Nanoparticle therapeutic vaccines that simultaneously co-deliver MHC class i and MHC class ii antigens and an adjuvant
The nanoparticle vaccine delivery platform co-delivering MHC class I and II antigens and an adjuvant effectively activates both cytotoxic and helper T cells, addressing the limitations of current cancer therapies by enhancing immune responses and treating cancers and autoimmune diseases.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2025-09-26
- Publication Date
- 2026-04-02
AI Technical Summary
Current cancer therapies, such as radiation and immune checkpoint therapies, are ineffective in curing a majority of patients and can cause severe side effects, while cancer vaccines fail to effectively elicit robust antigen-specific immune responses due to the lack of simultaneous delivery of MHC class I and II antigens.
A nanoparticle vaccine delivery platform that simultaneously co-delivers MHC class I and II restricted antigens and an adjuvant, tailored to induce targeted immune responses in cancer and autoimmune diseases, using hollow protein nanoparticles with specific antigens and adjuvants conjugated to the surface or loaded into the inner cavity, optimized for dendritic cell uptake.
The platform induces robust antigen-specific immune responses, prolonging survival in cancer models by activating both cytotoxic CD8+ and helper CD4+ T cells, reducing tumor growth, and modulating immune responses to treat various cancers and autoimmune diseases.
Smart Images

Figure US2025048321_02042026_PF_FP_ABST
Abstract
Description
Atorney docket No. 00058-088W01NANOPARTICLE THERAPEUTIC VACCINES THAT SIMULTANEOUSLY CO-DELIVER MHC CLASS I AND MHC CLASS II ANTIGENS AND AN ADJUVANTCROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority under 35 U.S. C. §119 from Provisional Application Senal No. 63 / 700,571, filed September 27, 2024, the disclosure of which is incorporated herein by reference.STATEMENT OF GOVERNMENT SUPPORT
[0002] This invention was made with Government support under Grant No. R01EB027797 awarded by the National Institute of Biomedical Imaging and Bioengineering, and Grant No. P30CA062203 awarded by the National Cancer Institute. The Government has certain rights in the invention.INCORPORATION BY REFERENCE OF SEQUENCE LISTING
[0003] Accompanying this filing is a Sequence Listing entitled,L‘00058-088W01.xml” created on September 26, 2025, and having 15,176 bytes of data, machine formatted on IBM- PC, MS-Windows operating system. The sequence listing is hereby incorporated by reference in its entirety for all purposes.TECHNICAL FIELD
[0004] Provided is a nanoparticle vaccine delivery platform that simultaneously codelivers MHC class I and II restricted antigens and an adjuvant. Also provided is the use of the nanoparticle vaccine delivery platform to is elicit a targeted immune response in a subject having or suspected of having or suspected of having cancer, an autoimmune disease, or an autoimmune state. Additionally provided are methods for immunizing a subject having or suspected of having a cancer, an autoimmune disease, or an autoimmune state with the nanoparticle vaccine delivery platform.BACKGROUND
[0005] Cancer remains a major cause of death in the United States, but current therapies such as radiation therapy can lack effectiveness or cause severe side-effects. Melanoma is a particularly aggressive cancer, resulting in a disproportionate majority of all skin cancer deaths due to high evasion of treatment, especially when early intervention is not applied. Great efforts been expended to advance the field of immunotherapy, where immune system features are utilized for cancer treatment. The activation and persistence of cytotoxic T cellsAtorney docket No. 00058-088W01 for tumor cell lysis is of particular importance to maintain a sustainable anti-tumor immune response. For instance, immune checkpoint therapies, e.g. anti-PD-1 and anti-PD-Ll can facilitate the activation of T cells to increase tumor lysis, and these treatments have become widely adopted in the clinic over the past decade for dozens of cancer types, including melanoma. However, both classes of immune checkpoint therapy are insufficient to cure a majority of patients, and such treatments are not tumor-specific and can elicit a number of short- or long-term side effects. By contrast, cancer vaccines are immunotherapies that modulate interplay between dendritic cells (DCs) and T cell to induce antigen specific immunity, offering a promising strategy for the treatment of even highly aggressive and persistent cancers like melanoma among other diseases.
