Human papillomavirus detection

A multiplex qPCR assay for HPV16 and HPV18 nucleic acids provides rapid, sensitive, and specific detection in clinical pathology labs, overcoming the limitations of current OPSCC diagnostics by using optimized oligonucleotide sets for improved genomic coverage and cost-effective implementation.

WO2026072767A1PCT designated stage Publication Date: 2026-04-02THE CLEVELAND CLINIC FOUND
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/047892
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-09-30
Filing Date
2025-09-25
Publication Date
2026-04-02

AI Technical Summary

Technical Problem

Current diagnostics for oropharyngeal squamous cell carcinoma (OPSCC) associated with high-risk HPV lack sensitivity, specificity, and cost-effectiveness, and are impractical for clinical implementation, leading to inadequate management and screening, and existing HPV biomarkers are not optimized for rapid, flexible use in clinical pathology laboratories.

Method used

Development of a multiplex single-tube qPCR assay for detecting HPV16 and HPV18 nucleic acids using oligonucleotide sets with high sequence identity, allowing for rapid, sensitive, and specific detection in a single step, suitable for clinical pathology laboratories, without requiring digital PCR instruments.

Benefits of technology

The assay achieves high analytical sensitivity and specificity, with a rapid turnaround time, suitable for clinical pathology laboratories, and improved genomic coverage, addressing the limitations of existing diagnostics.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000021_0001
    Figure IMGF000021_0001
  • Figure IMGF000018_0001_TABLE
    Figure IMGF000018_0001_TABLE
  • Figure IMGF000019_0001_TABLE
    Figure IMGF000019_0001_TABLE
Patent Text Reader

Abstract

The present disclosure relates to compositions, kits, systems, and methods for detecting the presence or absence of human papillomavirus 16 (HPV16) or HPV18 nucleic acid (e.g., cell-free DNA) in a sample from a subject. In particular embodiments, a sample is contacted with at least one set of oligonucleotide having a forward primer, reverse primer, and a detectable labeled probe (e.g., for detecting PCR generated amplicons). In certain embodiments, the amount of HPV16 or HPV18 in the sample is quantitated (e.g., quantitative PCR is employed).
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Attorney Docket No. CCF-43675.601

[0002] HUMAN PAPILLOMAVIRUS DETECTION

[0003] The present application claims priority to U.S. Provisional application serial number 63 / 700,940, filed September 30, 2024, which is herein incorporated by reference.

[0004] 5

[0005] SEQUENCE LISTING PARAGRAPH

[0006] The text of the computer readable sequence listing filed herewith, titled “CCF_43675_601_SequenceListing.xml”, created September 25, 2025, having a file size of 67,159 bytes, is hereby incorporated by reference in its entirety.

[0007] 10 FIELD

[0008] The present disclosure relates to compositions, kits, systems, and methods for detecting the presence or absence of human papillomavirus 16 (HPV16) or HPV18 nucleic acid (e.g., cell- free DNA) in a sample from a subject. In particular embodiments, a sample is contacted with at least one set of oligonucleotide having a forward primer, reverse primer, and a detectable labeled 15 probe (e.g., for detecting PCR generated amplicons). In certain embodiments, the amount of HPV16 or HPV18 in the sample is quantitated (e.g., quantitative PCR is employed).

[0009] BACKGROUND

[0010] While the incidence of cervical carcinoma has been declining in the United States since 20 the 1990s, rates of oropharyngeal squamous cell carcinoma (OPSCC) continue to increase despite similarities in pathogenesis and epidemiology. This is primarily due to the lack of secondary prevention. While adolescent and young adult high-risk HPV (hrHPV) vaccination rates are gradually increasing, this will not yield a measurable decrease in OPSCC incidence until approximately 2045 due to the long latency of hrHPV. In the absence of screening, 25 millions of latently-infected adults will develop HPV-associated neoplasms and suffer from the associated morbidity and mortality. Like cervical carcinoma, current treatments for OPSCC are based almost entirely on anatomic stage and may cause long-term dysphagia, xerostomia, dental complications, and soft tissue fibrosis.

[0011] Several major gaps exist in our understanding of how to manage and screen for HPV-30 associated OPSCC. In particular, our current staging system, therapies, and surveillance methods are defined almost entirely by pre-treatment anatomic stage, traditional diagnostic imaging, and surgical pathology despite opportunities to integrate dynamic hrHPV biomarkers.

[0012] 1 Attorney Docket No. CCF-43675.601

[0013] Combinations of radiotherapy, surgery, and cytotoxic chemotherapy cure most individuals, but often cause long-term morbidity and impaired quality of life.

[0014] Recent studies have identified high risk HPV (hrHPV) cell-free DNA (cfDNA) as a biomarker for relapse, but existing diagnostics are either impractical to implement clinically due 5 to cost / complexity (hybrid capture NGS), are intentionally optimized for cervical carcinoma screening (commercial nucleic acid amplification tests (NAAT)), or rely upon specialized instruments / techniques (dPCR) and likely have inadequate analytical sensitivity for minimal residual disease detection.

[0015] The success of biomarker-adapted prognostication, therapy, and surveillance for other 10 cancers (e.g., prostate, thyroid, nasopharynx) has been predicated on the availability of sensitive, specific, and cost-effective diagnostics which can be implemented in clinical laboratories. In OPSCC and other hrHPV-associated neoplasms, there is an unmet need for a diagnostic with high analytical sensitivity / specificity, hrHPV genotype specificity, low cost / complexity, rapid turnaround time, and flexibility for use in clinical pathology laboratories.

[0016] 15

[0017] SUMMARY

[0018] The present disclosure relates to compositions, kits, systems, and methods for detecting the presence or absence of human papillomavirus 16 (HPV16) or HPV18 nucleic acid (e.g., cell- free DNA) in a sample from a subject. In particular embodiments, a sample is contacted with at 20 least one set of oligonucleotide having a forward primer, reverse primer, and a detectable labeled probe (e.g., for detecting PCR generated amplicons). In certain embodiments, the amount of HPV16 or HPV18 in the sample is quantitated (e.g., quantitative PCR is employed).

[0019] In some embodiments, provided herein are methods for detecting HPV16 nucleic acid in a sample comprising: a) contacting a sample from a subject with at least one oligonucleotide set 25 from a plurality of oligonucleotide sets, wherein each oligonucleotide set comprises: a forward primer (FP) with at least 90% (e.g., at least 93%, 95%, 97%) sequence identity to, and / or at least 15 (e.g., at least 16, 17, 18, or 19) consecutive nucleotides from, an FP sequence, a reverse primer (RP) with at least 90% (e.g., at least 93%, 95%, 97%) sequence identity to, and / or at least 15 (e.g., at least 16, 17, 18, or 19) consecutive nucleotides from, an RP sequence, and a

[0020] 30 detectably labeled probe (PB) with at least 90% (e.g., at least 93%, 95%, 97%) sequence identity to, and / or 15 (e.g., at least 16, 17, 18, or 19) consecutive nucleotides from, a PB sequence, and

[0021] 2 Attorney Docket No. CCF-43675.601

[0022] wherein said plurality of oligonucleotide sets are selected from: i) oligonucleotide set one, wherein said FP comprises SEQ ID NO:1 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:2 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:3 optionally minus the 5’ and / or 3’ nucleotide, ii) oligonucleotide set two, wherein 5 said FP comprises SEQ ID NO:4 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:5 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:6 optionally minus the 5’ and / or 3’ nucleotide, iii) oligonucleotide set three, wherein said FP comprises SEQ ID NO:7 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:8 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:9 10 optionally minus the 5’ and / or 3’ nucleotide, iv) oligonucleotide set four, wherein said FP comprises SEQ ID NO:10 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:11 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:12 optionally minus the 5’ and / or 3’ nucleotide, v) oligonucleotide set five, wherein said FP comprises SEQ ID NO:13 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ 15 ID NO:14 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:15 optionally minus the 5’ and / or 3’ nucleotide, vi) oligonucleotide set six, wherein said FP comprises SEQ ID NO:16 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:17 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:18 optionally minus the 5’ and / or 3’ nucleotide, vii) oligonucleotide set seven, wherein said FP 20 comprises SEQ ID NO:19 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:20 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:21 optionally minus the 5’ and / or 3’ nucleotide, viii) oligonucleotide set eight, wherein said FP comprises SEQ ID NO:22 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:23 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:24 25 optionally minus the 5’ and / or 3’ nucleotide, ix) oligonucleotide set nine, wherein said FP comprises SEQ ID NO:25 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:26 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:27 optionally minus the 5’ and / or 3’ nucleotide, x) oligonucleotide set ten, wherein said FP comprises SEQ ID NO:28 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ 30 ID NO:29 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:30 optionally minus the 5’ and / or 3’ nucleotide, xi) oligonucleotide set eleven, wherein said FP comprises SEQ ID NO:31 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ

[0023] 3 Attorney Docket No. CCF-43675.601

[0024] ID NO:32 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:33 optionally minus the 5’ and / or 3’ nucleotide, and xii) oligonucleotide set twelve, wherein said FP comprises SEQ ID NO:34 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:35 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:36 5 optionally minus the 5’ and / or 3’ nucleotide, b) subjecting said sample to PCR amplification to generate a plurality of target HPV16 amplicons if HPV16 nucleic acid is present in said sample; and c) detecting the presence or absence of a signal from at least one of said detectably labelled probes, wherein the presence of said signal: i) indicates that said at least one detectably labelled probe binds to at least some of said plurality of target HPV16 amplicon, and ii) indicates the 10 presence of HPV16 nucleic acid in said sample.

