon atoms, more preferably 6 to 9 carbon atoms, and specifically includes triethylamine. Examples of acids forming the monoalkylammonium salt, dialkylammonium salt, and trialkylammonium salt include carbonic acid, acetic acid, formic acid, trifluoroacetic acid, and propionic acid. Examples of water-soluble organic solvents include alcohol-based organic solvents and nitrile-based organic solvents. Examples of alcohol-based organic solvents include C1-4 alcohols, C1-3 alcohols, and C1-2 alcohols, with methanol being preferred. Examples of nitrile-based organic solvents include acetonitrile. The temperature for reverse-phase column chromatography is typically 20 to 100°C, preferably 30 to 80°C, and more preferably 40 to 70°C.

[0045] The nucleic acid oligomer represented by the following formula (3) will be explained below.

[0046] In the formula, G 4 represents a hydrogen atom or a protecting group for a hydroxyl group. 4 When represents a protecting group for a hydroxyl group, the protecting group is preferably the following group: (In the formula, R 1 , R 2 and R 3 are each independently the same or different and represent a hydrogen atom or an alkoxy group. 1 , R 2 and R 3 Preferably, one of G is a hydrogen atom and the remaining two are the same or different (preferably the same) alkoxy groups, and a methoxy group is particularly preferred as the alkoxy group. 4 When represents a protecting group for a hydroxyl group, examples of the protecting group include a 4,4'-dimethoxytrityl group (DMTr group), a 4-monomethoxytrityl group, and a 4,4',4"-trimethoxytrityl group. The 4,4'-dimethoxytrityl group (DMTr group) is particularly preferred.

[0047] G 9represents an ammonium ion, alkylammonium ion, alkali metal ion, hydrogen ion, or hydroxyalkylammonium ion. Specific examples of the alkyl moiety of the alkylammonium ion include methyl, ethyl, n-propyl, isopropyl, n-butyl, dibutyl, isobutyl, tert-butyl, n-pentyl, isopentyl, and hexyl. More specific examples of the alkylammonium ion include diethylammonium ion, triethylammonium ion, tetrabutylammonium ion, hexylammonium ion, and dibutylammonium ion. Examples of the alkali metal ion include sodium ion and lithium ion. Specific examples of the hydroxyalkylammonium ion include hydroxymethyl, hydroxyethyl, hydroxy-n-propyl, hydroxyisopropyl, hydroxy-n-butyl, and trishydroxymethyl. More specific examples of the hydroxyalkylammonium ion include trishydroxymethylammonium ion.

[0048] B c are each independently the same or different and represent a nucleic acid base. c Examples of the nucleobase represented by B include adenine, cytosine, guanine, uracil, thymine, 5-methylcytosine, pseudouracil, and 1-methylpseudouracil. The nucleobase may be substituted with a substituent. Examples of the substituent include halogen atoms such as fluoro, chloro, bromo, and iodo groups, acyl groups such as acetyl groups, alkyl groups such as methyl and ethyl groups, arylalkyl groups such as benzyl groups, alkoxy groups such as methoxy groups, alkoxyalkyl groups such as methoxyethyl groups, cyanoalkyl groups such as cyanoethyl groups, hydroxy groups, hydroxyalkyl groups, acyloxymethyl groups, amino groups, monoalkylamino groups, dialkylamino groups, carboxy groups, cyano groups, and nitro groups, as well as combinations of two or more of these. B CMore specifically, the following groups can be mentioned: (In the formula, R 4’ represents a hydrogen atom or a methyl group; R 5’ represents a hydrogen atom or an acetyl group; R 6’ represents a hydrogen atom; 7 represents a 2-cyanoethyl group, R 8’ represents a hydrogen atom or a methyl group; R 9 represents a dimethylaminomethylene group.

[0049] R's are independently the same or different and represent a hydrogen atom, a fluorine atom, or an OQ group. Q's are independently the same or different and represent a triisopropylsilyloxymethyl group, a methyl group, a 2-methoxyethyl group, a methylene group bonded to the 4' carbon atom of ribose, an ethylene group bonded to the 4' carbon atom of ribose, or an ethylidene group bonded to the 4' carbon atom of ribose. Specific examples of the methylene group bonded to the 4' carbon atom of ribose, the ethylene group bonded to the 4' carbon atom of ribose, or the ethylidene group bonded to the 4' carbon atom of ribose include the structures shown by LNA-1, LNA-2, and LNA-3 below. (In the formula, B a represents a nucleobase which may be protected with a protecting group.

[0050] B aExamples of nucleobases represented by the formula (I) include adenine, cytosine, guanine, uracil, thymine, 5-methylcytosine, pseudouracil, and 1-methylpseudouracil. The nucleobase may be substituted with a substituent. Examples of the substituent include halogen atoms such as fluoro, chloro, bromo, and iodo groups, acyl groups such as acetyl groups, alkyl groups such as methyl and ethyl groups, arylalkyl groups such as benzyl groups, alkoxy groups such as methoxy groups, alkoxyalkyl groups such as methoxyethyl groups, cyanoalkyl groups such as cyanoethyl groups, hydroxy groups, hydroxyalkyl groups, acyloxymethyl groups, amino groups, monoalkylamino groups, dialkylamino groups, carboxy groups, cyano groups, and nitro groups, as well as combinations of two or more of these. When the nucleobase has an amino group outside the ring, the protecting group for the amino group is not particularly limited, and any protecting group known in nucleic acid chemistry can be used. Examples of such protecting groups include benzoyl, 4-methoxybenzoyl, 4-methylbenzoyl, acetyl, propionyl, butyryl, isobutyryl, phenylacetyl, phenoxyacetyl, 4-tert-butylphenoxyacetyl, 4-isopropylphenoxyacetyl, and (dimethylamino)methylene groups, as well as combinations of two or more thereof. a More specifically, the following groups can be mentioned: (In the formula, R 4 represents a hydrogen atom, a methyl group, a phenoxyacetyl group, a 4-tert-butylphenoxyacetyl group, a 4-isopropylphenoxyacetyl group, a phenylacetyl group, an acetyl group, or a benzoyl group; R 5 represents a hydrogen atom, an acetyl group, an isobutyryl group, or a benzoyl group; R 6 represents a hydrogen atom, a phenoxyacetyl group, a 4-tert-butylphenoxyacetyl group, a 4-isopropylphenoxyacetyl group, a phenylacetyl group, an acetyl group, or an isobutyryl group; R 7 represents a 2-cyanoethyl group, R 8represents a hydrogen atom, a methyl group, a benzoyl group, a 4-methoxybenzoyl group, or a 4-methylbenzoyl group; R 9 represents a dimethylaminomethylene group.

[0051] Each Y may be the same or different and independently represents an oxygen atom or a sulfur atom.

[0052] m represents an integer of 2 to 400. If necessary, when m is an integer of 3 or greater, a non-nucleotide linker may be incorporated in place of p nucleotides (where p is a positive integer satisfying the formula: m-1>p) between the 5'-terminal and 3'-terminal nucleotides.

[0053] Examples of non-nucleotide linkers include linkers consisting of an amino acid backbone (for example, linkers consisting of an amino acid backbone described in Japanese Patent No. 5157168 or Japanese Patent No. 5554881). Specific examples include linkers represented by the following formulas (A14-1), (A14-2), or (A14-3) (for example, as described in Japanese Patent No. 5555346 or Japanese Patent No. 5876890). In addition to these linkers, for example, linkers described in WO 2012 / 005368, WO 2018 / 182008, or WO 2019 / 074110 can be mentioned. (In the formula, 5' and 3' represent the 5'-end and 3'-end of the nucleic acid oligomer, respectively, and G 9 and Y are as defined above.

[0054] W and X are defined as either (a) or (b) below. (a) When W is a hydroxyl group, each X is independently the same or different and represents a hydrogen atom, a fluorine atom, or an OQ' group. Each Q' is independently the same or different and represents a triisopropylsilyloxymethyl group, a methyl group, a 2-methoxyethyl group, a methylene group bonded to the 4' carbon atom of ribose, an ethylene group bonded to the 4' carbon atom of ribose, an ethylidene group bonded to the 4' carbon atom of ribose, or a tert-butyldimethylsilyl group. (b) When X is a hydroxyl group, W represents an OV group. V represents a triisopropylsilyloxymethyl group, a tert-butyldimethylsilyl group, a methyl group, or a 2-methoxyethyl group. At least one of the R groups represents a hydroxyl group protected by a triisopropylsilyloxymethyl group.

[0055] The nucleic acid oligomer represented by formula (3) can be produced, for example, by solid-phase synthesis based on the phosphoramidite method, which includes the following steps (1) to (5). The solid-phase synthesis can be carried out according to a generally known method (for example, the method described in Synthesis of Therapeutic Oligonucleotides). Alternatively, the solid-phase synthesis can be carried out using an automated nucleic acid synthesizer. Step (1): a step of reacting a nucleoside or oligonucleotide bound to a solid support via a linker and having a hydroxyl group at the end of a chain extension protected with a protecting group that can be deprotected under acidic conditions with a deblocking solution to deprotect the protecting group of the hydroxyl group at the end of the chain extension from the nucleoside or oligonucleotide; Step (2): a step of subjecting the hydroxyl group at the end of the chain extension from which the protecting group has been deprotected in Step (1) to a coupling reaction with a phosphoramidite compound to produce a phosphite triester; Step (3): a step of converting the phosphite triester produced in Step (2) into a phosphate triester or a phosphorothioate triester by oxidizing or sulfurizing it. Step (4): synthesizing an oligonucleotide on a solid support by a chain extension reaction in which a cycle of a series of reactions consisting of steps (1) to (3), i.e., step (1) a deblocking reaction, step (2) a coupling reaction, and step (3) an oxidation or sulfurization reaction, is repeated any number of times; and Step (5): cleaving and deprotecting the oligonucleotide synthesized on the solid support in step (4). Step (5) specifically includes the following steps (5-1), (5-2), (5-3), and (5-4). Here, step (5-1) may be performed optionally, and steps (5-2), (5-3), and (5-4) may be performed simultaneously, or step (5-2) may be performed followed by steps (5-3) and (5-4).Step (5-1): A step of deprotecting the protecting group of the hydroxyl group at the chain elongation terminal of the oligonucleotide. Step (5-2): A step of deprotecting the protecting group of the phosphate moiety of the oligonucleotide. Step (5-3): A step of deprotecting the protecting group of the nucleobase moiety of the oligonucleotide. Step (5-4): A step of cleaving the oligonucleotide from the solid support. In the solid phase synthesis method, a step of capping hydroxyl groups that did not undergo the coupling reaction with the phosphoramidite compound may be added before or after the oxidation or sulfurization step. Steps (1) to (5) are described below.

[0056] The deblocking reaction in step (1) can be carried out using an acid. Examples of acids that can be used include trifluoroacetic acid, dichloroacetic acid, trifluoromethanesulfonic acid, trichloroacetic acid, methanesulfonic acid, hydrochloric acid, acetic acid, and p-toluenesulfonic acid. The acid can be used as a solution (deblocking solution) diluted with a solvent inert to the reaction. Examples of the deblocking solution that can be used include a toluene solution of dichloroacetic acid and a toluene solution of trichloroacetic acid. A commercially available deblocking solution can be used, or a commercially available acid diluted with a solvent such as toluene can be used as the deblocking solution. The amount of the deblocking solution used, the reaction time, and the reaction temperature in the deblocking reaction are not particularly limited and can be optimized as needed.

