Glyco-bridge and car-t cells comprising the same

Abstract

Provided herein are chimeric antigen receptor (CAR) T cells comprising modifications to enhance efficacy against certain cancers.

Description

GLYCO-BRIDGE AND CAR-T CELLS COMPRISING THE SAMERELATED APPLICATIONS

[0001] This application claims benefit under 35 U.S.C. § 119(e) to U.S. Provisional Application No. 63 / 694,715, filed September 13, 2024, entitled “CAR-T Cells Comprising a Glyco-Bridge”; U.S. Provisional Application No. 63 / 746,791, filed January 17, 2025, entitled “HPA-Based Chimeric Antigen Receptor”; and U.S. Provisional Application No. 63 / 746,853, filed January 17, 2025, entitled “Glyco-Bridge and CAR-T Cells Comprising the Same”, the entire contents of each of which are incorporated herein by reference.REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

[0002] The contents of the electronic sequence listing (M105370059WO00-SEQ-RE.xml; Size: 136,742 bytes; and Date of Creation: September 8, 2025) are herein incorporated by reference in its entirety.BACKGROUND

[0001] Chimeric antigen receptor T (CAR-T) cell therapy has revolutionized cancer treatment, particularly for hematologic malignancies. However, its application to solid tumors remains challenging.SUMMARY

[0002] The Tn antigen is a carbohydrate antigen overexpressed in various cancers, including breast, ovarian, bladder, pancreatic, prostate, lung, and stomach cancers. It is primarily overexpressed when T- synthase is degraded, silenced, or mutated, particularly due to defects in Cosme, which prevents protein misfolding of T-synthase. Loss of functional Cosme through mutation, deletion, or hypermethylation can also contribute to Tn antigen expression in some cancer cell lines and malignancies, such as pancreatic cancer. Furthermore, the initiating enzymes ppGalNAc-Ts may be abnormally expressed or mislocalized, with several isoforms, including Tl, T3, T6, and T13, reported to be elevated in human cancers. For example, overexpression of GalNAc-transferase (GalNAc-T3) has been shown to promote pancreatic cancer cell growth. A notable instance of this phenomenon is the Jurkat cell line, which has a1#14328154vlloss-of-function mutation in Cosme, leading to overexpression of the Tn antigen. As a result, Tn antigen serves as a potential biomarker for predicting or detecting human cancers early.

[0003] Mucl, a highly glycosylated transmembrane protein, is also overexpressed in various cancers, including breast cancer. A truncated form of Mucl, termed Tn antigen-Mucl (Tn- Mucl), is frequently overexpressed in breast cancer and has become the target of numerous therapeutic strategies. In particular, CAR-T cells targeting Tn-Mucl have demonstrated the ability to reduce tumor growth in triple-negative breast cancer. However, overexpression of Mucl thickens the cellular glycocalyx, impairing immune cell attack, including engineered immune cells such as CAR-T cell therapy. Given that conventional immune receptors are 20- 30 nm in size, the typical size of Mucl, which is around 100-200 nm, could limit the formation of immune synapses. Thus, by more effectively overcoming the glycocalyx barrier of cancer cells, it may enhance the induction of cell death.

[0004] Here, a strategy is shown that not only targets Mucl but also utilizes it as a binder. A structure, termed "glyco-bridge," has been engineered to bind Tn-Mucl or other Tn antigens (e.g., using one or more Helix pomatia agglutinin, HPA, lectins). The glyco-bridge is used in combination with CAR-T cells (e.g., anti-mesothelin CAR-T cells and anti-Tn CAR-T cells), thereby enhancing CAR-mediated killing. Additionally, CRISPR / Cas9 was utilized to knock out Cl GALT L creating a model with increased specificity for the Tn antigen structure. This effect was also mimicked using anti-fungal drug, called itraconazole, a C1GALT1 inhibitor, to confirm binding. To expand Tn antigen targeting, a new CAR provided herein was designed by replacing the scFv with one or more HPA lectins, which has high specificity for Tn structures. This new CAR demonstrates significant efficacy in Tn antigen-expressing models. Glyco-bridges of the disclosure also comprise HPA lectins to facilitate binding to Tn antigens.

[0005] Accordingly, some aspects of the disclosure provide a glycoprotein antigen receptor comprising an antigen-binding domain, a hinge / transmembrane domain, and an inactivated intracellular signaling domain.

[0006] In some embodiments, the hinge / transmembrane domain is a CD28 hinge / transmembrane domain. In some embodiments, the CD28 hinge / transmembrane domain comprises an amino acid sequence having at least 95% identity to the sequence of SEQ ID NO: 18. In some embodiments, the CD28 hinge / transmembrane domain comprises an amino acid sequence of SEQ ID NO: 18.

[0007] In some embodiments, the inactivated intracellular signaling domain is an inactivated CD28 intracellular signaling domain. In some embodiments, the inactivated CD28 intracellular2#14328154vlsignaling domain comprises an amino acid sequence having at least 95% identity to the sequence of SEQ ID NO: 19. In some embodiments, the inactivated CD28 intracellular signaling domain comprises an amino acid sequence of SEQ ID NO: 19.

[0008] In some embodiments, the antigen-binding domain comprises a Mucl binding domain. In some embodiments, the antigen-binding domain comprises a TnMucl binding domain. In some embodiments, the TnMucl binding domain is an anti-TnMucl scFv. In some embodiments, the TnMucl binding domain comprises: a variable heavy (VH) domain comprising a CDR-H1 of SEQ ID NO: 45, or a variant thereof; a CDR-H2 of SEQ ID NO: 46, or a variant thereof; and CDR-H3 of SEQ ID NO: 47, or a variant thereof; and / or a variable light (VL) domain comprising a CDR-L1 of SEQ ID NO: 48, or a variant thereof; a CDR-L2 of SEQ ID NO: 49, or a variant thereof; and CDR-L3 of SEQ ID NO: 50, or a variant thereof. In some embodiments, the TnMucl binding domain comprises a VH comprising an amino acid sequence having at least 90% identity to the sequence of SEQ ID NO: 43 and a VL comprising an amino acid sequence having at least 90% identity to the sequence of SEQ ID NO: 44. In some embodiments, the TnMucl binding domain comprises a VH comprising an amino acid sequence of SEQ ID NO: 43 and a VL comprising an amino acid sequence of SEQ ID NO: 44. In some embodiments, the anti-TnMucl scFv comprises an amino acid sequence having at least 95% identity to the sequence of SEQ ID NO: 17. In some embodiments, the anti-TnMucl scFv comprises an amino acid sequence of SEQ ID NO: 17.

[0009] In some embodiments, the glycoprotein antigen receptor comprises an amino acid sequence having at least 90% identity to the sequence of SEQ ID NO: 21. In some embodiments, the glycoprotein antigen receptor comprises an amino acid sequence of SEQ ID NO: 21.

[0010] In some embodiments, the antigen-binding domain comprises one or more HPA lectins. IN some embodiments, the antigen-binding domain comprises two HPA lectins. In some embodiments, the antigen-binding domain comprises three HPA lectins. In some embodiments, the one or more HPA lectins comprises the amino acid sequence of SEQ ID NO: 2. In some embodiments, the HPA lectins are linked by a linker.

[0011] In some embodiments, the glycoprotein antigen receptor comprises an amino acid sequence having at least 90% identity to the sequence of SEQ ID NO: 52 or 53. In some embodiments, the glycoprotein antigen receptor comprises an amino acid sequence of SEQ ID NO: 52 or 53.3#14328154vl

[0012] In some embodiments, the disclosure provides a cell comprising a glycoprotein antigen receptor described herein. In some embodiments, the cell is a human cell. In some embodiments, the human cell is an immune cell. In some embodiments, the immune cell is a T cell. In some embodiments, the immune cell is a natural killer (NK) cell.

[0013] In some aspects, the disclosure provides an immune cell comprising: (i) a chimeric antigen receptor (CAR) polypeptide; and (ii) a glycoprotein antigen receptor, wherein the glycoprotein antigen receptor comprises an antigen-binding domain, a hinge / transmembrane domain, and an inactivated intracellular signaling domain.

[0014] In some embodiments, the CAR polypeptide comprises one or more Helix pomatia agglutinin (HPA) lectins.

[0015] In some embodiments, the antigen-binding domain of the CAR polypeptide comprises a CD70-binding domain, CD27 or a portion thereof, a VEGF-binding domain, a CD19-binding domain, a mesothelin-binding domain, a TnMucl -binding domain, a CD79b-binding domain, a TACI-binding domain, a BCMA-binding domain, A Proliferation-Inducing Ligand (APRIL) or a portion thereof, a CD37-binding domain, a TRBC1 -binding domain, a TRBC2-binding domain, an EGER-binding domain, and / or an EGFR variant III (EGFRvIII)-binding domain. In some embodiments, the CAR polypeptide comprises an amino acid sequence having at least 90% identity to the amino acid sequence of any one of SEQ ID NOs: 39-42 or 73-114. In some embodiments, the CAR polypeptide comprises the amino acid sequence of any one of SEQ ID NOs: 39-42 or 73-114.

[0016] In some embodiments, the mesothelin binding domain comprises an anti-mesothelin scFv (e.g., as described in International Publication No. WO 2015 / 090230). In some embodiments, the anti-mesothelin scFv comprises a sequence having at least 90% identity to the sequence of SEQ ID NO: 55. In some embodiments, the anti-mesothelin scFv comprises a sequence of SEQ ID NO: 55. In some embodiments, the mesothelin binding domain comprises: (i) a VH domain comprising a CDR-H1 of SEQ ID NO: 25, or a variant thereof; a CDR-H2 of SEQ ID NO: 26, or a variant thereof; and a CDR-H3 of SEQ ID NO: 27, or a variant thereof; and a VL domain comprising a CDR-L1 of SEQ ID NO: 28, or a variant thereof; a CDR-L2 of SEQ ID NO: 29, or a variant thereof; and a CDR-L3 of SEQ ID NO: 30, or a variant thereof; or (ii) a VH domain comprising a CDR-H1 of SEQ ID NO: 33, or a variant thereof; a CDR-H2 of SEQ ID NO: 34, or a variant thereof; and a CDR-H3 of SEQ ID NO: 35, or a variant thereof; and a VL domain comprising a CDR-L1 of SEQ ID NO: 36, or a variant thereof; a CDR-L2 of SEQ ID NO: 37, or a variant thereof; and a CDR-L3 of SEQ ID NO: 38, or a variant thereof.4#14328154vl

[0017] In some embodiments, the mesothelin binding domain comprises: (i) a VH domain comprising an amino acid sequence having at least 90% identity to the sequence of SEQ ID NO: 23; and / or a VL domain comprising an amino acid sequence having at least 90% identity to the sequence of SEQ ID NO: 24; or (ii) a VH domain comprising an amino acid sequence having at least 90% identity to the sequence of SEQ ID NO: 31; and / or a VL domain comprising an amino acid sequence having at least 90% identity to the sequence of SEQ ID NO: 32.

[0018] In some embodiments, the mesothelin binding domain comprises: (i) a VH comprising an amino acid sequence of SEQ ID NO: 23 and a VL comprising an amino acid sequence of SEQ ID NO: 24; or (ii) a VH comprising an amino acid sequence of SEQ ID NO: 31 and a VL comprising an amino acid sequence of SEQ ID NO: 32.

[0019] In some embodiments, the antigen-binding domain of the glycoprotein antigen receptor comprises TnMucl binding domain. In some embodiments, the TnMucl binding domain is an anti-TnMucl scFv.

[0020] In some embodiments, the TnMucl binding domain comprises: a variable heavy (VH) domain comprising a CDR-H1 of SEQ ID NO: 45, or a variant thereof; a CDR-H2 of SEQ ID NO: 46, or a variant thereof; and CDR-H3 of SEQ ID NO: 47, or a variant thereof; and / or a variable light (VL) domain comprising a CDR-L1 of SEQ ID NO: 48, or a variant thereof; a CDR-L2 of SEQ ID NO: 49, or a variant thereof; and CDR-L3 of SEQ ID NO: 50, or a variant thereof.

[0021] In some embodiments, the TnMucl binding domain comprises a VH comprising an amino acid sequence having at least 90% identity to the sequence of SEQ ID NO: 43 and a VL comprising an amino acid sequence having at least 90% identity to the sequence of SEQ ID NO: 44.

[0022] In some embodiments, the TnMucl binding domain comprises a VH comprising an amino acid sequence of SEQ ID NO: 43 and a VL comprising an amino acid sequence of SEQ ID NO: 44.

[0023] In some embodiments, the anti-TnMucl scFv comprises an amino acid sequence having at least 95% identity to the sequence of SEQ ID NO: 17. In some embodiments, the anti- TnMucl scFv comprises an amino acid sequence of SEQ ID NO: 17.

[0024] In some embodiments, the antigen -binding domain of the glycoprotein antigen receptor comprises one or more HPA lectins. In some embodiments, each HPA lectin of the one or more HPA lectins comprises an amino acid sequence having at least 90% identity to the amino acid5#14328154vlsequence of SEQ ID NO: 2. In some embodiments, each HPA lectin of the one or more HP A lectins comprises an amino acid sequence of SEQ ID NO: 2. In some embodiments, the antigenbinding domain of the glycoprotein antigen receptor comprises two HPA lectins. In some embodiments, the antigen-binding domain of the glycoprotein antigen receptor comprises three HPA lectins. In some embodiments, the HPA lectins are linked by a linker.

[0025] In some embodiments of an immune cell, each HPA lectin of the one or more HPA lectins comprised in the CAR polypeptide comprises an amino acid sequence having at least 95% identity to the sequence of SEQ ID NO: 2. In some embodiments, each HPA lectin of the one or more HPA lectins comprises an amino acid sequence of SEQ ID NO: 2.

[0026] In some embodiments, the CAR polypeptide comprises two HPA lectins. In some embodiments, the CAR polypeptide comprises the amino acid sequence of SEQ ID NO: 14 or 15. In some embodiments, the CAR polypeptide comprises three HPA lectins. In some embodiments, the CAR polypeptide comprises the amino acid sequence of SEQ ID NO: 71 or 72.

[0027] In some embodiments, the HPA lectins are linked by a linker. In some embodiments, the linker is a glycine-serine linker. In some embodiments, the glycine-serine linker comprises an amino acid sequence of SEQ ID NO: 8.

[0028] In some embodiments, the hinge / transmembrane domain of the glycoprotein antigen receptor is a CD28 hinge / transmembrane domain. In some embodiments, the CD28 hinge / transmembrane domain comprises an amino acid sequence having at least 95% identity to the sequence of SEQ ID NO: 18. In some embodiments, the CD28 hinge / transmembrane domain comprises an amino acid sequence of SEQ ID NO: 18.

[0029] In some embodiments, the inactivated intracellular signaling domain is an inactivated CD28 intracellular signaling domain. In some embodiments, the inactivated CD28 intracellular signaling domain comprises an amino acid sequence having at least 95% identity to the sequence of SEQ ID NO: 19. In some embodiments, the inactivated CD28 intracellular signaling comprises an amino acid sequence of SEQ ID NO: 19.

[0030] In some embodiments, the CAR polypeptide comprises an amino acid sequence having at least 90% identity to the sequence of SEQ ID NO: 13, 15, 40, or 42. In some embodiments, the CAR polypeptide comprises an amino acid sequence of SEQ ID NO: 13, 15, 40, or 42.

[0031] In some embodiments, the glycoprotein antigen receptor comprises an amino acid sequence having at least 90% identity to the sequence of SEQ ID NO: 21. In some6#14328154vlembodiments, the glycoprotein antigen receptor comprises an amino acid sequence of SEQ ID NO: 21.

[0032] In some embodiments, the disclosure provides a nucleic acid encoding a glycoprotein antigen receptor described herein. In some embodiments, the disclosure provides a vector comprising a nucleic acid described herein. In some embodiments, the disclosure provides a pharmaceutical composition comprising an immune cell described herein or a cell described herein and a pharmaceutically acceptable excipient.

[0033] In some embodiments, the disclosure provides a method of treating a subject having cancer, the method comprising administering an immune cell described herein, a cell described herein, or a pharmaceutical composition described herein to the subject. In some embodiments, the cancer is a solid tumor. In some embodiments, the subject is a human.

[0034] In some aspects, the disclosure provides a method of treating a subject having cancer, the method comprising administering to the subject an immune cell comprising: (i) a chimeric antigen receptor (CAR) polypeptide; and (ii) a glycoprotein antigen receptor, wherein the glycoprotein antigen receptor comprises an antigen-binding domain, a hinge / transmembrane domain, and an inactivated intracellular signaling domain.

[0035] In some aspects, the disclosure provides a method of treating a subject having cancer, the method comprising administering to the subject an immune cell comprising a chimeric antigen receptor (CAR) polypeptide comprising one or more Helix pomatia agglutinin (HPA) lectins. In some embodiments, the cancer is a solid tumor.

[0036] In some aspects, the disclosure provides an immune cell comprising: (a) a chimeric antigen receptor (CAR) polypeptide comprising: (i) a mesothelin-binding domain; (ii) a CD8 hinge / transmembrane domain; (iii) a 4- IBB co- stimulatory domain; and (iv) a CD3z intracellular signaling domain; and (b) a glycoprotein antigen receptor comprising: (i) two Helix pomatia agglutinin (HPA) lectins; (ii) a CD8 hinge / transmembrane domain; and (iii) an inactivated CD28 intracellular signaling domain.