[0025] In some embodiments, provided herein are methods for detecting HPV18 nucleic acid in a sample comprising: a) contacting a sample from a subject with at least one oligonucleotide set from a plurality of oligonucleotide sets, wherein each oligonucleotide set comprises: a forward primer (FP) with at least 90% (e.g., at least 93%, 95%, 97%) sequence identity to, and / or at least 15 15 (e.g., at least 16, 17, 18, or 19) consecutive nucleotides from, an FP sequence, a reverse primer (RP) with at least 90% (e.g., at least 93%, 95%, 97%) sequence identity to, and / or at least 15 (e.g., at least 16, 17, 18, or 19) consecutive nucleotides from, an RP sequence, and a detectably labeled probe (PB) with at least 90% (e.g., at least 93%, 95%, 97%) sequence identity to, and / or 15 (e.g., at least 16, 17, 18, or 19) consecutive nucleotides from, a PB sequence, and 20 wherein said plurality of oligonucleotide sets are selected from: i) oligonucleotide set one, wherein said FP comprises SEQ ID NO:43 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:44 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:45 optionally minus the 5’ and / or 3’ nucleotide, ii) oligonucleotide set two, wherein said FP comprises SEQ ID NO:46 optionally minus the 5’ and / or 3’ nucleotide, said RP

[0026] 25 comprises SEQ ID NO:47 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:48 optionally minus the 5’ and / or 3’ nucleotide, iii) oligonucleotide set three, wherein said FP comprises SEQ ID NO:49 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:50 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:51 optionally minus the 5’ and / or 3’ nucleotide, iv) oligonucleotide set four, 30 wherein said FP comprises SEQ ID NO:52 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:53 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:54 optionally minus the 5’ and / or 3’ nucleotide, v) oligonucleotide set five, wherein

[0027] 4 Attorney Docket No. CCF-43675.601

[0028] said FP comprises SEQ ID NO:55 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:56 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:57 optionally minus the 5’ and / or 3’ nucleotide, vi) oligonucleotide set six, wherein said FP comprises SEQ ID NO:58 optionally minus the 5’ and / or 3’ nucleotide, said RP

[0029] 5 comprises SEQ ID NO:59 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:60 optionally minus the 5’ and / or 3’ nucleotide, vii) oligonucleotide set seven, wherein said FP comprises SEQ ID NO:61 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:62 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:63 optionally minus the 5’ and / or 3’ nucleotide, viii) oligonucleotide set eight, 10 wherein said FP comprises SEQ ID NO:64 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:65 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:66 optionally minus the 5’ and / or 3’ nucleotide, ix) oligonucleotide set nine, wherein said FP comprises SEQ ID NO:67 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:68 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises 15 SEQ ID NO:69 optionally minus the 5’ and / or 3’ nucleotide, x) oligonucleotide set ten, wherein said FP comprises SEQ ID NO:70 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:71 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:72 optionally minus the 5’ and / or 3’ nucleotide, and xi) oligonucleotide set eleven, wherein said FP comprises SEQ ID NO:73 optionally minus the 5’ and / or 3’ nucleotide, said RP 20 comprises SEQ ID NO:74 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:75 optionally minus the 5’ and / or 3’ nucleotide, b) subjecting said sample to PCR amplification to generate a plurality of target HPV18 amplicons if HPV18 nucleic acid is present in said sample; and c) detecting the presence or absence of a signal from at least one of said detectably labelled probes, wherein the presence of said signal: i) indicates that said at least one 25 detectably labelled probe binds to at least some of said plurality of target HPV18 amplicon, and ii) indicates the presence of HPV18 nucleic acid in said sample.

[0030] In particular embodiments, provided herein are compositions, kits, and systems (e.g., for detecting HPV16 nucleic acid) comprising: at least one oligonucleotide set from a plurality of oligonucleotide sets, wherein each oligonucleotide set comprises: a forward primer (FP) with at 30 least 90% (e.g., at least 93%, 95%, 97%) sequence identity to, and / or at least 15 (e.g., at least 16, 17, 18, or 19) consecutive nucleotides from, an FP sequence, a reverse primer (RP) with at least 90% (e.g., at least 93%, 95%, 97%) sequence identity to, and / or at least 15 (e.g., at least 16, 17,

[0031] 5 Attorney Docket No. CCF-43675.601

[0032] 18, or 19) consecutive nucleotides from, an RP sequence, and a detectably labeled probe (PB) with at least 90% (e.g., at least 93%, 95%, 97%) sequence identity to, and / or 15 (e.g., at least 16, 17, 18, or 19) consecutive nucleotides from, a PB sequence, and wherein said plurality of oligonucleotide sets are selected from: i) oligonucleotide set one, wherein said FP comprises 5 SEQ ID NO:1 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:2 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:3 optionally minus the 5’ and / or 3’ nucleotide, ii) oligonucleotide set two, wherein said FP comprises SEQ ID NO:4 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:5 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:6 optionally minus the 5’ 10 and / or 3’ nucleotide, iii) oligonucleotide set three, wherein said FP comprises SEQ ID NO:7 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:8 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:9 optionally minus the 5’ and / or 3’ nucleotide, iv) oligonucleotide set four, wherein said FP comprises SEQ ID NO:10 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:11 optionally minus the 5’ 15 and / or 3’ nucleotide, and said PB comprises SEQ ID NO:12 optionally minus the 5’ and / or 3’ nucleotide, v) oligonucleotide set five, wherein said FP comprises SEQ ID NO:13 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:14 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:15 optionally minus the 5’ and / or 3’ nucleotide, vi) oligonucleotide set six, wherein said FP comprises SEQ ID NO:16 optionally 20 minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:17 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:18 optionally minus the 5’ and / or 3’ nucleotide, vii) oligonucleotide set seven, wherein said FP comprises SEQ ID NO:19 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:20 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:21 optionally minus the 5’ and / or 3’ 25 nucleotide, viii) oligonucleotide set eight, wherein said FP comprises SEQ ID NO:22 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:23 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:24 optionally minus the 5’ and / or 3’ nucleotide, ix) oligonucleotide set nine, wherein said FP comprises SEQ ID NO:25 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:26 optionally minus the 5’ 30 and / or 3’ nucleotide, and said PB comprises SEQ ID NO:27 optionally minus the 5’ and / or 3’ nucleotide, x) oligonucleotide set ten, wherein said FP comprises SEQ ID NO:28 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:29 optionally minus the 5’

[0033] 6 Attorney Docket No. CCF-43675.601

[0034] and / or 3’ nucleotide, and said PB comprises SEQ ID NO:30 optionally minus the 5’ and / or 3’ nucleotide, xi) oligonucleotide set eleven, wherein said FP comprises SEQ ID NO:31 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:32 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:33 optionally minus the 5’ and / or 3’ 5 nucleotide, and xii) oligonucleotide set twelve, wherein said FP comprises SEQ ID NO:34 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:35 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:36 optionally minus the 5’ and / or 3’ nucleotide.

[0035] In particular embodiments, provided herein are compositions, kits, and systems (e.g., for 10 detecting HPV18 nucleic acid) comprising: at least one oligonucleotide set from a plurality of oligonucleotide sets, wherein each oligonucleotide set comprises: a forward primer (FP) with at least 90% (e.g., at least 93%, 95%, 97%) sequence identity to, and / or at least 15 (e.g., at least 16, 17, 18, or 19) consecutive nucleotides from, an FP sequence, a reverse primer (RP) with at least 90% (e.g., at least 93%, 95%, 97%) sequence identity to, and / or at least 15 (e.g., at least 16, 17, 15 18, or 19) consecutive nucleotides from, an RP sequence, and a detectably labeled probe (PB) with at least 90% (e.g., at least 93%, 95%, 97%) sequence identity to, and / or 15 (e.g., at least 16, 17, 18, or 19) consecutive nucleotides from, a PB sequence, and wherein said plurality of oligonucleotide sets are selected from: i) oligonucleotide set one, wherein said FP comprises SEQ ID NO:43 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:44 20 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:45 optionally minus the 5’ and / or 3’ nucleotide, ii) oligonucleotide set two, wherein said FP comprises SEQ ID NO:46 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:47 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:48 optionally minus the 5’ and / or 3’ nucleotide, iii) oligonucleotide set three, wherein said FP comprises SEQ 25 ID NO:49 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:50 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:51 optionally minus the 5’ and / or 3’ nucleotide, iv) oligonucleotide set four, wherein said FP comprises SEQ ID NO:52 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:53 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:54 optionally 30 minus the 5’ and / or 3’ nucleotide, v) oligonucleotide set five, wherein said FP comprises SEQ ID NO:55 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:56 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:57 optionally

[0036] 7 Attorney Docket No. CCF-43675.601

[0037] minus the 5’ and / or 3’ nucleotide, vi) oligonucleotide set six, wherein said FP comprises SEQ ID NO:58 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:59 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:60 optionally minus the 5’ and / or 3’ nucleotide, vii) oligonucleotide set seven, wherein said FP comprises SEQ 5 ID NO:61 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:62 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:63 optionally minus the 5’ and / or 3’ nucleotide, viii) oligonucleotide set eight, wherein said FP comprises SEQ ID NO:64 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:65 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:66 optionally 10 minus the 5’ and / or 3’ nucleotide, ix) oligonucleotide set nine, wherein said FP comprises SEQ ID NO:67 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:68 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:69 optionally minus the 5’ and / or 3’ nucleotide, x) oligonucleotide set ten, wherein said FP comprises SEQ ID NO:70 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:71

[0038] 15 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:72 optionally minus the 5’ and / or 3’ nucleotide, and xi) oligonucleotide set eleven, wherein said FP comprises SEQ ID NO:73 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:74 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:75 optionally minus the 5’ and / or 3’ nucleotide.