[0057] The coupling reaction in step (2) can be carried out using a phosphoramidite compound and an activator. As the phosphoramidite compound, for example, a phosphoramidite compound represented by the following formula (A13) can be used. In the formula, B a and R are as defined in formula (3). 1 represents a protecting group for a hydroxyl group. 1 There are no particular limitations on the protecting group G as long as it can function as a protecting group for a hydroxyl group, and a wide range of known protecting groups used in phosphoramidite compounds can be used. 1 is preferably the following group: (In the formula, R 1 , R 2 and R 3 are each independently the same or different and represent a hydrogen atom or an alkoxy group. 1 , R 2 and R 3 Preferably, one of G is a hydrogen atom and the remaining two are the same or different (preferably the same) alkoxy groups, and a methoxy group is particularly preferred as the alkoxy group. 1 Examples of the group include a 4,4'-dimethoxytrityl group (DMTr group), a 4-monomethoxytrityl group, and a 4,4',4"-trimethoxytrityl group. The 4,4'-dimethoxytrityl group (DMTr group) is particularly preferred. G 2 represents a protecting group for a hydroxyl group. 2 There are no particular limitations on the protecting group G as long as it can function as a protecting group for a hydroxyl group, and a wide range of known protecting groups used in phosphoramidite compounds can be used. 2 Examples of the group G include an alkyl group, an alkenyl group, an alkynyl group, a cycloalkyl group, a haloalkyl group, an aryl group, a heteroaryl group, an arylalkyl group, a cycloalkenyl group, a cycloalkylalkyl group, a cyclylalkyl group, a hydroxyalkyl group, an aminoalkyl group, an alkoxyalkyl group, a heterocyclylalkenyl group, a heterocyclylalkyl group, a heteroarylalkyl group, a silyl group, a silyloxyalkyl group, a mono-, di- or trialkylsilyl group, or a monoalkylsilyloxyalkyl group, and a dialkylsilyloxyalkyl group or a trialkylsilyloxyalkyl group, and the like, which may be substituted with one or more electron-withdrawing groups. 2 is preferably an alkyl group substituted with an electron-withdrawing group. Examples of the electron-withdrawing group include a cyano group, a nitro group, an alkylsulfonyl group, a halogen atom, an arylsulfonyl group, a trihalomethyl group, and a trialkylamino group. A cyano group is preferred. G 2 is preferably the following group: G3 are each independently the same or different and represent an alkyl group. 3 is two G 3 may be bonded to each other to form a cyclic structure. 3Preferably, both of the hydroxyl groups are isopropyl groups. The phosphoramidite compound represented by formula (A13) is a phosphoramidite compound used when synthesizing an oligonucleotide from the 3' side to the 5' side. When synthesizing an oligonucleotide from the 5' side to the 3' side, a phosphoramidite compound in which the substituent of the hydroxyl group at the 3' position and the substituent of the hydroxyl group at the 5' position of the phosphoramidite compound represented by formula (A13) are interchanged can be used. Examples of the phosphoramidite compound represented by formula (A13) include 2'-OMe amidite, 2'-F amidite, 2'-O-methoxyethyl amidite, 2'-O-triisopropylsilyloxymethyl amidite (TOM amidite), 2'-H amidite, and 2'-fluoro-2'-deoxy-β-D-arabinofuranosylamidite. These phosphoramidite compounds can be purchased commercially and used. The phosphoramidite compound can be used as a solution (amidite solution) diluted with a solvent inert to the reaction. The amidite solution can be, for example, a solution diluted with acetonitrile. As the activator, any activator used in the phosphoramidite method can be used without limitation. Examples of activators that can be used include 5-benzylthio-1H-tetrazole (BTT) (also referred to as 5-benzylmercapto-1H-tetrazole), 1H-tetrazole, 4,5-dicyanoimidazole (DCI), 5-ethylthio-1H-tetrazole (ETT), N-methylbenzimidazolium triflate (N-MeBIT), benzimidazolium triflate (BIT), N-phenylimidazolium triflate (N-PhIMT), imidazolium triflate (IMT), 5-nitrobenzimidazolium triflate (NBT), 1-hydroxybenzotriazole (HOBT), and 5-(bis-3,5-trifluoromethylphenyl)-1H-tetrazole. The activator can be used as a solution diluted with a solvent inert to the reaction (activator solution). Examples of activator solutions that can be used include a solution diluted with acetonitrile.The amounts of the amidite solution and activator solution used in the coupling reaction, the reaction time, and the reaction temperature are not particularly limited, and can be optimized as needed.

[0058] The oxidation or sulfurization reaction in step (3) is a reaction in which trivalent phosphorus is converted to pentavalent phosphorus using an oxidizing or sulfurizing agent. When converting a phosphite triester to a phosphate triester, the oxidizing agent can be any oxidizing agent used in the phosphoramidite method without limitation. For example, iodine can be used as the oxidizing agent. The oxidizing agent can be used as a solution (oxidizing solution) diluted with a solvent inert to the reaction. For example, acetonitrile, tetrahydrofuran (THF), or a mixed solvent of two or more of these can be used as the solvent. Water can be used as the oxygen source for oxidation. The oxidizing solution may contain a base. For example, pyridine, N-methylimidazole (NMI), N-methylmorpholine, and triethylamine can be used as the base. Examples of the oxidation solution that can be used include a mixed solution of iodine, water, pyridine, and acetonitrile, a mixed solution of iodine, water, and pyridine, a mixed solution of iodine, water, pyridine, and NMI, and a mixed solution of iodine, water, pyridine, and THF. The amount of the oxidation solution used, the reaction time, and the reaction temperature in the oxidation reaction are not particularly limited and can be optimized as needed. When converting a phosphite triester to a phosphorothioate triester, the sulfurizing agent can be any sulfurizing agent used in the phosphoramidite method without limitation. Examples of sulfurizing agents that can be used include sulfur, 3H-1,2-benzodithiol-3-one-1,1-dioxide (Beaucage reagent), 3-amino-1,2,4-dithiazole-5-thione (ADTT), 5-phenyl-3H-1,2,4-dithiazol-3-one (POS), [(N,N-dimethylaminomethylidene)amino]-3H-1,2,4-dithiazoline-3-thione (DDTT), and phenylacetyl disulfide (PADS). The sulfurizing agent can be used as a solution (sulfurizing solution) diluted with a solvent inert to the reaction. Examples of solvents that can be used include dichloromethane, acetonitrile, and pyridine, or a mixture of two or more of these. The amount of sulfurizing solution used in the sulfurization reaction, the reaction time, and the reaction temperature are not particularly limited and can be optimized as needed.When capping hydroxyl groups that did not undergo the coupling reaction with the phosphoramidite compound before or after the oxidation or sulfurization step, the capping solution can be any capping solution used in the phosphoramidite method. Examples of capping solutions that can be used include an acetic anhydride-tetrahydrofuran solution and a phenoxyacetic anhydride / N-methylimidazole solution. The amount of capping solution used, the reaction time, and the reaction temperature in the capping reaction are not particularly limited and can be optimized as needed.

[0059] The step (5-1) of deprotecting the protecting group of the hydroxyl group at the chain elongation terminal of the oligonucleotide can be carried out using a deblocking solution. The deblocking solution used in step (1) can be used as the deblocking solution. The step (5-2) of deprotecting the protecting group of the phosphate moiety of the oligonucleotide can be carried out using, for example, diethylamine. When diethylamine is used, it may be used as a solution mixed with a solvent such as acetonitrile. The step (5-3) of deprotecting the protecting group of the nucleobase moiety of the oligonucleotide and the step (5-4) of cleaving the oligonucleotide from the solid support can be carried out using ammonia or an amine. For example, aqueous ammonia may be used as the ammonia. When aqueous ammonia is used, for example, 28% aqueous ammonia may be used, or a solution obtained by mixing 28% aqueous ammonia with ethanol may be used. For example, methylamine, ethylamine, isopropylamine, ethylenediamine, or diethylamine may be used as the amine. For example, aqueous methylamine may be used as the methylamine. When using an aqueous methylamine solution, a 40% aqueous methylamine solution may be used, or a solution obtained by mixing a 40% aqueous methylamine solution with ethanol may be used. The reagents, reaction time, and reaction temperature used in steps (5-1) to (5-4) are not particularly limited and can be optimized as needed. After the nucleic acid oligomer is cleaved from the solid support, the solid support can be removed by filtration to obtain a solution containing the nucleic acid oligomer as a filtrate. The filtrate can also be concentrated under reduced pressure to obtain a dry solid containing the nucleic acid oligomer.

[0060] Specifically, the nucleic acid oligomer represented by the formula (3) can be obtained, for example, by subjecting a nucleic acid oligomer represented by the following formula (5), which is obtained by a solid-phase synthesis method based on the phosphoramidite method including the steps (1) to (4), to the step (5).

[0061] In the formula, G 2 , G 4 , Ba The definitions of R, Y and m are as defined in the formula (3). 1 When represents an OZ group, W 1 represents an OV group. 1 represents an R group, W 1 represents an OZ group. V is as defined in formula (3) above. Z represents a group consisting of a solid phase carrier and a linking moiety connecting the solid phase carrier with the oxygen atom of the hydroxyl group at the 2'-position or 3'-position of ribose at the 3'-end of the nucleic acid oligomer.

[0062] More specifically, Z includes a structure represented by the following formula (8): Formula (8): In the formula, Sp represents a spacer. Examples of the spacer (Sp) include a structure represented by the following formula (9): Formula (9): Linker in the formula (8) represents a structure that serves as a linker (junction structure). The structure of Linker may be, for example, a structure represented by the following formulas (8-1) to (8-8). Solid support in the formula (8) represents a structure that serves as a solid support. Examples of solid support include inorganic porous supports and organic resin supports. Examples of inorganic porous supports include controlled pore glass (CPG) and zeolite. Examples of organic resin supports include supports made of polystyrene. Formulas (8-1) to (8-8): (In the formula, each A may independently be a hydroxyl group, an alkoxy group, or an alkyl group. Examples of the alkoxy group include a methoxy group and an ethoxy group. Examples of the alkyl group include a methyl group, an ethyl group, an isopropyl group, and an n-propyl group. Si indicates that it is bonded to the oxygen of a hydroxyl group on the surface of the support.)

[0063] The nucleic acid oligomer represented by the following formula (4) will be explained below.

[0064] In the formula, each R' is independently the same or different and represents a hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethoxy group, or an OQ" group. Each Q" is independently the same or different and represents a methylene group bonded to the carbon atom at the 4' position of ribose, an ethylene group bonded to the carbon atom at the 4' position of ribose, or an ethylidene group bonded to the carbon atom at the 4' position of ribose. G 4 , G 9 , B c , Y and m are as defined in the formula (3). 0 is a hydroxyl group, a methoxy group, or a 2-methoxyethoxy group. 0 has the same definition as the R′ group. When m is an integer of 3 or greater, a non-nucleotide linker may be incorporated in place of p nucleotides (where p is a positive integer satisfying the formula: m−1>p) between each of the 5′-terminal and 3′-terminal nucleotides.

[0065] One embodiment of the present invention is a method for producing a nucleic acid oligomer, which comprises the step of contacting a nucleic acid oligomer containing ribose, the hydroxyl group at the 2'-position of which is protected with a triisopropylsilyloxymethyl group, with fluoride ions in the presence of an additive to deprotect the triisopropylsilyloxymethyl group, wherein the additive is at least one compound represented by the following formula (A): Formula (A) R a -NH 2 (In the formula, R a represents a hydrogen atom, a methyl group, an ethyl group, an n-propyl group, an isopropyl group, an n-butyl group, an isobutyl group, a sec-butyl group, a tert-butyl group, an n-pentyl group, an n-hexyl group, a cyclopropyl group, a cyclobutyl group, a cyclopentyl group, a cyclohexyl group, a phenyl group, or a benzyl group.

[0066] One embodiment of the present invention is a method for producing a nucleic acid oligomer, which comprises the step of contacting a nucleic acid oligomer containing ribose, the hydroxyl group at the 2'-position of which is protected with a triisopropylsilyloxymethyl group, with fluoride ions in the presence of an additive to deprotect the triisopropylsilyloxymethyl group, wherein the additive is at least one compound represented by the following formula (B): Formula (B) R b -NH-R c (In the formula, R b and R c are the same or different and each represent a methyl group, an ethyl group, an n-propyl group, an isopropyl group, an n-butyl group, an isobutyl group, a sec-butyl group, a tert-butyl group, an n-pentyl group, an n-hexyl group, a cyclopropyl group, a cyclobutyl group, a cyclopentyl group, a cyclohexyl group, a phenyl group, or a benzyl group.

[0067] One embodiment of the present invention is a method for producing a nucleic acid oligomer, which comprises the step of contacting a nucleic acid oligomer containing ribose, the hydroxyl group at the 2'-position of which is protected with a triisopropylsilyloxymethyl group, with fluoride ions in the presence of an additive to deprotect the triisopropylsilyloxymethyl group, wherein the additive is at least one compound represented by the following formula (C): Formula (C) R b -OH (wherein, R b are the same or different and each represent a methyl group, an ethyl group, an n-propyl group, an isopropyl group, an n-butyl group, an isobutyl group, a sec-butyl group, a tert-butyl group, an n-pentyl group, an n-hexyl group, a cyclopropyl group, a cyclobutyl group, a cyclopentyl group, a cyclohexyl group, a phenyl group, or a benzyl group.

