Biomarker for diagnosing cognitive dysfunction comprising mir-10a-5p and uses thereof

Abstract

One aspect of the present invention relates to a biomarker for diagnosing cognitive dysfunction comprising miR-10a-5p, and uses thereof. According to one aspect, by measuring an expression level of a biomarker comprising miR-10a-5p, accurate and rapid diagnosis of hippocampal aging and cognitive dysfunction resulting therefrom is enabled. Furthermore, when a biomarker further comprising a Camk2b gene is utilized, a more accurate and higher-precision diagnosis is enabled. The biomarker may be used for diagnosing cognitive dysfunction and for screening therapeutic agents for cognitive dysfunction, and may further be used for prevention or treatment of cognitive dysfunction by regulating an expression level of the biomarker.

Description

Biomarker for diagnosing cognitive impairment diseases including MIR-10A-5P and its use

[0001] The present invention relates to a biomarker for diagnosing cognitive impairment diseases comprising miR-10a-5p and the use thereof.

[0002]

[0003] With advancements in medical technology and improvements in living standards, average human life expectancy has nearly doubled over the past half-century, leading to a rapid increase in the proportion of the elderly population relative to the total population. As society gradually ages, senile dementia is emerging as a major public health issue. Consequently, there is a growing demand for the development of functional substances capable of preventing or treating cognitive impairments, including dementia.

[0004] The hippocampus is a core component of the brain that plays a role in regulating learning, memory, the recognition of new things, emotional behavior, and some motor functions, as well as controlling the functions of the hypothalamus. The hippocampus undergoes biological and structural changes with age and influences age-related cognitive decline. Neuromodulatory deficits caused by aging can affect the memory function and learning ability of the aging hippocampus, which may lead to the development of cognitive disorders such as Alzheimer's dementia.

[0005] MicroRNA (miRNA) is a new target substance for diagnosis and treatment that is currently being actively researched in various diseases. miRNA is a small, single-stranded RNA with approximately 20 nucleotides that binds to the 3'-UTR (3'-untranslated regions) of specific target mRNAs, thereby regulating proteins by inhibiting mRNA translation. To date, about 1,000 miRNAs have been identified in humans, but the functions of most of them remain unknown.

[0006] Specifically, about 50% of miRNAs in all mammals are abundant in the brain, and many of them are known to play important roles in neurodevelopment, but there is a lack of research on the diagnosis of cognitive impairment using miRNAs that are correlated with hippocampal aging.

[0007]

[0008] One aspect is to provide a biomarker for diagnosing cognitive impairment diseases that includes miR-10a-5p.

[0009] Another aspect is to provide a composition for diagnosing cognitive impairment diseases comprising a preparation for measuring the expression level of miR-10a-5p.

[0010] Another aspect is to provide a diagnostic kit for cognitive impairment comprising the above-mentioned composition for diagnosing cognitive impairment.

[0011] Another aspect is the step of measuring the expression level of miR-10a-5p in biological samples isolated from individuals suspected of having cognitive impairment; and

[0012] The present invention provides a method for providing information for diagnosing a cognitive impairment disease, comprising the step of comparing the expression level of miR-10a-5p in an individual suspected of having the above-mentioned cognitive impairment disease with the expression level of miR-10a-5p in a biological sample isolated from a normal individual.

[0013] Another aspect is the step of treating a candidate substance to a biological sample isolated from an individual having a cognitive impairment disease; and

[0014] The present invention provides a screening method for a therapeutic agent for cognitive impairment, comprising the step of measuring the expression level of miR-10a-5p in the biological sample.

[0015] Another aspect is to provide a pharmaceutical composition for the prevention or treatment of cognitive impairment comprising a miR-10a-5p inhibitor.

[0016]

[0017] One aspect provides a biomarker for diagnosing cognitive impairment diseases that includes miR-10a-5p.

[0018] The term “diagnosis” includes determining the susceptibility of an object, namely a subject to a specific disease or condition, determining whether an object currently has a specific disease or condition, determining the prognosis of an object with a specific disease or condition, or therametrics (e.g., monitoring the condition of an object to provide information on therapeutic efficacy).

[0019] The term "marker" or "biomarker" refers to a substance that can be used to distinguish and evaluate individuals with and without a disease, and may include organic biomolecules such as polypeptides, proteins, nucleic acids (e.g., mRNA, etc.), lipids, glycolipids, glycoproteins, sugars (monosaccharides, disaccharides, oligosaccharides, etc.), metabolites, etc., which show an increase or decrease in individuals with and without the disease compared to individuals without the disease. The above-mentioned biomarker can be used in medicine as an experimental parameter that can be used to assist physicians in making decisions regarding diagnosis and selecting a treatment course.

[0020] The term "miR" refers to "micro RNA" and can be used interchangeably.

[0021] In one embodiment, the miR-10a-5p may be a polynucleotide composed of a base sequence having sequence homology of at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 95%, at least about 97%, at least about 98%, or at least about 99% with respect to the base sequence of SEQ ID NO. 1, and specifically, may be a polynucleotide composed of the base sequence of SEQ ID NO. 1.

[0022] In one embodiment, the Camk2b (calcium / calmodulin dependent protein kinase II beta) gene may be further included.

[0023] The above Camk2b (calcium / calmodulin dependent protein kinase II beta) gene may include the Camk2b gene, a polynucleotide (e.g., mRNA) encoded by the gene, or a polypeptide encoded by the gene.

[0024] The protein encoded by the Camk2b gene is abundant in the brain, plays a crucial role in regulating neural functions such as synaptic plasticity and differentiation, and is a factor that influences memory and learning.

[0025] In one embodiment, the cognitive impairment disease may be a disease caused by the aging of hippocampal neurons, and, for example, the cognitive impairment disease may be one or more selected from the group consisting of Alzheimer's disease, Pick's disease, Creutzfeldt-Jakob disease, Parkinson's disease, amyotrophic lateral sclerosis, and Huntington's disease.

[0026] In one embodiment, the expression profile of miRNAs in the hippocampus according to aging was examined. As a result, it was confirmed that miRNAs that are upregulated in the hippocampus in the elderly stage exist compared to the hippocampus in the youth stage, and it was confirmed that inhibiting miR-10a-5p, among the miRNAs whose expression increased with aging, increased the expression of dendritic spines in hippocampal neurons. Accordingly, it was confirmed that miR-10a-5p can be utilized as a regulator of changes in cognitive function due to aging (see Examples 1 and 2).

[0027] In another example, the specific mechanism of action of miR-10a-5p was identified. As a result, it was confirmed that treatment with a miR-10a-5p inhibitor increased the expression of the Camk2b protein, which is known as a regulator of neural functions such as synaptic plasticity and neuronal differentiation. Furthermore, it was confirmed that when Camk2b was knocked down, treatment with a miR-10a-5p inhibitor restored the density of dendritic spines in hippocampal neurons to the level observed when Camk2b protein expression was not knocked down. Accordingly, it was confirmed that the expression of miR-10a-5p and Camk2b is regulated in an interrelated manner, and that aging of hippocampal neurons can be identified through miR-10a-5p and / or Camk2b genes, thereby enabling their use as biomarkers for the diagnosis of cognitive impairment diseases (see Examples 3 and 4).