[0039] 20 In particular embodiments, the at least one oligonucleotide set comprises at least two, three, four, five, six, seven, eight, nine, ten, eleven, or all twelve of the plurality of oligonucleotide sets. In particular embodiments, the HPV16 or HPV18 nucleic acid (e.g., DNA) is cell-free HPV16 or HPV18 nucleic acid, which is optionally isolated from a plasma sample from the subject or a saliva sample from the subject. In further embodiments, the sample is a 25 treated biological sample from sample to at least partially purify the HPV16 nucleic acid, if present, in the sample. In other embodiments, the detectably labeled probe comprises a fluorescent label and optionally a quencher. In further embodiments, the PCR amplification comprises quantitative PCR (qPCR).

[0040] In particular embodiments, the at least 90% sequence identity is at least 95% or 100% 30 sequence identity. In additional embodiments, the at least 15 consecutive nucleotides is at least 16 or 17 consecutive nucleotides. In further embodiments, the at least 15 consecutive nucleotides is at least 18 or 19 consecutive nucleotides. In additional embodiments, the PCR

[0041] 8 Attorney Docket No. CCF-43675.601

[0042] amplification comprises at least three cycle of PCR (e.g., at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13, 15, 20, 25, or 30).

[0043] In some embodiments, the absence of the signal is detected. In other embodiments, the presence of the signal is detected. In further embodiments, the methods further comprise 5 subjecting the plurality of target HPV16 amplicons (or HPV18 amplicons) to sequencing to generate a plurality of sequencing reads and / or quantifying the amount of the HPV16 (or HPV18) nucleic acid is present in the sample. In further embodiments, the methods further comprise treating the subject with an HPV antiviral.

[0044] 10 DESCRIPTION OF THE DRAWINGS

[0045] Figure 1. Bioinformatics approach to oligonucleotide selection for multiplex cfHPV16 and cfHPV18 qPCR assays. A. Variant allele frequency (VAF) plotted against reference genome position for HPV16 (left) and HPV18 (right) with gene annotation and 3% VAF masking threshold (red dashed line). B. Digitized frequency distribution of cfHPVDNA fragment size 15 (nt=nucleotides) in OPSCC from Leung et al. CCR 2021 (red points) with overlaid fit of 394,000 randomly-generated HPV16 cfDNA fragments from 394 HPV16 genomes (black line), demonstrating close agreement between digitized and fitted distributions. Red vertical dashed line indicates median fragment size of 146nt. C. Probability of detection of a single HPV16 cfDNA fragment in solution plotted against fragment size (nt). Red versus black points with 20 fitted solid lines reflect in silico multiplex (red) versus singleplex (12 separate singleplex amplicons) simulations. Red vertical dashed line indicates median fragment size of 146nt.

[0046] Horizontal blue dashed lines indicates probability of detection at the median fragment size (multiplex: 5.5%; singleplex: 0.5%). D. Cumulative proportion of the final 36 (HPV16) and 33 (HPV18) primers / probes which are conserved in their respective 3,944 and 149 genomes used 25 for assay design. Red dashed lines indicate that <3% of oligonucleotides (i.e., 1 in 33-36) have <97% inclusivity within these genomes. E and F. Specificity of thousands of randomly-generated HPV16 and HPV18 amplicons for 17 other genotypes (E) and the human genome (F) subset by number of mismatched bases for a given nucleotide across the reference genome. Percentages indicate proportion of all oligonucleotides. Oligonucleotides with only 0-2 mismatched bases 30 were filtered out during assay development.

[0047] Figure 2. In silico simulation of 394,000 randomly-generated HPV16 cfDNA fragments from 394 HPV16 genomes serially-diluted from 1-1000 fragments per reaction (x-axis,

[0048] 9 Attorney Docket No. CCF-43675.601

[0049] expressed in genome equivalents). Simulated detection probability of each of the 12 singleplex amplicons is presented alongside detection probability of the multiplex assay assuming that one (bottom left panel) or two (bottom middle panel) fragments are required for successful detection. Multiplex reactions achieve higher probability of detection at low concentrations: the 50% 5 predicted limit of detection was 0.92, 0.24, and 0.09 genome copies per reaction for the singleplex, multiplex (minimum two fragments), and multiple (minimum one fragment) assays.

[0050] Figure 3. Results of analytical validation for multiplex HPV16 qPCR (left, A, B, C) and multiplex HPV18 qPCR (left, D, E, F). A and D: Cycle threshold (Ct) plotted against nominal HPV concentration with solid black linear regression line (HPV16 R2=0.8972, HPV18

[0051] 10 R2=0.8665). B and E: Measured versus nominal HPV concentration with solid black line of identity and red dashed linear regression line. C and F: Bland-Altman plot of measured – nominal HPV concentration plotted against nominal HPV concentration with solid black line (difference of zero) and red dashed line indicating systematic bias.

[0052] Figure 4. A. Progression-free survival and number at risk among 17 patients with HPV-15 positive oropharyngeal carcinoma and available post-treatment plasma specimens, stratified by post-treatment cfHPVDNA landmark result (green = not detected, red = detected). Log-rank P value is provided. B. Characteristics of 36 patients in clinical cohort, including HPV status, smoking status, AJCC 8th edition T / N / Group stage, pre- and post-treatment HPV16 cfDNA result, and post-treatment disease status.

[0053] 20

[0054] DEFINITIONS

[0055] An “amplicon” refers to a nucleic acid fragment formed as a product of natural or artificial amplification events or techniques. For example, an amplicon can be produced by PCR.

[0056] As used herein, the terms “subject” and “patient” are used interchangeably herein and 25 refer to both human and nonhuman animals. The term “nonhuman animals” includes all vertebrates, e.g., mammals and non-mammals, such as nonhuman primates, sheep, dogs, cats, horses, cows, chickens, amphibians, reptiles, and the like. In some embodiments, the subject is a human. In particular embodiments, the subject may be male. In other embodiments, the subject may be female. .

[0057] 30 As used herein, “treat”, “treating”, “treatment”, and variations thereof refer to the clinical intervention made in response to a disease, disorder or physiological condition manifested by a patient or to which a patient may be susceptible. The aim of treatment includes the alleviation or

[0058] 10 Attorney Docket No. CCF-43675.601

[0059] prevention of symptoms, slowing or stopping the progression or worsening of a disease, disorder, or condition and / or the remission of the disease, disorder, or condition.

[0060] DETAILED DESCRIPTION

[0061] The present disclosure relates to compositions, kits, systems, and methods for detecting 5 the presence or absence of human papillomavirus 16 (HPV16) or HPV18 nucleic acid (e.g., cell- free DNA) in a sample from a subject. In particular embodiments, a sample is contacted with at least one set of oligonucleotide having a forward primer, reverse primer, and a detectable labeled probe (e.g., for detecting PCR generated amplicons). In certain embodiments, the amount of HPV16 or HPV18 in the sample is quantitated (e.g., quantitative PCR is employed).

[0062] 10 In work conducted during the development of embodiments herein, a multiplex single- tube hrHPV genotype-specific real-time polymerase chain reaction (qPCR) assay for detection of hrHPV DNA (e.g., cell free) in human plasma and other body fluids was developed. In contrast to commercially-available cervical cancer screening NAATs, the assay, in certain embodiments, is specifically optimized for detection of cell-free DNA (median amplicon size 99 [range 81-15 124]) with greater HPV16 or HPV18 genomic coverage (~16%) while remaining specific for the HPV genotype of interest.

[0063] In some embodiments, the assays herein employ 36 oligonucleotides (24 primers and 12 hydrolysis pair) or employ 39 oligonucleotides (26 primers, 13 hydrolysis probes) for amplification of 12 HPV16-specific amplicons and 1 human internal control. In work conducted 20 during development of embodiments, using a cohort of ~3,900 HPV16 whole genome sequences, the median sensitivity of each individual amplicon was approximately 99% (range, 99.7-95.2%). Cell-free DNA is extracted from plasma or body fluid and amplified in a single tube with TaqMan probe mastermix, primer / probe mix, and nuclease-free water on a real-time PCR instrument. Synthetic HPV whole-genomic DNA served as a positive quantitative control, while 25 nuclease-free water and HPV negative plasma served as no-template and negative controls. The limit of blank is 0 copies per reaction and the 95% lower limit of detection is approximately 0.35 HPV16 genomes per reaction.

[0064] In certain embodiments, such one-step single-tube qPCR formats use techniques and instrumentation generally available in any clinical pathology laboratory conducting routine 30 NAAT (e.g., qualitative or quantitative SARS-CoV-2, influenza, EBV, CMV testing). In contrast to Naveris NavDx, the current assay does not rely, in particular embodiments, on digital PCR instruments which are unavailable in most clinical laboratories (e.g., no digital PCR is performed

[0065] 11 Attorney Docket No. CCF-43675.601

[0066] with the assays herein). In certain embodiments, in contrast to hybrid-capture HPV NGS with ~48 hour turnaround time, the assays herein can be performed in a single step after nucleic acid extraction with rapid turnaround time and do not require multi-step library preparation, and further may be suitable for automated extraction / amplification platforms.