[0068] One embodiment of the present invention is a method for producing a nucleic acid oligomer, which comprises the step of contacting a nucleic acid oligomer containing ribose, the hydroxyl group at the 2'-position of which is protected with a triisopropylsilyloxymethyl group, with fluoride ions in the presence of an additive to deprotect the triisopropylsilyloxymethyl group, wherein the additive is at least one compound represented by the following formula (D): Formula (D) R d -SH (wherein, R drepresents a methyl group, an ethyl group, an n-propyl group, an isopropyl group, an n-butyl group, an isobutyl group, a sec-butyl group, a tert-butyl group, an n-pentyl group, an n-hexyl group, an n-heptyl group, an n-octyl group, an n-nonyl group, an n-decyl group, an n-undecyl group, an n-dodecyl group, a cyclobutyl group, a cyclopentyl group, a cyclohexyl group, a cycloheptyl group, a cyclooctyl group, a phenyl group, or a benzyl group.

[0069] One embodiment of the present invention includes a method for producing a nucleic acid oligomer, comprising the step of contacting a nucleic acid oligomer containing ribose, the hydroxyl group at the 2'-position of which is protected with a triisopropylsilyloxymethyl group, with tetra-n-butylammonium fluoride in the presence of nitromethane to deprotect the triisopropylsilyloxymethyl group.

[0070] One embodiment of the present invention is a method for producing a nucleic acid oligomer, which comprises the step of contacting a nucleic acid oligomer containing ribose, the hydroxyl group at the 2'-position of which is protected with a triisopropylsilyloxymethyl group, with fluoride ions in the presence of an additive to deprotect the triisopropylsilyloxymethyl group, wherein the additive is at least one compound represented by the following formula (F): Formula (F) R e - (CH 2 -R f -CH 2 ) n -R g (In the formula, R e and R g are the same or different, and NH 2 , OH, SH, or COOH; R f is a single bond, CH 2 , C.H. 2 -O-CH 2 or an oxygen atom, and n represents an integer of 1 to 3. e and R g Both cannot be COOH.)

[0071] One embodiment of the present invention is a method for producing a nucleic acid oligomer, comprising the step of contacting a nucleic acid oligomer containing ribose, the hydroxyl group at the 2'-position of which is protected with a triisopropylsilyloxymethyl group, with fluoride ions in the presence of an additive to deprotect the triisopropylsilyloxymethyl group, wherein the additive is at least one of a nitrogen-containing five-membered ring compound and a nitrogen-containing six-membered ring compound.

[0072] One embodiment of the present invention is a method for producing a nucleic acid oligomer, comprising the step of contacting a nucleic acid oligomer containing ribose, the hydroxyl group at the 2'-position of which is protected with a triisopropylsilyloxymethyl group, with fluoride ions in the presence of an additive, thereby deprotecting the triisopropylsilyloxymethyl group, wherein the additive is at least one amidine compound.

[0073] Typical examples of nucleic acid oligomers that can be produced by the method of the present invention, in addition to the examples described in the Examples, are shown below, but are not limited to these. In the following sequence descriptions, U represents uridine (ST.25 format), T represents uridine (ST.26 format), C represents cytidine, A represents adenosine, and G represents guanosine. Examples include nucleic acids having the following sequences (A) and (B), as described in WO 2019 / 060442. Sequence (A): 5'-AUGGAAUmACUCUUGGUUmACdTdT-3' (based on ST.25 format) (5'-ATGGAATmACTCTTGGTTmACdTdT-3' (based on ST.26 format)) (Antisense) (SEQ ID NO: 1) 21 mer Sequence (B): 5'-GUmAACmCmAAGAGUmAUmUmCmCmAUmdTdT-3' (based on ST.25 format) (5'-GTmAACmCmAAGAGTmATmTmCmCmATmdTdT-3' (based on ST.26 format)) (Sense) (SEQ ID NO: 2) 21 mer In sequences (A) and (B), Um represents 2'-O-methyluridine (ST.25 format), Tm represents 2'-O-methyluridine (ST.26 format), Cm represents 2'-O-methylcytidine, and dT represents thymidine. Unless otherwise specified, the abbreviations in the sequences herein apply to both the ST.25 and ST.26 formats. Examples include the nucleic acids described in Daniel O'Reilly et al., Nucleic Acids Research, 2019, Vol. 47, No. 2, 546-558 (see page 553). A typical example is the nucleic acid having the following sequence (C): Sequence (C): 5'-AGAGCCAGCCUUCUUAUUGUUUUAGAGCUAUGCUGU-3' (conforming to the ST.25 format) (5'-AGAGCCAGCCTTCTTATTGTTTTAGAGCTATGCTGT-3' (conforming to the ST.26 format)) (SEQ ID NO: 3) 36mer. An example is a nucleic acid having the following sequence (D), which is described in Nucleic Acids Research, 2019, Vol. 47, No. 2: 547.Sequence (D): 5'-ACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU-3' (conforming to ST.25 format) (5'-ACAGCATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCT-3' (conforming to ST.26 format)) (SEQ ID NO: 4) 67mer Examples include nucleic acids having the following sequence (E), which is described in JP 2015-523856 A, page 173. Sequence (E): 5'-GUUUUCCCUUUUCAAAGAAAUCUCCUGGGCACCUAUCUUCUUAGGUGCCCUCCCUUGUUUAAACCUGACCAGUUAACCGGCUGGUUAGGUUUUU-3' (based on ST.25 format) (5'-GTTTTCCCTTTTCAAAGAAATCTCCTGGGCACCTATCTTCTTAGGTGCCCTCCCTTGTTTAAACCTGACCAGTTAACCGGCTGGTTAGGTTTTT-3' (based on ST.26 format)) (SEQ ID NO: 5) 94mer Examples include the nucleic acids described in JP-A-2017-537626. Typical examples include nucleic acids having the following sequences (F), (G), (H), and (J).Sequence (F): 5'-AGUCCUCAUCUCCCUCAAGCGUUUUAGAGCUAGUAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3' (based on ST.25 format) (5'-AGTCCTCATCTCCCTCAAGCGTTTTAGAGCTAGTAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT-3' (based on ST.26 format)) (SEQ ID NO: 6) 100mer Sequence (G): 5'-GCAGAUGUAGUGUUUCCACAGUUUAAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU-3' (based on ST.25 format) (5'-GCAGATGTAGTGTTTCCACAGTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT-3' (based on ST.26 format)) (SEQ ID NO: 7) 113mer Sequence (H): 5'-dAdGdTdCdCdTdCdAdTdCdTdCdCdCdTdCdAdGdCGUUUAAGAGCUAUGCUGGUAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU-3' (based on ST.25 format) (5'-dAdGdTdCdCdTdCdAdTdCdTdCdCdCdTdCdAdGdCGTTTAAGAGCTATGCTGGTAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT-3' (based on ST.26 format)) (SEQ ID NO: 8) 113mer In sequence (H), dT represents thymidine, dC represents 2'-deoxycytidine, dA represents 2'-deoxyadenosine, and dG represents 2'-deoxyguanosine.Sequence (J): 5'-AmsGmsUmsCCUCAUCUCCCUCAAGCGUUUAAGAGCUAUGCUGGUAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUmsUmsU-3' (based on ST.25 format) (5'-AmsGmsTmsCCTCATCTCCCTCAAGCGTTTAAGAGCTATGCTGGTAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTmsTmsTmsT-3' (based on ST.26 format)) (SEQ ID NO: 9) 113mer In sequence (J), Um represents 2'-O-methyluridine (ST.25 format), Tm represents 2'-O-methyluridine (ST.26 format), Am represents 2'-O-methyladenosine, Gm represents 2'-O-methylguanosine, and s represents a phosphorothioate modification.

[0074] The present invention will be described in more detail below with reference to examples, but the present invention is not limited to these examples.

[0075] The various measurement methods used in the following Examples and Comparative Examples are shown below.

[0076] (Measurement Method 1: Measurement of Nucleic Acid Oligomer Purity) The purity of the crude nucleic acid oligomer produced by solid-phase synthesis was calculated by HPLC measurement. The purity refers to the content (area percentage) of the target substance (full length product) that is the full chain length in the crude nucleic acid oligomer produced. The HPLC measurement conditions are shown in Table A below.

[0077] (Measurement Method 2: Measurement of Nucleic Acid Oligomer Yield) OD of the crude product of nucleic acid oligomer 260 The OD was measured. 260 represents the UV absorbance at 260 nm per 10 mm path length in 1 mL of solution (pH = 7.5). 260 = 40 μg, 260 The yield of the nucleic acid oligomer was calculated based on the measured values.

[0078] (Measurement method 3: Measurement of oxygen concentration) The oxygen concentration in the atmosphere (gas phase) of the reaction system was measured using a PACK KEEPER (Residual Oxygen Meter) manufactured by IIJIMA ELECTRONICS CORP. Before measuring the oxygen concentration, the device was calibrated by measuring the oxygen concentrations in air and pure nitrogen, and then the needle attached to the device was pierced into a container such as a flask capped with a septum, and the oxygen concentration in the gas phase of the system was measured. The measured oxygen concentration value was displayed in real time, and the point at which the measured value stabilized was considered to be the oxygen concentration of the atmosphere.

[0079] The sequences of the nucleic acid oligomers prepared in the following Examples and Comparative Examples are shown below. Sequence (I): 5'-AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAU-3' (based on the ST.25 format) (5'-AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAT-3' (based on the ST.26 format)) (SEQ ID NO: 10) 51 mer Sequence (II): 5'-AUAACUCAAUUUGUAAAAAAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU-3' (based on the ST.25 format) (5'-ATAACTCAATTTGTAAAAAAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT-3' (based on the ST.26 format)) (SEQ ID NO: 11) 103 mer In Sequence (I) and Sequence (II), A represents adenine, C represents cytidine, G represents guanosine, U represents uridine (ST.25 format), and T represents uridine (ST.26 format). Unless otherwise specified, the abbreviations in the sequences herein apply to both the ST.25 format and the ST.26 format.

[0080] The Controlled Pore Glass (CPG) carrying the 2'-OTBS-U derivative described in the following Examples and Comparative Examples was purchased from Synthepor and has an LCAA linker. The predicted structure of the 2'-OTBS-U derivative is shown below. The circle in the structural formula below is a schematic representation of CPG.

[0081] The 2'-TOM-A(Ac) amidite described in the following examples and comparative examples has a structure represented by the following formula (19), and was purchased from ChemGenes (product number: ANP-3201). The 2'-TOM-C(Ac) amidite has a structure represented by the following formula (20), and was purchased from ChemGenes (product number: ANP-3202). The 2'-TOM-G(Ac) amidite has a structure represented by the following formula (21), and was purchased from ChemGenes (product number: ANP-3203). The 2'-TOM-U amidite has a structure represented by the following formula (22), and was purchased from ChemGenes (product number: ANP-3205). In these amidites, the hydroxyl group at the 2'-position of ribose is protected with a triisopropylsilyloxymethyl group (TOM group). Formula (19): Formula (20): Formula (21): Formula (22):