[0037] In some aspects, the disclosure provides an immune cell comprising: (a) a chimeric antigen receptor (CAR) polypeptide comprising: (i) a mesothelin-binding domain comprising a variable heavy (VH) domain and a variable light (VL) domain, wherein the VH domain comprises the amino acid sequence of SEQ ID NO: 23 or 31 and the VL domain comprises the amino acid sequence of SEQ ID NO: 24 or 32; (ii) a CD8 hinge / transmembrane domain comprising the amino acid sequence of SEQ ID NO: 3; (iii) a 4- IBB co- stimulatory domain comprising the amino acid sequence of SEQ ID NO: 4; and (iv) a CD3z intracellular signaling7#14328154vldomain comprising the amino acid sequence of SEQ ID NO: 5; and (b) a glycoprotein antigen receptor comprising: (i) two Helix pomatia agglutinin (HPA) lectins, wherein each HPA lectin comprises the amino acid sequence of SEQ ID NO: 2; (ii) a CD8 hinge / transmembrane domain comprising the amino acid sequence of SEQ ID NO: 3; and (iii) an inactivated CD28 intracellular signaling domain comprising the amino acid sequence of SEQ ID NO: 19.BRIEF DESCRIPTION OF THE DRAWINGS

[0038] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present disclosure, which can be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein. The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

[0039] FIGs. 1A-1M show enhancing CAR T cell efficacy by inducing Tn antigen expression. Fig. 1A shows a biosynthetic pathway for O-glycans. FIGs. 1B-1C show the relative Mucl and PODXL expression level on pancreatic cancer cell lines (FIG. IB) and multiple myeloma cell lines (FIG. 1C) from DepMap. FIG. ID is a schematic of Mesothelin- targeting CAR T cells with Glyco-Bridge; Glyco-Bridge contains scFv targeting Tn-Mucl or CD19, CD28 Hinge and transmembrane domain. FIG. IE shows the flow cytometry analysis of Glyco-Bridge surface levels on T cells using AEFA-Tag (left) and (G4S)3 linkers expression levels (right). FIG. IF shows the surface levels of recombinant CD19 protein on CAR T cells with CD 19 Bridges following CD 19 protein incubation at indicated dilutions. Results are mean ± s.d. of n = 3 technical replicates. FIG. 1G depicts a schematic of the biosynthetic pathway for Tn antigen. FIG. 1H shows the flow cytometry analysis of Tn-Mucl surface level on Capan- 2 and Capan-2 C1GAET1 KO cells. FIG. II shows representative cytotoxicity as assessed in a luciferase-based killing assay for 24 hours with the indicated CAR and Capan-2 Cl GAFT 1 KO cells from n = 2 biological replicates corresponding to two distinct human blood cell donors. Results are mean ± s.d. of n = 3 independent experimental replicates. FIG. 1J is a representative real-time cytotoxicity assay against Capan-2 C1GAET1 KO cells at a 1:1 E:T ratio (relative to day 0 tumor seeding) from n = 3 biological replicates corresponding to three distinct human blood cell donors. Results are mean ± s.d. of n = 3 independent experimental replicates. FIG. IK shows the surface level of Tn-Mucl on Capan-2 following itraconazole8#14328154vlincubation at the indicated concentrations for 48 hours. FIG. IL is the representative cytotoxicity as assessed in a luciferase-based killing assay for 24 hours with the indicated CAR and 2.5 pM itraconazole-treated Capan-2 cells from n = 2 biological replicates corresponding to two distinct human blood cell donors. Results are mean ± s.d. of n = 3 independent experimental replicates. FIG. IM shows a representative real-time cytotoxicity assay against 2.5 M itraconazole-treated Capan-2 cells at a 1:1 E:T ratio (relative to day 0 tumor seeding) from n = 3 biological replicates corresponding to three distinct human blood cell donors. Results are mean ± s.d. of n = 3 independent experimental replicates. In FIGs. IF, II, 1J, and IM, statistical analysis was performed by one-way ANOVA with Tukey’s post hoc tests. * p < 0.05, **p < 0.01.

[0040] FIGs. 2A-2F show in vivo validation of Mesothelin CAR T cells with Glyco-Bridge. FIG. 2A shows NOD.Cg-Prkdcscid I12rgtmlWjl / SzJ (NSG) mice were subcutaneously injected with 5 x 106 Capan-2 or Capan-2 C1GALT1 KO cells on day 0. The mice were future treated intraperitoneally with Itraconazole (40 mg / kg) once daily for 30 days. FIG. 2B shows the tumor growth curve for each condition (n = 5 mice). Results are mean ± s.d. FIG. 2C shows NSG mice were subcutaneously injected with 5 x 106 Capan-2 C1GALT1 KO cells on day - 14. On Day 0, 5 mice per group received 2.5 x 106 CAR T cells from the indicated Mesothelin CAR with Glyco-Bridge or Untransduced T cell (UTD). FIG. 2D shows the tumor growth curve for each condition (n = 5 mice). Results are mean ± s.d. FIG. 2E shows NSG mice were subcutaneously injected with 5 x 106 Capan-2 cells on day -14. On Day 0, at least 3 mice per group received 2.5 x 106 CAR T cells from the indicated Mesothelin CAR with Glyco-Bridge or untransduced T cell (UTD). The mice were treated intraperitoneally with Itraconazole (40 mg / kg) once daily for 30 days. FIG. 2F shows the tumor growth curve for each condition (at least n = 3 mice). In FIGs. 2D and 2F, statistical analysis was performed by one-way ANOVA with Tukey’s post hoc tests.

[0041] FIGs. 3A-3G show Glyco-Bridges activate CARs in a target antigen densitydependent manner. FIG. 3A depicts a schematic showing the mechanism of Glyco-Bridge. FIG. 3B shows the real-time cytotoxicity assay against RPMI 8226 cells and RPMI 8226 CD 19 overexpression cells with Mesothelin CAR T cells with CD 19 Bridge at a 1:1 E:T ratio (relative to day 0 tumor seeding). Results are mean ± s.d. of n = 3 independent experimental replicates. FIG. 3C shows the real-time cytotoxicity assay against Jeko-1 and Jeko-1 CD 19 knockdown cells with Mesothelin CAR T cells with Glyco-Bridge at a 1 : 1 E:T ratio (relative to day 0 tumor seeding). Results are mean ± s.d. of n = 3 independent experimental replicates. FIG. 3D is9#14328154vlrepresentative fluorescence images of Jeko-1 CBG-GFP following co-culture with indicated CAR T cells at a 1:1 E:T ratio. Scale bar, 1 mm. TnMucl Bridge and CD 19 Bridge only: Mesothelin CAR molecules were removed. FIG. 3E are cropped fluorescence images from (FIG. 3D) at day 1. Scale bar, 100 pm. FIG. 3F shows the real-time cytotoxicity assay against Jeko-1 with indicated CAR T cells at a 1:1 E:T ratio (relative to day 0 tumor seeding). Results are mean ± s.d. of n = 3 independent experimental replicates. FIG. 3G shows the real-time cytotoxicity assay against Capan-2 (top), Capan-2 CD19 overexpression (middle), Capan-2 C1GAET1 KO (bottom) with Glyco-Bridge only or UTD at a 1:1 E:T ratio (relative to day 0 tumor seeding). Results are mean ± s.d. of n = 3 independent experimental replicates. In FIG. 3B, 3C, and 3F, statistical analysis was performed by one-way ANOVA with Tukey’s post hoc tests.

[0042] FIG. 4A-4H are snail lectin HPA-based CAR T cells showing antitumor activity against Tn antigen-positive pancreatic tumor cell line. FIG. 4A depicts a schematic of the biosynthetic pathway for Tn antigen. HPA binds to Tn antigen structure. FIG. 4B are representative images of HPA lectin staining on pancreatic ductal adenocarcinoma (PDAC) tissue and normal pancreatic tissue. Scale bar, 100 pm. FIG. 4C show surface level of Tn antigen on Capan-2 following itraconazole incubation at the indicated concentrations for 48 hours. FIG. 4D is a schematic showing HPA-based CAR T cells; One or two HPA lectins were replaced with the scFv domain. FIG. 4E shows the flow cytometry analysis of CD69 expression on CAR T cells followed by the incubation with indicated target cells for 24 hours. Results are mean ± s.d. of n = 3 technical replicates. PMA-ionomycin were used as positive controls. FIG. 4F show the real-time cytotoxicity assay against indicated target cells with HPA-based CAR T cells at a 2:1 E:T ratio (relative to day 0 tumor seeding). Results are mean ± s.d. of n = 3 independent experimental replicates. FIG. 4G shows NSG mice were subcutaneously injected with 5 x 106 Capan-2 C1GAET1 KO cells on day -14. On Day 0, 5 mice per group received 0.5 x 106HPA-based CAR T cells from or Untransduced T cell (UTD). FIG. 4H show the tumor growth curve for each condition (n = 5 mice). Results are mean ± s.d. In FIGs. 4E, 4F, and 4H, statistical analysis was performed by one-way ANOVA with Tukey’s post hoc tests.

[0043] FIGs. 5A-5D shows CAR T cells with CD19-Bridge against CD19 overexpressed tumor cells. FIG. 5A shows surface level of CD19 on Capan-2, Capan-2 CD19 overexpression, RPMI 8226, and RPMI 8226 CD19 overexpression, and Jeko-1 cell lines. FIGs. 5B and 5C show the real-time cytotoxicity assay against Capan-2 and Capan-2 CD 19 overexpression cells (FIG. 5B) or RPMI 8226 and RPMI 8226 CD19 overexpression (FIG. 5C) with indicated CAR10#14328154vlT cells at a 1:1 E:T ratio (relative to day 0 tumor seeding). Results are mean ± s.d. of n = 3 independent experimental replicates. FIG. 5D shows the real-time cytotoxicity assay against Capan-2 CD19 overexpression and Jeko-1 with indicated MOI CAR T cells at a 1:1 E:T ratio (relative to day 0 tumor seeding). Results are mean ± s.d. of n = 3 independent experimental replicates. In FIGs. 5B-5D the statistical analysis was performed by one-way ANOVA with Tukey’s post hoc tests.

[0044] FIGs. 6A-6E relate to enhancing CAR-T cell efficacy by inducing Tn antigen expression. FIG. 6A is an exemplary schematic of mesothelin-targeting CAR-T cells with a glyco-bridge. FIG. 6B shows flow cytometry analysis of glyco-bridge surface expression on T cells using AEFA-Tag (left) and (G4S)3 linkers (right). FIG. 6C shows a representative realtime cytotoxicity assay against Capan-2 cells treated with 2.5 pM of itraconazole at a 1:1 E:t ratio (relative to day 0 tumor seeding) from n = 3 biological replicates corresponding to three distinct human blood cell donors. Results are mean ± s.d. of n = 3 independent experimental replicates. FIGs. 6D-6E show phenotypes (CD4+ v. CD8+, FIG. 6D; T cell subtypes, FIG. 6E) of CAR-T cells with Tn-Mucl bridge or CD 19 bridge.

[0045] FIGs. 7A-7H demonstrate in vivo validation of mesothelin CAR-T cells with a glyco- bridge. FIG. 7A shows a tumor growth curve for each mouse in the indicated group (n = 5 mice per group). FIG. 7B shows representative immunohistochemistry (IHC) images for Tn antigen in formalin-fixed, paraffin-embedded tumor specimens from mice injected with Capan-2, Capan-2 C1GALT1 KO, and Capan-2 with itraconazole treatment. Scale bar, 100 pm. FIGs. 7C-7E show tumor growth curves (left) and body weight change (right) for Capan-2 (FIG. 7C), Capan-2 C1GALT1 KO (FIG. 7D), and Capan-2 with itraconazole treatment (FIG. 7E). Results are mean ± s.e.m of n=5 mice. FIGs. 7F-7G show representative IHC images for CD3+ cells (T cells) in formalin-fixed, paraffin-embedded tumor specimens from mice injected with Capan-2 Cl GALT 1 KO and mesothelin-targeted CAR-T cells with Tn-Mucl bridge (FIG. 7F) or CD19 bridge (FIG. 7G). FIG. 7H shows quantification of infiltrating CD3+ cells in tumors of mice treated with mesothelin-targeted CAR-T cells using either a Tn-Mucl or CD 19 bridging strategy.

[0046] FIGs. 8A-8R demonstrate that glyco-bridge activates CARs in a target antigen density-dependent manner. FIG. 8A is an exemplary schematic showing a mechanism of glyco- bridge depending on the target antigen density of the glyco-bridge and corresponding CAR-T cell activity. FIG. 8B shows surface level expression of Tn-Mucl on RPMI 8226 cells following itraconazole incubation at the indicated concentrations for 48 hours. FIG. 8C shows11#14328154vlresults of a real-time cytotoxicity assay against RPMI 8226 cells with 0 or 2.5 uM itraconazole with mesothelin-targeted CAR-T cells with Tn-Mucl bridge or CD 19 bridge at a 1:1 E:T ratio (relative to day 0 tumor seeding). Results are mean ± s.d. of n = 3 independent experimental replicates. FIGs. 8D-8F show RPMI 8226 cells (FIG. 8D), RPMI 8226 cells expressing low CD19 (FIG. 8E), and RPMI 8226 cells expressing medium CD19 (FIG. 8F). Results are mean ± s.d. of n = 3 independent experimental replicates. FIG. 8G is the log number of CD19 molecules versus log of the normalized target cell GFP signal from FIGs. 8D-8F at 60 hours; best-fit line to a power-law model with slope = -0.16 and R2 = 0.6568. FIG. 8H shows surface level expression of CD19 on Jeko-1 clones. FIGs. 8I-8J show the results of a real-time cytotoxicity assay against Jeko-1 and Jeko-1 clone B cells with mesothelin-targeted CAR-T cells with Tn-Mucl bridge or CD 19 bridge at a 1:1 E:T ratio (relative to day 0 tumor seeding). Panels show Jeko-1 (FIG. 81) and Jeko-1 clone B (FIG. 8J). Results are mean ± s.d. of n = 3 independent experimental replicates. FIG. 8K is the log number of CD19 molecules versus the log of the normalized target cell GFP signal from FIGs. 8I-8J at 60 hours; best-fit line to a power-law model with slope = -0.74 and R2 = 0.6392. FIG. 8E is an exemplary schematic showing the deletion of CAR molecules. FIGs. 8M-8N show results of a real-time cytotoxicity assay against Capan-2 (FIG. 8M) and Jeko-1 (FIG. 8N) cells with either Tn-Mucl bridge or CD19 bridge only at a 1:1 E:T ratio (relative to day 0 tumor seeding). Results are mean ± s.d. of n = 3 independent experimental replicates. FIG. 80 is an exemplary schematic showing the deletion of scFv on CAR molecules. FIGs. 8P-8Q show results of a real-time cytotoxicity assay against Jeko-1 (FIG. 8P) and Jeko-1 clone B (FIG. 8Q) cells with either Tn-Mucl bridge or CD19 bridge only at a 1:1 E:T ratio (relative to day 0 tumor seeding). Results are mean ± s.d. of n = 3 independent experimental replicates. FIG. 8R shows a proposed relationship between glyco-bridge-mediated killing, target antigen density for the glyco-bridge, and binding affinity.

[0047] FIGs. 9A-9E relate to antitumor activity of snail lectin HPA-based CAR-T cells against Tn antigen-positive pancreatic tumor cell lines. FIG. 9A shows surface level of HP A binding on PDX1294 cells, Capan-2 C1GALT1 KO cells, and Capan-2 cells following itraconazole incubation at the indicated concentrations for 48 hours. FIG. 9B shows quantitative HPA binding on cells from FIG. 9A. Results are mean ± s.d. of n = 3 technical replicates. FIG. 9C is representative confocal images of Capan-2 cells, Capan-2 cells with 2.5 pM itraconazole, Capan-2 Cl GAFT 1 KO cells, PDX1294 cells labeled with HPA and Hoechst. Scale bar, 10 pm. FIG. 9D shows results of a real-time cytotoxicity assay against PDX1294 cells with indicated HPA-based CAR-T cells at a 0.5:1 E:T ratio (relative to day 0 tumor12#14328154vlseeding). Results are mean ± s.d. of n = 3 independent experimental replicates. In FIG. 9E, NSG mice were subcutaneously injected with 5 x 106Capan-2 C1GALT1 KO cells in day -14; on day 0, five mice per group received 2 x 106HPA-based CAR T cells (HPAx2) or untransduced (UTD) from n = 3 biological replicates corresponding to three distinct human blood cell donors. Body weight change (left) and survival percentage for HPA-based CAR-T cells or UTD for n = 5 mice.

[0048] FIGs. 10A-10G demonstrate that glyco-bridge with tandem HPAs show antitumor activity against pancreatic cancer patient-derived xenograft (PDX) models. FIG. 10A is a graphic representation of exemplary constructs used to make CARs with tandem HPA-based bridge. FIG. 10B is an exemplary schematic of mesothelin-targeting CAR-T cells with tandem HPA-based glyco-bridge. FIG. 10C shows flow cytometry analysis of (G4S)3 linker expression on T cells. FIG. 10D shows surface level of HPA binding on Jurkat cells, PDX1294 cells, and Capan-2 C1GALT1 KO cells. FIG. 10E shows results of a real-time cytotoxicity assay against Jurkat cells with indicated CAR-T cells at a 1:1 E:T ratio (relative to day 0 tumor seeding). Results are mean ± s.d. of n = 3 independent experimental replicates. In FIGs. 10F-10G, NSG mice were subcutaneously (s.c) injected with 5 x 106PDX1294 cells on day -14. On day 0, five mice per group received 2 x 106CAR-T cells with HPA bridge, CD 19 bridge, or UTD cells. Tumor growth curves (FIG. 10F) and body weight change (FIG. 10G) for PDX1294 cell models are shown. Results are mean ± s.e.m of n=5 mice.

[0049] FIGs. 11A-11D relate to mesothelin-targeted CAR-T cells with a CD19 bridge system. Relative secreted cytokine levels (IFN-y, FIG. 11A; GzmB, FIG. 11B; TNF-a, FIG. 11C; and IL-2, FIG. 1 ID) after coculture with Capan-2 wild-type, Capan-2 C1GALT1 KO and indicated CAR-T cells at a 1:1 E:T ratio. Results are mean ± s.d. of n = 3 biological replicates corresponding to three distinct human blood cell donors.

[0050] FIGs. 12A-12C relate to the effects of itraconazole treatment on Capan-2 cells. In FIG. 12A, NOD .Cg-PrkdcscldIl2r "nlWl' / SzJ (NSG) mice were subcutaneously injected with 5 x 106Capan-2 C1GALT1 KO cells on day -14. On Day 0, 5 mice per group received indicated dose of CAR T cells intravenously. FIG. 12B shows glow cytometry analysis of a2,3-linked sialic acid (MAL-2) or Core-I structure (PNA) on Capan-2 cell lines after treatment of indicated itraconazole treatment for 48 hours. FIG. 12C is a representative real-time cancer cell growth assay of Capan-2 wild-type cells cultured in media containing the indicated itraconazole concentration.13#14328154vl

[0051] FIGs. 13A-13F demonstrate that the glyco-bridge activates CARs intracellularly. FIG. 13A shows flow cytometry analysis of HPA lectin binding on RPMI 8226 cell line after treatment with the indicated itraconazole concentration for 48 hours. FIG. 13B shows flow cytometry analysis of T cell activation using NF AT Jurkat reporter cells after coculturing with Capan-2 or Capan-2 CD 19 OE cells, along with mesothelin-targeted CAR-T cells using a CD19 bridge or CD19 bridge only. Results are mean ± s.d. of n = 3 technical replicates. FIG. 13C show results of a real-time cytotoxicity assay against Capan-2 C1GALT1 KO cells with only Tn-Mucl bridge or CD 19 bridge at a 1:1 E:T ratio (relative to day 0 tumor seeding). Results are mean ± s.d. of n = 3 independent experimental replicates. FIG. 13D shows representative fluorescent images of mesothelin-overexpressing Jeko-1 GFP cells after coculturing with indicated CAR-T cells. Scale bar, 100 pm. FIG. 13E shows results of a realtime cytotoxicity assay against RPMI 8226 (left) and RPMI 8226 CD 19 high-expression (right) with ASS1 CAR-T cells with the indicated bridges at a 1:1 E:T ratio (relative to day 0 tumor seeding). Results are mean ± s.d. of n = 3 independent experimental replicates. FIG. 13F shows results of a real-time cytotoxicity assay against RPMI 8226 (left) and RPMI 8226 CD 19 high- expression (right) with ASS1 CAR-T cells with the indicated bridges at a 1:1 E:T ratio (relative to day 0 tumor seeding). Results are mean ± s.d. of n = 3 independent experimental replicates.

[0052] FIGs. 14A-14B relate to the activity of HPA-based CAR-T cells against Capan-2 C1GALT1 KO cells. FIG. 14A shows results of a real-time cytotoxicity assay against Capan-2 or Capan-2 Cl GALT 1 KO cells with HPA-based CAR-T cells at a 2: 1 E:T ratio (relative to day 0 tumor seeding). Results are mean ± s.d. of n = 3 independent experimental replicates. FIG. 14B shows results of a real-time cytotoxicity assay against PDX1294 cells with HPAxl or HPAx2 CAR-T cells at indicated E:T ratio (relative to day 0 tumor seeding). Results are mean ± s.d. of n = 3 independent experimental replicates.