[0067] 5 In particular embodiments, the assays herein are designed to detect short fragments of cell-free DNA in plasma / body fluids (e.g., in contrast to diagnostics designed for cervical cytology specimens). Furthermore, analytical sensitivity of the assays herein, in particular embodiments, is improved by increasing HPV16 genomic coverage from ~1-2% with HPV16 E6 / E7 qPCR / dPCR to ~16% while avoiding primer dimerization and cross-genotype nonspecific 10 amplification. Prior studies have demonstrated that hybrid-capture HPV NGS is much more sensitive than commercial cervical cancer screening NAATs and HPV16 E6 / E7 dPCR due to improved genomic coverage.

[0068] For any of the methods described herein, any suitable sample type may be used. The sample may be obtained from the subject and subsequently used for any of the methods

[0069] 15 described herein. In some embodiments, the sample is obtained from the subject and circulating tumor DNA is isolated from the sample for use in the methods described herein. Suitable samples include fluids (e.g. urine, blood, blood products, sputum, saliva, etc.), solids, tissues, and gases. In some embodiments, the sample is blood (e.g. whole blood) or a blood product such as plasma, serum, and the like. In some embodiments, the sample is a plasma sample. In some 20 embodiments, the sample is a sample obtained from the mouth of the subject. For example, the sample may be a saliva sample. The term “saliva” or “saliva sample” is meant to include any sample containing saliva from the subject, including spit, an oral swab or sponge sample, a mouthwash rinse sample, etc.

[0070] In some embodiments, the probes herein comprise a detectable label. Any suitable 25 detectable label may be used. In some embodiments, the detectable label is a fluorescent label.

[0071] Suitable fluorescent labels include, for example, FAM (5- or 6-carboxyfluorescein), VIC, NED, Fluorescein, FITC, IRD-700 / 800, CY3, CY5, CY3.5, CY5.5, HEX, TET, TAMRA, JOE, ROX, BODIPY TMR, Oregon Green, Rhodamine Green, Rhodamine Red, Texas Red, Yakima Yellow, Alexa Fluor PET, Biosearch Blue™, Marina Blue®, Bothell Blue®, Alexa Fluor®, 350 FAM™, 30 SYBR® Green 1, Fluorescein, EvaGreen™, Alexa Fluor® 488 JOE™, VIC™ HEX™ TET™, CAL Fluor® Gold 540, Yakima Yellow®, ROX™, CAL Fluor® Red 610, Cy3.5™, Texas Red®, Alexa Fluor® 0.568 Cy5™, Quasar™ 670, LightCycler Red640®, Alexa Fluor 633

[0072] 12 Attorney Docket No. CCF-43675.601

[0073] Quasar™ 705, LightCycler Red705®, Alexa Fluor® 680, SYTO® 9, LC Green®, LC Green® Plus+, and EvaGreen™.

[0074] The methods of detecting and / or quantifying HPV16 or HPV18 DNA (e.g., cell free DNA) may be used in a variety of diagnostic or predictive methods. In some embodiments, the 5 methods of detecting or the methods of quantifying HPV16 or HPV18 cfDNA may be used in methods of determining whether a subject has an HPV positive cancer. For example, the methods may be used to determine whether a subject has an HPV positive cervical cancer, head and neck cancer (e.g. oropharyngeal cancer), anal cancer, penile cancer, vaginal cancer, or vulvar cancer. For example, the methods may be used to determine whether a subject has an HPV 10 positive head and neck cancer, such as HPV positive oropharyngeal cancer. In some embodiments, the methods for detecting or the methods for quantifying HPV16 or HPV18 cfDNA may be used in methods of predicting patient response to therapy in a cancer.

[0075] The cell free DNA may be isolated from plasma obtained from the subject. For example, plasma may be obtained and cell free DNA may be isolated using any suitable method. In some 15 embodiments, cell free DNA is isolated using a commercially available kit.

[0076] In some aspects, provided herein are kits, system, and compositions with at least some of the oligonucleotide sets herein. The kits, systems, and compositions may further comprise reagents necessary to purify, isolate, detect and / or quantify HPV16 DNA or HPV18 DNA. For example, the kits, systems, and compositions may further comprise PCR reagents, including 20 buffers and enzymes (e.g. dUTPs, dNTPs). The kit, systems, and compositions may further comprise control samples, if needed. The kit, systems, and compositions may comprise solid surfaces (e.g., beads) comprising capture reagents (e.g., oligonucleotides) specific for target cfDNA. The kits and systems can further include containers for holding or storing a sample (e.g., a container or cartridge for a plasma sample, a container for a DNA sample, etc.). The kits 25 and systems can also include one or more instrument for assisting with obtaining a test sample, such as a syringe.

[0077] EXAMPLES

[0078] 30 EXAMPLE 1

[0079] Highly-Multiplex Detection and Quantitation of Plasma Cell-Free Human Papillomavirus- 16 DNA in Oropharyngeal Carcinoma

[0080] 13 Attorney Docket No. CCF-43675.601

[0081] Plasma cell-free Human Papillomavirus DNA (cfHPVDNA) is a biomarker for oropharyngeal carcinoma. Existing molecular diagnostics utilizing single-target real-time PCR (qPCR), multiplex digital PCR (dPCR), or hybrid-capture next-generation sequencing (NGS) may be limited by inadequate sensitivity, low genomic coverage, specialized instrumentation, or 5 impractical cost / complexity for longitudinal monitoring and minimal residual disease assessment. We designed and validated a highly-multiplex single-tube one-step genotype- specific qPCR assay for detection of cfHPV16DNA in human plasma. Recurrently-mutated or conserved regions within and across HPV genotypes were identified using more than 8,000 whole genome sequences spanning 18 genotypes. Amplicons were optimized for cfHPVDNA 10 fragment size, genotype specificity, and maximal genomic coverage. A human gene served as an endogenous internal control. HPV genomic DNA from four genotypes served as control materials to define analytical sensitivity, specificity, precision, and accuracy. Pre- and post- treatment plasma specimens from patients with HPV-positive and HPV-negative head / neck carcinomas served as clinical controls. Analytical performance near the limit of detection was 15 assessed using in silico and in vitro methods.

[0082] The multiplex cfHPV16DNA qPCR assay spanned 16% of the HPV16 genome with median amplicon size 99 (range, 81-124). Amplicons were conserved in a median of 99.0% (range, 95.2-99.7%) of 3,944 HPV16 genomes in silico and did not amplify human nor seventeen other HPV genotypes. The 95% lower limit of detection was 0.35 HPV16 genome

[0083] 20 copies / reaction (95% CI 0.22-0.48) and the limit of blank was 0. Multiplexing achieved an approximate tenfold improvement in analytical sensitivity compared with single amplicons using in silico simulations of cfHPVDNA fragment distribution, which was in close agreement with experimental observations using both controls and clinical specimens. This approach was replicated for HPV18 with similar findings. In a cohort of 36 patients with mucosal head / neck 25 carcinomas (26 HPV-positive, 12 HPV-negative), there was 100% concordance with tissue HPV status. Pre-treatment specimens with sub-genomic HPV16 cfDNA concentration were also positive by this multiplex assay. In a subset of 11 patients with available testing, there was also 100% concordance with NavDx TTMV HPV detection and genotyping. False negatives were observed with single amplicon assays but not with this multiplex assay among both control 30 materials and clinical specimens. Among 17 patients with available post-treatment landmark plasma specimens, there was 100% PPV and 100% NPV for clinical recurrence.

[0084] 14 Attorney Docket No. CCF-43675.601

[0085] In conclusion, a highly-multiplex qPCR assay was specific for detection of plasma HPV16 cfDNA among subjects with oropharyngeal carcinoma and is prognostic for disease recurrence. Sub-genomic analytical sensitivity was achieved and was in close agreement with in silico findings, demonstrating the value of a bioinformatics simulation approach informed by 5 HPV cfDNA fragment size and a large dataset of published sequences. The one-step single- reaction qPCR format might be more accessible for longitudinal testing than dPCR or NGS due to low cost / complexity, rapid turnaround time, and widespread availability of qPCR instrumentation and trained personnel.

[0086] 10 METHODS

[0087] Assay Design

[0088] We designed and validated a multiplex single-tube, one-step, genotype-specific qPCR assay for the detection of cell-free HPV16 DNA from human plasma. We obtained reference 15 genomes from NIAID PaVe (https: / / pave.niaid.nih.gov / search / search_database) for 18 HPV genotypes as well as 8,124 non-reference genomes for these 18 genotypes from NCBI GenBank (https: / / www.ncbi.nlm.nih.gov / genbank / ). Non-reference genomes were aligned to each corresponding reference genome using default parameters of the Burrows-Wheeler aligner. Positions within each reference genome with variant allele frequency greater than 3% were 20 masked to minimize probability of mutations within oligonucleotides (Figure 1A).

[0089] Using these masked reference genomes, IDT PrimerQuest was used to generate thousands of candidate amplicons (two primers, one hydrolysis probe) no larger than 125 nucleotides based on a prior study of cfHPVDNA fragment size (Figure 1B, 1C).

[0090] Oligonucleotides were designed with similar melt temperatures to facilitate multiplexing.