[0082] Example 1: Using CPG (solid support) carrying 75.79 μmol of the 2'-OTBS-U derivative, a nucleic acid oligomer of sequence (I) was synthesized from the 3' end to the 5' end using an AKTA Oligopilot Plus 100 (Cytiva). First, a chain extension reaction was performed in which a series of reactions consisting of step (1) a deblocking reaction, step (2) a coupling reaction, and step (3) an oxidation reaction followed by a capping reaction were repeated 50 times. Step (1) was performed by delivering a solution of dichloroacetic acid:toluene = 3:97 (volume ratio) to the solid support. After step (1), acetonitrile was delivered to the solid support. Step (2) was performed by delivering an acetonitrile solution of 2'-TOM-A(Ac) amidite and an acetonitrile solution of 5-benzylthio-1H-tetrazole to the solid support. After step (2), acetonitrile was pumped onto the solid support. Step (3) was performed by pumping an oxidizing solution containing 50 mM iodine onto the solid support. After step (3), acetonitrile was pumped onto the solid support. Subsequently, a 0.1 M phenoxyacetic anhydride acetonitrile solution and a 10% N-methylimidazole / 10% 2,6-lutidine acetonitrile solution were pumped onto the solid support to cap hydroxyl groups where the coupling reaction had not progressed. After the capping reaction, acetonitrile was pumped onto the solid support. After the chain extension reaction, a dichloroacetic acid:toluene = 3:97 (volume ratio) solution was pumped onto the solid support to remove the DMTr group at the 5' end, and then acetonitrile was pumped onto the solid support. Subsequently, a diethylamine:acetonitrile = 20:80 (volume ratio) solution was pumped onto the solid support to remove the cyanoethyl group from the phosphate moiety, and then acetonitrile was pumped onto the solid support. From the solid phase carrier carrying the nucleic acid oligomer obtained above (hereinafter referred to as solid phase carrier A), a solid phase carrier carrying 24.9154 μmol of nucleic acid oligomer was collected, and 12.83 g of 28% aqueous ammonia solution and 3.79 g of ethanol were poured into the solid phase carrier. This mixture was incubated at 40°C for 4 hours to cleave the nucleic acid oligomer from the solid phase carrier. The solid phase carrier was removed by filtration, and the filtrate was concentrated under reduced pressure to obtain a dry solid containing the nucleic acid oligomer.To the dried solid, 20.84 g of dimethyl sulfoxide and 4.19 g of acetonitrile were added to prepare a uniform solution of nucleic acid oligomer (hereinafter referred to as stock solution A). A solution containing 0.9966 μmol of nucleic acid oligomer was collected from stock solution A. 13.5 μL of nitromethane (5.0 mol per mol of TOM group) was added to the collected solution. 1.40 mL of a 1 M tetra-n-butylammonium fluoride (hereinafter referred to as TBAF) dimethyl sulfoxide solution (27.6 mol of TBAF per mol of TOM group) previously dehydrated with molecular sieves 4A under an oxygen concentration of 21% was added to this solution, and the mixture was stirred uniformly using a vortex mixer. The oxygen concentration was calculated according to Measurement Method 3 described above. The TOM group was deprotected by incubating the reaction solution at 30°C for 4 hours. The reaction solution was quenched by adding 1.45 g of a 3 M aqueous ammonium acetate solution, and then a crude product of the nucleic acid oligomer of sequence (I) was obtained by precipitation. Measurement using the measurement method 1 showed that the purity of the crude product was 25%. Measurement using the measurement method 2 showed that the yield of the crude product was 7.85 mg. The results are shown in Table 1.

[0083] Example 2: A solution containing 1.0044 μmol of nucleic acid oligomer was collected from stock solution A prepared in Example 1. 6.75 μL of nitromethane (2.5 moles per mole of TOM group) was added to the collected solution. 1.40 mL of a 1 M TBAF dimethyl sulfoxide solution (27.4 moles of TBAF per mole of TOM group) previously dehydrated with molecular sieves 4A was added to this solution under an oxygen concentration of 21%, and the solution was stirred uniformly using a vortex mixer. The oxygen concentration was calculated according to Measurement Method 3 described above. The TOM group was deprotected by incubating the reaction solution at 30°C for 4 hours. 1.45 g of a 3 M aqueous ammonium acetate solution was added to the reaction solution to quench the reaction, followed by precipitation to obtain a crude product of nucleic acid oligomer of sequence (I). Measurement using Measurement Method 1 described above revealed that the purity of the crude product was 23%. As a result of measurement using the above-mentioned Measurement Method 2, the yield of the obtained crude product was 7.86 mg. The results are shown in Table 1.

[0084] Example 3: A solution containing 1.0161 μmol of nucleic acid oligomer was collected from stock solution A prepared in Example 1. 13.5 μL of nitromethane (4.9 mol per mol of TOM group) was added to the collected solution. 1.40 mL of a 1 M TBAF dimethyl sulfoxide solution (27.1 mol of TBAF per mol of TOM group) previously dehydrated with molecular sieves 4A was added dropwise to this solution at 15°C over 1 hour under an oxygen concentration of 21%. The oxygen concentration was calculated according to Measurement Method 3 described above. The TOM group was deprotected by incubating the reaction solution at 30°C for 4 hours. After quenching by adding 1.45 g of 3 M ammonium acetate aqueous solution to the reaction solution, a crude product of nucleic acid oligomer of sequence (I) was obtained by precipitation. Measurement using Measurement Method 1 described above revealed that the purity of the crude product was 19%. As a result of measurement using the above-mentioned Measurement Method 2, the yield of the obtained crude product was 8.15 mg. The results are shown in Table 1.

[0085] Example 4 A solution containing 1.0454 μmol of nucleic acid oligomer was collected from stock solution A prepared in Example 1. 13.5 μL of nitromethane (4.7 moles per mole of TOM group) was added to the collected solution. The reactor containing this solution was sealed with a φ15 mm septum, and two syringe needles were inserted into the septum. Nitrogen gas was introduced into the reactor through one of the syringe needles. A separate oxygen concentration needle was inserted into the septum, and the oxygen concentration inside the reactor was measured, confirming that the oxygen concentration was 0%. The oxygen concentration was calculated according to Measurement Method 3 above. While maintaining the oxygen concentration inside the reactor at 0%, 1.40 mL of a 1 M TBAF dimethyl sulfoxide solution (26.3 moles of TBAF per mole of TOM group) previously dehydrated with molecular sieves 4A was added and stirred uniformly using a vortex mixer. The reaction solution was incubated at 30°C for 4 hours to deprotect the TOM group. After quenching by adding 1.45 g of a 3 M aqueous ammonium acetate solution, a crude product of nucleic acid oligomer of sequence (I) was obtained by precipitation. Measurement using Measurement Method 1 showed that the purity of the crude product was 26%. Measurement using Measurement Method 2 showed that the yield of the crude product was 8.29 mg. The results are shown in Table 1.

[0086] Example 5: A solution containing 0.9916 μmol of nucleic acid oligomer was collected from stock solution A prepared in Example 1. 13.5 μL of nitromethane (5.0 mol per mol of TOM group) was added to the collected solution. 1.40 mL of a 1 M TBAF dimethyl sulfoxide solution (27.7 mol of TBAF per mol of TOM group) previously dehydrated with molecular sieves 4A was added to this solution under an oxygen concentration of 21%, and the solution was stirred uniformly using a vortex mixer. The oxygen concentration was calculated according to Measurement Method 3 described above. The TOM group was deprotected by incubating the reaction solution at 30°C for 4 hours. 1.45 g of 1 M Tris-HCl buffer was added to the reaction solution to quench the reaction, followed by precipitation to obtain a crude product of nucleic acid oligomer of sequence (I). Measurement using Measurement Method 1 described above revealed that the purity of the crude product was 26%. As a result of measurement using the above-mentioned Measurement Method 2, the yield of the obtained crude product was 7.43 mg. The results are shown in Table 1.

[0087] Comparative Example 1: A solution containing 0.9941 μmol of nucleic acid oligomer was collected from stock solution A prepared in Example 1. Under an atmosphere of 21% oxygen concentration, 1.40 mL of a 1 M TBAF dimethyl sulfoxide solution (27.7 mol of TBAF per mol of TOM group) previously dehydrated with molecular sieves 4A was added to the collected solution, and the solution was stirred uniformly using a vortex mixer. The oxygen concentration was calculated according to Measurement Method 3 described above. The TOM group was deprotected by incubating the reaction solution at 30°C for 4 hours. After quenching by adding 1.45 g of a 3 M aqueous ammonium acetate solution, a crude product of nucleic acid oligomer having sequence (I) was obtained by precipitation. Measurement using Measurement Method 1 described above revealed that the purity of the crude product was 0%. The results are shown in Table 1.

[0088] Comparative Example 2: A solution containing 1.0267 μmol of nucleic acid oligomer was collected from stock solution A prepared in Example 1. 1.40 mL of a 1 M TBAF dimethyl sulfoxide solution (26.8 mol of TBAF per mol of TOM group) previously dehydrated with molecular sieves 4A was added to the collected solution under an oxygen concentration of 21% and the solution was stirred uniformly using a vortex mixer. The oxygen concentration was calculated according to Measurement Method 3 described above. The TOM group was deprotected by incubating the reaction solution at 30°C for 4 hours. After quenching the reaction by adding 1.45 g of 1 M Tris-HCl buffer, a crude product of nucleic acid oligomer having sequence (I) was obtained by precipitation. Measurement using Measurement Method 1 described above revealed that the purity of the crude product was 0%. The results are shown in Table 1.

[0089] Comparative Example 3: A solution containing 0.9906 μmol of nucleic acid oligomer was collected from stock solution A prepared in Example 1. 1.40 mL of a 1 M TBAF dimethyl sulfoxide solution (27.8 mol of TBAF per mol of TOM group) previously dehydrated with molecular sieves 4A was added to the collected solution under an oxygen concentration of 21%. The solution was then stirred uniformly using a vortex mixer. The oxygen concentration was calculated according to Measurement Method 3 described above. The TOM group was deprotected by incubating the reaction solution at 30°C for 4 hours. 13.5 μL of nitromethane (5.0 mol per mol of TOM group) was added to the solution, followed by quenching with the addition of 1.45 g of a 3 M aqueous ammonium acetate solution. A crude product of nucleic acid oligomer having sequence (I) was then obtained by precipitation. Measurement using Measurement Method 1 described above revealed that the purity of the crude product was 0%. The results are shown in Table 1.

[0090]

[0091] Example 6: A solution containing 0.2412 μmol of nucleic acid oligomer was collected from stock solution A prepared in Example 1. 393 μL of 28% aqueous ammonia (473.6 mol per mol of TOM group) was added to the collected solution. 0.39 mL of a 1 M TBAF dimethyl sulfoxide solution (31.7 mol of TBAF per mol of TOM group) previously dehydrated with molecular sieves 4A was added to this solution under an oxygen concentration of 21%, and the solution was stirred uniformly using a vortex mixer. The oxygen concentration was calculated according to Measurement Method 3 described above. The TOM group was deprotected by incubating the reaction solution at 30°C for 4 hours. After quenching by adding 0.36 mL of 3 M aqueous ammonium acetate solution to the reaction solution, a crude product of nucleic acid oligomer of sequence (I) was obtained by precipitation. Measurement using Measurement Method 1 described above revealed that the purity of the crude product was 24%. As a result of measurement using the above-mentioned Measurement Method 2, the yield of the obtained crude product was 1.96 mg. The results are shown in Table 2.

[0092] Example 7: A solution containing 0.2413 μmol of nucleic acid oligomer was collected from stock solution A prepared in Example 1. 157 μL of diethylamine (123.3 mol per mol of TOM group) was added to the collected solution. 0.39 mL of a 1 M TBAF dimethyl sulfoxide solution (31.7 mol of TBAF per mol of TOM group) previously dehydrated with molecular sieves 4A was added to this solution under an oxygen concentration of 21%, and the solution was stirred uniformly using a vortex mixer. The oxygen concentration was calculated according to Measurement Method 3 described above. The TOM group was deprotected by incubating the reaction solution at 30°C for 4 hours. 0.36 mL of a 3 M aqueous ammonium acetate solution was added to the reaction solution to quench the reaction, followed by precipitation to obtain a crude product of nucleic acid oligomer of sequence (I). Measurement using Measurement Method 1 described above revealed that the purity of the crude product was 26%. As a result of measurement using the above-mentioned Measurement Method 2, the yield of the obtained crude product was 1.98 mg. The results are shown in Table 2.

[0093] Example 8: A solution containing 0.1926 μmol of nucleic acid oligomer was collected from stock solution A prepared in Example 1. 125 μL of methanol (316.4 mol per mol of TOM group) was added to the collected solution. 0.31 mL of a 1 M TBAF dimethyl sulfoxide solution (TBAF amount: 31.6 mol per mol of TOM group) previously dehydrated with molecular sieves 4A was added to this solution under an oxygen concentration of 21%, and the solution was stirred uniformly using a vortex mixer. The oxygen concentration was calculated according to Measurement Method 3 described above. The TOM group was deprotected by incubating the reaction solution at 30°C for 4 hours. 0.29 mL of a 3 M ammonium acetate aqueous solution was added to the reaction solution to quench the reaction, followed by precipitation to obtain a crude product of nucleic acid oligomer of sequence (I). Measurement using Measurement Method 1 described above revealed that the purity of the crude product was 25%. As a result of measurement using the above-mentioned Measurement Method 2, the yield of the obtained crude product was 1.59 mg. The results are shown in Table 2.