[0028] In other words, since the miR-10a-5p influences the expression of dendritic spines associated with brain aging, inhibiting the expression of miR-10a-5p increases the expression of dendritic spines in hippocampal neurons, thereby preventing brain aging. Furthermore, since the miR-10a-5p influences the expression of the Camk2b gene, aging of hippocampal neurons can be predicted and cognitive impairment diseases can be diagnosed by confirming the expression levels of the Camk2b gene along with the expression levels of miR-10a-5p.

[0029] By utilizing the above biomarker, if the expression level of miR-10a-5p is higher than that of a normal individual, it can be diagnosed that the individual has a cognitive impairment disease, and if the expression level of miR-10a-5p is lower than that of a normal individual, it can be diagnosed that the individual does not have a cognitive impairment disease.

[0030] In addition, by utilizing a biomarker that further includes the Camk2b gene, if the expression level of the miR-10a-5p is higher than that of a normal individual and the expression level of the Camk2b gene is lower than that of a normal individual, it can be diagnosed that the individual has a cognitive impairment disease, and if the expression level of the miR-10a-5p is lower than that of a normal individual and the expression level of the Camk2b gene is higher than that of a normal individual, it can be diagnosed that the individual does not have a cognitive impairment disease.

[0031] In other words, a biomarker containing miR-10a-5p, which is associated with hippocampal aging according to daily patterns, enables the early diagnosis of cognitive impairment diseases; furthermore, utilizing a biomarker that additionally includes the Camk2b gene can further enhance the diagnostic precision of cognitive impairment diseases. Accordingly, biomarkers containing miR-10a-5p and / or the Camk2b gene can be used to assess the treatment course of the aforementioned diseases, thereby enabling the provision of personalized treatment methods for patients.

[0032] Another aspect provides a composition for diagnosing cognitive impairment diseases comprising a preparation for measuring the expression level of miR-10a-5p.

[0033] The above "miR", "Camk2b", "cognitive impairment disease", "diagnosis", etc. may be within the aforementioned scope.

[0034] In one embodiment, the agent for measuring the expression level of miR-10a-5p may also be a agent for measuring the expression level of the Camk2b gene. Accordingly, the composition for diagnosing cognitive impairment diseases according to one embodiment can provide results with high accuracy and precision in diagnosing hippocampal neuron aging and the resulting cognitive impairment diseases by additionally measuring the expression level of the Camk2b gene as well as the expression level of miR-10a-5p.

[0035] Additionally, according to one embodiment, the composition for diagnosing cognitive impairment may further include a preparation for measuring the expression level of the Camk2b gene. The composition for diagnosing cognitive impairment may simultaneously measure the expression level of miR-10a-5p and the expression level of the Camk2b gene; may measure the expression level of the Camk2b gene after measuring the expression level of miR-10a-5p; or may measure the expression level of miR-10a-5p after measuring the expression level of the Camk2b gene.

[0036] According to one embodiment, the composition for diagnosing cognitive impairment diseases further includes a preparation for measuring the expression level of the Camk2b gene, thereby providing results with high accuracy and precision in diagnosing aging of hippocampal neurons and the resulting cognitive impairment diseases.

[0037] The term "measurement" refers to quantifying the concentration of a detected or measured object.

[0038] The above measurement can be performed by a method selected from the group consisting of polymerase chain reaction (PCR), real-time polymerase chain reaction (qPCR), reverse transcription polymerase chain reaction (RT-PCR), competitive polymerase chain reaction (competitive RT-PCR), nuclease protection assay (RNase and S1 nuclease protection assay), in situ hybridization, nucleic acid microarray, northern blotting, or DNA chip.

[0039] The term "reagent for measuring expression levels" refers to a substance that can be used to specifically identify or detect the miR-10a-5p and / or Camk2b genes.

[0040] In one embodiment, the preparation may comprise a primer, probe, antisense oligonucleotide, antibody, antibody fragment, antibody mimic, aptamer, avidity multimer, peptidomimerics, peptide, or compound that specifically binds to the miR-10a-5p and / or Camk2b genes, and specifically may comprise a primer, probe, or antisense oligonucleotide.

[0041] The term "primer" refers to a fragment that recognizes a target gene sequence and may include a pair of forward and reverse primers; specifically, it may be a pair of primers that provide analytical results with specificity and sensitivity. High specificity may be conferred when the nucleic acid sequence of the primer is inconsistent with the non-target sequence present in the sample, thereby amplifying only the target gene sequence containing the complementary primer binding site and not inducing non-specific amplification.

[0042] The term "probe" refers to a nucleic acid fragment, such as RNA or DNA, capable of specifically binding to a target nucleic acid, e.g., the miR-10a-5p and / or Camk2b gene, and may be labeled to confirm the presence, content, and expression level of a specific miRNA or gene. The probe may be constructed in the form of an oligonucleotide probe, single-strand DNA probe, double-strand DNA probe, RNA probe, etc. The selection of an appropriate probe and hybridization conditions may be appropriately selected according to techniques known in the art.

[0043] The above primer or probe may be chemically synthesized using the phosphoramidite solid support method or other widely known methods. These nucleic acid sequences may also be modified using many means known in the art. Non-limiting examples of such modifications include methylation, capping, substitution with one or more homologues of the natural nucleotide, and modification between nucleotides, for example, modification to an uncharged linkage (methyl phosphonate, phosphotriester, phosphoroamidate, carbamate, etc.) or a charged linkage (phosphorothioate, phosphorodithioate, etc.).

[0044] The term "antisense oligonucleotide" refers to a nucleic acid-based molecule that has a sequence complementary to a target gene and can form a dimer with the target gene.

[0045] The term "antibody" may include polyclonal antibodies, monoclonal antibodies, or recombinant antibodies. The antibody may be easily manufactured using techniques widely known in the art. The antibody may be separated and purified using methods such as gel electrophoresis, dialysis, salt precipitation, ion exchange chromatography, and affinity chromatography. Additionally, the antibody may include not only a complete form having two full-length light chains and two full-length heavy chains, but also functional fragments of the antibody molecule.

[0046] The term "aptamer" refers to a single-stranded oligonucleotide and may refer to a nucleic acid molecule having binding activity to the protein. The aptamer may have various secondary or tertiary structures depending on its base sequence and may have a high affinity for a specific substance, such as in an antigen-antibody reaction. The aptamer may be RNA, DNA, modified nucleic acid, or a mixture thereof, and may be linear or cyclic in form.

[0047] A composition for diagnosing cognitive impairment diseases comprising a preparation for measuring the expression level of miR-10a-5p associated with hippocampal aging according to a specific pattern can be utilized to determine whether hippocampal neurons are aging, the stage of aging progression, predict or diagnose cognitive impairment diseases early, and further assess the course of treatment for said disease by measuring the expression level of said miR-10a-5p.

[0048] For example, by utilizing the above composition for diagnosing cognitive impairment, if the expression level of miR-10a-5p is higher than that of a normal individual, it can be diagnosed that the individual has cognitive impairment, and if the expression level of miR-10a-5p is lower than that of a normal individual, it can be diagnosed that the individual does not have cognitive impairment.

[0049] In addition, by utilizing a composition for diagnosing cognitive impairment disease that further includes the Camk2b gene, if the expression level of miR-10a-5p is higher than that of a normal individual and the expression level of the Camk2b gene is lower than that of a normal individual, it can be diagnosed that the individual has a cognitive impairment disease, and if the expression level of miR-10a-5p is lower than that of a normal individual and the expression level of the Camk2b gene is higher than that of a normal individual, it can be diagnosed that the individual does not have a cognitive impairment disease.