[0053] FIGs. 15A- 15F relate to efficacy of glyco-bridges with tandem HPA lectins. FIG. 15A is an exemplary schematic of CAR-T cells with a tandem HPA bridge, showing expanded glycan targeting and reduced bridge-mediated activation. FIG. 15B shows flow cytometry analysis of mesothelin, HPA, MUC1, and Tn-MUCl expression on Capan-2 and PDX-derived cells (PDX1294, PDX1275, and PDX1391). FIGs. 15C-15E show real-time cytotoxicity assays against PDX-derived cells (FIG. 15C, PDX1294; FIG. 15D, PDS1275; FIG. 15E, PDX1319) with the indicated CAR-T cells as a 1: 1-2:1 E:T ratio (relative to day 0 tumor seeding). Results are mean ± s.d. of n = 3 independent experimental replicates. FIG. 15F shows the strength of interaction between PDX1294 cells and the indicated CAR-T cells. The percentage of total14#14328154vlCAR-T cells remaining bound to target cells as the acoustic force ramp is applied from 0 to 1,000 pN is shown. Results are mean ± s.e.m. of n = 3 independent measurements. For FIGs. 15C-15F, statistical analysis was performed by two-way ANOVA with correction for multiple comparisons.

[0054] FIGs. 16A-16G relate to in vivo efficacy of CAR-T cells bearing HPA-based glycobridges. FIG. 16A is a schematic of an exemplary experimental design; NSG mice were subcutaneously injected with 5 x 106Capan-2 Cl GALT 1 KO cells on day -14. On day 0, five mice per group received 2 x 106CAR-T cells with an HPA bridge, HPA-directed CAR-T cells, or untransduced (UTD) T cells. FIGs. 16B-16D show tumor growth curves (FIG. 16B), body weight change (FIG. 16C), and survival percentage (FIG. 16D) for a Capan-2 Cl GALT 1 KO model using cells obtained from Donor #1. Results are mean ± s.e.m of n = 5 mice. FIGs. 16E- 16G show tumor growth curves (FIG. 16E), body weight change (FIG. 16F), and survival percentage (FIG. 16G) for a Capan-2 Cl GALT 1 KO model using cells obtained from Donor #2. Results are mean ± s.e.m of n = 5 mice. For FIGs. 16B and 16E, statistical analysis was performed by two-way ANOVA with correction for multiple comparisons.

[0055] FIG. 17 shows representative IHC images for human CD3 staining comparing HPX 2x CAR-T cells and CAR-T cells bearing an HPA-based glyco-bridge across different organs from experiments relating to FIGs. 16A-16G.

[0056] FIGs. 18A-18D relate to efficacy of CAR-T cells expressing glyco-bridges in a PDX1294 model. FIG. 18A is a schematic of an exemplary experimental design; NSG mice were subcutaneously injected with 5 x 106PDX1294 cells on day -14. On day 0, five mice per group received 2 x 106CAR-T cells expressing a tandem HPA-based glyco-bridge, CAR-T cells expressing a CD 19 bridge, or UTD cells. FIGs. 18B-18D show tumor growth curves (FIG. 18B), body weight change (FIG. 18C), and survival percentage (FIG. 18D) for the PDX1294 model. Results are mean ± s.e.m. of n = 5 mice. For FIGs. 18B and 18D, statistical analysis was performed by two-way ANOVA with correction for multiple comparisons.

[0057] FIGs. 19A-19C demonstrate that glyco-bridges co-localize with CAR molecules. FIG. 19A is an exemplary schematic of CAR-T cells with glyco-bridges. The CARs lack an scFv and instead contain human CD33 as a non-binding domain, fused to mCherry for visualization. The glyco-bridge construct contains the CD19 scFv (FMC63) and is fused to sfGFP. FIGs. 19B-19C are confocal images with CAR-T cells containing sfGFP and mCherry only (FIG. 19B) and co-cultured with Capan-2 CD 19 OE cells showing location of CD33-CARs in the immune synapse (FIG. 19C). Scale bar = 10 pm.15#14328154vlDETAILED DESCRIPTION

[0058] The Tn antigen is a truncated O-linked glycan characterized by a GalNAc (N- acetylgalactos amine) residue attached to serine or threonine residues in glycoproteins. It is expressed due to aberrant glycosylation processes (e.g., as a result of T-synthase degradation) commonly observed in various solid tumor cancers such as breast, colon, and pancreatic cancers. As such, Tn antigen expression is associated with tumor progression, metastasis, and immune evasion, making it a hallmark of malignant transformation. Its restricted presence in healthy tissues and prevalence in tumors make it a promising target for cancer diagnostics and immunotherapy. However, anti-cancer therapeutics, such as chimeric antigen receptor (CAR)- T cell therapy, that target Tn-expressing glycoproteins typically utilize antibodies or antibody fragments (e.g., single-chain fragment variables, scFvs) that have high specificity for a single antigen, making them unsuitable for targeting a variety of cancers that express Tn on different glycoproteins. Accordingly, presented herein are CAR constructs and other constructs (e.g. , the “glyco-bridge”, described elsewhere herein) that utilize one or more Helix pomatia agglutinin (HPA) lectins, a natural ligand for which is Tn.One exemplary glycoprotein that is overexpressed in various cancers is Mucl, a transmembrane protein. Its truncated form, Tn antigen-Mucl (Tn-Mucl) is overexpressed in some cancers and has therefore previously served as a target for CAR-T therapy. However, overexpression of Mucl thickens the cellular glycocalyx, a highly-hydrated layer of carbohydrates that cover the cell membrane. The thickened glycocalyx can impair immune cell attack, including by CAR-T cells. Accordingly, provided herein is an engineered structure, termed “glyco-bridge”, that is engineered to bind to Tn-Mucl (e.g., via incorporation of an anti-Tn-Mucl scFv) or other Tn antigens (e.g., via incorporation of one or more HPA lectins), that is utilized alongside anti-mesothelin or anti-Tn CAR-T cells to enhance CAR-mediated killing. Additionally, CRISPR / Cas9 was utilized to knock out Cl GALT 7, creating a model with increased specificity for the Tn antigen structure. This effect was also mimicked using antifungal drug, called itraconazole, a C1GALT1 inhibitor, to confirm binding.Glyco-Bridge

[0059] In some aspects, the disclosure provides cells comprising a glyco-bridge. A glyco- bridge comprises a glycoprotein antigen receptor, wherein the glycoprotein antigen receptor16#14328154vldoes not have an intracellular domain or has a non-functional intracellular signaling domain (e.g., an intracellular signaling domain that does not transmit signals). A glycoprotein as used herein refers to a glycoprotein, a glycan, and / or a glycolipid.

[0060] In some embodiments, the glycoprotein antigen receptor does not comprise an intracellular domain. In some embodiments, a glycoprotein antigen receptor comprises an inactivated (e.g., non-functional) intracellular domain (e.g., an intracellular domain that does not transmit signals). In some embodiments, the glycoprotein antigen receptor comprises an inactivated (e.g., non-functional) transmembrane domain (e.g., a transmembrane domain that does not transmit signals from the outside of the cell to the inside of the cell). In some embodiments, the glycoprotein antigen receptor binds a glycoprotein (e.g., a glycoprotein, a glycan, and / or a glycolipid). In some embodiments, the glycoprotein antigen receptor binds (e.g. , targets) a cancer-associated glycoprotein (e.g. , a cancer-associated glycoprotein, a cancer- associated glycan, and / or a cancer-associated glycolipid). In some embodiments, the glycoprotein antigen receptor binds Tn antigen, Tn-Mucl, Mucl, Muc4, Mucl6, Mucl7, podocalyxin, sialyl Tn (STn) antigen, lewisb, sialyl lewisa, sialyl lewisx, lewisy, high-mannose oligosaccharides, ganglioside GD2, ganglioside GD3, fucosyl GM1, STn antigen, TF antigen, SLeA, SLeX, prostate-specific antigen (PSA), polysialic acid (PSA), human carcinoembryonic antigen (CEA), cancer antigen 125 (CA125), cancer antigen 15-3 (CA15-3), cancer antigen 19- 9 (CAI 9-9), and / or cancer antigen 27-29 (CA27-29). In some embodiments, the glycoprotein antigen receptor binds Tn-Mucl. In some embodiments, the glycoprotein antigen receptor binds podocalyxin.

[0061] In some embodiments, an antigen-binding domain is an anti-TnMucl antibody or fragment thereof. In some embodiments, an antigen-binding domain is an anti-TnMucl scFv. In some embodiments, a glycoprotein antigen receptor comprises an antigen-binding domain comprising an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 95%, at least 98%, or at least 99%) identity to the amino acid sequence of SEQ ID NO: 17. In some embodiments, a glycoprotein antigen receptor comprises an antigen-binding domain comprising an amino acid sequence of SEQ ID NO: 17. In some embodiments, a glycoprotein antigen receptor comprises an antigen-binding domain consisting of SEQ ID NO: 17.

[0062] In some embodiments, a glycoprotein antigen receptor comprises an antigen-binding domain comprising one or more Helix pomatia agglutinin (HPA) lectins. In some embodiments, each HPA lectin of the one or more HPA lectins comprises an amino acid sequence having at17#14328154vlleast 80% (e.g., at least 85%, at least 90%, at least 95%, at least 98%, or at least 99%) identity to the amino acid sequence of SEQ ID NO: 2. In some embodiments, each HPA lectin of the one or more HPA lectins comprises an amino acid sequence of SEQ ID NO: 2. In some embodiments, each HPA lectin of the one or more HPA lectins consists of SEQ ID NO: 2. In some embodiments, the antigen-binding domain comprises two HPA lectins. In some embodiments, the antigen-binding domain comprises three HPA lectins. In some embodiments, the antigen-binding domain comprises four HPA lectins. In some embodiments, the antigenbinding domain comprises five HPA lectins. In some embodiments, the antigen-binding domain comprises six HPA lectins. In some embodiments, the antigen-binding domain comprises seven HPA lectins. In some embodiments, the antigen-binding domain comprises eight HPA lectins. In some embodiments, the antigen-binding domain comprises nine HPA lectins. In some embodiments, the antigen-binding domain comprises ten HPA lectins. In some embodiments, the antigen-binding domain comprises no more than ten HPA lectins. In some embodiments, the antigen-binding domain comprises one to three HPA lectins. In some embodiments, the antigen-binding domain comprises one to four HPA lectins. In some embodiments, the antigenbinding domain comprises two to four HPA lectins. In some embodiments, the antigen-binding domain comprises two or more HPA lectins. In some embodiments, the antigen-binding domain comprises three or more HPA lectins.

[0063] In some embodiments, a glycoprotein antigen receptor comprises a hinge / transmembrane domain. In some embodiments, a glycoprotein antigen receptor comprises a hinge / transmembrane domain selected from the hinge / transmembrane domain of an alpha, beta or zeta chain of a T cell receptor, CD2, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, CD154, KIRDS2, 0X40, CD2, CD27, LFA-1 (CDlla, CD18), ICOS (CD278), 4-1BB (CD137), 4- 1BBL, GITR, CD40, BAFFR, HVEM (LIGHTR), SLAMF7, NKp80 (KLRFI), CD160, CD19, IL2R beta, IL2R gamma, IL7R a, ITGA1, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA- 6, CD49f, ITGAD, CDlld, ITGAE, CD103, ITGAL, CDlla, LFA-1, ITGAM, CDllb, ITGAX, CD 11c, ITGB1, CD29, ITGB2, CD 18, LFA-1, ITGB7, TNFR2, DNAM1 (CD226), SLAMF4 (CD244, 2B4), CD84, CD96 (Tactile), CEACAM1, CRT AM, Ly9 (CD229), CD160 (BY55), PSGL1, CD100 (SEMA4D), SLAMF6 (NTB-A, Lyl08), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD 162), LTBR, PAG / Cbp, NKp44, NKp30, NKp46, NKG2D, and / or NKG2C. In some embodiments, a glycoprotein antigen receptor comprises a CD8 hinge / transmembrane domain. In some embodiments, a glycoprotein antigen receptor18#14328154vlcomprises a hinge / transmembrane domain comprising an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 95%, at least 98%, or at least 99%) identity to the amino acid sequence of SEQ ID NO: 3. In some embodiments, a glycoprotein antigen receptor comprises a hinge / transmembrane domain comprising an amino acid sequence of SEQ ID NO: 3.

[0064] In some embodiments, a glycoprotein antigen receptor comprises an inactivated intracellular signaling domain. Any suitable intracellular domain modified (e.g.. via insertion, substitution, or deletion of an amino acid or amino acids) to inactivate intracellular signaling transduction can be used. In some embodiments, a glycoprotein antigen receptor comprises an inactivated intracellular signaling domain derived from an alpha, beta or zeta chain of a T cell receptor, CD2, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, CD154, KIRDS2, 0X40, CD2, CD27, LFA-1 (CDlla, CD18), ICOS (CD278), 4-1BB (CD137), 4-1BBL, GITR, CD40, BAFFR, HVEM (EIGHTR), SEAMF7, NKp80 (KERFI), CD160, CD19, IE2R beta, IE2R gamma, IE7R a, ITGA1, VEA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VEA-6, CD49f, ITGAD, CD lid, ITGAE, CD 103, ITGAE, CDlla, LFA-1, ITGAM, CDllb, ITGAX, CDllc, ITGB1, CD29, ITGB2, CD18, LFA-1, ITGB7, TNFR2, DNAM1 (CD226), SEAMF4 (CD244, 2B4), CD84, CD96 (Tactile), CEACAM1, CRT AM, Ey9 (CD229), CD160 (BY55), PSGE1, CD100 (SEMA4D), SEAMF6 (NTB-A, Lyl08), SEAM (SEAMF1, CD150, IPO-3), BEAME (SLAMF8), SELPLG (CD162), LTBR, PAG / Cbp, NKp44, NKp30, NKp46, NKG2D, and / or NKG2C. In some embodiments, a glycoprotein antigen receptor comprises an inactivated CD28 intracellular signaling domain. In some embodiments, a glycoprotein antigen receptor comprises an inactivated intracellular signaling domain comprising an amino acid sequence having at least 80% (e.g.. at least 85%, at least 90%, at least 95%, at least 98%, or at least 99%) to the amino acid sequence of SEQ ID NO: 19. In some embodiments, a glycoprotein antigen receptor comprises an inactivated intracellular signaling domain comprising an amino acid sequence of SEQ ID NO: 19. In some embodiments, a glycoprotein antigen receptor comprises an inactivated intracellular signaling domain consisting of an amino acid sequence of SEQ ID NO: 19.

[0065] In some embodiments, a glycoprotein antigen receptor comprises a hinge / transmembrane domain and an inactivated intracellular signaling domain, wherein the hinge / transmembrane domain and the inactivated intracellular signaling domain are derived from the same protein. In some embodiments, a glycoprotein antigen receptor comprises a hinge / transmembrane domain and an inactivated intracellular signaling domain, wherein the19#14328154vlhinge / transmembrane domain and the inactivated intracellular signaling domain are derived from different proteins.

[0066] In some embodiments, a glycoprotein antigen receptor comprises an amino acid sequence having at least 80% identity to the amino acid sequence of SEQ ID NO: 21. In some embodiments, a glycoprotein antigen receptor comprises an amino acid sequence having at least 85% identity to the amino acid sequence of SEQ ID NO: 21. In some embodiments, a glycoprotein antigen receptor comprises an amino acid sequence having at least 90% identity to the amino acid sequence of SEQ ID NO: 21. In some embodiments, a glycoprotein antigen receptor comprises an amino acid sequence having at least 95% identity to the amino acid sequence of SEQ ID NO: 21. In some embodiments, a glycoprotein antigen receptor comprises an amino acid sequence having at least 98% identity to the amino acid sequence of SEQ ID NO: 21. In some embodiments, a glycoprotein antigen receptor comprises an amino acid sequence having at least 99% identity to the amino acid sequence of SEQ ID NO: 21. In some embodiments, a glycoprotein antigen receptor comprises an amino acid sequence of SEQ ID NO: 21. In some embodiments, a glycoprotein antigen receptor consists of an amino acid sequence of SEQ ID NO: 21.

[0067] In some embodiments, a glycoprotein antigen receptor comprises an amino acid sequence having at least 80% identity to the amino acid sequence of SEQ ID NO: 52. In some embodiments, a glycoprotein antigen receptor comprises an amino acid sequence having at least 85% identity to the amino acid sequence of SEQ ID NO: 52. In some embodiments, a glycoprotein antigen receptor comprises an amino acid sequence having at least 90% identity to the amino acid sequence of SEQ ID NO: 52. In some embodiments, a glycoprotein antigen receptor comprises an amino acid sequence having at least 95% identity to the amino acid sequence of SEQ ID NO: 52. In some embodiments, a glycoprotein antigen receptor comprises an amino acid sequence having at least 98% identity to the amino acid sequence of SEQ ID NO: 52. In some embodiments, a glycoprotein antigen receptor comprises an amino acid sequence having at least 99% identity to the amino acid sequence of SEQ ID NO: 52. In some embodiments, a glycoprotein antigen receptor comprises an amino acid sequence of SEQ ID NO: 52. In some embodiments, a glycoprotein antigen receptor consists of an amino acid sequence of SEQ ID NO: 52.

[0068] In some embodiments, a glycoprotein antigen receptor comprises a tag. Tags are useful for identifying cells expressing a glycoprotein antigen receptor or evaluation expression levels of a glycoprotein antigen receptor. In some embodiments, a glycoprotein antigen receptor20#14328154vlcomprises an ALFA tag, a His tag, a myc tag, or a FLAG tag. In some embodiments, a glycoprotein antigen receptor comprises an ALFA tag. In some embodiments, a glycoprotein antigen receptor comprises an ALFA tag comprising an amino acid sequence of SEQ ID NO: 51.

[0069] By engineering CAR-T cells to express the glyco-bridge, which targets cancer- associated glycoproteins (e.g., Tn-Mucl, podocalyxin, and / or other Tn antigens, etc.), CAR-T cell recognition and binding to the glycocalyx is enhanced. In some embodiments, a glyco- bridge comprises an scFv (TnMucl or CD 19), a hinge / transmembrane domain, and an inactivated intracellular signaling domain, and it can include other target antigens as well. In some embodiments, a glyco-bridge comprises one or more HPA lectins, a hinge / transmembrane domain, and an inactivated intracellular signaling domain.