[0094] Example 9: A solution containing 0.4923 μmol of nucleic acid oligomer was collected from stock solution A prepared in Example 1. 30.2 μL of 1-dodecanethiol (5.0 mol per mol of TOM group) was added to the collected solution. 0.70 mL of a 1 M TBAF dimethyl sulfoxide solution (27.9 mol of TBAF per mol of TOM group) previously dehydrated with molecular sieves 4A was added to this solution under an oxygen concentration of 21%, and the solution was stirred uniformly using a vortex mixer. The oxygen concentration was calculated according to Measurement Method 3 described above. The TOM group was deprotected by incubating the reaction solution at 30°C for 4 hours. 0.73 g of a 3 M aqueous ammonium acetate solution was added to the reaction solution to quench the reaction, followed by precipitation to obtain a crude product of nucleic acid oligomer having sequence (I). Measurement using Measurement Method 1 described above revealed that the purity of the crude product was 13%. As a result of measurement using the above-mentioned Measurement Method 2, the yield of the obtained crude product was 4.27 mg. The results are shown in Table 2.

[0095] Example 10: A solution containing 0.2467 μmol of nucleic acid oligomer was collected from stock solution A prepared in Example 1. 5.5 μL of 3-mercaptopropionic acid (5.0 mol per mol of TOM group) was added to the collected solution. 0.39 mL of a 1 M TBAF dimethyl sulfoxide solution (31.0 mol of TBAF per mol of TOM group) previously dehydrated with molecular sieves 4A was added to this solution under an atmosphere of 21% oxygen concentration, and the solution was stirred uniformly using a vortex mixer. The oxygen concentration was calculated according to Measurement Method 3 above. The TOM group was deprotected by incubating the reaction solution at 30°C for 4 hours. 0.36 mL of a 3 M aqueous ammonium acetate solution was added to the reaction solution to quench the reaction, followed by precipitation to obtain a crude product of the nucleic acid oligomer of sequence (I). As a result of measurement using the above-mentioned Measurement Method 1, the purity of the obtained crude product was 14%. As a result of measurement using the above-mentioned Measurement Method 2, the yield of the obtained crude product was 2.04 mg. The results are shown in Table 2.

[0096] Example 11: A solution containing 0.2485 μmol of nucleic acid oligomer was collected from stock solution A prepared in Example 1. 157 μL of ethylenediamine (185.5 mol per mol of TOM group) was added to the collected solution. 0.39 mL of a 1 M TBAF dimethyl sulfoxide solution (30.8 mol of TBAF per mol of TOM group) previously dehydrated with molecular sieves 4A was added to this solution under an oxygen concentration of 21%, and the solution was stirred uniformly using a vortex mixer. The oxygen concentration was calculated according to Measurement Method 3 described above. The TOM group was deprotected by incubating the reaction solution at 30°C for 4 hours. 0.36 mL of a 3 M aqueous ammonium acetate solution was added to the reaction solution to quench the reaction, followed by precipitation to obtain a crude product of nucleic acid oligomer of sequence (I). Measurement using Measurement Method 1 described above revealed that the purity of the crude product was 31%. As a result of measurement using the above-mentioned Measurement Method 2, the yield of the obtained crude product was 2.00 mg. The results are shown in Table 2.

[0097] Example 12: A solution containing 0.2427 μmol of nucleic acid oligomer was collected from stock solution A prepared in Example 1. 2.7 mg of piperazine (2.5 moles per mole of TOM group) was added to the collected solution. 0.39 mL of a 1 M TBAF dimethyl sulfoxide solution (31.5 moles of TBAF per mole of TOM group) previously dehydrated with molecular sieves 4A was added to this solution under an oxygen concentration of 21%, and the solution was stirred uniformly using a vortex mixer. The oxygen concentration was calculated according to Measurement Method 3 described above. The TOM group was deprotected by incubating the reaction solution at 30°C for 4 hours. After quenching by adding 0.36 mL of a 3 M aqueous ammonium acetate solution, a crude product of nucleic acid oligomer of sequence (I) was obtained by precipitation. Measurement using Measurement Method 1 described above revealed that the purity of the crude product was 27%. As a result of measurement using the above-mentioned Measurement Method 2, the yield of the obtained crude product was 1.87 mg. The results are shown in Table 2.

[0098] Example 13: A solution containing 0.2541 μmol of nucleic acid oligomer was collected from stock solution A prepared in Example 1. 5.4 μL of morpholine (4.9 mol per mol of TOM group) was added to the collected solution. 0.39 mL of a 1 M TBAF dimethyl sulfoxide solution (30.1 mol of TBAF per mol of TOM group) previously dehydrated with molecular sieves 4A was added to this solution under an oxygen concentration of 21%, and the solution was stirred uniformly using a vortex mixer. The oxygen concentration was calculated according to Measurement Method 3 described above. The TOM group was deprotected by incubating the reaction solution at 30°C for 4 hours. After quenching by adding 0.36 mL of 3 M ammonium acetate aqueous solution to the reaction solution, a crude product of nucleic acid oligomer of sequence (I) was obtained by precipitation. Measurement using Measurement Method 1 described above revealed that the purity of the crude product was 27%. As a result of measurement using the above-mentioned Measurement Method 2, the yield of the obtained crude product was 1.98 mg. The results are shown in Table 2.

[0099] Example 14: A solution containing 0.5054 μmol of nucleic acid oligomer was collected from stock solution A prepared in Example 1. 393 μL of 40% aqueous methylamine solution (76.8 mol per mol of TOM group) and 393 μL of ethanol (261.1 mol per mol of TOM group) were added to the collected solution. 1.40 mL of a 1 M TBAF dimethyl sulfoxide solution (54.4 mol of TBAF per mol of TOM group) previously dehydrated with molecular sieves 4A was added to this solution under an oxygen concentration of 21%, and the mixture was stirred uniformly using a vortex mixer. The oxygen concentration was calculated according to Measurement Method 3 described above. The TOM group was deprotected by incubating the reaction solution at 30°C for 4 hours. The reaction solution was quenched by adding 1.45 g of a 3 M aqueous ammonium acetate solution, followed by precipitation to obtain a crude product of the nucleic acid oligomer of sequence (I). Measurement using Measurement Method 1 showed that the purity of the crude product obtained was 28%. Measurement using Measurement Method 2 showed that the yield of the crude product obtained was 3.65 mg. The results are shown in Table 2.

[0100]

[0101] Example 15: Using CPG (solid phase support) carrying 73.72 μmol of the 2'-OTBS-U derivative, a nucleic acid oligomer of sequence (II) was synthesized from the 3' end to the 5' end using an AKTA Oligopilot Plus 100 (Cytiva). First, a chain elongation reaction was carried out, in which a series of reaction cycles consisting of step (1) a deblocking reaction, step (2) a coupling reaction, and step (3) an oxidation reaction followed by a capping reaction were repeated 102 times. The chain elongation reaction was carried out in the same manner as in Example 1, except that 2'-TOM-A(Ac) amidite, 2'-TOM-C(Ac) amidite, 2'-TOM-G(Ac) amidite, and 2'-TOM-U amidite were used as the phosphoramidite compounds. After the chain extension reaction, a dichloroacetic acid:toluene (3:97 volume ratio) solution was applied to the solid support to remove the DMTr group at the 5' end, and then acetonitrile was applied to the solid support. Subsequently, a diethylamine:acetonitrile (20:80 volume ratio) solution was applied to the solid support to remove the cyanoethyl group at the phosphate moiety, and then acetonitrile was applied to the solid support. From the solid support carrying the nucleic acid oligomer obtained above (hereinafter referred to as solid support B), a solid support carrying 1.0300 μmol of nucleic acid oligomer was collected, and 380 μL of 40% aqueous methylamine solution and 380 μL of ethanol were poured into the solid support. This mixture was incubated at 30°C for 3 hours to cleave the nucleic acid oligomer from the solid support. The solid support was removed by filtration, and the filtrate was concentrated under reduced pressure to obtain a dry solid containing the nucleic acid oligomer. 755 μL of dimethyl sulfoxide and 212 μL of acetonitrile were added to the dried solid to prepare a homogeneous solution of nucleic acid oligomer. To this solution, 13.5 μL of nitromethane (2.4 moles per mole of TOM group) was added. To this solution, 1.40 mL of a 1 M TBAF dimethyl sulfoxide solution (13.2 moles of TBAF per mole of TOM group) pre-dehydrated with molecular sieves 4A was added under an oxygen concentration of 21% and stirred uniformly using a vortex mixer. The oxygen concentration was calculated according to Measurement Method 3 above. The TOM group was deprotected by incubating the reaction solution at 30°C for 4 hours.The reaction solution was quenched by adding 1.45 g of a 3 M aqueous ammonium acetate solution, followed by precipitation to obtain a crude product of the nucleic acid oligomer of sequence (II). Measurement using Measurement Method 1 showed that the purity of the crude product obtained was 12%. Measurement using Measurement Method 2 showed that the yield of the crude product obtained was 11.50 mg. The results are shown in Table 3.

[0102] Example 16: A solid support carrying 25.063 μmol of nucleic acid oligomer was collected from solid support B synthesized in Example 15, and 8.56 g of 40% aqueous methylamine solution and 7.55 g of ethanol were added to the solid support. This mixture was incubated at 30°C for 3 hours to release the nucleic acid oligomer from the solid support. The solid support was removed by filtration, and the filtrate was concentrated under reduced pressure to obtain a dry solid containing the nucleic acid oligomer. 20.82 g of dimethyl sulfoxide and 4.19 g of acetonitrile were added to the dry solid to prepare a homogeneous solution of nucleic acid oligomer (hereinafter referred to as stock solution B). A solution containing 0.5089 μmol of nucleic acid oligomer was collected from stock solution B. 25.0 μL of 40% aqueous methylamine solution (4.8 moles per mole of TOM group) was added to the collected solution. To this solution, 1.40 mL of a 1 M TBAF dimethyl sulfoxide solution (26.8 moles of TBAF per mole of TOM group) previously dehydrated with molecular sieves 4A was added under an oxygen concentration of 21%, and the mixture was stirred uniformly using a vortex mixer. The oxygen concentration was calculated according to Measurement Method 3 described above. The reaction solution was incubated at 30°C for 4 hours to deprotect the TOM group. After quenching by adding 1.45 g of a 3 M aqueous ammonium acetate solution to the reaction solution, a crude product of the nucleic acid oligomer of sequence (II) was obtained by precipitation. Measurement using Measurement Method 1 showed that the purity of the crude product was 13%. Measurement using Measurement Method 2 showed that the yield of the crude product was 5.79 mg. The results are shown in Table 3.

[0103] Example 17: A solution containing 0.4976 μmol of nucleic acid oligomer was collected from stock solution B prepared in Example 16. 314 μL of diethylamine (59.2 mol per mol of TOM group) was added to the collected solution. 1.40 mL of a 1 M TBAF dimethyl sulfoxide solution (27.4 mol of TBAF per mol of TOM group) pre-dehydrated with molecular sieves 4A was added to this solution under an oxygen concentration of 21%, and the solution was stirred uniformly using a vortex mixer. The oxygen concentration was calculated according to Measurement Method 3 described above. The TOM group was deprotected by incubating the reaction solution at 30°C for 4 hours. 1.45 g of a 3 M ammonium acetate aqueous solution was added to the reaction solution to quench the reaction, followed by precipitation to obtain a crude product of nucleic acid oligomer of sequence (II). Measurement using Measurement Method 1 described above revealed that the purity of the crude product was 14%. As a result of measurement using the above-mentioned Measurement Method 2, the yield of the obtained crude product was 3.58 mg. The results are shown in Table 3.

[0104] Example 18: A solution containing 0.5245 μmol of nucleic acid oligomer was collected from stock solution B prepared in Example 16. 780 μL of methanol (357.3 mol per mol of TOM group) was added to the collected solution. 1.40 mL of a 1 M TBAF dimethyl sulfoxide solution (26.0 mol of TBAF per mol of TOM group) previously dehydrated with molecular sieves 4A was added to this solution under an oxygen concentration of 21%, and the mixture was stirred uniformly using a vortex mixer. The oxygen concentration was calculated according to Measurement Method 3 described above. The TOM group was deprotected by incubating the reaction solution at 30°C for 4 hours. 1.45 g of a 3 M aqueous ammonium acetate solution was added to the reaction solution to quench the reaction, followed by precipitation to obtain a crude product of nucleic acid oligomer of sequence (II). Measurement using Measurement Method 1 described above revealed that the purity of the crude product was 10%. As a result of measurement using the above-mentioned Measurement Method 2, the yield of the obtained crude product was 6.08 mg. The results are shown in Table 3.