[0050] In other words, if the expression level of the Camk2b gene is additionally measured in addition to miR-10a-5p, it is possible to provide results with higher precision and accuracy for the prediction, diagnosis, or assessment of the treatment course of the aforementioned disease.

[0051] Another aspect provides a diagnostic kit for cognitive impairment comprising the above-mentioned composition for diagnosing cognitive impairment.

[0052] The above "miR", "cognitive impairment disease", "diagnosis", "measurement", "expression level", "Camk2b", etc. may be within the aforementioned range.

[0053] In one embodiment, the kit may be a real-time PCR (RT-PCR) kit, a microarray kit, a protein chip kit, or a SAGE (Serial Analysis of Gene Expression) kit, and specifically, it may be a real-time PCR (RT-PCR) kit or a microarray kit.

[0054] As a specific example, the kit may be a kit containing essential elements necessary to perform RT-PCR. For example, in addition to respective primers specific to the miR-10a-5p and / or Camk2b genes, the RT-PCR kit may include test tubes or other suitable containers, reaction buffers (varying pH and magnesium concentration), deoxynucleotides (dNTPs), dideoxynucleotides (ddNTPs), enzymes such as Taq-polymerase and reverse transcriptase, DNase, RNAse inhibitors, DEPC-water, sterile water, etc. Additionally, it may include primer pairs specific to DNA, RNA, or miRNA used as quantitative controls.

[0055] In addition, a kit according to one aspect may include a kit for extracting proteins or nucleic acids (e.g., total RNA) from body fluids, cells, or tissues, a fluorescent label, an enzyme and culture medium for nucleic acid amplification, instructions for use, etc.

[0056] In addition, the above kit is a device for measuring cognitive impairment disease markers in which the miR-10a-5p and / or Camk2b genes are bound or attached, for example, to a solid. Examples of materials for the solid include plastic, paper, glass, silicone, etc., and plastic is a preferred material for the solid due to ease of processing. The shape of the solid is arbitrary and may be, for example, square, circular, rectangular, film-shaped, etc.

[0057] The microarray chip described above may include polynucleotide probes composed of DNA or RNA. A microarray refers to a structure in which the probes are immobilized at a high density in distinct regions of a substrate surface. Furthermore, the hybridization of nucleic acids and the detection of hybridization results on a microarray are well known in the art.

[0058] The protein chip kit described above can, for example, measure the expression level of a polypeptide or a fragment thereof encoded by the Camk2b gene. For the immunological detection of antibodies, the protein chip kit may include a substrate, a suitable buffer solution, a secondary antibody labeled with a chromogenic enzyme or a fluorescent substance, a chromogenic substrate, etc. Peroxidase, alkaline phosphatase, etc. may be used as the chromogenic enzyme. Additionally, FITC, RITC, etc. may be used as the fluorescent substance, and ABTS (2,2'-azino-bis-(3-ethylbenzothiazoline-6-sulfonic acid)), OPD (o-phenylenediamine), TMB (tetramethylbenzidine), etc. may be used as the chromogenic substrate. The kit may also include instructions for use.

[0059] A diagnostic kit for cognitive impairment comprising a composition for diagnosing cognitive impairment according to one aspect can be used to determine whether hippocampal neurons are aging, the stage of aging progression, predict or diagnose cognitive impairment early, and further assess the course of treatment for said disease by measuring the expression level of miR-10a-5p.

[0060] For example, by utilizing the above-mentioned diagnostic kit for cognitive impairment, if the expression level of miR-10a-5p is higher than that of a normal individual, it can be diagnosed that the individual has a cognitive impairment, and if the expression level of miR-10a-5p is lower than that of a normal individual, it can be diagnosed that the individual does not have a cognitive impairment.

[0061] In addition, by utilizing a diagnostic kit for cognitive impairment that further includes the Camk2b gene, if the expression level of the miR-10a-5p is higher than that of a normal individual and the expression level of the Camk2b gene is lower than that of a normal individual, it can be diagnosed that the individual has a cognitive impairment; and if the expression level of the miR-10a-5p is lower than that of a normal individual and the expression level of the Camk2b gene is higher than that of a normal individual, it can be diagnosed that the individual does not have a cognitive impairment.

[0062] In other words, if the expression level of the Camk2b gene is additionally measured in addition to miR-10a-5p, it is possible to provide results with higher precision and accuracy for the prediction, diagnosis, or assessment of the treatment course of the aforementioned disease.

[0063] Another aspect is the step of measuring the expression level of miR-10a-5p in biological samples isolated from individuals suspected of having cognitive impairment; and

[0064] The present invention provides a method for providing information for diagnosing a cognitive impairment disease, comprising the step of comparing the expression level of miR-10a-5p in an individual suspected of having the above-mentioned cognitive impairment disease with the expression level of miR-10a-5p in a biological sample isolated from a normal individual.

[0065] The above "miR", "cognitive impairment disease", "diagnosis", "measurement", "expression level", "Camk2b", etc. may be within the aforementioned range.

[0066] The term "individual" is interpreted to include humans who are at risk of developing or have developed a cognitive impairment, primates including chimpanzees, pets such as dogs and cats, livestock such as cattle, horses, sheep, and goats, and mammals such as rodents such as mice and rats.

[0067] In one embodiment, the method for providing information for diagnosing a cognitive impairment disease may further include the step of measuring the expression level of the Camk2b gene in a biological sample isolated from an individual suspected of having the cognitive impairment disease.

[0068] Specifically, the step of measuring the expression level of the Camk2b gene may be performed at one point in time selected from the group consisting of: before the step of measuring the expression level of miR-10a-5p; simultaneously with the step of measuring the expression level of miR-10a-5p; after the step of measuring the expression level of miR-10a-5p; before the step of comparing the expression level of miR-10a-5p in an individual suspected of having the cognitive impairment disease with the expression level of miR-10a-5p in a biological sample isolated from a normal individual; and after the step of comparing the expression level of miR-10a-5p in an individual suspected of having the cognitive impairment disease with the expression level of miR-10a-5p in a biological sample isolated from a normal individual; more specifically, before the step of measuring the expression level of miR-10a-5p; simultaneously with the step of measuring the expression level of miR-10a-5p; It can be performed at one time point selected from a group consisting of the step after measuring the expression level of miR-10a-5p and the step before comparing the expression level of miR-10a-5p in an individual suspected of having the cognitive impairment disease with the expression level of miR-10a-5p in a biological sample isolated from a normal individual.

[0069] In one embodiment, the method for providing information for diagnosing a cognitive impairment disease may further include the step of determining that an individual suspected of having a cognitive impairment disease has a cognitive impairment disease if the expression level of miR-10a-5p measured in a biological sample isolated from an individual suspected of having a cognitive impairment disease is higher than the expression level of miR-10a-5p measured in a biological sample isolated from a normal individual.