[0091] 25 Thereafter, amplicons were filtered among these candidates to permit single-tube multiplexing with sensitivity and specificity for HPV16 DNA, defined as conservation among >97% HPV16 genomes, <3% of non-HPV16 genomes (0-2 mismatched bases), and no oligonucleotides with fewer than 3 mismatched bases in the GRCh38 human genome (https: / / hgdownload.soe.ucsc.edu / downloads.html). A final set of amplicons were selected 30 among these filtered candidates by maximizing genomic coverage while assessing compatibility for multiplexing (non-overlapping amplicons and low probability of primer dimerization at the

[0092] 15 Attorney Docket No. CCF-43675.601

[0093] annealing temperature). An internal control amplifying human RNaseP was also included in the assay.

[0094] Hydrolysis probes targeting HPV and RNaseP contained 5’-FAM / 3’-BFQ and 5’- HEX / 3’-BFQ, respectively. To demonstrate the ability to extend this pipeline to other genotypes, 5 the process was repeated for HPV18. All oligonucleotides were obtained from IDT. Whole- genome HPV control material (genotypes 16, 18, 31, 68) were obtained from ATCC (VR- 3240SD, VR-3241SD, VR-3256SD) and BioRad (HPVP200), which had been quantitated by digital PCR. Positive controls for HPV16 and HPV18 were created by spiking HPV genomic DNA in HPV-negative human plasma (ThermoFisher). HPV-negative human plasma was used 10 as a negative control. Nuclease-free water was used as a no-template control (NTC, ThermoFisher). The NTC and negative controls were used to assess for primer dimers and nonspecific amplification of human DNA. cfDNA was extracted from 1mL double-spun plasma and eluted into 40uL buffer AVE using the QIAamp Circulating Nucleic Acid Kit (Qiagen #55114).

[0095] 15 Real-time PCR was performed using 12.5 µL TaqMan Multiplex Master Mix (Roche, Switzerland), 2.5uL of a primer / probe mix including all oligonucleotides (150nM each primer, 100nM each probe), 5uL template DNA, and 5uL nuclease-free water for a final reaction volume of 25uL. All experiments were conducted using a QuantStudio 3 qPCR instrument with cycling conditions set to 50°C for 2 minutes and 95°C for 10 minutes for the initial denaturation, 20 followed by 45 cycles of 95°C for 0:30 and 57.5°C for 0:15. Fixed fluorescence thresholds (FAM: 20,000; HEX: 3,000) were used to determine each target’s threshold cycle (Ct). Samples with HPV DNA Ct<45 were considered positive. Samples with no detected HPV DNA and RNaseP DNA Ct<45 were considered negative. Samples with neither target detected were considered indeterminate. We also evaluated the impact of extraction volume, oligonucleotide 25 concentration, and template volume on assay sensitivity.

[0096] In Silico Validation

[0097] To estimate the incremental improvement in analytical sensitivity with the multiplexed HPV16 assay compared with individual amplicons in singleplex reactions, we conducted in 30 silico simulations of serial dilution of cfHPVDNA. To accomplish this, we digitized a previously-published frequency distribution of cfHPV DNA fragment size among patients with oropharyngeal carcinomas. From a random sample of 10% of the 3,944 available HPV16

[0098] 16 Attorney Docket No. CCF-43675.601

[0099] genomes, we randomly generated 1,000 cfHPVDNA fragments for each genome by sampling from this digitized frequency distribution. We then assessed whether each individual amplicon would detect cfHPVDNA in simulated serial dilutions from 1-1,000 cfHPVDNA fragments in a given qPCR reaction, and compared this against the multiplexed oligonucleotides. The in silico 5 lower limit of detection (LLOD) was compared against in vitro results.

[0100] Analytical Validation

[0101] The limit of blank was assessed in replicates of 10 using HPV-negative human plasma and nuclease-free water. The 95% LLOD was assessed using synthetic 5uL whole-genome 10 HPV16 and HPV18 DNA control spiked in and serially diluted in 995uL HPV-negative human plasma in ten replicates. Control material had been quantitated by the manufacturer using digital PCR. Probit regression was performed to estimate the 95% LLOD.

[0102] To establish a standard curve between Ct and nominal concentration for precision and accuracy experiments, qPCR was performed using three replicates of four dilution factors (7-15 28,500 genomic copies / mL plasma) followed by linear regression. Analytical precision was assessed at four dilution factors (7-285 genomic copies / mL plasma) in replicates of five for three separate days. In vitro genotype specificity was assessed using the HPV16 and HPV18 multiplex assays against four available whole-genome commercial controls (genotypes 16, 18, 31, 68).

[0103] 20 Clinical Validation

[0104] We assessed the performance of the HPV16 multiplex assay using a set of EDTA plasma specimens collected from 26 patients with newly-diagnosed HPV-positive oropharyngeal carcinomas and 12 patients with HPV-negative mucosal head / neck squamous cell carcinomas. The gold standard for HPV status was site or origin (oropharyngeal vs other) and tissue testing 25 by immunohistochemistry, HPV in situ hybridization, or HPV polymerase chain reaction. We also assessed the prognostic performance of our assay in a subset of patients with HPV-positive oropharyngeal carcinomas and available post-treatment EDTA plasma (0-4 months after completion of curative-intent therapy). We also compared sensitivity and amplicon dropout of singleplex versus multiplex assays using 10 pre-treatment specimens at increasing dilutions 30 (1:10, 1:100, 1:300).

[0105] RESULTS

[0106] 17 Attorney Docket No. CCF-43675.601

[0107] In Silico Validation

[0108] After bioinformatic analysis and multiplex optimization, the HPV16 qPCR assay included 12 HPV16-specific amplicons (Table 1) and the RNaseP internal control (Table 2), whereas the HPV18 qPCR assay included 11 HPV18-specific amplicons (Table 9) and the same 5 internal control.

[0109] TABLE 1

[0110] Target Oligo Sequence (5’->3’) SEQ ID 5’ Mod 3’ Mod Amplicon Region NO: Length (bases) E1 Forward TATGTAGAGGCTGTAGTGGAA1n / a n / a 81

[0111]

[0112] Attorney Docket No. CCF-43675.601

[0113] E6 Forward TGTACTGCAAGCAACAGTTA28n / a n / a 85 primer

[0114] R ATTATTTATATATAT

[0115]

[0116] INTERNAL CONTROL SequenceSEQ ID NO:Modification

[0117] IC Primer AGATTTGGACCTGCGAGC37None

[0118]

[0119] 5 The median amplicon size was 99 (range, 81-125) covering 16% of the HPV16 genome.

[0120] Amplicons were conserved in a median of 99.0% (range, 95.2-99.7%) of 3,944 HPV16 genomes in silico and were specific for HPV16 rather than the human genome or other HPV genotypes (Figure 1D, 1E, 1F). When considering a single cfHPVDNA fragment in the context of fragment size distribution, the predicted probability of detection at the median fragment size of 146nt was 10 5.5% with the multiplex assay compared with 0.5% with any of the 12 individual amplicons (Figure 1C).

[0121] In a simulation of 395,000 HPV16 cfDNA fragments serially diluted from 1-1,000 fragments per reaction, the multiplex reaction achieved an approximately tenfold increase in sensitivity at sub-genomic concentrations (Figure 2). For example, the 50% lower limit of 15 detection was 0.09 vs.0.92 genomic copies per reaction with the multiplex and best-performing singleplex (amplicon 1) assay, respectively. Assuming that the multiplex reaction required 1 vs.

[0122] 2 amplified cfHPVDNA fragments to achieve detection, the respective 95% predicted LLODs were approximately 0.45 and 0.65 genomic copies per reaction

[0123] 19 Attorney Docket No. CCF-43675.601

[0124] Analytical Validation

[0125] Replicates of nuclease-free water and HPV-negative serum found the limit of blank to be zero for both the HPV16 and HPV18 assays (Table 3).

[0126] 5

[0127] Table 3. Limit of Blank, Lower Limit of Detection, and HPV Genotype Specificity for Multiplex Plasma HPV16 DNA qPCR

[0128] Template HPV16 Non-HPV16 HPV16 Amplification RNaseP Amplification Concentration Concentration Status Status iti iti

[0129]

[0130] RnaseP was detected in all plasma replicates, and neither the HPV16 nor HPV18 multiplex 10 assays exhibited cross-reactivity with HPV16 / 18 / 31 / 68 genomic DNA. The 95% LLOD was determined to be 0.35 HPV16 genomic copies / reaction (95% CI 0.22-0.48) and 0.33 HPV18 genomic copies / reaction (95% CI 0.20-0.46). This was similar to the predicted in silico 95% LLOD (0.45). Within-lab precision (Sl) were 0.197-0.305 and 0.084-0.201 for the HPV16 and

[0131] 20 Attorney Docket No. CCF-43675.601

[0132] HPV18 multiplex assays, respectively (Table 4). There was a slight negative systematic bias for the HPV16 assay which was not observed for HPV18 (Figure 3).

[0133] Table 4. Analytical Precision, Linearity, and Accuracy of Multiplex Plasma HPV16 and HPV18 DNA qPCR Assay Multiplex plasma HPV16 qPCR Multiplex plasma HPV18 qPCR

[0134] Nominal 260 26 13 6.5

[0135] %

[0136] 5

[0137]

[0138] We also evaluated the impact of extraction volume, template volume, and RnaseP oligonucleotide concentration on quantity of detected control HPV16 cfDNA (Table 5).