[0105] Example 19: A solution containing 0.4934 μmol of nucleic acid oligomer was collected from stock solution B prepared in Example 16. 11.0 μL of 3-mercaptopropionic acid (2.5 mol per mol of TOM group) was added to the collected solution. 1.40 mL of a 1 M TBAF dimethyl sulfoxide solution (27.6 mol of TBAF per mol of TOM group) previously dehydrated with molecular sieves 4A was added to this solution under an atmosphere of 21% oxygen concentration, and the solution was stirred uniformly using a vortex mixer. The oxygen concentration was calculated according to Measurement Method 3 above. The TOM group was deprotected by incubating the reaction solution at 30°C for 4 hours. 1.45 g of a 3 M aqueous ammonium acetate solution was added to the reaction solution to quench the reaction, followed by precipitation to obtain a crude product of the nucleic acid oligomer of sequence (II). As a result of measurement using the above Measurement Method 1, the purity of the obtained crude product was 7%. As a result of measurement using the above Measurement Method 2, the yield of the obtained crude product was 5.41 mg. The results are shown in Table 3.

[0106] Example 20: A solution containing 0.5083 μmol of nucleic acid oligomer was collected from stock solution B prepared in Example 16. 21.8 mg of piperazine (4.8 mol per mol of TOM group) was added to the collected solution. 1.40 mL of a 1 M TBAF dimethyl sulfoxide solution (26.8 mol of TBAF per mol of TOM group) previously dehydrated with molecular sieves 4A was added to this solution under an oxygen concentration of 21%, and the solution was stirred uniformly using a vortex mixer. The oxygen concentration was calculated according to Measurement Method 3 described above. The TOM group was deprotected by incubating the reaction solution at 30°C for 4 hours. 1.45 g of a 3 M aqueous ammonium acetate solution was added to the reaction solution to quench the reaction, followed by precipitation to obtain a crude product of nucleic acid oligomer of sequence (II). Measurement using Measurement Method 1 described above revealed that the purity of the crude product was 12%. As a result of measurement using the above-mentioned Measurement Method 2, the yield of the obtained crude product was 5.76 mg. The results are shown in Table 3.

[0107] Comparative Example 4: A solution containing 0.4971 μmol of nucleic acid oligomer was collected from stock solution B prepared in Example 16. 1.40 mL of a 1 M TBAF dimethyl sulfoxide solution (27.4 mol of TBAF per mol of TOM group) previously dehydrated with molecular sieves 4A was added to the collected solution under an oxygen concentration of 21% and the solution was stirred uniformly using a vortex mixer. The oxygen concentration was calculated according to Measurement Method 3 described above. The TOM group was deprotected by incubating the reaction solution at 30°C for 4 hours. After quenching by adding 1.45 g of a 3 M aqueous ammonium acetate solution to the reaction solution, a crude product of nucleic acid oligomer of sequence (II) was obtained by precipitation. Measurement using Measurement Method 1 described above revealed that the purity of the crude product was 3%. The results are shown in Table 3.

[0108]

[0109] Example 21: A solid support carrying 24.9444 μmol of nucleic acid oligomer was collected from the solid support A synthesized in Example 1, and 12.79 g of 28% aqueous ammonia and 3.79 g of ethanol were poured into the solid support. This mixture was incubated at 40°C for 4 hours to cleave the nucleic acid oligomer from the solid support. The solid support was removed by filtration, and the filtrate was concentrated under reduced pressure to obtain a dry solid containing the nucleic acid oligomer. 20.84 g of dimethyl sulfoxide was poured into the dry solid to prepare a uniform solution of nucleic acid oligomer (hereinafter referred to as stock solution C). A solution containing 0.5104 μmol of nucleic acid oligomer was collected from stock solution C. To the collected solution, 142 μL of 40% aqueous methylamine solution (55.1 mol per mol of TOM group), 142 μL of 28% aqueous ammonia solution (80.9 mol per mol of TOM group), and 95 μL of ethanol (62.5 mol per mol of TOM group) were added. To this solution, 758 μL of triethylamine trihydrofluoride (hereinafter referred to as TEA·3HF) (178.7 mol of TEA·3HF per mol of TOM group) was added under an oxygen concentration of 21% and the mixture was stirred uniformly using a vortex mixer. The oxygen concentration was calculated according to Measurement Method 3 described above. The TOM group was deprotected by incubating the reaction solution at 40°C for 4 hours, yielding a crude product of the nucleic acid oligomer of sequence (I). Measurement using Measurement Method 1 described above revealed that the purity of the crude product was 24%. The results are shown in Table 4.

[0110] Example 22: A solution containing 0.5023 μmol of nucleic acid oligomer was collected from stock solution C prepared in Example 21. 5.4 mg of piperazine (2.5 moles per mole of TOM group) was added to the collected solution. 758 μL of TEA·3HF (181.5 moles of TEA·3HF per mole of TOM group) was added to this solution under an oxygen concentration of 21%, and the solution was stirred uniformly using a vortex mixer. The oxygen concentration was calculated according to Measurement Method 3 described above. The TOM group was deprotected by incubating the reaction solution at 40°C for 4 hours, yielding a crude product of nucleic acid oligomer having sequence (I). Measurement using Measurement Method 1 described above revealed that the purity of the crude product was 20%. The results are shown in Table 4.

[0111] Example 23: A solution containing 0.2487 μmol of nucleic acid oligomer was collected from stock solution B prepared in Example 16. 157 μL of 28% aqueous ammonia (90.9 mol per mol of TOM group) was added to the collected solution. 379 μL of TEA·3HF (TEA·3HF amount: 90.8 mol per mol of TOM group) was added to this solution under an oxygen concentration of 21%, and the solution was stirred uniformly using a vortex mixer. The oxygen concentration was calculated according to Measurement Method 3 described above. The TOM group was deprotected by incubating the reaction solution at 40°C for 4 hours, yielding a crude product of nucleic acid oligomer of sequence (II). Measurement using Measurement Method 1 described above revealed that the purity of the crude product was 11%. The results are shown in Table 4.

[0112] Example 24: A solution containing 0.2563 μmol of nucleic acid oligomer was collected from stock solution B prepared in Example 16. 12.5 μL of 40% aqueous methylamine solution (4.8 mol per mol of TOM group) was added to the collected solution. 379 μL of TEA·3HF (88.1 mol of TEA·3HF per mol of TOM group) was added to this solution under an oxygen concentration of 21%, and the solution was stirred uniformly using a vortex mixer. The oxygen concentration was calculated according to Measurement Method 3 described above. The TOM group was deprotected by incubating the reaction solution at 40°C for 4 hours, yielding a crude product of nucleic acid oligomer of sequence (II). Measurement using Measurement Method 1 described above revealed that the purity of the crude product was 11%. The results are shown in Table 4.

[0113] Example 25: A solution containing 0.2617 μmol of nucleic acid oligomer was collected from stock solution B prepared in Example 16. 5.4 mg of piperazine (2.3 moles per mole of TOM group) was added to the collected solution. 379 μL of TEA-3HF (86.3 moles of TEA-3HF per mole of TOM group) was added to this solution under an oxygen concentration of 21%, and the solution was stirred uniformly using a vortex mixer. The oxygen concentration was calculated according to Measurement Method 3 described above. The TOM group was deprotected by incubating the reaction solution at 40°C for 4 hours, yielding a crude product of nucleic acid oligomer of sequence (II). Measurement using Measurement Method 1 described above revealed that the purity of the crude product was 8%. The results are shown in Table 4.

[0114] Example 26 A solution containing 0.2503 μmol of nucleic acid oligomer was collected from stock solution B prepared in Example 16. 157 μL of 1-methylimidazole (76.2 mol per mol of TOM group) was added to the collected solution. 379 μL of TEA·3HF (the amount of TEA·3HF was 90.0 mol per mol of TOM group) was added to this solution under an atmosphere with an oxygen concentration of 21%, and the solution was stirred uniformly using a vortex mixer. The oxygen concentration was calculated according to Measurement Method 3 described above. The TOM group was deprotected by incubating the reaction solution at 40°C for 4 hours, yielding a crude product of nucleic acid oligomer of sequence (II). Measurement using Measurement Method 1 described above revealed that the purity of the crude product obtained was 11%. The results are shown in Table 4.

[0115] Comparative Example 5: A solution containing 0.5197 μmol of nucleic acid oligomer was collected from stock solution C prepared in Example 21. 758 μL of TEA·3HF (the amount of TEA·3HF was 175.5 mol per mol of TOM group) was added to the collected solution under an atmosphere of 21% oxygen concentration, and the solution was stirred uniformly using a vortex mixer. The oxygen concentration was calculated according to Measurement Method 3 described above. The TOM group was deprotected by incubating the reaction solution at 40° C. for 4 hours, yielding a crude product of nucleic acid oligomer having sequence (I). Measurement using Measurement Method 1 described above revealed that the purity of the crude product was 7%. The results are shown in Table 4.

[0116] Comparative Example 6: A solution containing 0.2555 μmol of nucleic acid oligomer was collected from stock solution B prepared in Example 16. 379 μL of TEA-3HF (the amount of TEA-3HF was 88.3 mol per mol of TOM group) was added to the collected solution under an atmosphere of 21% oxygen concentration, and the solution was stirred uniformly using a vortex mixer. The oxygen concentration was calculated according to Measurement Method 3 described above. The TOM group was deprotected by incubating the reaction solution at 40°C for 4 hours, yielding a crude product of nucleic acid oligomer of sequence (II). Measurement using Measurement Method 1 described above revealed that the purity of the crude product was 3%. The results are shown in Table 4.

[0117]

[0118] Example 27: A solution containing 0.101 μmol of nucleic acid oligomer was collected from stock solution B prepared in Example 16. 314 μL of 28% aqueous ammonia (447.6 mol per mol of TOM group) was added to the collected solution. Under an oxygen concentration of 21%, 1 mL of a 63.8% hydrogen fluoride pyridine (hereinafter referred to as HF·Py):pyridine:dimethyl sulfoxide = 1:2:3 (volume ratio) solution (HF·Py amount: 102.0 mol per mol of TOM group) was added to the solution, and the mixture was stirred uniformly using a vortex mixer. The oxygen concentration was calculated according to Measurement Method 3 described above. The TOM group was deprotected by incubating the reaction solution at 40°C for 1.5 hours, yielding a crude product of nucleic acid oligomer of sequence (II). Measurement using Measurement Method 1 described above revealed that the purity of the crude product was 10%. The results are shown in Table 5.

[0119] Example 28: A solution containing 0.096 μmol of nucleic acid oligomer was collected from stock solution B prepared in Example 16. 4.3 mg of piperazine (5.0 mol per mol of TOM group) was added to the collected solution. Under an atmosphere with an oxygen concentration of 21%, 1 mL of a 63.8% HF·Py:pyridine:dimethyl sulfoxide = 1:2:3 (volume ratio) solution (HF·Py amount: 106.8 mol per mol of TOM group) was added to the solution, and the mixture was stirred uniformly using a vortex mixer. The oxygen concentration was calculated according to Measurement Method 3 described above. The TOM group was deprotected by incubating the reaction solution at 40°C for 1.5 hours, yielding a crude product of nucleic acid oligomer of sequence (II). Measurement using Measurement Method 1 described above revealed that the purity of the crude product was 9%. The results are shown in Table 5.

[0120] Example 29 A solution containing 0.100 μmol of nucleic acid oligomer was collected from stock solution B prepared in Example 16. 125 μL of 1-methylimidazole (151.7 mol per mol of TOM group) was added to the collected solution. Under an atmosphere with an oxygen concentration of 21%, 1 mL of a 63.8% HF·Py:pyridine:dimethyl sulfoxide = 1:2:3 (volume ratio) solution (HF·Py amount: 102.6 mol per mol of TOM group) was added to this solution, and the mixture was stirred uniformly using a vortex mixer. The oxygen concentration was calculated according to Measurement Method 3 described above. The TOM group was deprotected by incubating the reaction solution at 40°C for 1.5 hours, yielding a crude product of nucleic acid oligomer of sequence (II). Measurement using Measurement Method 1 described above revealed that the purity of the crude product was 9%. The results are shown in Table 5.