[0070] In one embodiment, the method for providing information for diagnosing a cognitive impairment disease may further include the step of determining that an individual suspected of having a cognitive impairment disease has a cognitive impairment disease when the expression level of miR-10a-5p measured in a biological sample isolated from an individual suspected of having a cognitive impairment disease is higher than the expression level of miR-10a-5p measured in a biological sample isolated from a normal individual, and the expression level of the Camk2b gene measured in a biological sample isolated from an individual suspected of having a cognitive impairment disease is lower than the expression level of the Camk2b gene measured in a biological sample isolated from a normal individual.

[0071] By further including a step of comparing the expression levels of the Camk2b gene along with the expression levels of miR-10a-5p in individuals suspected of having the above-mentioned cognitive impairment disease and normal individuals, results with higher accuracy and precision can be provided for the diagnosis of hippocampal neuron aging and the resulting cognitive impairment disease.

[0072] In one embodiment, the biological sample may contain the miR-10a-5p and / or Camk2b genes and may be, for example, blood, plasma, serum, urine, mucus, saliva, tears, tissue, or cells. Specifically, the biological sample may be brain-derived tissue or cells, more specifically cerebral, for example, hippocampal tissue or surrounding tissue or cells thereof, and even more specifically hippocampal neurons.

[0073] In one embodiment, the step of measuring the expression level may be one or more selected from the group consisting of RT-PCR, competitive RT-PCR, real-time RT-PCR, RNase protection assay (RPA), Northern blotting, DNA chip, Western blotting, ELISA, radioimmunoassay, radioimmunodiffusion, Ouchterlony immunodiffusion, rocket immunoelectrophoresis, immunohistochemical staining, immunoprecipitation assay, complement fixation assay, FACS, and protein chip, and specifically, may be one or more selected from the group consisting of RT-PCR, competitive RT-PCR, real-time RT-PCR, RNase protection assay (RPA), Northern blotting, and DNA chip.

[0074] In one embodiment, the step of measuring the expression level may be performed using a preparation comprising a primer, probe, antisense oligonucleotide, antibody, antibody fragment, antibody mimic, aptamer, avidity multimer, peptidomimerics, peptide, or compound that specifically binds to the miR-10a-5p and / or Camk2b gene, and specifically, may be performed using a preparation comprising a primer, probe, or antisense oligonucleotide.

[0075] By utilizing a method for providing information on the diagnosis of cognitive impairment based on daily patterns, it is possible to measure the expression level of miR-10a-5p and compare it with that of normal individuals to determine the presence of hippocampal neuron aging, the stage of aging progression, and to predict or make an early diagnosis of cognitive impairment. Furthermore, if the expression level of the Camk2b gene is additionally measured in addition to miR-10a-5p and compared with that of normal individuals, results with higher precision and accuracy can be provided for the prediction, diagnosis, or assessment of the treatment course of the aforementioned diseases.

[0076] Another aspect is the step of treating a candidate substance to a biological sample isolated from an individual having a cognitive impairment disease; and

[0077] A screening method for a therapeutic agent for cognitive impairment disease is provided, comprising the step of measuring the expression level of miR-10a-5p in the biological sample.

[0078] The above "miR", "cognitive impairment disease", "diagnosis", "measurement", "expression level", "individual", "biological sample", etc. may be within the aforementioned range.

[0079] In one embodiment, the screening method for the therapeutic agent for the cognitive impairment disease may further include the step of measuring the expression level of the Camk2b gene in a biological sample isolated from an individual having the cognitive impairment disease.

[0080] Specifically, the step of measuring the expression level of the Camk2b gene may be performed at one point in time selected from the group consisting of: after the step of treating a biological sample isolated from an individual having a cognitive impairment disease with a candidate substance and before the step of measuring the expression level of miR-10a-5p in the biological sample; simultaneously with the step of measuring the expression level of miR-10a-5p in the biological sample; and after the step of measuring the expression level of miR-10a-5p in the biological sample. Specifically, it may be performed at one point in time selected from the group consisting of simultaneously with the step of measuring the expression level of miR-10a-5p in the biological sample and after the step of measuring the expression level of miR-10a-5p in the biological sample.

[0081] In one embodiment, the screening method for a cognitive impairment treatment may further include the step of selecting the candidate substance as a cognitive impairment treatment when the expression level of miR-10a-5p measured in a biological sample treated with the candidate substance is lower than the expression level of miR-10a-5p measured in a biological sample isolated from an individual having a cognitive impairment.

[0082] In one embodiment, the screening method for a cognitive impairment treatment may further include the step of selecting the candidate substance as a cognitive impairment treatment when the expression level of miR-10a-5p measured in a biological sample treated with the candidate substance is lower than the expression level of miR-10a-5p measured in a biological sample isolated from an individual having a cognitive impairment, and the expression level of the Camk2b gene measured in the biological sample treated with the candidate substance is higher than the expression level of the Camk2b gene measured in a biological sample isolated from an individual having a cognitive impairment.

[0083] That is, by utilizing the above screening method, if the expression level of miR-10a-5p in a biological sample treated with the above candidate substance is lower than that of an individual with the disease, the above candidate substance can be selected as a treatment for cognitive impairment.

[0084] In addition, by utilizing a screening method that further includes a step of measuring the expression level of the Camk2b gene, if the expression level of miR-10a-5p in the biological sample treated with the candidate substance is lower than that of the disease-carrying individual and the expression level of the Camk2b gene is higher than that of the disease-carrying individual, the candidate substance can be selected as a treatment for cognitive impairment.

[0085] By further including a step of comparing the expression levels of miR-10a-5p and Camk2b genes in biological samples of individuals with the aforementioned cognitive impairment disease and biological samples treated with candidate substances, results with higher accuracy and precision can be provided for the selection of agents that can be utilized for the prevention or treatment of hippocampal neuronal aging and the resulting cognitive impairment disease.

[0086] In one embodiment, the step of measuring the expression level may be performed using a preparation comprising a primer, probe, antisense oligonucleotide, antibody, antibody fragment, antibody mimic, aptamer, avidity multimer, peptidomimerics, peptide, or compound that specifically binds to the miR-10a-5p and / or Camk2b gene, and specifically, may be performed using a preparation comprising a primer, probe, or antisense oligonucleotide.

[0087] By using a screening method for cognitive impairment treatments based on daily patterns to identify agents that alter the expression levels of miR-10a-5p, it is possible to secure agents for the prevention or treatment of cognitive impairments caused by the aging of hippocampal neurons. Furthermore, if changes in the expression levels of the Camk2b gene are additionally measured alongside miR-10a-5p, results with higher accuracy and precision can be provided for the selection of agents that can be utilized for the prevention or treatment of hippocampal neuronal aging and the resulting cognitive impairments.

[0088] Another aspect provides a pharmaceutical composition for the prevention or treatment of cognitive impairment comprising a miR-10a-5p inhibitor.

[0089] The above "miR", "Camk2b", "cognitive impairment disease", etc. may be within the aforementioned range.

[0090] The term "prevention" may refer to any act of suppressing or delaying cognitive impairment in an individual through the administration of a pharmaceutical composition according to one aspect.

[0091] The term "treatment" may refer to any act in which symptoms of an individual's cognitive impairment are improved or beneficially altered by the administration of a pharmaceutical composition according to one aspect.

[0092] The above pharmaceutical composition is administered in a pharmaceutically effective amount. The term "pharmaceutically effective amount" means an amount sufficient to treat a disease with a reasonable benefit / risk ratio applicable to medical treatment, and the effective dose level may be determined based on factors including the type and severity of the patient's disease, drug activity, sensitivity to the drug, time of administration, route of administration and elimination rate, duration of treatment, concomitantly used drugs, and other factors well known in the medical field. The administration may be given once a day or divided into several doses. For example, it may be given every other day or once a week.