[0139] 10 Table 5. Impact of Extraction Volume and Oligonucleotide Concentration on Performance of Multiplex Plasma HPV16 DNA qPCR

[0140] Extracted Template HPV16 RnaseP HPV16 HPV16 on

[0141]

[0142] Attorney Docket No. CCF-43675.601

[0143] Volume

[0144] (mL)

[0145] 1 5 Sinllx 100nM rimr 302 100

[0146]

[0147] ional to template volume (5 vs 10 uL) and extraction volume (1 vs 5mL). Halving RnaseP oligonucleotide concentrations did not substantially impact results.

[0148] 5

[0149] Clinical Validation

[0150] Characteristics of the clinical cohort are presented in Table 6, with clinical p16 / HPV testing presented in Table 7.

[0151] 10Table 6. Patient Characteristics at Diagnosis for Clinical Validation

[0152] HPV-Positive

[0153] Oroharneal HPV-Negative

[0154] <

[0155]

[0156] Attorney Docket No. CCF-43675.601

[0157] Tumor site

[0158] Oropharynx 26 (100%) 2 (17%)

[0159] Oral Cavit 0 (0%) 3 (25%)

[0160] percent). HNSCC, head and neck

[0161]

[0162] (mucosa) squamous ce carcnoma

[0163] *T4 (HPV-positive), T4a (HPV-negative). **N2 (HPV-positive), N2b (HPV-negative), N3b (HPV-negative).

[0164] 5 Table 7. Concordance between Multiplex Plasma HPV16 DNA qPCR and Tissue HPV Status at Diagnosis and During Surveillance

[0165] 23 Attorney Docket No. CCF-43675.601

[0166] HPV-Positive

[0167] Oropharyngeal HPV-Negative

[0168] Ci HNSCC

[0169] I

[0170] ucosal) squamous cell carcinoma;

[0171]

[0172] p esng no ncae n remaner o paens ue o prmary se of disease in larynx or oral cavity.

[0173] Most patients with HPV-positive and HPV-negative carcinomas were treated with 5 definitive chemoradiotherapy (81% vs.58%, respectively). Median post-treatment follow-up was 7.5 months among all patients. Among the 26 HPV-positive and 12 HPV-negative tumors, there was 100% concordance between the HPV16 multiplex assay and HPV status as determined by tissue p16 / HPV testing (Table 7). No patient with HPV-negative tumors had detectable HPV16 cfDNA. Among 11 patients with pre-treatment NavDx testing, there was 100% concordance with 10 HPV status and HPV genotype (all HPV16). Lack of HPV18-positive clinical samples precluded

[0174] 24 Attorney Docket No. CCF-43675.601

[0175] clinical validation of the HPV18 multiplex assay. The median estimated HPV16 cfDNA concentration was 31.7 copies / mL (range, 0.72-3,785.14). One patient had estimated cfHPVDNA concentration below 1 genomic copy per mL at diagnosis, in support of the observed sub-genomic analytical sensitivity.

[0176] 5 Next, we compared detection of HPV16 cfDNA between the multiplex and singleplex (12 individual amplicons) assays among ten pre-treatment clinical samples (Table 8).

[0177] Table 8. Estimated HPV16 Genome Copy Number per Milliliter Plasma, Multiplex versus Singleplex qPCR Multiplex

[0178] Patient ID HPV16 E1 E2 E5 L2AL2BL1AL1BL1CURR E6 E6 / E7 E7

[0179] qPCR

[0180] 2.9

[0181] 7.2

[0182] 12

[0183] 2.3

[0184] 5.3

[0185] .9

[0186] 2.9

[0187] 4.2

[0188] 9.2

[0189] 0.3 7.9 .9 2.3 / 10

[0190] 10acid (451 E1:

[0191]

[0192] p / mL; 451 URR: 5.6 cp / mL).

[0193] Using the standard extraction and template volumes (1mL, 5uL), six of the 12 amplicons 15 failed to detect HPV16 in at least one patient. When the singleplex reactions were repeated with triple the template volume (15uL), HPV16 cfDNA was detected, indicating false negative due to cfDNA concentration rather than mutations within oligonucleotides. Thereafter, one sample was serially diluted (1:10, 1:100, 1:300) and amplified in triplicate with the multiplex vs. L1B singleplex assay, demonstrating detection in 2 / 3 multiplex replicates vs.0 / 3 singleplex replicate 20 at 1:300 dilution, highlighting the incremental sensitivity with multiplexing among clinical samples.

[0194] Among 17 patients with available post-treatment plasma specimens (0-4 months), one patient has developed clinical recurrence thus far (Table 7). This patient underwent definitive

[0195] 25 Attorney Docket No. CCF-43675.601

[0196] radiotherapy alone for stage I oropharyngeal carcinoma with pre-treatment cfHPV16 DNA of 145 copies / mL. Three months after treatment, they were found to have new out-of-field biopsy- proven nodal recurrence with plasma cfHPV16 DNA of 7.25 copies / mL. None of the 16 other patients had detectable cfHPV16 DNA after treatment and none have recurred, indicating 100% 5 PPV and 100% NPV in this small cohort with limited follow-up.

[0197] Table 9. Oligonucleotides for Multiplex Plasma HPV18 DNA qPCR

[0198] Target Oligonucleotide Sequence (5’->3’) SEQ 5’ 3’ Amplicon Region ID Mod Mod Length NO (bases) 10

[0199]

[0200] REFERENCES

[0201] 1. Dyne EAV. Trends in Human Papillomavirus–Associated Cancers — United States, 1999–2015. MMWR Morb Mortal Wkly Rep.2018;67.

[0202] 26 Attorney Docket No. CCF-43675.601

[0203] 2. Zhang Y, Fakhry C, D’Souza G. Projected Association of Human Papillomavirus Vaccination With Oropharynx Cancer Incidence in the US, 2020-2045. JAMA Oncol.

[0204] 2021;7(10):e212907.

[0205] 3. Leung E, Han K, Zou J, et al. HPV Sequencing Facilitates Ultrasensitive Detection of 5 HPV Circulating Tumor DNA. Clin Cancer Res.2021;27(21):5857-5868.

[0206] 4. Chera BS, Kumar S, Shen C, et al. Plasma Circulating Tumor HPV DNA for the Surveillance of Cancer Recurrence in HPV-Associated Oropharyngeal Cancer. J Clin Oncol Off J Am Soc Clin Oncol.2020;38(10):1050-1058.

[0207] 5. Cao H, Banh A, Kwok S, et al. Quantitation of Human Papillomavirus DNA in Plasma of 10 Oropharyngeal Carcinoma Patients. Int J Radiat Oncol.2012;82(3):e351-e358.

[0208] 6. Routman DM, Kumar S, Chera BS, et al. Detectable Postoperative Circulating Tumor Human Papillomavirus DNA and Association with Recurrence in Patients With HPV-Associated Oropharyngeal Squamous Cell Carcinoma. Int J Radiat Oncol Biol Phys.2022;113(3):530-538.

[0209] 7. Hanna GJ, Roof SA, Jabalee J, et al. Negative Predictive Value of Circulating Tumor 15 Tissue Modified Viral (TTMV)-HPV DNA for HPV-driven Oropharyngeal Cancer Surveillance.

[0210] Clin Cancer Res Off J Am Assoc Cancer Res.2023;29(20):4306-4313.

[0211] 8. Chen L, Cohen M, Hatzoglou V, et al. Early Disease Recurrence Following Post- operative HPV ctDNA Directed Active Surveillance in Oropharyngeal Carcinoma – Outcomes of a Prospective Pilot Study. In: ASTRO; 2024. Accessed September 22, 2024.

[0212] 20 https: / / astro.confex.com / astro / hncs2024 / meetingapp.cgi / Paper / 60851

[0213] 9. Yom SS, Torres-Saavedra P, Caudell JJ, et al. Reduced-Dose Radiation Therapy for HPV-Associated Oropharyngeal Carcinoma (NRG Oncology HN002). J Clin Oncol Off J Am Soc Clin Oncol.2021;39(9):956-965.

[0214] 10. Ahn SM, Chan JYK, Zhang Z, et al. Saliva and Plasma Quantitative Polymerase Chain 25 Reaction–Based Detection and Surveillance of Human Papillomavirus–Related Head and Neck Cancer. JAMA Otolaryngol-- Head Neck Surg.2014;140(9):846-854.

[0215] 11. Centers for Medicare and Medicaid Services.2019 Medicare Clinical Laboratory Fee Schedule. Published 2019. Accessed January 20, 2019. https: / / www.cms.gov / Medicare / Medicare-Fee-for-Service-30 Payment / ClinicalLabFeeSched / Clinical-Laboratory-Fee-Schedule-Files- Items / 19CLABQ1.html?DLPage=1&DLEntries=10&DLSort=2&DLSortDir=descending

[0216] 27 Attorney Docket No. CCF-43675.601

[0217] 12. Chan KCA, Woo JKS, King A, et al. Analysis of Plasma Epstein-Barr Virus DNA to Screen for Nasopharyngeal Cancer. N Engl J Med.2017;377(6):513-522.

[0218] 13. Lo YM, Chan LY, Lo KW, et al. Quantitative analysis of cell-free Epstein-Barr virus DNA in plasma of patients with nasopharyngeal carcinoma. Cancer Res.1999;59(6):1188-1191.

[0219] 5 14. Tang LL, Guo R, Zhang N, et al. Effect of Radiotherapy Alone vs Radiotherapy With Concurrent Chemoradiotherapy on Survival Without Disease Relapse in Patients With Low-risk Nasopharyngeal Carcinoma: A Randomized Clinical Trial. JAMA.2022;328(8):728-736.