[0121] Comparative Example 7: A solution containing 0.099 μmol of nucleic acid oligomer was collected from stock solution B prepared in Example 16. Under an atmosphere with an oxygen concentration of 21%, 1 mL of a 63.8% HF·Py:pyridine:dimethyl sulfoxide = 1:2:3 (volume ratio) solution (HF·Py amount: 103.9 mol per mol of TOM group) was added to the collected solution, and the solution was stirred uniformly using a vortex mixer. The oxygen concentration was calculated according to Measurement Method 3 described above. The TOM group was deprotected by incubating the reaction solution at 40°C for 1.5 hours, yielding a crude product of nucleic acid oligomer of sequence (II). Measurement using Measurement Method 1 described above revealed that the purity of the crude product was 5%. The results are shown in Table 5.

[0122]

[0123] Example 30: 0.97 g of ammonium fluoride was dissolved in 2.43 mL of water, and 2.43 mL of acetic acid was added to prepare a solution (hereinafter referred to as ammonium fluoride solution D). A solution containing 0.1043 μmol of nucleic acid oligomer was collected from stock solution C prepared in Example 21. 2.5 μL of 40% aqueous methylamine solution (4.7 mol per mol of TOM group) was added to the collected solution. 143 μL of ammonium fluoride solution D (145.2 mol of ammonium fluoride per mol of TOM group) was added to this solution under an oxygen concentration of 21%, and the mixture was stirred uniformly using a vortex mixer. The oxygen concentration was calculated according to Measurement Method 3 above. The reaction solution was incubated at 55°C for 3 hours to deprotect the TOM group. The reaction mixture was quenched by adding 257 μL of 3 M ammonium acetate aqueous solution, followed by precipitation to obtain a crude product of nucleic acid oligomer of sequence (I). Measurement using the above-mentioned Measurement Method 1 revealed that the purity of the crude product was 14%. The results are shown in Table 6.

[0124] Example 31: A solution containing 0.1035 μmol of nucleic acid oligomer was collected from stock solution C prepared in Example 21. 63 μL of diethylamine (115.4 mol per mol of TOM group) was added to the collected solution. 143 μL of ammonium fluoride solution D (146.3 mol of ammonium fluoride per mol of TOM group) was added to this solution under an oxygen concentration of 21%, and the mixture was stirred uniformly using a vortex mixer. The oxygen concentration was calculated according to Measurement Method 3 described above. The TOM group was deprotected by incubating the reaction solution at 55°C for 3 hours. 257 μL of 3M ammonium acetate aqueous solution was added to the reaction solution to quench the reaction, followed by precipitation to obtain a crude product of nucleic acid oligomer of sequence (I). Measurement using Measurement Method 1 described above revealed that the purity of the crude product was 24%. The results are shown in Table 6.

[0125] Example 32: A solution containing 0.1029 μmol of nucleic acid oligomer was collected from stock solution C prepared in Example 21. 1.1 mg of piperazine (2.4 mol per mol of TOM group) was added to the collected solution. 143 μL of ammonium fluoride solution D (147.2 mol of ammonium fluoride per mol of TOM group) was added to this solution under an oxygen concentration of 21%, and the solution was stirred uniformly using a vortex mixer. The oxygen concentration was calculated according to Measurement Method 3 described above. The TOM group was deprotected by incubating the reaction solution at 55°C for 3 hours. 257 μL of 3M ammonium acetate aqueous solution was added to the reaction solution to quench the reaction, followed by precipitation to obtain a crude product of nucleic acid oligomer of sequence (I). Measurement using Measurement Method 1 described above revealed that the purity of the crude product was 22%. The results are shown in Table 6.

[0126] Example 33: A solution containing 0.1031 μmol of nucleic acid oligomer was collected from stock solution C prepared in Example 21. 2.2 μL of 3-mercaptopropionic acid (4.8 mol per mol of TOM group) was added to the collected solution. 143 μL of ammonium fluoride solution D (146.8 mol of ammonium fluoride per mol of TOM group) was added to this solution under an oxygen concentration of 21%, and the solution was stirred uniformly using a vortex mixer. The oxygen concentration was calculated according to Measurement Method 3 described above. The TOM group was deprotected by incubating the reaction solution at 55°C for 3 hours. 257 μL of 3 M ammonium acetate aqueous solution was added to the reaction solution to quench the reaction, followed by precipitation to obtain a crude product of nucleic acid oligomer of sequence (I). Measurement using Measurement Method 1 described above revealed that the purity of the crude product was 22%. The results are shown in Table 6.

[0127] Example 34 A solution containing 0.1067 μmol of nucleic acid oligomer was collected from stock solution C prepared in Example 21. 157 μL of 1-methylimidazole (362.1 mol per mol of TOM group) was added to the collected solution. 143 μL of ammonium fluoride solution D (141.9 mol of ammonium fluoride per mol of TOM group) was added to this solution under an oxygen concentration of 21%, and the solution was stirred uniformly using a vortex mixer. The oxygen concentration was calculated according to Measurement Method 3 described above. The TOM group was deprotected by incubating the reaction solution at 55°C for 3 hours. 257 μL of 3 M aqueous ammonium acetate solution was added to the reaction solution to quench the reaction, followed by precipitation to obtain a crude product of nucleic acid oligomer having sequence (I). Measurement using Measurement Method 1 described above revealed that the purity of the crude product was 27%. The results are shown in Table 6.

[0128] Example 35: A solution containing 0.1001 μmol of nucleic acid oligomer was collected from stock solution C prepared in Example 21. 157 μL of methanol (761.4 mol per mol of TOM group) was added to the collected solution. 143 μL of ammonium fluoride solution D (151.3 mol of ammonium fluoride per mol of TOM group) was added to this solution under an oxygen concentration of 21%, and the solution was stirred uniformly using a vortex mixer. The oxygen concentration was calculated according to Measurement Method 3 described above. The TOM group was deprotected by incubating the reaction solution at 55°C for 3 hours. 257 μL of 3M ammonium acetate aqueous solution was added to the reaction solution to quench the reaction, followed by precipitation to obtain a crude product of nucleic acid oligomer of sequence (I). Measurement using Measurement Method 1 described above revealed that the purity of the crude product was 24%. The results are shown in Table 6.

[0129] Example 36: A solution containing 0.0995 μmol of nucleic acid oligomer was collected from stock solution B prepared in Example 16. 126 μL of diethylamine (118.9 mol per mol of TOM group) was added to the collected solution. 286 μL of ammonium fluoride solution D (150.7 mol of ammonium fluoride per mol of TOM group) was added to this solution under an oxygen concentration of 21%, and the mixture was stirred uniformly using a vortex mixer. The oxygen concentration was calculated according to Measurement Method 3 described above. The TOM group was deprotected by incubating the reaction solution at 55°C for 3 hours. 514 μL of 3M ammonium acetate aqueous solution was added to the reaction solution to quench the reaction, followed by precipitation to obtain a crude product of nucleic acid oligomer of sequence (II). Measurement using Measurement Method 1 described above revealed that the purity of the crude product was 11%. The results are shown in Table 6.

[0130] Example 37: A solution containing 0.1040 μmol of nucleic acid oligomer was collected from stock solution B prepared in Example 16. 314 μL of 1-methylimidazole (367.7 mol per mol of TOM group) was added to the collected solution. 286 μL of ammonium fluoride solution D (144.2 mol of ammonium fluoride per mol of TOM group) was added to this solution under an oxygen concentration of 21%, and the solution was stirred uniformly using a vortex mixer. The oxygen concentration was calculated according to Measurement Method 3 described above. The TOM group was deprotected by incubating the reaction solution at 55°C for 3 hours. 514 μL of 3M aqueous ammonium acetate solution was added to the reaction solution to quench the reaction, followed by precipitation to obtain a crude product of nucleic acid oligomer of sequence (II). Measurement using Measurement Method 1 described above revealed that the purity of the crude product was 10%. The results are shown in Table 6.

[0131] Comparative Example 8: A solution containing 0.0961 μmol of nucleic acid oligomer was collected from stock solution C prepared in Example 21. Under an atmosphere with an oxygen concentration of 21%, 143 μL of ammonium fluoride solution D (the amount of ammonium fluoride was 157.6 moles per mole of TOM group) was added to the collected solution, and the solution was stirred uniformly using a vortex mixer. The oxygen concentration was calculated according to Measurement Method 3 described above. The TOM group was deprotected by incubating the reaction solution at 55°C for 3 hours. After quenching by adding 257 μL of 3M aqueous ammonium acetate solution to the reaction solution, a crude product of nucleic acid oligomer having sequence (I) was obtained by precipitation. Measurement using Measurement Method 1 described above revealed that the purity of the crude product was 9%. The results are shown in Table 6.

[0132] Comparative Example 9: A solution containing 0.1027 μmol of nucleic acid oligomer was collected from stock solution B prepared in Example 16. 286 μL of ammonium fluoride solution D (146.0 moles of ammonium fluoride per mole of TOM group) was added to the collected solution under an oxygen concentration of 21%, and the solution was stirred uniformly using a vortex mixer. The oxygen concentration was calculated according to Measurement Method 3 described above. The TOM group was deprotected by incubating the reaction solution at 55°C for 3 hours. 514 μL of 3M aqueous ammonium acetate solution was added to the reaction solution to quench the reaction, followed by precipitation to obtain a crude product of nucleic acid oligomer of sequence (II). Measurement using Measurement Method 1 described above revealed that the purity of the crude product was 0%. The results are shown in Table 6.

[0133]

[0134] As shown in Tables 1 to 6 above, the deprotection reaction of the TOM group, which is the protecting group for the hydroxyl group at the 2'-position of ribose contained in a nucleic acid oligomer, proceeded efficiently when carried out in the presence of an additive that can be used in the method of the present invention. As a result, the method of the present invention enabled the production of highly pure nucleic acid oligomers.

[0135] The present invention can provide an efficient method for producing a nucleic acid oligomer.

Claims

1. A method for producing a nucleic acid oligomer, comprising the step of contacting a nucleic acid oligomer containing ribose, the hydroxyl group at the 2'-position of which is protected with a triisopropylsilyloxymethyl group, with fluoride ions in the presence of an additive to deprotect the triisopropylsilyloxymethyl group, wherein the additive is at least one selected from the group consisting of a compound represented by the following formula (A), a compound represented by the following formula (B), a compound represented by the following formula (C), a compound represented by the following formula (D), a compound represented by the following formula (E), a compound represented by the following formula (F), the following nitrogen-containing heterocyclic compounds, and amidines. a -NH 2 (In the formula, R a represents a hydrogen atom, a methyl group, an ethyl group, an n-propyl group, an isopropyl group, an n-butyl group, an isobutyl group, a sec-butyl group, a tert-butyl group, an n-pentyl group, an n-hexyl group, a cyclopropyl group, a cyclobutyl group, a cyclopentyl group, a cyclohexyl group, a phenyl group, or a benzyl group. b -NH-R c (In the formula, R b and R c are the same or different and each represent a methyl group, an ethyl group, an n-propyl group, an isopropyl group, an n-butyl group, an isobutyl group, a sec-butyl group, a tert-butyl group, an n-pentyl group, an n-hexyl group, a cyclopropyl group, a cyclobutyl group, a cyclopentyl group, a cyclohexyl group, a phenyl group, or a benzyl group. b -OH (wherein, R b is as defined in formula (B) above.) Formula (D) R d -SH (wherein, R d represents a methyl group, an ethyl group, an n-propyl group, an isopropyl group, an n-butyl group, an isobutyl group, a sec-butyl group, a tert-butyl group, an n-pentyl group, an n-hexyl group, an n-heptyl group, an n-octyl group, an n-nonyl group, an n-decyl group, an n-undecyl group, an n-dodecyl group, a cyclobutyl group, a cyclopentyl group, a cyclohexyl group, a cycloheptyl group, a cyclooctyl group, a phenyl group, or a benzyl group. b -NO 2 (In the formula, R b is as defined in formula (B) above.) Formula (F) R e - (CH 2 -R f -CH 2 ) n -R g (In the formula, R e and R g are the same or different, and NH 2 , OH, SH, or COOH; R f is a single bond, CH 2 , C.H. 2 -O-CH 2 or an oxygen atom, and n represents an integer of 1 to 3. e and R g and (b) do not both become COOH.) The nitrogen-containing heterocyclic compound is a nitrogen-containing five-membered ring compound or a nitrogen-containing six-membered ring compound, the nitrogen-containing five-membered ring compound is pyrrolidine, 3-pyrroline, 2-pyrroline, 2H-pyrrole, 3H-pyrrole, pyrazolidine, imidazolidine, 2-pyrazoline, 2-imidazolidine, pyrazole, imidazole, 1,2,4-triazole, 1,2,3-triazole, 1H-tetrazole, 1-methylimidazole, oxazole, isoxazole, isothiazole, or thiazole, the nitrogen-containing six-membered ring compound is piperidine, piperazine, pyridine, pyridazine, pyrimidine, pyrazine, 1,2,4-triazine, 1,3,5-triazine, 2,6-lutidine, 3,5-lutidine, 4-dimethylaminopyridine, 2-dimethylaminopyridine, morpholine, or thiomorpholine, The amidine is benzamidine, formamidine, guanidine, benzamidine, or acetamidine.