[0070] As illustrated in FIGs. 8A-8R, a glyco-bridge (e.g., a glycoprotein antigen receptor) can activate CAR molecules in a target antigen density-dependent manner. This combination of a glyco-bridge (e.g., a glycoprotein antigen receptor) and a CAR demonstrates that the efficacy of dual CAR constructs is not merely a result of having two CAR molecules, but rather from CAR activation through the interaction between the two receptors. Consequently, CAR activation can be induced by using a binding molecule without an ICD domain. In particular, binders that target glycoproteins, hyaluronic acid, and collagen — often found as tumor microenvironment (TME) components on the surface of cancer cells — can also enhance CAR signaling.Chimeric Antigen Receptors (CARs)Extracellular DomainsHPA-based CARs

[0071] Given that high expression of Tn antigen is a typical characteristic of cancer cells, a new CAR utilizing HPA lectin from Helix pomatia - which specifically binds to Tn antigen, an O-linked a-N-acetylgalactosamine (GalNAc) found on some glycoproteins - was created as a novel binder. By using tandem HPA instead of conventional scFv, higher CAR activation and CAR-mediated killing was achieved. This was demonstrated with high efficacy in Capan- 2 cells, a pancreatic ductal adenocarcinoma (PDAC) cell line that overexpresses Tn antigen, both in vitro and in vivo. Additionally, a new cell line was developed using C1GALT1 knockout to further enhance Tn antigen expression. Several lectin-based CARs have been developed, but21#14328154vlonly a few have demonstrated in vivo activity. Additionally, employing multiple tandem structures, rather than just a single H lectin domain or lectin, enhances the efficacy of these CARs.

[0072] Moreover, by combining the glyco-bridge with the newly developed HPA provides an advanced technology designed to recognize a broader range of Tn antigens and enhance CAR-mediated killing.

[0073] In some embodiments, a CAR comprises one or more HPA lectins. In some embodiments, the one or more HPA lectins are codon-optimized. In some embodiments, each HPA lectin of the one or more HPA lectins comprise an amino acid sequence having at least 80% (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99%) sequence identity to the amino acid sequence of SEQ ID NO: 2. In some embodiments, each HPA lectin of the one or more HPA lectins comprises an amino acid sequence of SEQ ID NO: 2. In some embodiments, each HPA lectin of the one or more HPA lectins consists of an amino acid sequence of SEQ ID NO: 2.

[0074] In some embodiments, a CAR comprises two HPA lectins. In some embodiments, the HPA lectins are linked by a linker. In some embodiment, linkers can include or be composed of flexible residues such as glycine and serine so that the adjacent protein domains are free to move relative to one another. Linker sequences may be from 2 to 100 amino acids, 5 to 50 amino acids, 10 to 15 amino acids, 15 to 20 amino acids, or 18 to 20 amino acids in length, and include any suitable linkers known in the art. For instance, linker sequences may include, but are not limited to, glycine / serine linkers, e.g., as described by Whitlow et al., Protein Eng. 6(8) : 989-95 , 1993; a linker sequence as described by Andris-Widhopf et al. , Cold Spring Harb. Protoc. 2011 (9), 2011; as well as linker sequences with added functionalities, e.g., an epitope tag or an encoding sequence containing Cre-Lox recombination site as described by Sblattero et al., Nat. Biotechnol. 18( l):75-80, 2000. Longer linkers may be used when it is desirable to ensure that two adjacent domains do not sterically interfere with one another. Linkers may be cleavable or non-cleavable. In some embodiments, the linker comprises an amino acid sequence of SEQ ID NO: 8. In some embodiments, the linker consists of an amino acid sequence of SEQ ID NO: 8.

[0075] In some embodiments, a CAR comprising one or more HPA lectins comprises an amino acid sequence having at least 80% identity to the amino acid sequence of SEQ ID NO: 13. In some embodiments, a CAR comprising one or more HPA lectins comprises an amino acid sequence having at least 85% identity to the amino acid sequence of SEQ ID NO: 13. In22#14328154vlsome embodiments, a CAR comprising one or more HPA lectins comprises an amino acid sequence having at least 90% identity to the amino acid sequence of SEQ ID NO: 13. In some embodiments, a CAR comprising one or more HPA lectins comprises an amino acid sequence having at least 95% identity to the amino acid sequence of SEQ ID NO: 13. In some embodiments, a CAR comprising one or more HPA lectins comprises an amino acid sequence having at least 98% identity to the amino acid sequence of SEQ ID NO: 13. In some embodiments, a CAR comprising one or more HPA lectins comprises an amino acid sequence of SEQ ID NO: 13. In some embodiments, a CAR comprising one or more HPA lectins consists of an amino acid sequence of SEQ ID NO: 13.

[0076] In some embodiments, a CAR comprising two HPA lectins comprises an amino acid sequence having at least 80% identity to the amino acid sequence of SEQ ID NO: 15. In some embodiments, a CAR comprising two HPA lectins comprises an amino acid sequence having at least 85% identity to the amino acid sequence of SEQ ID NO: 15. In some embodiments, a CAR comprising two HPA lectins comprises an amino acid sequence having at least 90% identity to the amino acid sequence of SEQ ID NO: 15. In some embodiments, a CAR comprising two HPA lectins comprises an amino acid sequence having at least 95% identity to the amino acid sequence of SEQ ID NO: 15. In some embodiments, a CAR comprising two HPA lectins comprises an amino acid sequence having at least 98% identity to the amino acid sequence of SEQ ID NO: 15.Other CARs

[0077] In some embodiments, the disclosure provides an immune cell comprising a CAR polypeptide (e.g., as described herein) and a glycoprotein antigen receptor provided herein. In some embodiments, a CAR polypeptide comprises an antigen-binding domain. In some embodiments, an antigen-binding domain comprises one or more of a CD70-binding domain, CD27 or a portion thereof, a VEGF-binding domain, a CD19-binding domain, a mesothelin- binding domain, a TnMucl -binding domain, a CD79b-binding domain, a TACI-binding domain, a BCMA-binding domain, A Proliferation-Inducing Ligand (APRIL) or a portion thereof, a CD37-binding domain, a TRBC1 -binding domain, a TRBC2-binding domain, an EGFR-binding domain, and / or an EGFR variant III (EGFRvIII) -binding domain.

[0078] In some embodiments, an immune cell comprising a glycoprotein antigen receptor comprises CAR comprising a CD70-binding domain. In some embodiments, a CD70-binding domain comprises CD27 or a portion thereof. In some embodiments, CD27 or a portion thereof 23#14328154vlcomprises the amino acid sequence of any one of SEQ ID NOs: 59 or 60-62. In some embodiments, a CAR comprising a CD70-binding domain comprises the amino acid sequence of any one of SEQ ID NOs: 97-102.

[0079] In some embodiments, an immune cell comprising a glycoprotein antigen receptor comprises a CAR comprising a VEGF-binding domain. In some embodiments, a VEGF- binding domain comprises a variable heavy (VH) complementarity determining region 1 (CDR-H1) comprising the amino acid sequence of SEQ ID NO: 64, a CDR-H2 comprising the amino acid sequence of SEQ ID NO: 65, a CDR-H3 comprising the amino acid sequence of SEQ ID NO: 66, and a variable light (VL) CDR 1 (CDR1-L1) comprising the amino acid sequence of SEQ ID NO: 67, a CDR-L2 comprising the amino acid sequence of SEQ ID NO: 68, and a CDR-L3 comprising the amino acid sequence of SEQ ID NO: 69. In some embodiments, a VEGF-binding domain comprises the amino acid sequence of SEQ ID NO: 70.

[0080] In some embodiments, an immune cell comprising a glycoprotein antigen receptor comprises a CAR comprising a CD19-binding domain. In some embodiments, a CD19-binding domain comprises the amino acid sequence of SEQ ID NO: 20. In some embodiments, a CAR comprising a CD19-binding domain comprises the amino acid sequence of SEQ ID NO: 114. In some embodiments, a CAR comprising a CD19-binding domain is an anti-CD19 CAR known in the art, including by not limited to a CD19-binding domain of Aucatzyl®, Kymriah®, Tecartus®, or Yescarta®. In some embodiments, a CD19-binding CAR is the CAR of Aucatzyl®, Kymriah®, Tecartus®, or Yescarta®.

[0081] In some embodiments, an immune cell comprising a glycoprotein antigen receptor comprises a CAR comprising a mesothelin-binding domain. In some embodiments, a mesothelin-binding domain comprises a VH domain comprising a CDR-H1 comprising the amino acid sequence of SEQ ID NO: 25, a CDR-H2 comprising the amino acid sequence of SEQ ID NO: 26, a CDR-H3 comprising the amino acid sequence of SEQ ID NO: 27, and a VL comprising a CDR-L1 comprising the amino acid sequence of SEQ ID NO: 28, a CDR-L2 comprising the amino acid sequence of SEQ ID NO: 29, and a CDR-L3 comprising the amino acid sequence of SEQ ID NO: 30. In some embodiments, a mesothelin-binding domain comprises a VH comprising the amino acid sequence of SEQ ID NO: 23 and a VL comprising the amino acid sequence of SEQ ID NO: 24. In some embodiments, a mesothelin-binding domain comprises the amino acid sequence of SEQ ID NO: 55. In some embodiments, a mesothelin-binding domain comprises a VH domain comprising a CDR-H1 comprising the24#14328154vlamino acid sequence of SEQ ID NO: 33, a CDR-H2 comprising the amino acid sequence of SEQ ID NO: 34, a CDR-H3 comprising the amino acid sequence of SEQ ID NO: 35, and a VL comprising a CDR-L1 comprising the amino acid sequence of SEQ ID NO: 36, a CDR-L2 comprising the amino acid sequence of SEQ ID NO: 37, and a CDR-L3 comprising the amino acid sequence of SEQ ID NO: 38. In some embodiments, a mesothelin-binding domain comprises a VH comprising the amino acid sequence of SEQ ID NO: 31 and a VL comprising the amino acid sequence of SEQ ID NO: 32. In some embodiments, a CAR comprising a mesothelin-binding domain comprises the amino acid sequence of any one of SEQ ID NOs: 39-42 or 73-76.

[0082] In some embodiments, an immune cell comprising a glycoprotein antigen receptor comprises a CAR comprising a TnMucl -binding domain. In some embodiments, a TnMucl - binding domain comprises a VH comprising a CDR-H1 comprising the amino acid sequence of SEQ ID NO: 45, a CDR-H2 comprising the amino acid sequence of SEQ ID NO: 46, a CDR- H3 comprising the amino acid sequence of SEQ ID NO: 47, and a VL comprising a CDR-L1 comprising the amino acid sequence of SEQ ID NO: 48, a CDR-L2 comprising the amino acid sequence of SEQ ID NO: 49, and a CDR-L3 comprising the amino acid sequence of SEQ ID ON: 50. In some embodiments, a TnMucl -binding domain comprises a VH comprising the amino acid sequence of SEQ ID NO: 43 and a VL comprising the amino acid sequence of SEQ ID NO: 44. In some embodiments, a TnMucl -binding domain comprises the amino acid sequence of SEQ ID NO: 17.

[0083] In some embodiments, an immune cell comprising a glycoprotein antigen receptor comprises a CAR comprising a CD79b-binding domain. In some embodiments, a CAR comprising a CD79b-binding domain comprises the amino acid sequence of SEQ ID NO: 80 or 81. In some embodiments, an immune cell comprising a glycoprotein antigen receptor comprises a CAR comprising a CD79b-binding domain and a CD19-binding domain. In some embodiments, a CAR comprising a CD79b-binding domain and a CD19-binding domain comprises the amino acid sequence of any one of SEQ ID NOs: 77-80.

[0084] In some embodiments, an immune cell comprising a glycoprotein antigen receptor comprises a CAR comprising a TACI-binding domain. In some embodiments, a CAR comprising a TACI-binding domain comprises the amino acid sequence of SEQ ID NO: 104 or 105.25#14328154vl

[0085] In some embodiments, an immune cell comprising a glycoprotein antigen receptor comprises a CAR comprising a BCMA-binding domain. In some embodiments, a CAR comprising a BCMA-binding domain comprises the amino acid sequence of SEQ ID NO: 103.

[0086] In some embodiments, an immune cell comprising a glycoprotein antigen receptor comprises a CAR comprising a BCMA-binding domain and a TACI-binding domain. In some embodiments, a CAR comprising a BCMA-binding domain and a TACI-binding domain comprises the amino acid sequence of any one of SEQ ID NOs: 106-113. In some embodiments, a CAR comprises one or more APRIL domains (e.g., truncated APRIL domains). In some embodiments, an APRIL domain comprises the amino acid sequence of SEQ ID NO: 115. In some embodiments, a CAR comprising an APRIL domain comprises the amino acid sequence of any one of SEQ ID NOs: 83-86. In some embodiments, a CAR comprises three APRIL domains (e.g., truncated APRIL domains). In some embodiments, a CAR comprising three APRIL domains comprises the amino acid sequence of SEQ ID NO: 93 or 94.

[0087] In some embodiments, an immune cell comprising a glycoprotein antigen receptor comprises a CAR comprising a CD37-binding domain. In some embodiments, a CAR comprising a CD37-binding domain comprises the amino acid sequence of SEQ ID NO: 87 or 88. In some embodiments, a CAR comprising a CD37-binding domain further comprises a CD19-binding domain. In some embodiments, a CAR comprising a CD37-binding domain and a CD19-binding domain comprises the amino acid sequence of SEQ ID NO: 89 or 90.

[0088] In some embodiments, an immune cell comprising a glycoprotein antigen receptor comprises a CAR comprising a TRBCl-binding domain. In some embodiments, a CAR comprising a TRBCl-binding domain comprises the amino acid sequence of SEQ ID NO: 91.

[0089] In some embodiments, an immune cell comprising a glycoprotein antigen receptor comprises a CAR comprising a TRBC2-binding domain. In some embodiments, a CAR comprising a TRBC2-binding domain comprises the amino acid sequence of SEQ ID NO: 92.

[0090] In some embodiments, an immune cell comprising a glycoprotein antigen receptor comprises a CAR comprising an EGFRvIII-binding domain. In some embodiments, a CAR comprising an EGFRvIII-binding domain comprises the amino acid sequence of SEQ ID NO: 95 or 96.Hinge and. Transmembrane Domains26#14328154vl

[0091] In some embodiments, a CAR polypeptide comprises a transmembrane domain, or a hinge / transmembrane domain, which joins the extra-cellular binding domain to the intracellular signaling domain. The binding domain of the CAR is, in some embodiments, followed by one or more "hinge domains," which plays a role in positioning the extra-cellular binding domain away from the effector cell surface to enable proper cell / cell contact, antigen binding (by the extra-cellular binding domain) and activation. A CAR may include one or more hinge domains between the binding domain and the transmembrane domain (TM). The hinge domain may be derived either from a natural, synthetic, semi- synthetic, or recombinant source. The hinge domain may include the amino acid sequence of a naturally occurring immunoglobulin hinge region or an altered immunoglobulin hinge region. Illustrative hinge domains suitable for use in the CARs described herein include the hinge region derived from the extracellular regions of type 1 membrane proteins such as CD8 (e.g., CD8alpha), CD4, CD28, 4- IBB, and CD7, which may be wild-type hinge regions from these molecules or may be altered. In some embodiments, the CAR comprises polynucleotide encoding CD8alpha hinge / transmembrane domain.

[0092] In some embodiments, the hinge region is derived from the hinge region of an immunoglobulin like protein (e.g., IgA, IgD, IgE, IgG, or IgM), CD28, or CD8. In some embodiments, the hinge domain includes a CD8a hinge region.

[0093] As used herein, "transmembrane domain" (TM domain) refers to the portion of the CAR that fuses the extracellular binding portion, in some embodiments via a hinge domain, to the intracellular portion (e.g., the costimulatory domain and intracellular signaling domain) and anchors the CAR to the plasma membrane of the immune effector cell. The transmembrane domain is a generally hydrophobic region of the CAR, which crosses the plasma membrane of a cell. The TM domain can be the transmembrane region or fragment thereof of a transmembrane protein (for example a Type I transmembrane protein or other transmembrane protein), an artificial hydrophobic sequence, or a combination thereof. While specific examples are provided herein and used herein, other transmembrane domains will be apparent to those of skill in the art and can be used in connection with alternate embodiments of the technology. A selected transmembrane region or fragment thereof would preferably not interfere with the intended function of the CAR.

[0094] As used in relation to a transmembrane domain of a protein or polypeptide, "fragment thereof" refers to a portion of a transmembrane domain that is sufficient to anchor or attach a protein to a cell surface.27#14328154vl

[0095] In some embodiments, the transmembrane domain or fragment thereof of the CAR described herein includes a transmembrane domain selected from the transmembrane domain of an alpha, beta or zeta chain of a T cell receptor, CD2, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, CD154, KIRDS2, 0X40, CD2, CD27, LFA-1 (CDlla, CD18), ICOS (CD278), 4-1BB (CD137), 4- 1BBL, GITR, CD40, BAFFR, HVEM (LIGHTR), SLAMF7, NKp80 (KLRFI), CD160, CD19, IL2R beta, IL2R gamma, IL7R a, ITGA1, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA- 6, CD49f, ITGAD, CDlld, ITGAE, CD103, ITGAL, CDlla, LFA-1, ITGAM, CDllb, ITGAX, CD 11c, ITGB1, CD29, ITGB2, CD 18, LFA-1, ITGB7, TNFR2, DNAM1 (CD226), SLAMF4 (CD244, 2B4), CD84, CD96 (Tactile), CEACAM1, CRT AM, Ly9 (CD229), CD160 (BY55), PSGL1, CD100 (SEMA4D), SLAMF6 (NTB-A, Lyl08), SLAM (SLAME1, CD150, IPO-3), BLAME (SLAME8), SELPLG (CD 162), LTBR, PAG / Cbp, NKp44, NKp30, NKp46, NKG2D, and / or NKG2C.

[0096] In some embodiments, a CAR polypeptide comprises a transmembrane domain having at least 80% (e.g., at least 85%, at least 90%, at least 95%, at least 98%, or at least 99%) identity to the sequence of SEQ ID NO: 3. In some embodiments, a CAR polypeptide comprises a transmembrane domain comprising an amino acid sequence of SEQ ID NO: 3. In some embodiments, a CAR polypeptide comprises a transmembrane domain consisting of an amino acid sequence of SEQ ID NO: 3.

[0097] In some embodiments, a CAR polypeptide comprises a transmembrane domain having at least 80% (e.g., at least 85%, at least 90%, at least 95%, at least 98%, or at least 99%) identity to the sequence of SEQ ID NO: 18. In some embodiments, a CAR polypeptide comprises a transmembrane domain comprising an amino acid sequence of SEQ ID NO: 18. In some embodiments, a CAR polypeptide comprises a transmembrane domain consisting of an amino acid sequence of SEQ ID NO: 18.

[0098] As used herein, a "hinge / transmembrane domain" refers to a domain including both a hinge domain and a transmembrane domain. For example, a hinge / transmembrane domain can be derived from the hinge / transmembrane domain of CD8, CD28, CD7, or 4- IBB. In some embodiments, the hinge / transmembrane domain of a CAR or fragment thereof is derived from or includes the hinge / transmembrane domain of CD8. CD8 is an antigen preferentially found on the cell surface of cytotoxic T lymphocytes. CD8 mediates cell-cell interactions within the immune system, and acts as a T cell co-receptor. CD8 consists of an alpha (CD8alpha or CD8a) and beta (CD813 or CD8b) chain. CD8a sequences are known for a number of species, e.g.,28#14328154vlhuman CD8a, (NCBI Gene ID: 925) polypeptide (e.g., NCBI Ref Seq NP 001139345.1) and mRNA (e.g., NCBI Ref Seq NM_ 000002.12). CD8 can refer to human CD8, including naturally occurring variants, molecules, and alleles thereof. In some embodiments of any of the aspects, e.g., in veterinary applications, CD8 can refer to the CD8 of, e.g., dog, cat, cow, horse, pig, and the like.