[0093] The term "administration" means introducing a specific substance into an individual by an appropriate method.

[0094] Additionally, the above pharmaceutical composition may be provided as a pharmaceutical composition comprising only an active ingredient, or comprising one or more pharmaceutically acceptable carriers, excipients, or diluents.

[0095] Specifically, the carrier may be, for example, a colloidal suspension, powder, saline solution, lipid, liposome, microsphere, or nano-spherical particle. These may form a complex with or be associated with a transport means and may be transported in vivo using a transport system known in the art, such as lipids, liposomes, microparticles, gold, nanoparticles, polymers, condensation agents, polysaccharides, polyamino acids, dendrimers, saponins, adsorption-enhancing substances, or fatty acids.

[0096] When the above pharmaceutical composition is formulated, it may be prepared using diluents or excipients such as commonly used lubricants, sweeteners, flavorings, emulsifiers, suspending agents, preservatives, fillers, volume expanders, binders, wetting agents, disintegrants, and surfactants. Solid dosage forms for oral administration may include tablets, pills, powders, granules, capsules, etc., and these solid dosage forms may be prepared by mixing at least one excipient, for example, starch, calcium carbonate, sucrose or lactose, gelatin, etc., with the above composition. In addition, lubricants such as magnesium stearate and talc may also be used in addition to simple excipients. Liquid formulations for oral administration include suspensions, oral liquids, emulsions, syrups, etc., and may contain various excipients, such as humectants, sweeteners, flavorings, and preservatives, in addition to commonly used simple diluents like water and liquid paraffin. Formulations for parenteral administration may include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized formulations, and suppositories. Propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used as non-aqueous solvents and suspensions. Witepsol, macrogol, Tween 61, cacao oil, laurin oil, glycerogelatin, etc. may be used as bases for suppositories, and known diluents or excipients may be used when manufactured in the form of ophthalmic preparations.

[0097] The above pharmaceutical composition may be administered orally or parenterally, and when administered parenterally, a method of injection may be selected, such as external application to the skin or intraperitoneal injection, rectal injection, subcutaneous injection, intravenous injection, intramuscular injection, intra-arterial injection, intramedullary injection, intracardiac injection, intrathecal injection, transdermal injection, nasal injection, enteral injection, local injection, sublingual injection, rectal injection, or thoracic injection.

[0098] In one embodiment, the pharmaceutical composition may further include other therapeutic agents for cognitive impairment diseases in addition to miR-10a-5p inhibitors.

[0099] The above-mentioned other therapeutic agents for cognitive impairment may be included in the above-mentioned pharmaceutical composition in the minimum amount to obtain maximum effect without side effects, which can be easily determined by a person skilled in the art.

[0100] In addition, in one embodiment, the pharmaceutical composition may be administered alone or in combination with other known treatments for cognitive impairment. That is, the pharmaceutical composition may be administered in conjunction with other treatments for cognitive impairment, and may be administered simultaneously, separately, or sequentially, and may be administered as a single or multiple doses.

[0101] When the above-mentioned other therapeutic agent for cognitive impairment is administered in combination with the above-mentioned pharmaceutical composition, it may be administered in an amount or ratio that can obtain maximum effect without side effects, and this can be easily determined by a person skilled in the art.

[0102] The other cognitive impairment treatment mentioned above may be a conventionally known cognitive impairment treatment or a newly developed cognitive impairment treatment.

[0103] The above-mentioned other treatments for cognitive impairment may include a Camk2b gene expression promoter.

[0104] In one embodiment, the pharmaceutical composition may further include an expression promoter for the Camk2b gene. Specifically, the promoter may exhibit a preventive or therapeutic effect against aging of hippocampal neurons and associated cognitive impairment by promoting the expression of one or more selected from the group consisting of the Camk2b gene, the polynucleotide encoded by the gene, and the polypeptide encoded by the gene.

[0105] In one embodiment, the miR-10a-5p inhibitor or Camk2b promoter may be one or more selected from the group consisting of polynucleotides, polypeptides, and compounds, specifically, one or more selected from the group consisting of antisense oligonucleotides, antagomir, ribozymes, aptamers, siRNA, miRNA, shRNA (short hairpin RNA), PNA (peptide nucleic acid), and LNA (locked nucleic acid).

[0106] The term "polynucleotide" includes oligonucleotides, DNA, RNA, analogs thereof, and derivatives thereof.

[0107] The term "antagomir" refers to a single-stranded, chemically modified oligonucleotide used for the silence of endogenous microRNA.

[0108] The term "ribozyme" refers to an enzymatic RNA molecule, meaning a nucleic acid molecule capable of catalyzing chemical reactions either intramolecularly or intermolecularly. Available ribozymes include all different types of ribozymes based on ribozymes found in natural systems that catalyze nucleases or nucleic acid polymerase-type reactions, as well as ribozymes engineered to catalyze specific biological reactions. Ribozymes can cleave RNA or DNA substrates, specifically RNA substrates. Ribozymes typically cleave nucleic acid substrates through recognition and binding to a target substrate, followed by cleavage; since this recognition is largely based on base pair interactions, they can possess the characteristic of enabling target-specific cleavage.

[0109] The term "PNA" refers to an artificially synthesized polymer similar to DNA or RNA; while DNA has a phosphate-ribose sugar backbone, PNA has a repeating N-(2-aminoethyl)-glycine backbone linked by peptide bonds, which can significantly increase binding affinity and stability to DNA or RNA of a target sequence.

[0110] The term "LNA" refers to a modified ribonucleotide that has a locked form by including an additional bridge between the 2' and 4' carbons of the ribose sugar site, and thus oligonucleotides with LNA have improved thermal stability.

[0111] In one embodiment, the miR-10a-5p inhibitor may increase the expression of the Camk2b (calcium / calmodulin dependent protein kinase II beta) gene. Therefore,

[0112] In one embodiment, the miR-10a-5p inhibitor may increase the dendritic spine density of hippocampal neurons.

[0113] A pharmaceutical composition for the prevention or treatment of cognitive impairment diseases comprising a miR-10a-5p inhibitor according to one aspect can prevent or treat cognitive impairment diseases caused by aging of hippocampal neurons by inhibiting the expression of miR-10a-5p and increasing the expression level of the Camk2b gene.

[0114] Furthermore, when utilizing a pharmaceutical composition that further includes a Camk2b gene expression promoter, the preventive or therapeutic effects against hippocampal neuronal aging and associated cognitive impairment can be enhanced.

[0115]

[0116] According to one aspect, accurate and rapid diagnosis of hippocampal aging and associated cognitive impairment is possible by measuring the expression levels of biomarkers including miR-10a-5p. Furthermore, utilizing biomarkers that additionally include the Camk2b gene enables a more accurate and precise diagnosis. By utilizing these biomarkers, it is possible to diagnose cognitive impairment and screen for therapeutic agents, and by regulating the expression levels of these biomarkers, they can be utilized for the prevention or treatment of cognitive impairment.

[0117]

[0118] Figure 1a is a figure showing a multidimensional scale plot for each age stage of the mouse hippocampus.