2. In the presence of an additive, the following formula (3): (In the formula, G 4 represents a protecting group for a hydrogen atom or a hydroxyl group; 9 represents an ammonium ion, an alkylammonium ion, an alkali metal ion, a hydrogen ion, or a hydroxyalkylammonium ion; B c are each independently the same or different and represent a nucleic acid base; R are each independently the same or different and represent a hydrogen atom, a fluorine atom, or an OQ group; Q are each independently the same or different and represent a triisopropylsilyloxymethyl group, a methyl group, a 2-methoxyethyl group, a methylene group bonded to the carbon atom at the 4' position of ribose, an ethylene group bonded to the carbon atom at the 4' position of ribose, or an ethylidene group bonded to the carbon atom at the 4' position of ribose; Y are each independently the same or different and represent an oxygen atom or a sulfur atom; m represents an integer of 2 to 400; W and X are defined as either (a) or (b) below; (a) when W is a hydroxyl group, X are each independently the same or different and represent a hydrogen atom, a fluorine atom, or an OQ' group; Q' are each independently the same or different and represent a triisopropylsilyloxymethyl group, a methyl group, a 2-methoxyethyl group, a methylene group bonded to the 4' carbon atom of ribose, an ethylene group bonded to the 4' carbon atom of ribose, an ethylidene group bonded to the 4' carbon atom of ribose, or a tert-butyldimethylsilyl group. (b) When X is a hydroxyl group, W represents an OV group, and V represents a triisopropylsilyloxymethyl group, a tert-butyldimethylsilyl group, a methyl group, or a 2-methoxyethyl group. However, at least one group among R represents a hydroxyl group protected with a triisopropylsilyloxymethyl group. When m is an integer of 3 or greater, non-nucleotide linkers may be incorporated in place of p nucleotides (where p is a positive integer satisfying the formula: m-1>p) between the 5'- and 3'-terminal nucleotides. ) is contacted with fluoride ions, (wherein, each R' is independently the same or different and represents a hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethoxy group, or an OQ" group; each Q" is independently the same or different and represents a methylene group bonded to the carbon atom at the 4' position of ribose, an ethylene group bonded to the carbon atom at the 4' position of ribose, or an ethylidene group bonded to the carbon atom at the 4' position of ribose; G 4 , G 9 , B c , Y and m are as defined in the formula (3), 0 is a hydroxyl group, a methoxy group, or a 2-methoxyethoxy group, and X 0 has the same definition as the R' group, and when m is an integer of 3 or more, a non-nucleotide linker may be incorporated in place of p nucleotides (wherein p is a positive integer satisfying the formula: m-1>p) between each of the 5'-terminal and 3'-terminal nucleotides, wherein the additive is at least one selected from the group consisting of a compound represented by the following formula (A), a compound represented by the following formula (B), a compound represented by the following formula (C), a compound represented by the following formula (D), a compound represented by the following formula (E), a compound represented by the following formula (F), and the following nitrogen-containing heterocyclic compound. a -NH 2 (In the formula, R a represents a hydrogen atom, a methyl group, an ethyl group, an n-propyl group, an isopropyl group, an n-butyl group, an isobutyl group, a sec-butyl group, a tert-butyl group, an n-pentyl group, an n-hexyl group, a cyclopropyl group, a cyclobutyl group, a cyclopentyl group, a cyclohexyl group, a phenyl group, or a benzyl group. b -NH-R c (In the formula, R b and R c are the same or different and each represent a methyl group, an ethyl group, an n-propyl group, an isopropyl group, an n-butyl group, an isobutyl group, a sec-butyl group, a tert-butyl group, an n-pentyl group, an n-hexyl group, a cyclopropyl group, a cyclobutyl group, a cyclopentyl group, a cyclohexyl group, a phenyl group, or a benzyl group. b -OH (wherein, R b is as defined in formula (B) above.) Formula (D) R d -SH (wherein, R d represents a methyl group, an ethyl group, an n-propyl group, an isopropyl group, an n-butyl group, an isobutyl group, a sec-butyl group, a tert-butyl group, an n-pentyl group, an n-hexyl group, an n-heptyl group, an n-octyl group, an n-nonyl group, an n-decyl group, an n-undecyl group, an n-dodecyl group, a cyclobutyl group, a cyclopentyl group, a cyclohexyl group, a cycloheptyl group, a cyclooctyl group, a phenyl group, or a benzyl group. b -NO 2 (In the formula, R b is as defined in formula (B) above.) Formula (F) R e - (CH 2 -R f -CH 2 ) n -R g (In the formula, R e and R g are the same or different, and NH 2 , OH, SH, or COOH; R f is a single bond, CH 2 , C.H. 2 -O-CH 2 or an oxygen atom, and n represents an integer of 1 to 3. e and R g and (b) do not both become COOH.) The nitrogen-containing heterocyclic compound is a nitrogen-containing five-membered ring compound or a nitrogen-containing six-membered ring compound, the nitrogen-containing five-membered ring compound is pyrrolidine, 3-pyrroline, 2-pyrroline, 2H-pyrrole, 3H-pyrrole, pyrazolidine, imidazolidine, 2-pyrazoline, 2-imidazolidine, pyrazole, imidazole, 1,2,4-triazole, 1,2,3-triazole, 1H-tetrazole, 1-methylimidazole, oxazole, isoxazole, isothiazole, or thiazole, and the nitrogen-containing six-membered ring compound is piperidine, piperazine, pyridine, pyridazine, pyrimidine, pyrazine, 1,2,4-triazine, 1,3,5-triazine, 2,6-lutidine, 3,5-lutidine, 4-dimethylaminopyridine, 2-dimethylaminopyridine, morpholine, or thiomorpholine.

3. The method of claim 2, wherein the non-nucleotide linker is a linker consisting of an amino acid backbone.

4. The method according to claim 3, wherein the linker consisting of an amino acid skeleton has a structure represented by the following formula (A14-1), (A14-2), or (A14-3): (In the formula, 5' and 3' represent the 5'-end and 3'-end of the nucleic acid oligomer, respectively, and G 9 and Y is as defined in claim 2.

5. In formula (3), W represents a hydroxyl group, and X's are independently the same or different and represent a hydrogen atom, a fluorine atom, or an OQ' group; and in formula (4), W 0 represents a hydroxyl group, and X 0 The method according to any one of claims 2 to 4, wherein represents an R' group.

6. The method according to any one of claims 1 to 5, wherein the fluoride ion source is at least one selected from the group consisting of tetraalkylammonium fluoride, trialkylamine hydrofluoride, hydrogen fluoride pyridine, and ammonium fluoride.

7. The method of claim 6, wherein the tetraalkylammonium fluoride is tetra-n-butylammonium fluoride.

8. The method according to claim 6, wherein the trialkylamine hydrofluoride is triethylamine trihydrofluoride.

9. The method of any one of claims 1 to 5, wherein the fluoride ion source is at least one selected from the group consisting of tetra-n-butylammonium fluoride, triethylamine trihydrofluoride, and hydrogen fluoride pyridine.

10. The production method according to any one of claims 1 to 9, wherein the compound represented by formula (A) is ammonia, methylamine, ethylamine, n-propylamine, isopropylamine, n-butylamine, isobutylamine, sec-butylamine, tert-butylamine, n-pentylamine, n-hexylamine, cyclopropylamine, cyclobutylamine, cyclopentylamine, cyclohexylamine, aniline, or benzylamine.

11. The method according to any one of claims 1 to 9, wherein the compound represented by formula (A) is ammonia or methylamine.

12. The production method according to any one of claims 1 to 11, wherein the compound represented by formula (B) is dimethylamine, diethylamine, di-n-propylamine, diisopropylamine, di-n-butylamine, diisobutylamine, di-sec-butylamine, di-tert-butylamine, di-n-pentylamine, di-n-hexylamine, dicyclopropylamine, dicyclobutylamine, dicyclopentylamine, dicyclohexylamine, diphenylamine, dibenzylamine, N-methylethylamine, N-methylpropylamine, N-methylisopropylamine, N-methylbutylamine, N-methylpentylamine, N-methylhexylamine, N-methylcyclohexylamine, N-methylaniline, or N-methylbenzylamine.

13. The method according to any one of claims 1 to 11, wherein the compound represented by formula (B) is diethylamine.

14. The production method according to any one of claims 1 to 13, wherein the compound represented by formula (C) is methanol, ethanol, n-propanol, isopropanol, n-butanol, isobutanol, sec-butanol, tert-butanol, n-pentanol, n-hexanol, cyclopropanol, cyclobutanol, cyclopentanol, cyclohexanol, phenol, or benzyl alcohol.

15. The method according to any one of claims 1 to 13, wherein the compound represented by formula (C) is methanol or ethanol.

16. The method according to any one of claims 1 to 15, wherein the compound represented by formula (D) is methanethiol, ethanethiol, 1-propanethiol, 2-propanethiol, 1-butanethiol, 2-butanethiol, 2-methyl-1-propanethiol, 2-methyl-2-propanethiol, 1-pentanethiol, 1-hexanethiol, 1-heptanethiol, 1-octanethiol, 1-nonanethiol, 1-decanethiol, 1-undecanethiol, 1-dodecanethiol, cyclobutanethiol, cyclopentanethiol, cyclohexanethiol, cycloheptanethiol, cyclooctanethiol, phenylthiol, or benzylthiol.

17. The method according to any one of claims 1 to 15, wherein the compound represented by formula (D) is 1-dodecanethiol.

18. The method of any one of claims 1 to 17, wherein the compound represented by formula (E) is nitromethane, nitroethane, 1-nitropropane, 2-nitropropane, 1-nitrobutane, 1-nitropentane, or 1-nitrohexane.

19. The method of any one of claims 1 to 17, wherein the compound represented by formula (E) is nitromethane.

20. The method according to any one of claims 1 to 19, wherein the compound represented by formula (F) is ethylenediamine, ethanolamine, 2-mercaptoethanol, 3-mercapto-1-propanol, 4-mercapto-1-butanol, 6-mercapto-1-hexanol, 2-mercaptoethyl ether, or 3-mercaptopropionic acid.

21. The method according to any one of claims 1 to 19, wherein the compound represented by formula (F) is ethylenediamine or 3-mercaptopropionic acid.

22. The method according to any one of claims 1 to 21, wherein the nitrogen-containing heterocyclic compound is 1-methylimidazole, piperazine, or morpholine.

23. The manufacturing method according to any one of claims 1 to 9, wherein the additive is at least one selected from the group consisting of ammonia, methylamine, diethylamine, methanol, ethanol, 1-dodecanethiol, nitromethane, ethylenediamine, 3-mercaptopropionic acid, 1-methylimidazole, piperazine, and morpholine.

24. G 4 represents a protecting group for a hydroxyl group, the protecting group is (In the formula, R 1 , R 2 and R 3 and each independently represent the same or different, a hydrogen atom or an alkoxy group.

25. R 1 and R 2 is a methoxy group, and R 3 The method according to claim 24, wherein is a hydrogen atom.

26. The method of any one of claims 2 to 25, wherein m is an integer from 50 to 200.

Citation Information

Patent Citations

  • Ribonucleoside-derivative and method for preparing the same

    WO1999009044A1

  • Nucleic acid-polypeptide compositions and uses thereof

    WO2019071028A1

  • Method for producing nucleic acid oligomers

    WO2021070494A1