[0099] Homologs and / or orthologs of human CD8 are readily identified for such species by one of skill in the art, e.g., using the NCBI ortholog search function or searching available sequence data for a given species for sequence similar to a reference CD8 sequence.Co-stimulatory Domains

[0100] Each CAR described herein optionally includes the intracellular domain of one or more co-stimulatory molecule or co- stimulatory domain. As used herein, the term "co-stimulatory domain" refers to an intracellular signaling domain of a co-stimulatory molecule. Co- stimulatory molecules are cell surface molecules other than antigen receptors or Fe receptors that provide a second signal required for efficient activation and function of T lymphocytes upon binding to antigen. The co-stimulatory domain can be, for example, the co-stimulatory domain of 4- IBB, CD27, CD28, or 0X40. Additional illustrative examples of such co- stimulatory molecules include CARD11, CD2, CD7, CD27, CD28, CD30, CD40, CD54 (ICAM), CD83, CD134 (0X40), CD137 (4-1BB), CD150 (SLAMF1), CD152 (CTLA4), CD223 (LAG3), CD270 (HVEM), CD273 (PD-L2), CD274 (PD-L1), CD278 (ICOS), DAP10, LAT, NKD2C SLP76, TRIM, and ZAP70. In some embodiments, the intracellular domain is the intracellular domain of 4-1BB. 4-1BB (CD137; TNFRS9) is an activation induced costimulatory molecule and is an important regulator of immune responses.

[0101] 4-1BB is a membrane receptor protein, also known as CD137, which is a member of the tumor necrosis factor (TNF) receptor superfamily. 4- IBB is expressed on activated T lymphocytes. 4- IBB sequences are known for a number of species, e.g., human 4-1 BB, also known as TNFRSF9 (NCBI Gene 25 ID: 3604) and mRNA (NCBI Reference Sequence: NM_001561.5). 4-1BB can refer to human 4-1BB, including naturally occurring variants, molecules, and alleles thereof. In some embodiments of any of the aspects, e.g., in veterinary applications, 4-1BB can refer to the 4-1BB of, e.g., dog, cat, cow, horse, pig, and the like. Homologs and / or orthologs of human 4- IBB are readily identified for such species by one of skill in the art, e.g., using the NCBI ortholog search function or searching available sequence data for a given species for sequence similar to a reference 4-1 BB sequence.29#14328154vl

[0102] In some embodiments, the CAR comprises a 4- IBB co-stimulatory domain. In some embodiments, the 4- IBB co-stimulatory domain comprises an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 95%, at least 98%, or at least 99%) identity to the sequence of SEQ ID NO: 4. In some embodiments, the 4- IBB co-stimulatory domain comprises an amino acid sequence of SEQ ID NO: 4.Intracellular Signaling Domains

[0103] The properties of the intracellular signaling domain(s) of the CAR can vary as known in the art and as disclosed herein, but the chimeric target / extra- cellular binding domains(s) render the receptor sensitive to signaling activation when the chimeric target / extra-cellular binding domain binds the target / antigen on the surface of a targeted cell.

[0104] With respect to intracellular signaling domains, so-called "first-generation" CARs include those that solely provide CD3^ signals upon antigen binding by the extra-cellular binding domain. So-called "second-generation" CARs include those that provide both costimulation (e.g., CD28 or CD137) and activation (CD3^) domains, and so-called "third- generation" CARs include those that provide multiple costimulatory (e.g., CD28 and CD137) domains and activation domains (e.g., CD3^). In various embodiments, the CAR is selected to have high affinity or avidity for the target / antigen - for example, antibody-derived target or extra-cellular binding domains will generally have higher affinity and / or avidity for the target antigen than would a naturally occurring T cell receptor. This property, combined with the high specificity one can select for an antibody provides highly specific T cell targeting by CAR-T cells.

[0105] CARs as described herein include an intracellular signaling domain. An "intracellular signaling domain" refers to the part of a CAR polypeptide that participates in transducing the message of effective CAR binding to a target antigen into the interior of the immune effector cell to elicit effector cell function, e.g., activation, cytokine production, proliferation and cytotoxic activity, including the release of cytotoxic factors to the CAR-bound target cell, or other cellular responses elicited following antigen binding to the extracellular CAR domain. In various examples, the intracellular signaling domain is from CD3^ (see, e.g., below). Additional non-limiting examples of immunoreceptor tyrosine-based activation motif (ITAM)- containing intracellular signaling domains that are of particular use in the technology include30#14328154vlthose derived from TCR^, FcRy, FcRp, CD3y, CD30, CD3o, CD3r|, CD3e, CD3^, CD22, CD79a, CD79b, and CD66d.

[0106] CD3 is a T cell co-receptor that facilitates T lymphocyte activation when simultaneously engaged with the appropriate co- stimulation (e.g., binding of a co- stimulatory molecule). A CD3 complex consists of 4 distinct chains; mammalian CD3 consists of a CD3y chain, a CD38 chain, and two CD3e chains.

[0107] These chains associate with a molecule known as the T cell receptor (TCR) and the CD3^ to generate an activation signal in T lymphocytes. A complete TCR complex includes a TCR, CD3^, and the complete CD3 complex.

[0108] In some embodiments of any aspect, a CAR polypeptide described herein includes an intracellular signaling domain that includes an Immunoreceptor Tyrosine-based Activation Motif or ITAM from CD3^, including variants of CD3^ such as ITAM-mutated CD3^, CD3r|, or CD30. In some embodiments of any aspect, the ITAM includes three motifs of ITAM of CD3^ (ITAM3). In some embodiments of any aspect, the three motifs of ITAM of CD3^ are not mutated and, therefore, include native or wild- type sequences.

[0109] In some embodiments, a CAR comprises a CD3^ intracellular signaling domain. In some embodiments, the CD3^ intracellular signaling domain comprises an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 95%, at least 98%, or at least 99%) identity to the amino acid sequence of SEQ ID NO: 5. In some embodiments, a CAR comprises a CD3^ intracellular signaling domain comprising an amino acid sequence of SEQ ID NO: 5.

[0110] A more detailed description of CARs and CAR-T cells can be found in Maus et al. , Blood 123:2624-2635, 2014; Reardon et al., Neuro-Oncology 16:1441-1458, 2014; Hoyos et al., Haematologica 97: 1622, 2012; Byrd et al., J. Clin. Oncol. 32:3039-3047, 2014; Maher et al. , Cancer Res 69:4559-4562, 2009; and Tamada etal., Clin. Cancer Res. 18:6436-6445, 2012.Methods of Treatment

[0111] In some aspects, this disclosure describes a method of treating cancer in a subject, the method comprising administering a cell described herein (e.g., an immune cell comprising a CAR and a glycoprotein antigen receptor and / or an immune cell comprising a CAR comprising one or more HPA lectins).31#14328154vl

[0112] “Treating” refers to the application or administration of a composition including one or more active agents to a subject, who has a target disease, a symptom of the target disease, or a predisposition toward the target disease, with the purpose to cure, heal, alleviate, relieve, alter, remedy, ameliorate, improve, or affect the disease, the symptoms of the disease, or the predisposition toward the disease.

[0113] In some embodiments, the method comprises treating a subject having a cancer characterized by the presence of one or more solid tumors. The term “solid tumor” as used herein refers to a tumor characterized by a solid mass of cancer cells. Solid tumors include, but are not limited to, lung cancer, brain cancer, kidney cancer, pancreatic cancer, prostate cancer, ovarian cancer, testicular cancer, skin cancer, throat cancer, liver cancer, breast cancer, and colon cancer. Solid tumors do not include liquid tumors. In some embodiments, the method comprises treating a subject having a liquid tumor (e.g., a leukemia, lymphoma or myeloma). In some embodiments, the method comprises treating a subject having a tumor, wherein the tumor comprises cells expressing a Tn antigen.

[0114] In some aspects, the disclosure provides a method of treating a subject having cancer, the method comprising administering to the subject an immune cell comprising: (i) a CAR polypeptide; and (ii) a glycoprotein antigen receptor, wherein the glycoprotein antigen receptor comprises an inactivated intracellular domain.

[0115] In some aspects, the disclosure provides a method of treating a subject having cancer, the method comprising administering to the subject an immune cell comprising a CAR polypeptide comprising one or more Helix pomatia agglutinin (HPA) lectins.

[0116] In some embodiments, the subject is a mammal. In some embodiments, the subject is a human.

[0117] In some embodiments, the methods described herein comprise administering to the subject a pharmaceutical composition comprising a cell comprising a glycoprotein antigen receptor and / or a CAR provided herein. As used herein, the term “pharmaceutical composition” refers to the active agent (e.g., a cell comprising a glycoprotein antigen receptor and / or a CAR described herein) in combination with a pharmaceutically acceptable carrier, e.g., a carrier commonly used in the pharmaceutical industry.

[0118] The phrase “pharmaceutically acceptable carrier” is employed herein to refer to those compounds, materials, compositions, and / or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication,32#14328154vlcommensurate with a reasonable benefit / risk ratio. In some embodiments of any of the aspects, a pharmaceutically acceptable carrier can be a carrier other than water. In some embodiments of any of the aspects, a pharmaceutically acceptable carrier can be an artificial or engineered carrier, e.g., a carrier in which the active ingredient would not be found to occur in nature.Cells

[0119] One aspect of the technology described herein relates to a mammalian cell (e.g., an immune cell) comprising any of glycoprotein antigen receptor and / or CAR constructs described herein. The mammalian cell can be of human, primate, hamster, rabbit, rodent, cow, pig, sheep, horse, goat, dog or cat origin, but any other mammalian cell may be used. In some embodiments, the mammalian cell is human. In some embodiments, the mammalian cell is an induced pluripotent stem cell (iPSC).

[0120] In some embodiments of any aspect, the mammalian cell is an immune cell. As used herein, "immune cell" refers to a cell that plays a role in the immune response. Immune cells are of hematopoietic origin, and include lymphocytes, such as B cells and T cells; natural killer cells; myeloid cells, such as monocytes, macrophages, eosinophils, mast cells, basophils, and granulocytes. In some embodiments, the immune cell is a T cell. In some embodiments, the immune cell is an NK cell.

[0121] In some embodiments, the immune cell is obtained from an individual having or diagnosed as having cancer, a plasma cell disorder, or autoimmune disease. In some embodiments, the immune cell is allogenic to the subject. In some embodiments, the immune cell is produced from stem cell (e.g., an induced pluripotent stem cell or an embryonic stem cell).

[0122] In some embodiments, a mammalian cell, e.g., a T cell, can be engineered to include any of the glycoprotein antigen receptor and / or CAR constructs as described herein. T cells can be obtained from a subject using standard techniques known in the field. For example, T cells can be isolated from peripheral blood taken from a donor or patient. T cells can be isolated from a mammal. Preferably, T cells are isolated from a human.Nucleic Acids and Vectors

[0123] In some aspects, this disclosure describes a nucleic acid encoding any one of the glycoprotein antigen receptors and / or CAR polypeptides described herein. The term "nucleic acid" is used herein interchangeably with "polynucleotide" to indicate a polymer of 33#14328154vlnucleosides. Typically, a polynucleotide is composed of nucleosides that are naturally found in DNA or RNA (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxy guanosine, and deoxy cytidine) joined by phosphodiester bonds. However, the term encompasses molecules comprising nucleosides or nucleoside analogs containing chemically or biologically modified bases, modified backbones, etc., whether or not found in naturally occurring nucleic acids, and such molecules may be preferred for certain applications. Where this application refers to a nucleic acid it is understood that both DNA, RNA, and in each case both single- and double- stranded forms (and complements of each single- stranded molecule) are provided. "Nucleic acid" as used herein can refer to a polynucleotide material itself and / or to the sequence information (i.e., the succession of letters used as abbreviations for bases) that biochemically characterizes a specific nucleic acid. In some embodiments, the nucleic acid molecule is a heterologous nucleic acid molecule. As used herein the term, “heterologous nucleic acid molecule” refers to a nucleic acid molecule that does not naturally exist within a given cell or a nucleic acid sequence that has been engineered into a cell. For example, a heterologous nucleic acid molecule may be a nucleic acid molecule encoding a gene that is engineered into a cell (e.g., via a plasmid, vector or some other method). A polynucleotide sequence presented herein is presented in a 5' to 3' direction unless otherwise indicated.

[0124] In some embodiments, a nucleic acid encoding a polypeptide as described herein (e.g., a glycoprotein antigen receptor and / or CAR polypeptide) is comprised by a vector. The term "vector," as used herein, refers to a nucleic acid construct designed for delivery to a host cell or for transfer between different host cells. As used herein, a vector can be viral or non- viral. The term "vector" encompasses any genetic element that is capable of replication when associated with the proper control elements and that can transfer gene sequences to cells. A vector can include, but is not limited to, a cloning vector, an expression vector, a plasmid, phage, transposon, cosmid, artificial chromosome, virus, virion, etc.

[0125] As used herein, the term "expression vector" may refer to a vector that directs expression of an RNA or polypeptide from sequences linked to transcriptional regulatory sequences on the vector. The sequences expressed will often, but not necessarily, be heterologous to the cell. An expression vector may comprise additional elements, for example, the expression vector may have two replication systems, thus allowing it to be maintained in two organisms, for example, in human cells for expression and in a prokaryotic host for cloning and amplification. The term "expression" refers to the cellular processes involved in producing34#14328154vlRNA and proteins and as appropriate, secreting proteins, including where applicable, but not limited to, for example, transcription, transcript processing, translation and protein folding, modification and processing. "Expression products" include RNA transcribed from a gene, and polypeptides obtained by translation of mRNA transcribed from a gene.

[0126] As used herein, the term "viral vector" may refer to a nucleic acid vector construct that includes at least one element of viral origin and has the capacity to be packaged into a viral vector particle. The viral vector can contain a nucleic acid encoding a polypeptide as described herein in place of non-essential viral genes. The vector and / or particle may be utilized for the purpose of transferring nucleic acids into cells either in vitro or in vivo. Numerous forms of viral vectors are known in the art. In some embodiments, the viral vector is an adeno-associated viral, adenoviral, lentiviral, or a retroviral vector. In some embodiments, the lentiviral vector is a second generation lentiviral vector.

[0127] By "recombinant vector" may be a vector that includes a heterologous nucleic acid sequence or "transgene" that is capable of expression in vivo. It should be understood that the vectors described herein can, in some embodiments, be combined with other suitable compositions and therapies. In some embodiments, the vector is episomal. The use of a suitable episomal vector provides a means of maintaining the nucleotide of interest in the subject in high copy number extra-chromosomal DNA thereby eliminating potential effects of chromosomal integration.

[0128] In some embodiments, a polypeptide, polynucleotide, plasmid and or / vector as described herein optionally further comprises a reporter molecule, e.g., to determine if the vector is properly expressed in a cell. In some embodiments, the reporter molecule may be a fluorescent protein (e.g., GFP, YFP, RF, mCherry), antibody (e.g., CD34, tEGFR, tCD19, tCD20, tCD34, and tHer2), or a radioisotope. In some embodiments, the reporter molecule is hygromycin phosphotransferase (hph) that can be imaged alone or in combination with a substrate or chemical (for example 9-[4-[18F]fluoro-3-(hydroxymethyl)butyl]guanine ([18F]FHBG)).

[0129] In some embodiments, GFP and mCherry may be used as fluorescent tags for imaging a glycoprotein antigen receptor and / or CAR expressed on a T cell (e.g., a CAR-T cell). It is expected that essentially any fluorescent protein known in the art can be used as a fluorescent tag for this purpose. For clinical applications, the glycoprotein antigen receptor and / or CAR need not include a fluorescent tag or fluorescent protein. In each instance of particular constructs provided herein, therefore, any markers present in the constructs can be removed.35#14328154vlThe invention includes the constructs with or without the markers. Accordingly, when a specific construct is referenced herein, it can be considered with or without any markers or tags (including, e.g., histidine tags, such as the histidine tag of HHHHHH (SEQ ID NO: 115)) as being included within the invention.EXAMPLESExample 1: Results

[0130] Tn antigens are overexpressed due to the upregulation of ppGalNAcTs, genetic silencing or mutation of C1GALT1, or mutations in COSMC (FIG. 1A). These antigens decorate the backbone of Mucl, a well-known transmembrane mucin overexpressed in various cancers such as breast, pancreas, and ovary. This was modeled by primarily using the Capan- 2 pancreatic cancer cell line, a solid tumor overexpressing Mucl, and the RPMI 8226 multiple myeloma cell line (FIGs. 1B-1C). To target the Tn antigen on Mucl, a glyco-bridge incorporating TnMucl scFv (5E5) was used as a binder alongside a CAR molecule. The glyco- bridge utilized a CD28 hinge / transmembrane domain to prevent dimerization with CD8 from CAR molecule, and an inactive CD28 intracellular domain was employed to block CAR signaling through the bridge. Expression of these glyco-bridges was confirmed using ALFA tag (FIG. ID). CAR constructs with glyco-bridges showed similar expression levels, though the expression of TnMucl bridges was slightly lower than that of CD19 bridges (FIG. IE). The CD 19 bridge alongside CAR molecule demonstrated strong binding affinity to the recombinant CD19 protein. (FIG. IF). Overexpression of CD19 in Capan-2 and RPMI 8226 cell lines revealed that CD 19 bridges enhanced the killing ability of mesothelin CARs (FIG. 5A). Furthermore, the combination of CD 19 bridges and CAR showed increased efficacy in these CD19-overexpressing cell lines (FIGs. 5B-5C).

[0131] To increase surface expression of Tn-Mucl, C1GALT1 knockout Capan-2 cells were generated using CRISPR / Cas9 (FIG. 1G). Capan-2 C1GALT1 KO cells exhibited increased Tn-Mucl expression (FIGs. 1H-1J). In a real-time killing assay with mesothelin CAR-T cells with TnMucl bridge, Capan-2 Cl GALT 1 KO cells demonstrated higher killing efficiency compared to CD19 bridge. The use of itraconazole also elevated Tn-Mucl expression (FIG. IK), and combining itraconazole with TnMucl -bridge CAR-T cells enhanced killing efficacy in vitro (FIGs. IL, IM).36#14328154vl

[0132] To validate this approach in vivo, the impact of Capan-2, Capan-2 Cl GALT 1 KO, and the use of itraconazole on tumor growth was examined. Tumor cells (5 x 106) were subcutaneously injected, and itraconazole was administered via intraperitoneal injection at 40 mg / kg for 30 days. Overall, no significant differences in tumor growth were observed across the three conditions (FIGs. 2A-2B). However, C1GALT1 KO cells exhibited slower in vitro growth rates compared to wild-type cells, consistent with previous studies. In the C1GALT1 KO model, no significant difference was observed between the two bridges in the CAR-T cell condition (FIGs. 2C-2D). Nonetheless, in the Capan-2 model, combining itraconazole with bridge CAR-T cells significantly reduced tumor size with the Tn-Muc 1 bridge compared to the CD19 bridge (FIGs. 2E-2F).