[0220] 10 It is understood that the foregoing detailed description and accompanying examples are merely illustrative and are not to be taken as limitations upon the scope of the disclosure, which is defined solely by the appended claims and their equivalents. Various changes and modifications to the disclosed embodiments will be apparent to those skilled in the art. Any patents and publications referenced herein are herein incorporated by reference in their entireties.

[0221] 28

Claims

1. Attorney Docket No. CCF-43675.6012.CLAIMS3.We claim:

1. A method for detecting HPV16 nucleic acid in a sample comprising:5.a) contacting a sample from a subject with at least one oligonucleotide set from a plurality of oligonucleotide sets,6.wherein each oligonucleotide set comprises: a forward primer (FP) with at least 90% sequence identity to, and / or at least 15 consecutive nucleotides from, an FP sequence, a reverse primer (RP) with at least 90% sequence identity to, and / or at least 15 consecutive nucleotides from, an RP sequence, and a detectably labeled probe (PB) with at least 90% sequence identity to, and / or 15 consecutive nucleotides from, a PB sequence, and7.wherein said plurality of oligonucleotide sets are selected from:8.i) oligonucleotide set one, wherein said FP comprises SEQ ID NO:1 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:2 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:3 optionally minus the 5’ and / or 3’ nucleotide,9.ii) oligonucleotide set two, wherein said FP comprises SEQ ID NO:4 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:5 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:6 optionally minus the 5’ and / or 3’ nucleotide,10.iii) oligonucleotide set three, wherein said FP comprises SEQ ID NO:7 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:8 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:9 optionally minus the 5’ and / or 3’ nucleotide,11.iv) oligonucleotide set four, wherein said FP comprises SEQ ID NO:10 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:11 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:12 optionally minus the 5’ and / or 3’ nucleotide,12.v) oligonucleotide set five, wherein said FP comprises SEQ ID NO:13 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:14 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:15 optionally minus the 5’ and / or 3’ nucleotide,13.vi) oligonucleotide set six, wherein said FP comprises SEQ ID NO:16 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:17 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:18 optionally minus the 5’ and / or 3’ nucleotide,14.vii) oligonucleotide set seven, wherein said FP comprises SEQ ID NO:19 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:20 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:21 optionally minus the 5’ and / or 3’ nucleotide,15.29 Attorney Docket No. CCF-43675.60116.viii) oligonucleotide set eight, wherein said FP comprises SEQ ID NO:22 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:23 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:24 optionally minus the 5’ and / or 3’ nucleotide,17.ix) oligonucleotide set nine, wherein said FP comprises SEQ ID NO:25 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:26 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:27 optionally minus the 5’ and / or 3’ nucleotide,18.x) oligonucleotide set ten, wherein said FP comprises SEQ ID NO:28 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:29 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:30 optionally minus the 5’ and / or 3’ nucleotide,19.xi) oligonucleotide set eleven, wherein said FP comprises SEQ ID NO:31 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:32 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:33 optionally minus the 5’ and / or 3’ nucleotide, and xii) oligonucleotide set twelve, wherein said FP comprises SEQ ID NO:34 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:35 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:36 optionally minus the 5’ and / or 3’ nucleotide,20.b) subjecting said sample to PCR amplification to generate a plurality of target HPV16 amplicons if HPV16 nucleic acid is present in said sample; and21.c) detecting the presence or absence of a signal from at least one of said detectably labelled probes, wherein the presence of said signal: i) indicates that said at least one detectably labelled probe binds to at least some of said plurality of target HPV16 amplicon, and ii) indicates the presence of HPV16 nucleic acid in said sample.

2. The method of claim 1, wherein said at least one oligonucleotide set comprises at least two of said plurality of oligonucleotide sets.

3. The method of claim 1, wherein said with at least one oligonucleotide set comprises at least three of said plurality of oligonucleotide sets.

4. The method of claim 1, wherein said with at least one oligonucleotide set comprises at least four of said plurality of oligonucleotide sets.

5. The method of claim 1, wherein said HPV16 nucleic acid is cell-free HPV16 nucleic acid, which is optionally isolated from a plasma sample from said subject or a saliva sample from said subject.26.30 Attorney Docket No. CCF-43675.6016. The method of claim 1, wherein said sample is a treated biological sample from sample to at least partially purify said HPV16 nucleic acid, if present, in said sample.

7. The method of any one of the preceding claims, wherein said detectably labeled probe comprises a fluorescent label and optionally a quencher.

8. The method of any of the proceeding claims, wherein said PCR amplification comprises quantitative PCR (qPCR).

9. The method of any of the proceeding claims, wherein said at least 90% sequence identity is at least 95% or 100% sequence identity.

10. The method of any of the proceeding claims, wherein said at least 15 consecutive nucleotides is at least 16 or 17 consecutive nucleotides.

11. The method of any of the proceeding claims, wherein said at least 15 consecutive nucleotides is at least 18 or 19 consecutive nucleotides.

12. The method of any of the proceeding claims, wherein said PCR amplification comprises at least three cycle of PCR.

13. The method of claim 1, wherein said absence of said signal is detected.

14. The method of any of the proceeding claims, wherein said presence of said signal is detected.

15. The method of claim 14, further comprising subjecting said plurality of target HPV16 amplicons to sequencing to generate a plurality of sequencing reads and / or quantifying the amount of said HPV16 nucleic acid is present in said sample.

16. The method of claim 14, further comprising treating said subject with an HPV antiviral.38.31 Attorney Docket No. CCF-43675.60117. A composition or kit or system comprising: at least one oligonucleotide set from a plurality of oligonucleotide sets,40.wherein each oligonucleotide set comprises: a forward primer (FP) with at least 90% sequence identity to, and / or at least 15 consecutive nucleotides from, an FP sequence, a reverse primer (RP) with at least 90% sequence identity to, and / or at least 15 consecutive nucleotides from, an RP sequence, and a detectably labeled probe (PB) with at least 90% sequence identity to, and / or 15 consecutive nucleotides from, a PB sequence, and41.wherein said plurality of oligonucleotide sets are selected from:42.i) oligonucleotide set one, wherein said FP comprises SEQ ID NO:1 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:2 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:3 optionally minus the 5’ and / or 3’ nucleotide,43.ii) oligonucleotide set two, wherein said FP comprises SEQ ID NO:4 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:5 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:6 optionally minus the 5’ and / or 3’ nucleotide,44.iii) oligonucleotide set three, wherein said FP comprises SEQ ID NO:7 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:8 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:9 optionally minus the 5’ and / or 3’ nucleotide,45.iv) oligonucleotide set four, wherein said FP comprises SEQ ID NO:10 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:11 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:12 optionally minus the 5’ and / or 3’ nucleotide,46.v) oligonucleotide set five, wherein said FP comprises SEQ ID NO:13 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:14 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:15 optionally minus the 5’ and / or 3’ nucleotide,47.vi) oligonucleotide set six, wherein said FP comprises SEQ ID NO:16 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:17 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:18 optionally minus the 5’ and / or 3’ nucleotide,48.32 Attorney Docket No. CCF-43675.60149.vii) oligonucleotide set seven, wherein said FP comprises SEQ ID NO:19 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:20 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:21 optionally minus the 5’ and / or 3’ nucleotide,50.viii) oligonucleotide set eight, wherein said FP comprises SEQ ID NO:22 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:23 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:24 optionally minus the 5’ and / or 3’ nucleotide,51.ix) oligonucleotide set nine, wherein said FP comprises SEQ ID NO:25 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:26 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:27 optionally minus the 5’ and / or 3’ nucleotide,52.x) oligonucleotide set ten, wherein said FP comprises SEQ ID NO:28 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:29 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:30 optionally minus the 5’ and / or 3’ nucleotide,53.xi) oligonucleotide set eleven, wherein said FP comprises SEQ ID NO:31 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:32 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:33 optionally minus the 5’ and / or 3’ nucleotide, and54.xii) oligonucleotide set twelve, wherein said FP comprises SEQ ID NO:34 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:35 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:36 optionally minus the 5’ and / or 3’ nucleotide.

18. The composition, kit, or system of claim 17, wherein said at least one oligonucleotide set comprises at least two of said plurality of oligonucleotide sets.

19. The composition, kit, or system of claim 17, wherein said with at least one oligonucleotide set comprises at least three of said plurality of oligonucleotide sets.

20. The composition, kit, or system of claim 17, wherein said with at least one oligonucleotide set comprises at least four of said plurality of oligonucleotide sets.58.33 Attorney Docket No. CCF-43675.60121. The composition, kit, or system of claim 17, further comprising a sample from a subject suspected of containing HPV16 nucleic acid.

22. The composition, kit, or system of claim 21, wherein said HPV16 nucleic acid is cell-free HPV16 nucleic acid, which is optionally isolated from a plasma sample from said subject or a saliva sample from said subject.

22. The composition, kit, or system of claim 21, wherein said sample is a treated biological sample from sample to at least partially purify said HPV16 nucleic acid, if present, in said sample.

23. The composition, kit, or system of claim 17, wherein said detectably labeled probe comprises a fluorescent label and optionally a quencher.

24. The composition, kit, or system of any of the proceeding claims, wherein said at least 90% sequence identity is at least 95% or 100% sequence identity.

25. The composition, kit, or system of any of the proceeding claims, wherein said at least 15 consecutive nucleotides is at least 16 or 17 consecutive nucleotides.