[0119] Figures 1b to 1d show changes in the differentially expressed miRNA expression patterns between age stages of six clusters calculated by K-means clustering.

[0120] Figure 1e is a figure showing the number of miRNAs at each age stage in the mouse hippocampus.

[0121] Figure 1f shows the results of quantitative RT-PCR verification of differentially expressed miR-10a-5p between the young and old stages.

[0122] Figure 2a is a microscopic view of the change in dendritic spine density of hippocampal neurons when treated with an SCR inhibitor or a miR-10a-5p inhibitor.

[0123] Figure 2b shows the density of dendritic spines of hippocampal neurons when treated with a miR-10a-5p inhibitor.

[0124] Figure 3a compares luciferase activity when miR-10a-5p was treated against wild-type (WT) and mutant (MUT) Camk2b 3'UTR in hippocampal neurons.

[0125] Figure 3b shows the change in Camk2b protein expression levels when miR-10a-5p inhibitors were treated in hippocampal neurons.

[0126] Figure 4a is a microscopic view of the change in dendritic spine density of hippocampal neurons when a mir-10a-5p inhibitor was applied to the Camk2b gene knocked down with siRNA.

[0127] Figure 4b shows the density of dendritic spines in hippocampal neurons when a mir-10a-5p inhibitor was applied to the Camk2b gene knocked down with siRNA.

[0128] Figure 4c shows the change in Camk2b protein expression levels due to aging measured through Western blot analysis.

[0129]

[0130] The present invention will be explained in more detail below through examples. However, these examples are intended to illustrate the invention and the scope of the invention is not limited to these examples.

[0131]

[0132] <Reference Example 1> Animal and tissue preparation

[0133] Wild-type male C57BL / 6J mice aged 3 months (3M; young stage), 12 months (12M; middle stage), and 24 months (24M; old stage) were obtained from the KRIBB-IACUC (Korea Research Institute of Bioscience and Biotechnology - Infectious Disease Care and Care Committee). Normal mice without signs of tumors or disease were sacrificed, and hippocampal tissues were immediately dissected and frozen using liquid nitrogen. Eight hippocampal tissues were obtained from four mice of each age group and analyzed. All animals were kept under specific pathogen-free conditions, and animal experiments were performed in accordance with guidelines approved by the KRIBB-IACUC.

[0134]

[0135] <Reference Example 2> RNA Preparation

[0136] RNA extraction and quality control were performed using standardized protocols. Frozen tissues were homogenized and thawed, followed by extraction with phenol. The RNA pellets were dissolved in nuclease-free water and stored at -80°C until use. RNA purity and concentration were analyzed using a NanoDrop 2000 spectrophotometer (Thermo Scientific).

[0137]

[0138] <Reference Example 3> MicroRNA (miRNA) Extraction and cDNA Library Construction

[0139] sRNA was extracted using the Pure Link Micro-to-Midi total RNA Purification System kit (Invitrogen) and the miRNeasy mini kit (Qiagen). sRNA from mouse hippocampal tissues at all stages was purified and prepared for Illumina sequencing according to the manufacturer's recommendations.

[0140] At each step, 10 µg of sRNA isolated from the hippocampal tissues of four rats was subjected to electrophoresis on a 15% TBE-urea PAGE gel. Fractions of lanes containing RNA molecules with sRNA lengths of 18 to 30 nucleotides were cut from the gel, RNA was extracted from them, and precipitated in ethanol. The isolated sRNA was reverse transcribed with attached 5' and 3' adapters. The obtained cDNA was PCR amplified using Illumina primers (Illumina Truseq kit), and the PCR amplification products were separated from the PAGE gel and precipitated in ethanol after electrophoresis. Each cDNA library was analyzed using Illumina sequencing technology.

[0141]

[0142] <Reference Example 4> Deep sequencing

[0143] To analyze miRNA sequences via next-generation sequencing (NGS), the miRNA profiles of mouse hippocampal tissue were analyzed using Illumina deep sequencing Hi-seq2000. Single-end sequencing was performed on the sRNA sample library with a read length of 50 nt across all age groups. The read results were aligned with raw sequences using Cufflink and Top-Hat software programs and mapped to the reference mouse genome (Mus_musculus.NCBIM37.55).

[0144] Raw data, which are reads for each miRNA, were normalized to RPM (Reads per million; number of miRNA reads / total number of reads for each sample x million). MiRNAs with fewer than 10 reads per sample were excluded, and 1 was added to the RPM value to facilitate log 2 transformation. The filtered data was log-transformed, and differentially expressed miRNAs among the 3, 12, and 24-month groups were determined by adjusting for fold change > |2|.

[0145]

[0146] <Reference Example 5> Quantitative RT-PCR Analysis

[0147] Total RNA was isolated from the mouse hippocampus using the TRIzol reagent (Invitrogen Life technologies), digested with DNase I, and then cDNA was synthesized by reverse transcribing mature miRNA using the PrimeScript™ RT reagent kit (Promega ImPromm-II Reverse Transcription system) and the Invitrogen NCode miRNA First strand cDNA module.

[0148] Quantitative RT-PCR was performed using the Bio-Rad real-time PCR system (CFX-96), and primers were designed using the Primer Blast interface and PrimerBank. All reactions were performed using SYBR ® The procedure was performed by dispensing two sets of Green Mix and respective forward and reverse primers (universal reverse primers for miRNA) into 96-well plates.

[0149]

[0150] <Reference Example 6> Western blot analysis

[0151] Western blots were performed on each hippocampal tissue sample according to the abcam® Western blot protocol. The sample tissues were lysed in RIPA buffer, the entire lysate was electrophoresed on SDS-PAGE, and then electrotransferred to a nitrocellulose membrane.

[0152] The blots were hybridized with a primary antibody prepared in Tris-buffered saline containing 5% dry milk, and then hybridized with a secondary antibody prepared in the same way. The hybridized bands were confirmed using an enhancement chemiluminescence (ECL) detection system. Tubulin (AbClon; AbC-2001) and CaMKII beta (abcam; ab34703) antibodies were used.

[0153]

[0154] <Reference Example 7> Plasmid Composition and Luciferase Analysis

[0155] The full-length 3'-UTR sequence of the wild-type (WT) or mutant (MUT; a form in which positions 546 to 553 of the Camk2b-3'UTR sequence in Mouse CAMK2B ENST00000502837.2 are mutated to GGAATATG (see Fig. 3a)) mouse Camk2b gene was amplified and then inserted into the NotI region of the double luciferase reporter plasmid pGL3. Camk2b gene mutations were produced using the PCR-based site-directed mutagenesis method with the primers listed in Table 1 below.

[0156] Sequence Name Sequence Number Sequence mmu-miR-10a-5p 1UACCCUGUAGAUCCGAAUUUGUG miR-10a-5p Mimic 2UACCCUGUAGAUCCGAAUUUGUG miR-10a-5p Inhibitor 3CACAAAUUCGGAUCUACAGGGUASCR Mimic 4UGAACAGUGUACGUACGAACCSCR Inhibitor 5GGUUCGUACGUACACUGUUCACamk2b-MF6GTTCCCTACCCATGGACGGAATATGAACATCTGCCACCCATGCamk2b-MR7CATGGGTGGCAGATGTTCATATTCCGTCCATGGGTAGGGAAC

[0157] To analyze the interaction between miR-10a-5p and Camk2b, hippocampal neurons were co-transfected with Lipofectamine 2000 (Invitrogen) using 50 nM miR-10a-5p mimics or 50 nM SCR mimics and 200 ng Camk2b-WT or 200 ng Camk2b-MUT. All transfections included 10 ng of Renilla luciferase (pRL-CMV) plasmid, and Renilla and firefly luciferase activities were measured 48 hours after transfection using the Dual-Luciferase Reporter Assay System (Promega, Madison, WI).