[0133] To further investigate the glyco-bridge mechanism, the interaction between CARs and bridges was examined by preparing antigen-deficient cells (FIG. 3A). Notably, Mesothelin CAR and CD19 bridge-mediated killing was observed only in CD19-expressing RPMI 8226 cells but not in wild-type cells (FIG. 3B). The same phenomenon was confirmed in Jeko-1 cells, which express CD19 but not Mesothelin. CD19 bridge-mediated killing was diminished when CD 19 was knocked out using CRISPR / Cas9, demonstrating that CAR activity depended on target cell antigen expression (FIG. 3C). When CAR molecules were removed, no cell killing occurred, confirming the bridge's CAR-dependent function (FIG. 3F). Fluorescent microscopy revealed no direct killing by the bridge alone but showed aggregation of Jeko-1 cells induced by the bridge (FIGs. 3D-3E). Similarly, no killing occurred with the bridge alone in the Capan-2 model (FIG. 3G). These results indicate that the glyco-bridge induces cell death by activating CAR molecules in an antigen density-dependent manner.

[0134] In addition to Tn-Muc 1, HPA lectin was used to universally target Tn structures (FIG. 4A). As previously reported, the Tn structure was predominantly expressed in the ductal regions of pancreatic ductal adenocarcinoma, with HPA binding confirmed (FIG. 4B). Itraconazole inhibition of C1GALT1 further increased HPA binding (FIG. 4C). A new HPA- based CAR was then engineered by substituting HPA for the scFv binder (FIG. 4D). Considering that HPA has a hexagonal structure formed by two trimeric subunits, a dual HPA structure was designed to enhance binding (FIG. 4D). Coculture of C1GALT1 KO cells with HPA CAR showed increased activation, with the dual HPA structure demonstrating higher activity than the single HPA structure (FIG. 4E). The dual HPA structure also exhibited higher in vitro killing specificity in C1GALT1 KO cells (FIG. 4F), and in NSG mice, it reduced tumor size in C1GALT1 KO tumors (FIG. 4H).37#14328154vl

[0135] Mesothelin CARs with glyco-bridge include two CAR constructs: (1) Mesothelin CAR or conventional CAR: SSI scFv, CD8 hinge / transmembrane (H / TM), 4- IBB, CD3z; and (2) Glyco-Bridge: TnMucl scFv or CD19 scFv, CD28 H / TM, inactivated CD28 ICD. Complete sequences are shown in Table 1.

[0136] For HPA-based CAR T cells, the scFv sequences were replaced by HPA lectins. Two HPAs were linked by (G+Sja (SEQ ID NO: 8) linker. Complete sequences are shown in Table1.Example 2: Targeting Cancer-Associated Glycosylation Enhances CAT-T Cell Killing with an Additional Binding Molecule in an Antigen Density-Dependent Manner

[0137] Chimeric antigen receptor T (CAR-T) cell therapy has revolutionized cancer treatment, particularly for hematologic malignancies. However, its application to solid tumors remains challenging due to factors such as antigen heterogeneity, an immunosuppressive tumor microenvironment, and structural barriers like the glycocalyx. The glycocalyx is composed of dense, glycosylated glycoproteins, particularly Mucl. In solid tumors such as pancreatic and breast cancers, the glycocalyx significantly impedes CAR-T infiltration and target antigen engagement, thereby reducing therapeutic efficacy. Tn-Mucl, a truncated form of Mucl decorated with Tn antigen, is frequently overexpressed in pancreatic cancer. Here, an additional binder targeting Tn-Mucl, termed a "glyco-bridge", was incorporated into mesothelin-targeted CAR-T cells to enhance CAR-T cell-mediated killing. This glyco-bridge not only facilitates CAR-T cell infiltration but also activates CAR molecules in a manner dependent on the density of the bridge target antigens. To expand the glyco-bridge targeting range, the binding domain was modified to be composed of tandem HPA lectins, enabling effective recognition of Tn- antigens across various cancer types. CAR-T cells with the HPA glyco-bridge exhibit superior cytotoxicity in patient-derived xenograft (PDX) models of pancreatic cancer. By advancing binding strategies to penetrate the cancer glycocalyx, this approach opens new pathways for enhanced CAR-T cell efficacy in solid tumor immunotherapy.Introduction

[0138] Chimeric antigen receptor T (CAR-T) cell therapy has revolutionized cancer immunotherapy by harnessing the body’s immune system to target and eliminate malignant cells. It has dramatically changed the treatment landscape for patients with relapsed and refractory B-cell malignancies, especially following FDA approval for diffuse large B-cell 38#14328154vllymphoma (DLBCL), B-cell acute lymphoblastic leukemia (B-ALL), and multiple myeloma. This success has sparked significant interest in expanding the technology to solid tumors. CAR- T studies targeting various solid cancers, including pancreatic cancer and triple-negative breast cancer, have recently gained momentum, although challenges remain that can hinder CAR-T cell efficacy and persistence. These challenges include antigen heterogeneity, an immunosuppressive tumor microenvironment, and physical barriers such as the tumor stromal barrier and cellular glycocalyx. Advancing CAR-T cell efficacy in solid tumors will require a deeper understanding of these obstacles and the design of innovative CAR-T cells that can effectively overcome them.

[0139] The physical barriers in solid tumors present significant challenges to CAR-T cell therapy. In particular, the dense layer of heavily glycosylated transmembrane proteins like Mucl, which is often overexpressed in cancers, contributes to a protective barrier that hinders immune cell infiltration and effective CAR-T cell targeting. A truncated form of Mucl, known as Tn antigen-Mucl (Tn-Mucl), is frequently found in solid tumors such as pancreatic cancer and has become a target for several therapeutic strategies, including CAR-T cell therapy. Furthermore, glycoproteins and other large components in the glycocalyx are proposed to sterically shield molecular epitopes, affecting the interactions between immune cells and tumor cells. Specifically, the overexpression of Mucl contributes to a thickened glycocalyx, which acts as a physical barrier that impairs immune cell infiltration and attack, including by CAR-T cells. Overcoming this barrier by designing CAR-T cells capable of penetrating the glycocalyx may significantly enhance their ability to induce tumor cell death, improving therapeutic efficacy in solid cancers like pancreatic cancer.

[0140] Glycans, which are sugar molecules attached to cell-surface proteins, can alter the functions of essential immune cells, including macrophages, dendritic cells, cytotoxic T cells, and natural killer cells. The Tn antigen is a carbohydrate antigen overexpressed in various cancers, including pancreatic, breast, ovarian, bladder, prostate, lung, and stomach cancers. It is primarily overexpressed when T-synthase is degraded, silenced, or mutated. These alterations often occur due to defects in COSMC, a molecular chaperone that prevents protein misfolding of T-synthase. Loss of functional COSMC through mutation, deletion, or hypermethylation can also contribute to Tn antigen expression in some cancer cell lines and malignancies. For example, the Jurkat cell line overexpresses the Tn antigen due to a loss-of-function mutation in COSMC. Several isoforms of the initiating enzymes ppGalNAc-Ts, including Tl, T3, T6, and T13, have been reported to be elevated in human cancers, resulting in increased Tn antigen39#14328154vlexpression. For instance, overexpression of GalNAc-transferase (GalNAc-T3) has been shown in pancreatic cancer and has been linked to promoting cancer cell growth. Due to this overexpression, the Tn antigen serves as a potential biomarker for early prediction or detection of human cancers.

[0141] Here, CAR-T cells were engineered to express additional glycoprotein-binding molecules, termed the "glyco-bridge." This design strategically utilizes cancer-associated Mucl within the glycocalyx to enhance binding efficiency, thereby improving CAR-T cell activity against mucin-overexpressing cancer cells. This approach leverages the unique structural characteristics of the glycocalyx to facilitate more effective targeting and increase penetration into the tumor microenvironment. Notably, this glyco-bridge alone can modulate CAR-T activation, depending on the target antigen density on the cancer cells. This mechanism was further explored by employing different transmembrane domains (e.g., CD28 versus CD8) to prevent CAR dimerization and by deleting specific CAR molecules to validate the effect of the glyco-bridge. To target a broader range of cancer-associated Tn antigens beyond Tn-Mucl, tandem HPA lectins were incorporated as the antigen-binding domain of the CAR. These Tn- antigen- specific CAR-T cells show enhanced efficacy against cancer cell lines and patient- derived xenograft (PDX) models from a pancreatic cancer patient in vitro and in vivo. Finally, the HPA lectins were integrated into the glyco-bridge approach to target universal Tn-antigen structures in cancer cells. The results reveal new binding strategies that target glycans to penetrate the glycocalyx barrier, thereby enhancing CAR-T cell-mediated cytotoxicity.ResultsGlyco-bridge strategy enhances CAR-T cell killing of Tn-Mucl -expressing cancer cells

[0142] Tn antigens are overexpressed due to the upregulation of ppGalNAcTs, genetic silencing or mutation of C1GALT1, or mutations in COSMC (FIG. 1A). Tn antigens decorate the backbone of cell-surface glycolipids and glycoproteins, such as cell-surface mucins. Notably, cancer-associated mucins are overexpressed in tumors and cell lines and are associated with high heterogeneity at the cell surface level. Since the mucins can form a nanoscale glycocalyx barrier that impedes immune cell access, it was hypothesized that enhancing CAR T cell binding to cancer cells could help overcome this barrier. To increase binding, CAR-T cells expressing a glyco-bridge that engages the cancer-associated cell surface mucin structure Tn-Mucl with validated single-chain variable fragments (scFv) were developed. Initially, a Tn-Mucl scFv (5E5) was tested as the bridge binder alongside a40#14328154vlmesothelin-targeting CAR molecule (with an SSI scFv), and used a CD 19 scFv (FMC63) bridge as a control. All of these scFvs have been used in CAR T cells that have either entered clinical trials or have received FDA approval and contain a (G+Sja linker between their variable heavy and light chains. The SSI scFv was directly fused to a CD8 hinge / transmembrane domain, a 4- IBB costimulatory domain, and CD3^ (FIG. ID, FIG. 6A). To prevent dimerization with CD8 transmembrane domain from the CAR molecule, a CD28 hinge / transmembrane domain was utilized in the glyco-bridge. To better anchor the bridge to the cell membrane, a CD28 intracellular domain was incorporated, but its key subdomains were mutated to prevent signaling. Specifically, proline residues P208 and P211 were mutated to alanine within the PRRP subdomain to prevent SH3-containing proteins (such as Itk and Tec) from binding, and the PYAP motif was modified by substituting tyrosine (Y191) with phenylalanine, inhibiting binding to the SH2 domain of Lek, a key mediator in T-cell signaling43(FIG. ID, FIG. 6B). Expression of CAR molecules and these glyco-bridges was confirmed using an ALFA tag and the (G+Sja linker (FIG. ID, FIG. 6B). In both constructs, the transduction rate of CAR molecules ranged from 40-50% and remained stable over time. The CD 19 bridge alongside the CAR molecule demonstrated strong binding affinity to recombinant CD 19 protein (FIG. IF).

[0143] As the target, the Capan-2 pancreatic ductal adenocarcinoma (PDAC) cell line, which overexpresses cell-surface mucins, including Mucl, was used (FIG. IB). To increase the surface expression of Tn-Mucl, Cl GALT 1 knockout (KO) Capan-2 cells were generated using CRISPR / Cas9-mediated gene editing. Itraconazole, an antifungal drug, was also utilized to inhibit C1GALT1 enzymatic activity, resulting in elevated Tn-Mucl expression (FIG. 1G). Both Capan-2 Cl GALT 1 KO cells and itraconazole-treated Capan-2 cells increased Tn-Mucl expression. In a luciferase killing assay and real-time killing assay with Capan-2 C1GALT1 KO cells, mesothelin-targeted CAR-T cells incorporating a Tn-Mucl bridge demonstrated higher killing efficiency compared to those with a CD19 bridge (FIGs. 1H-1J). Likewise, combining itraconazole treatment with Tn-Mucl bridge CAR-T cells further enhanced killing of Capan-2 cells in vitro (FIGs. 1L-1M, FIG. 6C). Similarly, overexpression of CD19 in Capan-2 and the RPMI 8226 multiple myeloma cell line, which also exhibits high Mucl expression, showed that the CD 19 bridge enhanced the cytotoxicity of mesothelin-targeted CARs (FIGs. 5A-5C). The phenotype of each CAR-T cell was phenotyped and classified them as Naive (CD45RA+ CCR7+), Terminally Differentiated Effector (TEMRA; CD45RA+ CCR7-), Central Memory (TCM; CD45RA- CCR7+), or Effector Memory T cells (TEM;41#14328154vlCD45RA- CCR7-) within the CD4 and CD8 CAR-T cell populations. There were no differences in cell phenotypes between the glyo- and CD19-bridge CAR T cells (FIG. IK, FIGs. 11A-11D).Tn-Mucl bridge CAR-T cells enhance tumor suppression in Capan-2 mouse models

[0144] To validate this approach in vivo, the impact of Cl GALT 1 KO and itraconazole treatment on Capan-2 tumor growth was examined. Tumor cells (5xl06) were subcutaneously injected into NSG mice, and itraconazole was administered via intraperitoneal injection at a dose of 40 mg / kg for 60 days. Overall, no significant differences in tumor growth were observed among the conditions, although Capan-2 Cl GALT 1 KO cells exhibited slower in vitro growth rates compared to wild-type cells (FIGs. 2A-2B, FIG. 7A). It was further confirmed that itraconazole and C1GALT1 KO approach can increase Tn-antigen expression in mice (FIG. 7B). Next, CAR-T cell-mediated killing against Capan-2, Capan-2 C1GALT1 KO, and itraconazole-treated Capan-2 was measured in vivo. Capan-2 cell lines (5xl06) were injected subcutaneously into NSG mice. The tumors were monitored for 14 days until the average tumor size reached around 150-200 mm3. Following a single injection of CAR-T cells (2-2.5 xlO6), we measured tumor size using calipers. As expected, no significant difference in CAR-T cell- mediated cytotoxicity was observed between the two bridges in the CAR-T cell condition in the Capan-2 wild-type model (FIG. IB, FIG. 7C). However, in Capan-2 C1GALT1 KO model or Capan-2 model treated with itraconazole, CAR-T cells with Tn-Mucl bridge significantly reduced tumor size compared to the CD 19 bridge (FIG. 2B, FIG. 2D, FIG. 2F, FIGs. 7D-7E, FIG. 12C). Furthermore, no significant off-tumor toxicity leading to severe weight loss or decreased body condition was observed (FIG. 2B, FIGs. 7D-7E). To further evaluate the effect of the glyco-bridge on CAR-T cell infiltration throughout the tumor, residual tumors were stained for human CD3+ T cells on Day 52 using an anti-human CD3 antibody. Notably, CAR- T cells with the Tn-Mucl bridge showed 7.91 times higher infiltration than the CD 19 bridge into Capan-2 Cl GALT 1 KO tumors (FIGs. 7F-7H). The tumor control by mesothelin-targeted CAR-T cells with the glyco-bridge strongly correlated with infiltration density. Taken together, these results support the use of a glyco-bridge with CAR molecules to enhance the CAR T cell tumor killing.Bridge molecules lead to antigen-dependent activation of CAR-T cells42#14328154vl

[0145] It was next investigated how different expression levels of the glycol-bridge target antigen contribute to glyco-bridge CAR-mediated killing (FIG. 8A). As a model, the RPMI 8226 multiple myeloma cell line was used, which has low expression of mesothelin (FIG. 5A) and moderate expression of Mucl. The cell-surface expression level of Tn-Mucl on RPMI 8226 cells could be induced by itraconazole treatment (FIG. 8B, FIG. 13A). Using Tn-Mucl bridge CAR T cells against the RPMI 8226 cell line, there was no significant killing, even when treating with itraconazole (FIG. 8C). However, mesothelin-targeted CAR-T cells with the CD 19 bridge exhibited higher killing efficiency when CD 19 was overexpressed in RPMI 8226 cells compared to wild- type (WT) cells (FIG. 3B, FIGs. 8D-8G). The same trend was confirmed in Jeko-1 cells, which overexpress high levels of CD19 in WT cells but low mesothelin (FIG. 5A). CD19 bridge-mediated killing was diminished when CD19 was knocked out using CRISPR / Cas9, demonstrating that the killing was dependent on target cell antigen expression for the bridge molecule (FIG. 3C, FIGs. 8H-8K). The data revealed a clear power-law dependence of CD19-bridge-mediated killing on CD 19 density in Jeko-1 cells, with a scaling exponent of -0.74 (FIG. 8K). Similarly, RPMI CD19 overexpression cell lines exhibited comparable trends, with a scaling exponent of -0.16 (FIG. 8G). These relationships provide a crucial framework for understanding how the additional bridge binder can induce CAR target-independent killing mechanisms by CAR-T cells.

[0146] To explore this CAR-independent killing further, we deleted the CAR from our constructs, leaving only the bridge molecule expressed in T-cells. Without the CAR, there was no target cell killing, confirming that the bridge-mediated killing is CAR-dependent (FIGs. 3B-3C, FIGs. 8D-8N, FIG. 13B). Fluorescent microscopy also revealed no direct killing by the bridge alone but showed aggregation of Jeko-1 cells induced by the CD 19 bridge (FIG. 13D). Likewise, no target cell killing occurred with the Tn-Mucl bridge alone in Capan-2 C1GALT1 KO cells (FIG. 13C). To investigate whether the interaction between the bridge and the CAR molecule is influenced by specific components of the CAR, such as the scFv, the SSI scFv was deleted from the CAR construct to eliminate potential non-specific interactions between the two scFvs. Interestingly, the CD19-bridge demonstrated increased cytotoxicity against CD19-overexpressing cell lines, independent of the SSI scFv (FIGs. 8P-8Q, FIGs. 13E-13F). This finding suggests that the activation of the CAR intracellular domain may be driven by the bridge and that the bridge induces cell killing by activating CAR molecules in an antigen density-dependent manner. Furthermore, the affinity of the CD 19 and Tn-Mucl scFvs for their target antigens vary. The dissociation constant of the FMC63 scFv (ocCD19) ranges43#14328154vlfrom 300 pM to 5 nM, whereas the ocTn-Mucl scFv ranges from 2 nM to 4 nM. This difference suggests that the ligand affinity, in addition to the antigen density, could also be playing a role in the efficacy of killing mediated by the bridge. Lower affinity binders, such as scFvs targeting lectins, may not effectively activate CAR-mediated killing through the bridge but can still provide critical binding interactions. (FIG. 3A, FIG. 8R).HPA lectin-based. CAR-T cells enhance targeting of Tn antigens

[0147] To universally target Tn-antigen structures, through glyco-bridge targets, Helix pomatia agglutinin (HPA) lectin was utilized as the antigen-binding domain of the CAR molecule. This lectin has a relatively low dissociation constant while maintaining high specificity for Tn antigen. The dissociation constant of HPA with GalNAc is approximately 130 pM, which is lower than that of conventional CD 19 scFv, thereby reducing the risk of unnecessary killing mediated by CD 19 bridges. The goal was to quantitatively evaluate the effectiveness of HPA as a binder for both CARs and glyco-bridges. As previously reported, the Tn structure is predominantly expressed in the ductal regions of pancreatic ductal adenocarcinoma. It was confirmed that HPA binds in these regions using a fluorescently labeled recombinant lectin (FIGs. 4A-4B). Furthermore, when Cl GALT 1 enzymatic function was inhibited using itraconazole, HPA binding to Capan-2 cells increased compared to baseline (FIG. 4C). Next, a novel HPA-based CAR was engineered by replacing the scFv binder with HPA to determine its efficacy as a binding component (FIG. 4D). Since wild- type HPA has a hexagonal structure formed by two trimeric subunits, a dual HPA structure was designed to enhance binding affinity. Two HPA (HPAx2) units are fused via a (G4S)3 (SEQ ID NO: 8) linker (FIG. 4D). To quantify the activation of the HPA-based CAR, expression of the activation marker CD69 was measured on CAR-T cells after a 24-hour co-culture with Capan- 2 and Capan-2 C1GALT1 KO cells. The dual HPA structure led to higher activation and improved in vitro killing specificity against Capan-2 Cl GALT 1 KO cells compared to the single HPA structure (FIGs. 4E-4F, FIGs. 14A-14B). In NSG mice, it also significantly reduced tumor size in Capan-2 C1GALT1 KO tumors (FIGs. 4G-4H).