26. The composition, kit, or system of any of the proceeding claims, wherein said at least 15 consecutive nucleotides is at least 18 or 19 consecutive nucleotides.66.34 Attorney Docket No. CCF-43675.60127. A method for detecting HPV18 nucleic acid in a sample comprising:68.a) contacting a sample from a subject with at least one oligonucleotide set from a plurality of oligonucleotide sets, wherein each oligonucleotide set comprises:69.a forward primer (FP) with at least 90% sequence identity to, and / or at least 15 consecutive nucleotides from, an FP sequence, a reverse primer (RP) with at least 90% sequence identity to, and / or at least 15 consecutive nucleotides from, an RP sequence, and a detectably labeled probe (PB) with at least 90% sequence identity to, and / or 15 consecutive nucleotides from, a PB sequence, and70.wherein said plurality of oligonucleotide sets are selected from:71.i) oligonucleotide set one, wherein said FP comprises SEQ ID NO:43 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:44 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:45 optionally minus the 5’ and / or 3’ nucleotide,72.ii) oligonucleotide set two, wherein said FP comprises SEQ ID NO:46 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:47 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:48 optionally minus the 5’ and / or 3’ nucleotide,73.iii) oligonucleotide set three, wherein said FP comprises SEQ ID NO:49 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:50 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:51 optionally minus the 5’ and / or 3’ nucleotide,74.iv) oligonucleotide set four, wherein said FP comprises SEQ ID NO:52 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:53 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:54 optionally minus the 5’ and / or 3’ nucleotide,75.v) oligonucleotide set five, wherein said FP comprises SEQ ID NO:55 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:56 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:57 optionally minus the 5’ and / or 3’ nucleotide,76.vi) oligonucleotide set six, wherein said FP comprises SEQ ID NO:58 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:59 optionally minus the 5’77.35 Attorney Docket No. CCF-43675.60178.and / or 3’ nucleotide, and said PB comprises SEQ ID NO:60 optionally minus the 5’ and / or 3’ nucleotide,79.vii) oligonucleotide set seven, wherein said FP comprises SEQ ID NO:61 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:62 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:63 optionally minus the 5’ and / or 3’ nucleotide,80.viii) oligonucleotide set eight, wherein said FP comprises SEQ ID NO:64 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:65 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:66 optionally minus the 5’ and / or 3’ nucleotide,81.ix) oligonucleotide set nine, wherein said FP comprises SEQ ID NO:67 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:68 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:69 optionally minus the 5’ and / or 3’ nucleotide,82.x) oligonucleotide set ten, wherein said FP comprises SEQ ID NO:70 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:71 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:72 optionally minus the 5’ and / or 3’ nucleotide, and83.xi) oligonucleotide set eleven, wherein said FP comprises SEQ ID NO:73 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:74 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:75 optionally minus the 5’ and / or 3’ nucleotide,84.b) subjecting said sample to PCR amplification to generate a plurality of target HPV18 amplicons if HPV18 nucleic acid is present in said sample; and85.c) detecting the presence or absence of a signal from at least one of said detectably labelled probes, wherein the presence of said signal: i) indicates that said at least one detectably labelled probe binds to at least some of said plurality of target HPV18 amplicon, and ii) indicates the presence of HPV18 nucleic acid in said sample.

28. The method of claim 27, wherein said at least one oligonucleotide set comprises at least two of said plurality of oligonucleotide sets.87.36 Attorney Docket No. CCF-43675.60129. The method of claim 27, wherein said with at least one oligonucleotide set comprises at least three of said plurality of oligonucleotide sets.

30. The method of claim 27, wherein said with at least one oligonucleotide set comprises at least four of said plurality of oligonucleotide sets.

31. The method of claim 27, wherein said HPV18 nucleic acid is cell-free HPV18 nucleic acid, which is optionally isolated from a plasma sample from said subject or a saliva sample from said subject.

32. The method of claim 27, wherein said sample is a treated biological sample from sample to at least partially purify said HPV18 nucleic acid, if present, in said sample.

33. The method of any one of the preceding claims, wherein said detectably labeled probe comprises a fluorescent label and optionally a quencher.

34. The method of any of the proceeding claims, wherein said PCR amplification comprises quantitative PCR (qPCR).

35. The method of any of the proceeding claims, wherein said at least 90% sequence identity is at least 95% or 100% sequence identity.

36. The method of any of the proceeding claims, wherein said at least 15 consecutive nucleotides is at least 16 or 17 consecutive nucleotides.

37. The method of any of the proceeding claims, wherein said at least 15 consecutive nucleotides is at least 18 or 19 consecutive nucleotides.

38. The method of any of the proceeding claims, wherein said PCR amplification comprises at least three cycle of PCR.

39. The method of claim 1, wherein said absence of said signal is detected.99.37 Attorney Docket No. CCF-43675.60140. The method of any of the proceeding claims, wherein said presence of said signal is detected.

41. The method of claim 40, further comprising subjecting said plurality of target HPV18 amplicons to sequencing to generate a plurality of sequencing reads and / or quantifying the amount of said HPV18 nucleic acid is present in said sample.

42. The method of claim 30, further comprising treating said subject with an HPV antiviral.

43. A composition or kit or system comprising: at least one oligonucleotide set from a plurality of oligonucleotide sets,104.wherein each oligonucleotide set comprises: a forward primer (FP) with at least 90% sequence identity to, and / or at least 15 consecutive nucleotides from, an FP sequence, a reverse primer (RP) with at least 90% sequence identity to, and / or at least 15 consecutive nucleotides from, an RP sequence, and a detectably labeled probe (PB) with at least 90% sequence identity to, and / or 15 consecutive nucleotides from, a PB sequence, and105.wherein said plurality of oligonucleotide sets are selected from:106.i) oligonucleotide set one, wherein said FP comprises SEQ ID NO:43 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:44 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:45 optionally minus the 5’ and / or 3’ nucleotide,107.ii) oligonucleotide set two, wherein said FP comprises SEQ ID NO:46 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:47 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:48 optionally minus the 5’ and / or 3’ nucleotide,108.iii) oligonucleotide set three, wherein said FP comprises SEQ ID NO:49 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:50 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:51 optionally minus the 5’ and / or 3’ nucleotide,109.iv) oligonucleotide set four, wherein said FP comprises SEQ ID NO:52 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:53 optionally minus the 5’110.38 Attorney Docket No. CCF-43675.601111.and / or 3’ nucleotide, and said PB comprises SEQ ID NO:54 optionally minus the 5’ and / or 3’ nucleotide,112.v) oligonucleotide set five, wherein said FP comprises SEQ ID NO:55 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:56 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:57 optionally minus the 5’ and / or 3’ nucleotide,113.vi) oligonucleotide set six, wherein said FP comprises SEQ ID NO:58 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:59 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:60 optionally minus the 5’ and / or 3’ nucleotide,114.vii) oligonucleotide set seven, wherein said FP comprises SEQ ID NO:61 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:62 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:63 optionally minus the 5’ and / or 3’ nucleotide,115.viii) oligonucleotide set eight, wherein said FP comprises SEQ ID NO:64 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:65 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:66 optionally minus the 5’ and / or 3’ nucleotide,116.ix) oligonucleotide set nine, wherein said FP comprises SEQ ID NO:67 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:68 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:69 optionally minus the 5’ and / or 3’ nucleotide,117.x) oligonucleotide set ten, wherein said FP comprises SEQ ID NO:70 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:71 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:72 optionally minus the 5’ and / or 3’ nucleotide, and118.xi) oligonucleotide set eleven, wherein said FP comprises SEQ ID NO:73 optionally minus the 5’ and / or 3’ nucleotide, said RP comprises SEQ ID NO:74 optionally minus the 5’ and / or 3’ nucleotide, and said PB comprises SEQ ID NO:75 optionally minus the 5’ and / or 3’ nucleotide.119.39 Attorney Docket No. CCF-43675.60144. The composition, kit, or system of claim 43, wherein said at least one oligonucleotide set comprises at least two of said plurality of oligonucleotide sets.

45. The composition, kit, or system of claim 43, wherein said with at least one oligonucleotide set comprises at least three of said plurality of oligonucleotide sets.

46. The composition, kit, or system of claim 43, wherein said with at least one oligonucleotide set comprises at least four of said plurality of oligonucleotide sets.

47. The composition, kit, or system of claim 43, further comprising a sample from a subject suspected of containing HPV18 nucleic acid.

48. The composition, kit, or system of claim 47, wherein said HPV18 nucleic acid is cell-free HPV16 nucleic acid, which is optionally isolated from a plasma sample from said subject or a saliva sample from said subject.

49. The composition, kit, or system of claim 47, wherein said sample is a treated biological sample from sample to at least partially purify said HPV16 nucleic acid, if present, in said sample.

50. The composition, kit, or system of claim 43, wherein said detectably labeled probe comprises a fluorescent label and optionally a quencher.

51. The composition, kit, or system of any of the proceeding claims, wherein said at least 90% sequence identity is at least 95% or 100% sequence identity.

52. The composition, kit, or system of any of the proceeding claims, wherein said at least 15 consecutive nucleotides is at least 16 or 17 consecutive nucleotides.

53. The composition, kit, or system of any of the proceeding claims, wherein said at least 15 consecutive nucleotides is at least 18 or 19 consecutive nucleotides.130.40

Citation Information

Patent Citations

  • Methods and systems for HPV detection and quantification

    US20240254573A1

  • Materials and methods for detection of HPV nucleic acids

    US9885092B2