[0158]

[0159] <Example 1> Analysis of Hippocampal miRNA Expression Changes with Aging

[0160] (1) RNA-seq (NGS) analysis results of miRNA expression according to aging stage

[0161] To screen for factors that can regulate the aging of hippocampal neurons, miRNA expression in hippocampal neurons of mice at different growth stages (young, middle, and old stages) was analyzed.

[0162] According to Reference Examples 1 to 4, sRNA was extracted from mouse hippocampal tissue, a cDNA library was constructed, and deep sequencing was performed.

[0163] As a result, 159 differentially expressed miRNAs were found to have fold changes greater than |2| between each age stage.

[0164] Specifically, as shown in Fig. 1a, it was confirmed that the old age stage shows a distinct difference in miRNA expression profile compared to the other two stages (young age and middle age).

[0165] In addition, when differentially expressed miRNAs were grouped into 6 clusters for each age group, it was confirmed that when comparing the young and old stages, clusters 2 and 6 were downregulated in the old stage, as shown in Figure 1b, while clusters 1, 3, 4, and 5 were upregulated, resulting in 131 out of a total of 159 differentially expressed miRNAs being upregulated.

[0166] Therefore, as shown in the results of Figures 1a to 1d above, it was confirmed that miRNAs upregulated in the aging stage have a high correlation with the aging of hippocampal neurons.

[0167]

[0168] (2) Results of quantitative RT-PCR analysis of miRNA expression according to aging stage

[0169] In addition, to verify the results of the miRNA deep sequencing above, quantitative RT-PCR was performed according to Reference Example 5 to confirm the changes in differentially expressed miRNAs according to the aging stage.

[0170] As shown in Figure 1e, it was confirmed that 68 out of a total of 522 expressions were specifically upregulated in the aging stage.

[0171] Specifically, when differentially expressed miRNAs between the young and old stages were examined using a scattered volume plot, 100 miRNAs were upregulated more than twice as much in the hippocampus of the old stage compared to the young stage, while 21 miRNAs were downregulated more than twice as much, confirming that the number of miRNAs upregulated rather than downregulated with aging was greater.

[0172] In other words, quantitative RT-PCT results also indicated that the number of upregulated miRNAs significantly increases with hippocampal aging, suggesting that upregulated miRNAs may be associated with the regulation of hippocampal aging.

[0173] Accordingly, miRNAs with an expression multiple greater than │2│ between the young and old stages were randomly selected and qPCR was performed. As a result, it was confirmed that similar expression trends were observed between the qRT-PCR and RNA-seq analysis results (Fig. 1f), and it was verified that the RNA-seq analysis results reliably reflect the overall expression trend of miRNAs.

[0174]

[0175] <Example 2> Analysis of miRNA regulating dendritic spine density in hippocampal neurons

[0176] To find miRNAs capable of regulating hippocampal aging, 16 miRNAs with an expression multiple greater than │2│ between any two age groups were selected, and whether said miRNAs regulate dendritic spine density, which is known to be associated with synaptic plasticity of hippocampal neurons, was evaluated.

[0177] Changes in the density of the aforementioned dendritic spines were measured by the following method. Mouse hippocampal neurons were ectopically transfected on day 7 with a control group (Scrambled miRNA inhibitor; SCR inhibitor) and an inhibitor for miR-10a-5p, respectively, and cultured until day 24. Specifically, hippocampal neurons were fixed with 4% paraformaldehyde and cultured overnight. Afterward, they were washed with PBS and incubated at room temperature for 1 hour in Alexa 488-conjugated secondary antibody (Life Technologies Waltham). Transfected hippocampal neurons were identified using fluorescence microscopy and confocal laser scanning microscopy.

[0178] As shown in Figures 2a and 2b, the miR-10a-5p inhibitor increased the dendritic spines of hippocampal neurons by 60%, from 8.3 at 10 µm to 5.3 at 10 µm compared to the control group.

[0179] It was confirmed that miR-10a-5p is a factor that regulates the expression of dendritic spines in hippocampal neurons and that miR-10a-5p can play a role as a regulator of age-related changes in cognitive function.

[0180]

[0181] <Example 3> Correlation analysis of Camk2b and miR-10a-5p associated with hippocampal neuron aging

[0182] To confirm the specific mechanism of action of miR-10a-5p, target gene analysis was performed using Targetscan. Specifically, it was determined whether miR-10a-5p could specifically inhibit the expression of Camk2b, which was analyzed as a potential target gene known as a regulator of neuronal functions such as synaptic plasticity and neuronal differentiation. Western blot and luciferase analysis were performed according to References 6 and 7.

[0183] As shown in Fig. 3a, the expression of the luciferase-Camk2b 3'UTR reporter construct (hereinafter referred to as the Camk2b construct) was inhibited by the miR-10a-5p mimic. Additionally, when treated with the miR-10a-5p mimic, the luciferase activity of the Camk2b construct decreased by 55%, whereas the Camk2b mutant construct exhibiting a 6-nucleotide mismatch in the seed sequence did not show a significant change in luciferase activity.

[0184] Accordingly, to analyze the correlation between miR-10a-5p and Camk2b, treatment with a miR-10a-5p inhibitor resulted in, as shown in Figure 3b, a decrease of about 34% in Camk2b protein expression levels compared to the SCR mimic treatment group when transfected with a miR-10a-5p mimic, while an increase of 72% was observed when transfected with a miR-10a-5p inhibitor.

[0185] In other words, it was confirmed that miR-10a-5p targets the Camk2b gene in hippocampal neurons to regulate hippocampal neuronal aging.

[0186]

[0187] <Example 4> Analysis of Changes in Dendritic Spines of Hippocampal Neurons According to Camk2b Regulation

[0188] To determine whether changes in Camk2b gene expression affect the dendritic spines of hippocampal neurons, changes in the dendritic spines of hippocampal neurons were measured after knocking down the Camk2b gene.

[0189] Changes in dendritic spines were confirmed by transfecting the SCR inhibitor treatment group, Camk2b siRNA treatment group, Camk2b siRNA and SCR inhibitor treatment group, and Camk2b siRNA and miR-10a-5p inhibitor treatment group, respectively, in the same manner as in Example 2, and then examining the transfected hippocampal neurons using a fluorescence microscope and a confocal laser scanning microscope.

[0190] As shown in Figures 4a and 4b, in the Camk2b siRNA-treated group, which inhibited the expression of Camk2b, the dendritic spines of hippocampal neurons were 2.8 at 10 µm, a 47% decrease compared to the SCR inhibitor-treated group, which was 5.9 at 10 µm. In addition, it was confirmed that in the Camk2b siRNA and miR-10a-5p inhibitor-treated group, the dendritic spines were improved to the level of the SCR inhibitor-treated group compared to the Camk2b siRNA and SCR inhibitor-treated groups.