[0148] A non-immortalized pancreatic ductal adenocarcinoma patient-derived xenograft (PDX) cell line (PDX1294), which overexpresses both Tn antigen and mesothelin, was next utilized (FIGs. 9A-9B; FIG. 5A) . The expression level of Tn antigen on PDX1294 was higher than Capan-2 C1GALT1 KO cells or itraconazole-treated Capan-2 (FIGs. 9A-9B). Confocal images confirmed that PDX 1294 bind more HPA on its cell membrane than Capan-2 cells44#14328154vl(FIG. 9C). The dual HPA-directed CAR-T cells exhibited enhanced cytotoxicity against PDX1294 cells than single HPA in vitro (FIG. 9D). However, in one group of mice treated with CAR T cells from the same donor, toxicity was observed that resulted in rapid weight loss and decreased survival of these mice (FIG. 9E). A similar toxicity was observed in 1 / 5 mice from each of the other two donor groups, suggesting an on-target, off-tumor toxicity from the HPAx2 CAR T cells. This observation led to the utilization the HPAx2 as a glyco-bridge instead of the CAR antigen-binding domain based on the previous experiments showing that HPA can function effectively as a binder (FIG. 8R, FIG. 3A). Overall, these results provided a framework for understanding the HPA lectins as a binder of CAR molecules and show that HPA lectins induce CAR-mediated activation and killing.Enhancing CAR-T cell efficacy with dual HPA bridge in PDX models

[0149] To explore the hypothesis that incorporating a dual HPA structure into the glyco- bridge could broaden Tn antigen targeting and enhance CAR-T cell efficacy, the existing glyco-bridge was modified with the dual HPA structure (FIGs. 10A-10B; FIG. 15A). The expression level of CAR with HPA glyco-bridge was similar to the levels of the Tn-Mucl bridge and CD19 bridge, as measured by (648)3 (SEQ ID NO: 8) MFI (FIG. 10C). To confirm that the dual HPA glyco-bridge does not induce killing, Jurkat cells, which overexpress Tn antigen but lack mesothelin expression, (FIG. 5A), were used as a control model. Even with high levels of HPA binding, glyco-bridge-mediated cytotoxicity did not occur (FIGs. 10D- 10E).

[0150] Several PDX cell lines were assessed for HPA binding, as well as their expression of mesothelin, MUC1, and TnMUCl. HPA was found to bind strongly to PDX1294 (FIG. 15B). Anti-mesothelin CARs bearing an HPA-based glyco-bridge exhibited potent in vitro killing of PDX1294 and PDX1275 cells compared to untransduced (UTD) cells, and improved killing compared to anti-mesothelin CARs bearing a TnMUCl-based glyco-bridge (FIGs. 15C-15D). Glyco-bridge bearing anti-mesothelin CAR-T cells exhibited no significant killing of PDX1319 cells compared to UTD cells, consistent with their lack of mesothelin expression (FIG. 15E). Glyco-bridge bearing CAR-T cells exhibited strong interactions with PDX 1294 cells, as indicated by the percentage of bound CAR-T cells at increased acoustic force compared to UTD cells (FIG. 15F).

[0151] To validate this approach in vivo, 5 x 106PDX1294 cells were injected subcutaneously into NSG mice. The tumors were monitored for 14 days, and 2 xlO6CAR-T cells were injected45#14328154vlintravenously when the average tumor size reached around 200 mm3(FIG. 18A). After a single injection of CAR-T cells, tumor size was monitored via caliper measurement. It was confirmed that CAR-T cells with a dual HPA bridge exhibited superior tumor-killing compared to CAR- T cells with the control CD19 bridge (FIGs. 10F and 18B). Additionally, the toxicity observed with the HPA-CAR was significantly reduced with the meso-CAR plus dual HPA glyco-bridge (FIG. 10G and FIGs. 18C-18D).

[0152] Next, NSG mice were injected subcutaneously with 5 x 106Capan-2 C1GALT1 KO cells. 2 x 106CAR-T cells were injected intravenously 14 days later, and tumors were measured up to day 60 post-CAR-T injection (FIG. 16A). HPA-based CAR-T cells and anti-mesothelin CAR-T cells bearing an HPA glyco-bridge both exhibited significant control of tumor growth compared to UTD cells (FIG. 16B). CAR-T cells engineered from human donors exhibited only partial toxicity; the majority of recipients did not suffer weight loss and survived for the duration of the experiment (FIGs. 16C-16G). Histology of various organs showed the presence of CAR-T cells as indicated by the presence of staining for human CD3 (FIG. 17). Fluorescent microscopy confirmed that glyco-bridge molecules co-localize with CAR molecules (FIGs.19A-19C).

[0153] Taken together, these data suggest that adding the glyco-bridge to CAR-T cells can overcome the glycocalyx barrier and increase target binding and killing. Moreover, the bridge system's ability to activate CAR-T cells based on antigen density and binding affinity was validated. By using HPA lectin, which specifically binds to a broader range of Tn antigens, a novel binder was incorporated into the glyco-bridge module that not only improves killing efficacy, even in a pancreatic cancer PDX model, but also significantly reduces the toxicity observed with previous binders.Discussion

[0154] This Example demonstrated that equipping CAR-T cells with an additional binder can significantly enhance their efficacy in a pancreatic cancer model in vitro and in vivo. To better understand the underlying mechanisms, it was investigated how the glyco-bridge activates CAR molecules. This analysis revealed that bridges with high binding affinity scFvs can activate CARs independent of the CAR antigen, facilitating target cell elimination. To broaden the targeting capabilities against a wider range of cancer-associated glycans, such as the Tn- antigen, we developed a new binder derived from an existing lectin called Helix pomatia agglutinin (HPA). Notably, HPA applied in a bridging mechanism demonstrated strong46#14328154vlspecificity in models overexpressing the Tn antigen, further enhancing the efficacy of CAR-T cells.

[0155] These glyco-bridges and additional binders offer insight into the dual CAR mechanism. Specifically, the results suggest that the interaction between the two CAR molecules goes beyond a simple OR-gate function. Rather, there could be a relationship between the CAR molecules that influences the activation dynamics of dual or multiple CARs. If this is similar to what was observed using a CAR and bridge, the relationship depends on antigen density and binding affinity. Furthermore, these findings suggest that even binding molecules without intracellular domains (ICDs) can help sustain CAR activation and promote immune synapse formation in the presence of CAR molecules. Although the glyco-bridge- induced activation effects were minimized by employing HPA lectin, which has a relatively low binding affinity compared to an scFv, this work emphasizes the importance of considering that CAR activation can be influenced by factors such as binding affinity, dissociation rate, and binding force of scFv-containing binders.

[0156] Importantly, this Example did not directly target the Tn antigen but rather leveraged it indirectly to enhance immune cell accessibility. By mimicking the Tn antigen structure through the knockout of T-synthase (C1GALT1) or itraconazole treatment, elevated Tn antigen expression was observed in cell lines that was comparable to actual patient cancer cells, as demonstrated in PDX1294. This approach underscores the potential for modulating glycosylation pathways to improve immune recognition of cancer cells.

[0157] In the context of CAR-T strategies that target glycans via lectins, previous approaches have primarily focused on specific glycans, such as mannose (via the H84T banana lectin) and glycoproteins like GD3, some of which are currently undergoing clinical trials. While lectin- based CAR-T cell approaches have shown effectiveness in targeting the limited and complex glycan structures with scFvs, challenges remain regarding binding affinity and selectivity. Advancing research into lectins with multimeric structures or introducing targeted lectin mutations, as discussed here, could enhance both the specificity and affinity of CAR-T cells for glycan targets, thereby improving their accessibility to target antigens and therapeutic efficacy. Furthermore, combining lectin-based CAR-T strategies with glycoengineering techniques could help address the variability of glycan expression in tumor microenvironments, offering a more robust and adaptable approach to glycan-targeted therapies. Such advancements could ultimately lead to more precise, potent, and versatile CAR-T cell therapies for diverse cancer types.47#14328154vlMaterials and MethodsPrimary cells, cell lines, and. PDX tumor

[0158] Capan-2 (ATCC; HTB-80), RPMD8226 (ATCC; CCL-155), and Jurkat (ATCC; TIB- 152) cells were cultured in RPMD1640 media (Thermo Fisher Scientific; Cat# 72400047) supplemented with 10% fetal bovine serum (Thermo Fisher Scientific) and lx penicillin / streptomycin (Thermo Fisher Scientific) at 37 °C in 5% CO2. Human T cells were isolated (Stem Cell Technologies, 15061) from healthy donor leukopaks obtained through the Massachusetts General Hospital Blood Bank, following a protocol approved by the institutional review board, and were cultured in RPMI 1640 media supplemented with 10% fetal bovine serum, 20 U mb1recombinant human IL-2 (PeproTech), and lx penicillin / streptomycin at 37°C in 5% CO2. An unimmortalized PDX PDAC cell line, PDX 1294, was kindly provided by the Liss laboratory at Massachusetts General Hospital (MGH) and cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum and lx penicillin / streptomycin.Mice

[0159] Male and female 6-11 week-old in-house bred NOD.Cg-Prkdcscid I12rgtmlWjl / SzJ (NSG) mice (The Jackson Laboratory) were housed in groups of up to five under pathogen- free conditions. The animals were kept at temperatures of 21.1-24.5°C (70-76°F), 30-70% humidity, and a 12:12 light-dark cycle. All mice were housed at the MGH Center for Cancer Research, and all care and experiments were conducted in accordance with protocols approved by the Massachusetts General Hospital Institutional Animal Care and Use Committee.Generation of engineered cell lines

[0160] Cell lines were transduced to express click beetle green (CBG) luciferase and enhanced GFP (eGFP), then sorted using a BD FACSAria to isolate a clonal or different population of transduced cells. Capan2 C1GALT1 KO was generated by electroporation of 10 pg of Cas9 mRNA and 0.3 nmol of sgRNA (Synthego CRISPRevolution GUAAAGCAGGGCUACAUGAG) (SEQ ID NO: 116) using BTX ECM 830 electroporator. Knockout efficiency was measured by flow cytometry, and a pure population was isolated through cell sorting.Generation of CAR constructs48#14328154vl

[0161] Three anti-mesothelin CAR plus bridge constructs (anti-TnMucl, anti-CD19, anti- HPAx2) and three CAR only constructs (anti-mesothelin, anti-HPAxl, anti-HPAx2) were synthesized and cloned into a third-generation lentiviral plasmids backbone regulated by a human EF-la promoter (Genscript). All CAR constructs contained a CD8 hinge and transmembrane domains, a 4-1BB co-stimulatory domain, and an intracellular CD3^ signaling domain. Bridges were designed to be flanked by an IgK leader peptide, a CD28 transmembrane domain and mutated CD28 co-stimulatory domain, and an ALFA-tag element. Anti-HPA CAR constructs contained a transgene coding for the fluorescent reporter, mCherry, to aid in evaluating transduction efficiency. The scFvs against mesothelin, Tn-Mucl, and CD 19 were derived from sequences of SSI, 5E5, and blinatumomab, respectively (available to the public). Glyco-bridge constructs were further modified to remove the anti-mesothelin scFv (SSI) or to substitute the CD28 transmembrane domain with the PDGFRP transmembrane domain using the Q5 Site-Directed Mutagenesis Kit (E0554S; New England Biolabs) or Q5 High-Fidelity 2x Mater Mix (M0492S; New England Biolabs).Flow cytometric analysis

[0162] The following antibody clones were used for CAR-T cell analysis: Alexa Fluor 647 conjugated FluoTag-X2 anti- ALFA (N1502-AF647-L; NanoTag Biotechnologies), Alexa Fluor 647 conjugated G4S (E7O2V) antibody (69782S; Cell Signaling Technology), Alexa Fluor 700 conjugated anti-human CD3 antibody (300424; BioLegend), Per / Cy7 conjugated anti-human CD4 antibody (300518; BioLegend), PerCP conjugated anti-human CD8a antibody (301032; BioLegend), FITC conjugated anti-human CCR7 antibody (561271; BD BioSciences), Brilliant Violet 42 conjugated anti-human CD45RA antibody (304130; BioLegend), Alexa Fluor 700 conjugated anti-human CD45 antibody (304024; BioLegend). For human CAR T quantification in the peripheral blood of NSG mice, Trucount tubes (BD Biosciences, 340334) were used according to the manufacturer's protocol. Adherent cancer cells were detached by incubating with Tryple Express Enzyme (lx; 12-604-013; Fisher Scientific) at 37°C for 5-10 minutes. Alexa Fluor 647 conjugated HPA lectin (L32454; Thermo Scientific), PE conjugated CD19 (363003; BioLegend), and APC conjugated anti-human CD69 (310910; BioLegend) were diluted 1:200 in 2% FBS PBS and incubated with cells at 4°C for 1 hour for each stain. For analysis of Tn-Mucl cell surface expression level, anti-human Tn-Mucl (FHD14210-100; ProteoGenix) was diluted 1:200 in 2% FBS PBS and incubated with cells at 4°C for 1 hour. Secondary labelling was with Alexa Fluor 647 conjugated goat anti-human IgG (H+L)49#14328154vlrecombinant secondary antibody (A56019; fflivitrogen), diluted 1 :200 in 2% FBS PBS and incubated with cells at 4°C for 1 hour. To quantify cell surface CD 19 expression level, BD Quantibrite Beads PE Fluorescence Quantification Kit (340495; BD Biosciences) was used according to the manufacturer’s protocol. Cells were washed and stained with DAPI containing 2% FBS PBS to assess cell viability before analyzing on a BD Fortessa X-20.Cytotoxicity assays

[0163] For single time-point cytotoxicity assays, target cells expressing CBG luciferase were incubated with CAR-T cells or untransduced T cells at varying effector-to-target (E:T) ratios in 200 pL of growth media specific to the target cell line, without IL-2, and cocultured in a 96- well plate for 30 hours at 37°C in 5% CO2. Cells were then lysed using the Bright-Glo Luciferase Assay System (E2610; Promega), and luciferase activity was measured with a Biotek Neo2 luminescence plate reader. Specific lysis was calculated using the following formula: Percentage of specific lysis = [(luminescence target cell only) - (luminescence target cell + CAR-T cell)] / (luminescence target cell only) x 100%. For real-time killing assays, target cells expressing CBG-eGFP were plated in flat-bottom 48- or 96-well plates (Corning) and incubated for at least 4 hours at 37°C in 5% CO2. CAR-T cells or untransduced T cells were added in triplicate at various effector: target (E:T) ratios as indicated. CAR expression (%) was normalized using untransduced T cells for each donor. Plates were then incubated at 37 °C for up to 6 days, with whole wells recorded every 2 hours using the IncuCyte Live Cell Analysis system. Cytotoxicity was measured as the total green fluorescent area and analyzed using the IncuCyte image analysis software.Immunofluorescence

[0164] Target cancer cell lines (Capan-2, Capan-2 C1GALT1 KO, and PDX1294) were plated in 35 mm glass bottom dishes (P35G-1.5-14-C; Mattek), grown for 24 hours. HPA conjugated Alexa Fluor 647 (L32454; Thermo Scientific) was diluted 1:200 in 2% FBS PBS and incubated on samples at 4°C for 1 hour. For itraconazole treatment, Capan-2 cells were treated with 2.5 pM itraconazole in cell culture media at 37°C for 48 hours before staining with HPA lectin. Cells were further treated with Hoechst 33342 (4082S; Cell Signaling Technology) containing 2% FBS PBS. All samples above were imaged on a LSM 780 confocal microscope using 63x (NA: 1.4 Oil) objectives (Zeiss).50#14328154vlImmunohistochemistry ( IHC )

[0165] After tumor-engrafted mice were euthanized, tumors were extracted and fixed in 4% PFA overnight, washed with PBS, and serial wash with 30%, 50%, 70% ethanol and stored in 70% EtOH until staining. Tissue slides were then made and embedded in paraffin. Slides were stained for CD3, Mucl (NBP2-47883-0.1mg; Novus Biologicals), Tn-antigen (GTX82968; GeneTex) by the specialized histopathology services core facility at MGH. All IHC slides were imaged on a Axio Scan.Zl microscope and quantified the respective stains by QuPath (v0.5.1).Statistical methods, sample sizes, data collection, and assumptionsThe sample sizes were selected on the basis of standards in the field and not pre-determined using statistical methods. For statistical comparisons, data distributions were assumed to be normal. Normality was tested for conditions with approximately ten or more data points. All the statistical analyses were performed using GraphPad Prism 8 software. All the experimental data are presented as mean ± s.d or as box-and- whisker plots with the first and third quartiles (boxes), median and range of data, unless stated otherwise within figure legends. Appropriate statistical tests were used to analyse the data, as described in the figure legends.Table 1. Sequences51#14328154vl52#14328154vl53#14328154vl54#14328154vl55#14328154vl56#14328154vl57#14328154vl58#14328154vl59#14328154vl60#14328154vl61#14328154vl62#14328154vl63#14328154vl64#14328154vl65#14328154vl66#14328154vl#14328154vlEQUIVALENTS AND SCOPE

[0166] While several inventive embodiments have been described and illustrated herein, those of ordinary skill in the art will readily envision a variety of other means and / or structures for performing the function and / or obtaining the results and / or one or more of the advantages described herein, and each of such variations and / or modifications is deemed to be within the scope of the inventive embodiments described herein. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are meant to be exemplary and that the actual parameters, dimensions, materials, and / or configurations will depend upon the specific application or applications for which the inventive teachings is / are used. Those skilled in the art will recognize or be able to ascertain using no more than routine experimentation, many equivalents to the specific inventive embodiments described herein. It is, therefore, to be understood that the foregoing embodiments are presented by way of example only and that, within the scope of the appended claims and equivalents thereto, inventive embodiments may be practiced otherwise than as specifically described and claimed. Inventive embodiments of the present disclosure are directed to each individual feature, system, article, material, kit, and / or method described herein. In addition, any combination of two or more such features, systems, articles, materials, kits, and / or methods, if such features, systems, articles, materials, kits, and / or methods are not mutually inconsistent, is included within the inventive scope of the present disclosure.

[0167] The indefinite articles “a” and “an,” as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean “at least one.”

[0168] It should also be understood that, unless clearly indicated to the contrary, in any methods claimed herein that include more than one step or act, the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are recited.

[0169] In the claims, as well as in the specification above, all transitional phrases such as “comprising,” “including,” “carrying,” “having,” “containing,” “involving,” “holding,” “composed of,” and the like are to be understood to be open-ended, i.e., to mean including but not limited to. Only the transitional phrases “consisting of’ and “consisting essentially of’ shall be closed or semi-closed transitional phrases, respectively, as set forth in the United States Patent Office Manual of Patent Examining Procedures, Section 2111.03.

[0170] The terms “about” and “substantially” preceding a numerical value mean ±10% of the recited numerical value.68#14328154vl

[0171] Where a range of values is provided, each value between and including the upper and lower ends of the range are specifically contemplated and described herein.

[0172] In the various embodiments described herein, it is further contemplated that variants (naturally occurring or otherwise), alleles, homologs, conservatively modified variants, and / or conservative substitution variants of any of the particular polypeptides described are encompassed. As to amino acid sequences, one of ordinary skill will recognize that individual substitutions, deletions or additions to a nucleic acid, peptide, polypeptide, or protein sequence which alters a single amino acid or a small percentage of amino acids in the encoded sequence is a “conservatively modified variant” where the alteration results in the substitution of an amino acid with a chemically similar amino acid and retains the desired activity of the polypeptide. Such conservatively modified variants are in addition to and do not exclude polymorphic variants, interspecies homologs, and alleles consistent with the disclosure.

[0173] A given amino acid can be replaced by a residue having similar physiochemical characteristics, e.g., substituting one aliphatic residue for another (such as He, Vai, Leu, or Ala for one another), or substitution of one polar residue for another (such as between Lys and Arg; Glu and Asp; or Gin and Asn). Other such conservative substitutions, e.g., substitutions of entire regions having similar hydrophobicity characteristics, are well known. Polypeptides comprising conservative amino acid substitutions can be tested in any one of the assays described herein to confirm that a desired activity, e.g., ligand-mediated receptor activity and specificity of a native or reference polypeptide is retained.

[0174] Amino acids can be grouped according to similarities in the properties of their side chains (in A. L. Lehninger, in Biochemistry, second ed., pp. 73-75, Worth Publishers, New York (1975)): (1) non-polar: Ala (A), Vai (V), Leu (L), He (I), Pro (P), Phe (F), Trp (W), Met (M); (2) uncharged polar: Gly (G), Ser (S), Thr (T), Cys (C), Tyr (Y), Asn (N), Gin (Q); (3) acidic: Asp (D), Glu (E); (4) basic: Lys (K), Arg (R), His (H). Alternatively, naturally occurring residues can be divided into groups based on common side-chain properties: (1) hydrophobic: Norleucine, Met, Ala, Vai, Leu, He; (2) neutral hydrophilic: Cys, Ser, Thr, Asn, Gin; (3) acidic: Asp, Glu; (4) basic: His, Lys, Arg; (5) residues that influence chain orientation: Gly, Pro; (6) aromatic: Trp, Tyr, Phe. Non-conservative substitutions will entail exchanging a member of one of these classes for another class. Particular conservative substitutions include, for example; Ala into Gly or into Ser; Arg into Lys; Asn into Gin or into His; Asp into Glu; Cys into Ser; Gin into Asn; Glu into Asp; Gly into Ala or into Pro; His into Asn or into Gin; He into Leu or into Vai; Leu into He or into Vai; Lys into Arg, into Gin or into Glu; Met into69#14328154vlLeu, into Tyr or into He; Phe into Met, into Leu or into Tyr; Ser into Thr; Thr into Ser; Trp into Tyr; Tyr into Trp; and / or Phe into Vai, into He or into Leu.70#14328154vl

Claims

CLAIMSWhat is claimed is:1 . A glycoprotein antigen receptor comprising an antigen-binding domain, a hinge / transmembrane domain, and an inactivated intracellular signaling domain.

2. The glycoprotein antigen receptor of claim 2, wherein the hinge / transmembrane domain is a CD28 hinge / transmembrane domain.

3. The glycoprotein antigen receptor of claim 2, wherein the CD28 hinge / transmembrane domain comprises an amino acid sequence having at least 95% identity to the sequence of SEQ ID NO: 18.

4. The glycoprotein antigen receptor of claim 2, wherein the CD28 hinge / transmembrane domain comprises an amino acid sequence of SEQ ID NO: 18.

5. The glycoprotein antigen receptor of any one of claims 1-4, wherein the inactivated intracellular signaling domain is an inactivated CD28 intracellular signaling domain.

6. The glycoprotein antigen receptor of claim 5, wherein the inactivated CD28 intracellular signaling domain comprises an amino acid sequence having at least 95% identity to the sequence of SEQ ID NO: 19.

7. The glycoprotein antigen receptor of claim 5, wherein the inactivated CD28 intracellular signaling domain comprises an amino acid sequence of SEQ ID NO: 19.

8. The glycoprotein antigen receptor of any one of claims 1-7, wherein the antigenbinding domain comprises a Mucl binding domain.

9. The glycoprotein antigen receptor of any one of claims 1-8, wherein the antigenbinding domain comprises a TnMucl binding domain.71#14328154vl10. The glycoprotein antigen receptor of claim 9, wherein the TnMucl binding domain is an anti-TnMucl scFv.

11. The glycoprotein antigen receptor of claim 9, wherein the TnMucl binding domain comprises: a variable heavy (VH) domain comprising a CDR-H1 of SEQ ID NO: 45, or a variant thereof; a CDR-H2 of SEQ ID NO: 46, or a variant thereof; and CDR-H3 of SEQ ID NO: 47, or a variant thereof; and / or a variable light (VL) domain comprising a CDR-L1 of SEQ ID NO: 48, or a variant thereof; a CDR-L2 of SEQ ID NO: 49, or a variant thereof; and CDR-L3 of SEQ ID NO: 50, or a variant thereof.

12. The glycoprotein antigen receptor of claim 9, wherein the TnMucl binding domain comprises a VH comprising an amino acid sequence having at least 90% identity to the sequence of SEQ ID NO: 43 and a VL comprising an amino acid sequence having at least 90% identity to the sequence of SEQ ID NO: 44.

13. The glycoprotein antigen receptor of claim 9, wherein the TnMucl binding domain comprises a VH comprising an amino acid sequence of SEQ ID NO: 43 and a VL comprising an amino acid sequence of SEQ ID NO: 44.

14. The glycoprotein antigen receptor of claim 10, wherein the anti-TnMucl scFv comprises an amino acid sequence having at least 95% identity to the sequence of SEQ ID NO: 17.

15. The glycoprotein antigen receptor of claim 10, wherein the anti-TnMucl scFv comprises an amino acid sequence of SEQ ID NO: 17.

16. The glycoprotein antigen receptor of claim 1, wherein the glycoprotein antigen receptor comprises an amino acid sequence having at least 90% identity to the sequence of SEQ ID NO: 21.72#14328154vl17. The glycoprotein antigen receptor of claim 1, wherein the glycoprotein antigen receptor comprises an amino acid sequence of SEQ ID NO: 21.

18. The glycoprotein antigen receptor any one of claims 1-7, wherein the antigen-binding domain comprises one or more HPA lectins.

19. The glycoprotein antigen receptor of claim 18, wherein the antigen -binding domain comprises two HPA lectins.

20. The glycoprotein antigen receptor of claim 18, wherein the antigen-binding domain comprises three HPA lectins.

21. The glycoprotein antigen receptor of any one of claims 18-20, wherein the one or more HPA lectins comprises the amino acid sequence of SEQ ID NO: 2.

22. The glycoprotein antigen receptor of any one of claims 19-21, wherein the HPA lectins are linked by a linker.

23. The glycoprotein antigen receptor of claim 1 or 19, wherein the glycoprotein antigen receptor comprises an amino acid sequence having at least 90% identity to the sequence of SEQ ID NO: 52 or 53.

24. The glycoprotein antigen receptor of any one of claims 1, 19, or 23, wherein the glycoprotein antigen receptor comprises an amino acid sequence of SEQ ID NO: 52 or 53.

25. A cell comprising the glycoprotein antigen receptor of any one of claims 1-24.

26. The cell of claim 25, wherein the cell is a human cell.

27. The cell of claim 26, wherein the human cell is an immune cell.

28. The cell of claim 27, wherein the immune cell is a T cell.73#14328154vl29. The cell of claim 27, wherein the immune cell is a natural killer (NK) cell.

30. An immune cell comprising:(i) a chimeric antigen receptor (CAR) polypeptide; and(ii) a glycoprotein antigen receptor, wherein the glycoprotein antigen receptor comprises an antigen-binding domain, a hinge / transmembrane domain, and an inactivated intracellular signaling domain.

31. The immune cell of claim 30, wherein the CAR polypeptide comprises one or more Helix pomatia agglutinin (HPA) lectins.

32. The immune cell of claim 30, wherein the CAR polypeptide comprises an antigenbinding domain.

33. The immune cell of claim 32, wherein the antigen-binding domain comprises a CD70- binding domain, CD27 or a portion thereof, a VEGF-binding domain, a CD19-binding domain, a mesothelin-binding domain, a TnMucl -binding domain, a CD79b-binding domain, a TACI-binding domain, a BCMA-binding domain, A Proliferation-Inducing Ligand (APRIL) or a portion thereof, a CD37-binding domain, a TRBC1 -binding domain, a TRBC2- binding domain, an EGER-binding domain, and / or an EGFR variant III (EGFRvIII)-binding domain.

34. The immune cell of claim 32, wherein the CAR polypeptide comprises an amino acid sequence having at least 90% identity to the amino acid sequence of any one of SEQ ID NOs: 39-42 or 73-114.

35. The immune cell of claim 32, wherein the CAR polypeptide comprises the amino acid sequence of any one of SEQ ID NOs: 39-42 or 73-114.

36. The immune cell of claim 33, wherein the mesothelin binding domain comprises an anti-mesothelin scFv.

37. The immune cell of claim 33, wherein the mesothelin binding domain comprises:74#14328154vl(i) a VH domain comprising a CDR-H1 of SEQ CD NO: 25, or a variant thereof; a CDR-H2 of SEQ CD NO: 26, or a variant thereof; and a CDR-H3 of SEQ ID NO: 27, or a variant thereof; and a VL domain comprising a CDR-L1 of SEQ ID NO: 28, or a variant thereof; a CDR-L2 of SEQ CD NO: 29, or a variant thereof; and a CDR-L3 of SEQ ID NO: 30, or a variant thereof; or(ii) a VH domain comprising a CDR-H1 of SEQ CD NO: 33, or a variant thereof; a CDR-H2 of SEQ CD NO: 34, or a variant thereof; and a CDR-H3 of SEQ ID NO: 35, or a variant thereof; and a VL domain comprising a CDR-L1 of SEQ ID NO: 36, or a variant thereof; a CDR-L2 of SEQ CD NO: 37, or a variant thereof; and a CDR-L3 of SEQ ID NO: 38, or a variant thereof.

38. The immune cell of claim 33, wherein the mesothelin binding domain comprises:(i) a VH domain comprising an amino acid sequence having at least 90% identity to the sequence of SEQ CD NO: 23; and / or a VL domain comprising an amino acid sequence having at least 90% identity to the sequence of SEQ CD NO: 24; or(ii) a VH domain comprising an amino acid sequence having at least 90% identity to the sequence of SEQ CD NO: 31; and / or a VL domain comprising an amino acid sequence having at least 90% identity to the sequence of SEQ ID NO: 32.

39. The immune cell of claim 33, wherein the mesothelin binding domain comprises:(i) a VH comprising an amino acid sequence of SEQ ID NO: 23 and a VL comprising an amino acid sequence of SEQ CD NO: 24; or(ii) a VH comprising an amino acid sequence of SEQ ID NO: 31 and a VL comprising an amino acid sequence of SEQ ID NO: 32.

40. The immune cell of any one of claims 30-39, wherein the antigen-binding domain of the glycoprotein antigen receptor comprises TnMucl binding domain.

41. The immune cell of claim 40, wherein the TnMucl binding domain is an anti- TnMucl scFv.

42. The immune cell of claim 40, wherein the TnMucl binding domain comprises:75#14328154vla variable heavy (VH) domain comprising a CDR-H1 of SEQ ID NO: 45, or a variant thereof; a CDR-H2 of SEQ ID NO: 46, or a variant thereof; and CDR-H3 of SEQ ID NO: 47, or a variant thereof; and / or a variable light (VL) domain comprising a CDR-L1 of SEQ ID NO: 48, or a variant thereof; a CDR-L2 of SEQ ID NO: 49, or a variant thereof; and CDR-L3 of SEQ ID NO: 50, or a variant thereof.

43. The immune cell of claim 40, wherein the TnMucl binding domain comprises a VH comprising an amino acid sequence having at least 90% identity to the sequence of SEQ ID NO: 43 and a VL comprising an amino acid sequence having at least 90% identity to the sequence of SEQ ID NO: 44.

44. The immune cell of claim 40, wherein the TnMucl binding domain comprises a VH comprising an amino acid sequence of SEQ ID NO: 43 and a VL comprising an amino acid sequence of SEQ ID NO: 44.

45. The immune cell of claim 41, wherein the anti-TnMucl scFv comprises an amino acid sequence having at least 95% identity to the sequence of SEQ ID NO: 17.

46. The immune cell of claim 42, wherein the anti-TnMucl scFv comprises an amino acid sequence of SEQ ID NO: 17.

47. The immune cell of any one of claims 30-39, wherein the antigen-binding domain of the glycoprotein antigen receptor comprises one or more HPA lectins.

48. The immune cell of claim 47, wherein each HPA lectin of the one or more HPA lectins comprises an amino acid sequence having at least 90% identity to the amino acid sequence of SEQ ID NO: 2.

49. The immune cell of claim 47, wherein each HPA lectin of the one or more HPA lectins comprises an amino acid sequence of SEQ ID NO: 2.76#14328154vl50. The immune cell of any one of claims 47-49, wherein the antigen-binding domain of the glycoprotein antigen receptor comprises two HPA lectins.

51. The immune cell of any one of claims 47-49, wherein the antigen-binding domain of the glycoprotein antigen receptor comprises three HPA lectins.

52. The immune cell of claim 50 or 51, wherein the HPA lectins are linked by a linker.

53. The immune cell of claim 31, wherein each HPA lectin of the one or more HPA lectins comprises an amino acid sequence having at least 95% identity to the sequence of SEQ ID NO: 2.

54. The immune cell of claim 31, wherein each HPA lectin of the one or more HPA lectins comprises an amino acid sequence of SEQ ID NO: 2.

55. The immune cell of any one of claims 31 or 53-54, wherein the CAR polypeptide comprises two HPA lectins.

56. The immune cell of claim 55, wherein the CAR polypeptide comprises the amino acid sequence of SEQ ID NO: 14 or 15.

57. The immune cell of any one of claims 31 or 53-54, wherein the CAR polypeptide comprises three HPA lectins.

58. The immune cell of claim 57, wherein the CAR polypeptide comprises the amino acid sequence of SEQ ID NO: 71 or 72.

59. The immune cell of claim 55 or 57, wherein the HPA lectins are linked by a linker.

60. The immune cell of claim 59, wherein the linker is a glycine- serine linker.

61. The immune cell of claim 60, wherein the glycine-serine linker comprises an amino acid sequence of SEQ ID NO: 8.77#14328154vl62. The immune cell of any one of claims 30-61, wherein the hinge / transmembrane domain of the glycoprotein antigen receptor is a CD28 hinge / transmembrane domain.

63. The immune cell of claim 62, wherein the CD28 hinge / transmembrane domain comprises an amino acid sequence having at least 95% identity to the sequence of SEQ ID NO: 18.

64. The immune cell of claim 63, wherein the CD28 hinge / transmembrane domain comprises an amino acid sequence of SEQ ID NO: 18.

65. The immune cell of any one of claims 30-64, wherein the inactivated intracellular signaling domain is an inactivated CD28 intracellular signaling domain.

66. The immune cell of claim 65, wherein the inactivated CD28 intracellular signaling domain comprises an amino acid sequence having at least 95% identity to the sequence of SEQ ID NO: 19.

67. The immune cell of claim 65, wherein the inactivated CD28 intracellular signaling comprises an amino acid sequence of SEQ ID NO: 19.

68. The immune cell of claim 30, wherein the CAR polypeptide comprises an amino acid sequence having at least 90% identity to the sequence of SEQ ID NO: 13, 15, 40, or 42.

69. The immune cell of claim 30, wherein the CAR polypeptide comprises an amino acid sequence of SEQ ID NO: 13, 15, 40, or 42.

70. The immune cell of claim 30 or 69, wherein the glycoprotein antigen receptor comprises an amino acid sequence having at least 90% identity to the sequence of SEQ ID NO: 21.

71. The immune cell of claim 30 or 64, wherein the glycoprotein antigen receptor comprises an amino acid sequence of SEQ ID NO: 21.78#14328154vl72. A nucleic acid encoding the glycoprotein antigen receptor of any one of claims 1-24.

73. A vector comprising the nucleic acid of claim 72.

74. A pharmaceutical composition comprising the immune cell of any one of claims SO- 71 or the cell of any one of claims 25-29 and a pharmaceutically acceptable excipient.

75. A method of treating a subject having cancer, the method comprising administering the immune cell of any one of claims 30-71, the cell of any one of claims 25-29, or the pharmaceutical composition of claim 74 to the subject.

76. The method of claim 75, wherein the cancer is a solid tumor.

77. The method of claim 75 or 76, wherein the subject is a human.

78. A method of treating a subject having cancer, the method comprising administering to the subject an immune cell comprising:(i) a chimeric antigen receptor (CAR) polypeptide; and(ii) a glycoprotein antigen receptor, wherein the glycoprotein antigen receptor comprises an antigen-binding domain, a hinge / transmembrane domain, and an inactivated intracellular signaling domain.

79. A method of treating a subject having cancer, the method comprising administering to the subject an immune cell comprising a chimeric antigen receptor (CAR) polypeptide comprising one or more Helix pomatia agglutinin (HPA) lectins.

80. The method of claim 78 or 79, wherein the cancer is a solid tumor.

81. An immune cell comprising:(a) a chimeric antigen receptor (CAR) polypeptide comprising:(i) a mesothelin-binding domain;(ii) a CD8 hinge / transmembrane domain;79#14328154vl(iii) a 4- IBB co-stimulatory domain; and(iv) a CD3z intracellular signaling domain; and(b) a glycoprotein antigen receptor comprising:(i) two Helix pomatia agglutinin (HPA) lectins;(ii) a CD8 hinge / transmembrane domain; and(iii) an inactivated CD28 intracellular signaling domain.

82. An immune cell comprising:(a) a chimeric antigen receptor (CAR) polypeptide comprising:(i) a mesothelin-binding domain comprising a variable heavy (VH) domain and a variable light (VL) domain, wherein the VH domain comprises the amino acid sequence of SEQ ID NO: 23 or 31 and the VL domain comprises the amino acid sequence of SEQ ID NO: 24 or 32;(ii) a CD8 hinge / transmembrane domain comprising the amino acid sequence of SEQ CD NO: 3;(iii) a 4- IBB co-stimulatory domain comprising the amino acid sequence of SEQ CD NO: 4; and(iv) a CD3z intracellular signaling domain comprising the amino acid sequence of SEQ CD NO: 5; and(b) a glycoprotein antigen receptor comprising:(i) two Helix pomatia agglutinin (HPA) lectins, wherein each HPA lectin comprises the amino acid sequence of SEQ CD NO: 2;(ii) a CD8 hinge / transmembrane domain comprising the amino acid sequence of SEQ CD NO: 3; and(iii) an inactivated CD28 intracellular signaling domain comprising the amino acid sequence of SEQ ID NO: 19.80#14328154vl

Images