[0191] In other words, based on the above results confirming that the density of dendritic spines in hippocampal neurons, which was reduced due to decreased Camk2b protein expression, recovered to a level where Camk2b protein expression was not reduced upon treatment with a miR-10a-5p inhibitor, it was confirmed that miR-10a-5p can serve as a regulator of aging in hippocampal neurons.

[0192] In addition, to confirm the association of age-dependent Camk2b protein downregulation by miR-10a-5p, Camk2b protein expression patterns in the hippocampus of young and old mice were evaluated.

[0193] As shown in Figure 4c, the Camk2b protein expression level was significantly reduced by up to 46% in the hippocampus of older mice compared to the young stage.

[0194] In other words, considering that the expression of Camk2b protein is directly regulated by miR-10a-5p according to the results shown in Examples 3 and 4, the significant decrease in Camk2b protein expression in aging mice is associated with the upregulation of miR-10a-5p in the aged hippocampus, and accordingly, it was confirmed that miR-10a-5p inhibitors are important factors affecting the regulation of aging in hippocampal neurons.

Claims

1. Biomarker for diagnosing cognitive impairment diseases containing miR-10a-5p.

2. A biomarker for diagnosing cognitive impairment disease, wherein miR-10a-5p is a polynucleotide composed of the nucleotide sequence of SEQ ID NO.

1.

3. A biomarker for diagnosing cognitive impairment disease according to Claim 1, further comprising the Camk2b (calcium / calmodulin dependent protein kinase II beta) gene.

4. A biomarker for diagnosing a cognitive impairment disease according to claim 1, wherein the cognitive impairment disease is one or more selected from the group consisting of Alzheimer's disease, Pick's disease, Creutzfeldt-Jakob disease, Parkinson's disease, amyotrophic lateral sclerosis (ALS), and Huntington's disease.

5. A composition for diagnosing cognitive impairment diseases comprising a preparation for measuring the expression level of miR-10a-5p.

6. The composition for diagnosing cognitive impairment disease according to claim 5, wherein the composition for diagnosing cognitive impairment disease further comprises a preparation for measuring the expression level of the Camk2b gene.

7. In Claim 5, A composition for diagnosing cognitive impairment, wherein the above preparation comprises a primer, probe, antisense oligonucleotide, antibody, antibody fragment, antibody mimic, aptamer, avidity multimer, peptidomimerics, peptide, or compound that specifically binds to the miR-10a-5p.

8. A kit for diagnosing cognitive impairment comprising the composition of Claim 5.

9. A kit for diagnosing cognitive impairment, wherein the kit is a real-time PCR (RT-PCR) kit, a microarray kit, a protein chip kit, or a SAGE (Serial Analysis of Gene Expression) kit.

10. A step of measuring the expression level of miR-10a-5p in a biological sample isolated from an individual suspected of having a cognitive impairment disease; and A method for providing information for diagnosing a cognitive impairment disease, comprising the step of comparing the expression level of miR-10a-5p in an individual suspected of having the above-mentioned cognitive impairment disease with the expression level of miR-10a-5p in a biological sample isolated from a normal individual.

11. The method for providing information for diagnosing a cognitive impairment disease according to claim 10, further comprising the step of measuring the expression level of a Camk2b gene in a biological sample isolated from an individual suspected of having the cognitive impairment disease.

12. The method for providing information for diagnosing a cognitive impairment disease according to claim 10, further comprising the step of determining that an individual suspected of having a cognitive impairment disease has a cognitive impairment disease when the expression level of miR-10a-5p measured in a biological sample isolated from an individual suspected of having a cognitive impairment disease is higher than the expression level of miR-10a-5p measured in a biological sample isolated from a normal individual.

13. The method for providing information for diagnosing a cognitive impairment disease according to claim 11, wherein the method further comprises the step of determining that an individual suspected of having a cognitive impairment disease has a cognitive impairment disease when the expression level of miR-10a-5p measured in a biological sample isolated from an individual suspected of having a cognitive impairment disease is higher than the expression level of miR-10a-5p measured in a biological sample isolated from a normal individual, and the expression level of the Camk2b gene measured in a biological sample isolated from an individual suspected of having a cognitive impairment disease is lower than the expression level of the Camk2b gene measured in a biological sample isolated from a normal individual.

14. A method for providing information for diagnosing a cognitive impairment disease, wherein the biological sample of claim 10 is blood, plasma, serum, urine, mucus, saliva, tears, tissue, or cells.

15. A method for providing information for the diagnosis of a cognitive impairment disease, wherein the step of measuring the expression level according to claim 10 is to measure using one or more selected from the group consisting of RT-PCR, competitive RT-PCR, real-time RT-PCR, RNase protection assay (RPA), Northern blotting, DNA chip, Western blotting, ELISA, radioimmunoassay, radioimmunodiffusion, Ouchterlony immunodiffusion, rocket immunoelectrophoresis, immunohistochemical staining, immunoprecipitation assay, complement fixation assay, FACS, and protein chip.

16. A step of treating a biological sample isolated from an individual having a cognitive impairment disease with a candidate substance; and A screening method for a therapeutic agent for cognitive impairment disease comprising the step of measuring the expression level of miR-10a-5p in the biological sample.

17. The screening method for a cognitive impairment treatment according to claim 16, wherein the screening method further comprises the step of measuring the expression level of the Camk2b gene in a biological sample isolated from an individual having the cognitive impairment disease.

18. The screening method for a cognitive impairment treatment according to claim 16 further comprises the step of screening the candidate substance as a cognitive impairment treatment when the expression level of miR-10a-5p measured in a biological sample treated with the candidate substance is lower than the expression level of miR-10a-5p measured in a biological sample isolated from an individual having a cognitive impairment.

19. The screening method for a cognitive impairment disease treatment according to claim 17 further comprises the step of selecting a candidate substance as a cognitive impairment disease treatment when the expression level of miR-10a-5p measured in a biological sample treated with the candidate substance is lower than the expression level of miR-10a-5p measured in a biological sample isolated from an individual having a cognitive impairment disease, and the expression level of the Camk2b gene measured in a biological sample treated with the candidate substance is higher than the expression level of the Camk2b gene measured in a biological sample isolated from an individual having a cognitive impairment disease.

20. A pharmaceutical composition for the prevention or treatment of cognitive impairment comprising a miR-10a-5p inhibitor.

21. The pharmaceutical composition of claim 20, wherein the pharmaceutical composition further comprises a Camk2b gene expression promoter, for the prevention or treatment of cognitive impairment.

22. A pharmaceutical composition according to claim 20, wherein the miR-10a-5p inhibitor is one or more selected from the group consisting of polynucleotides, polypeptides, and compounds.

23. A pharmaceutical composition according to claim 20, wherein the miR-10a-5p inhibitor is one or more selected from the group consisting of antisense oligonucleotide, antagomir, ribozyme, aptamer, siRNA, miRNA, shRNA (short hairpin RNA), PNA (peptide nucleic acid) and LNA (locked nucleic acid).

24. A pharmaceutical composition according to claim 20, wherein the miR-10a-5p inhibitor increases the expression of the Camk2b (calcium / calmodulin dependent protein kinase II beta) gene.

25. A pharmaceutical composition according to claim 20, wherein the miR-10a-5p inhibitor increases the dendritic spine density of hippocampal neurons.

Images