[0006] The capacity to deliver both MHC class I and class II antigens provides the opportunity' to “tune” the elicited antigen-specific immune response via choice of antigen, specifically MHC class II antigen, and adjuvant. For anti-tumor immune response, a T helper Class I immune response is favored. For autoimmune or chronic inflammatory states, T Helper Class II responses are favored. This platform provides the opportunity to tailor the immune system education and thus the class or phenotype of immune response.SUMMARY
[0007] Tumor-associated antigens (TAAs) are promising targets of NP cancer vaccines, especially major histocompatibility complex (MHC) class I-restricted TAAs. Following uptake and activation of DCs by nanoparticle (NP) vaccines, DCs can “educate” CD8+ T cells against the MHC class I restricted TAA, as mediated by display on MHC class I polypeptides. Although eliciting a robust antigen-specific CD8+ T cell-mediated adaptive immune response against tumor cells is the primary goal of cancer vaccines, a growing body of evidence supports the importance of CD4+ T cells activated against MHC class II peptides. CD4+ T cells can secrete supportive cytokines such as interleukin (IL)-2 or promote the activation of DCs through the CD40:CD40L interaction. Furthermore, CD4 T cells control the class of immune response from a primarily cytotoxic or killer response (T helper class I) to a primarily antibody-based response (T helper class II). There are additional classes of immune response including: Th3. Thl7, Follicular helper T cells (Tfh), THa helper cells, and regulatory T cell (T reg) responses, the latter of which engages TGF beta production.Atorney docket No. 00058-088W01
[0008] Nanoparticle (NP)-based cancer vaccine therapies conventionally include tumor- associated antigens or neoantigens that are major histocompatibility complex (MHC) class I- restricted, an approach that educates cytotoxic CD8+ T cells to recognize and respond to tumors. Increasing evidence also demonstrates the importance of helper CD4+ T cells, which can support CD8+ T cell-mediated responses and are activated by MHC class Il-presented peptides. However, immune responses elicited by delivering both MHC class I and II antigens using NPs have not been extensively examined for cancer immunotherapies. In melanoma and colon carcinoma murine models, studies were performed herein to evaluate the effects of transporting MHC class I and class II antigens using different NP-based approaches, with the NPs being within the optimal size range for uptake by dendritic cells, which are professional antigen-presenting cells. It was found herein that co-delivering MHC class I and II peptides on dual-antigen NPs with CpG caused proliferation of cytotoxic and helper T cells, and antigen-specific Thl responses (e.g., interferon (IFN)-y secretion) increased relative to single-antigen NPs alone (z.e., either MHC class I or II peptide on aNP) and to mixtures of the single-antigen NPs. In both tumor models, immunization with the dualantigen NPs significantly prolonged survival, with 40% of melanoma- and 71% of colon carcinoma-bearing mice surviving, compared to 0% and 13% of those treated with doseequivalent mixtures of single-antigen NPs, respectively. The disclosure demonstrates the importance of the NP-based antigen delivery strategy, with the simultaneously co-delivery of both MHC class I and II antigens on the same NP to elicit the strongest anti-tumor responses.
[0009] In a particular embodiment, the disclosure provides a vaccine formulation for the simultaneous delivery of MHC class I and II restricted antigens and an adjuvant for the treatment of a cancer, comprising: nanoparticles that are hollow and comprise an outer surface and an accessible inner cavity, wherein MHC class I and II restricted antigens and / or the adjuvant are conjugated to the outer surface of the nanoparticles, and / or wherein MHC class I and II restricted antigens and / or the adjuvant are conjugated or loaded into the inner caviN of the nanoparticles. In a further embodiment, the MHC class I and II restricted antigens are peptides. In yet a further embodiment, the MHC class I and II restricted antigens are associated with a cancer selected from lung cancer, colorectal cancer, melanoma, chronic myeloid leukemia, colorectal carcinoma, stomach cancer, gastric carcinoma, endometrial carcinoma, head and neck squamous cell carcinoma, myeloid leukemia, lung squamous CC, acute lymphoblastic leukemia, acute myelogenous leukemia, chronic lymphocytic leukemia,Atorney docket No. 00058-088W01 renal cell carcinoma, ovarian cancer, metastatic colorectal cancer, pancreatic adenocarcinoma, bladder cancer, lung squamous cell carcinoma, promyelocytic leukemia, sarcoma, breast cancer, prostate cancer, liver cancer, thyroid cancer, testicular cancer, kidney cancer, glioblastoma, pancreatic cancer, and retinal cancer. In another embodiment, the MHC class I and II restricted antigens are selected from NY-ESO-1, gplOO, CT26, alphafetoprotein (AFP), carcinoembryonic antigen (CEA), CA-125, CA15-3. CA19-9, MUC- I, epithelial tumor antigen (ETA), tyrosinase, melanoma-associated antigen (MAGE), abnormal products of ras or p53, CTAG1B, MAGEA1, HER2 / neu, Melan-A, prostate specific antigen (PSA), prostate acid phosphatase (PAP), TRP1, TRP2, Cyclin A, HSP60, myelin basic protein, myelin oligodendrocyte glycoprotein, PLP, Collagen type II, vimentin, PAD4, alpha-enolase, and CDR1. In a further embodiment, the ratio of conjugated MHC class I restricted antigen to MHC class II restricted antigen is from 1 : 10 to 10: 1. In yet a further embodiment, the ratio conjugated MHC class I restricted antigen to MHC class II restricted antigen is from 1: 1 to 1:8. In another embodiment, the nanoparticles have a diameter from 20 nm to 50 nm. In yet another embodiment, the nanoparticles have a diameter of around 30 nm. In a further embodiment, the nanoparticles are hollow protein nanoparticles. In yet a further embodiment, the hollow protein nanoparticles are based on a heat shock protein(s), bacteriophage QP, human heavy chain ferritin, TIP60, or hepatitis B virus (HBV) surface-antigen protein. In a certain embodiment, the hollow protein nanoparticles are based on the E2 subunit, or a portion thereof, of the pyruvate dehydrogenase complex (PDC) from the Geobacillus stearothermophilus In a further embodiment, the E2 subunit of the PDC has been recombinantly modified to substitute one or more amino acids with cysteines. In yet a further embodiment, the E2 subunit of PDC has a sequence that is at least 98% identical to SEQ ID NO: 15. In a particular embodiment, the adjuvant is selected from CpG1826, CpGI018, MGN1703, ssRNA, aluminum hydroxide, aluminum phosphate, and aluminum potassium sulfate, AS04, MF59, ASOIB, CpG ODN 1466, CpG ODN PB3, CpG ODN BW005, CpG Alum, CPG 21424, CpG 7909, CpG-ODN 2135, ODN K3, CpG ODN 10101, CpG-28. CpG ODN C274, CpG ODN C695, CpG ODN#17, CpG-ODN 2722, CpG 8916, CpG 8954, CpG ODN 678. CpG ODN BW015, CpG ODN 658, CpG ODN 640, CpG ODN PB9, CpG ODN BW004, CpG ODN BW103, CpG ODN 110, CpG ODN BW206, CpG ODN 607, CpG ODN 647, CpG ODN 111, CpG ODN 109, CpG ODN 656, CpG ODN 664, CpG ODN C9, CPG2429, CPG5475, CPG21608,Atorney docket No. 00058-088W01CPG21797, CPG21796, CPG21799, CPG21800, CPG21802, CPG21889, CPG23409, CpG- C41, CPG23410, CPG23411, CPG23412, CPG23413. CPG23617, CPG23414, CPG 1681, CPG 2143, CPG 21425, and CPG 21426. In another embodiment, the adjuvant is CpG1018 or CpG1826. In yet another embodiment, the MHC class I and II restricted antigens are conjugated to the outer surface of the nanoparticles, and wherein the adjuvant is conjugated or loaded into the inner cavity of the nanoparticles. In a certain embodiment, the MHC class I and II restricted antigens are conjugated to the outer surface of the nanoparticles by use of mal-tNTA-Ni, sulfo-SMCC, sortase A ligation, or by use of SpyCatcher / SpyTag. In a further embodiment, the MHC class I and II restricted antigens are conjugated to the outer surface of the nanoparticles by use of sulfo-SMCC. In yet a further embodiment, the adjuvant is conjugated or loaded into the inner cavity of the nanoparticles by use of a linker that binds to both the adjuvant and free cysteine groups in the inner cavity of the nanoparticles. In another embodiment, the adjuvant has been modified to comprise a terminal aldehyde or benzaldehyde group, and wherein the linker is a A-(P-maleimidopropionic acid) hydrazide (BMPH) linker. In yet another embodiment, the vaccine formulation is formulated for oral administration, intranasal administration, subcutaneous administration, intradermal administration, or intramuscular administration.
[0010] In a certain embodiment, the disclosure also provides for a pharmaceutical composition comprising the vaccine formulation disclosed herein. In a further embodiment, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier, diluent, stabilizer and / or excipient. In yet a further embodiment, the pharmaceutical composition further comprises a buffered saline solution.
[0011] In a particular embodiment, the disclosure further provides a method of immunizing a subject against a cancer comprising: administering one or more therapeutically effective doses of the vaccine formulation disclosed herein or a pharmaceutical composition disclosed herein to a subj ect having a cancer or suspected of having a cancer. In a further embodiment, the subject is a human subject. In yet a further embodiment, the cancer is selected from lung cancer, colorectal cancer, melanoma, chronic myeloid leukemia, colorectal carcinoma, stomach cancer, gastric carcinoma, endometrial carcinoma, head and neck squamous cell carcinoma, myeloid leukemia, lung squamous CC, acute lymphoblastic leukemia, acute myelogenous leukemia, chronic lymphocytic leukemia, renal cell carcinoma, ovarian cancer, metastatic colorectal cancer, pancreatic adenocarcinoma, bladder cancer, lungAtorney docket No. 00058-088W01 squamous cell carcinoma, promyelocytic leukemia, sarcoma, breast cancer, prostate cancer, liver cancer, thyroid cancer, testicular cancer, kidney cancer, glioblastoma, pancreatic cancer, and retinal cancer. In another embodiment, the administration of the vaccine formulation or the pharmaceutical composition to the subject induces the production of Thl or pro- inflammatory cytokines. Examples of Thl or pro-inflammatory cytokines include, but are not limited to IFN-y, TNF-a. and IL-2. In yet another embodiment, administration of the vaccine formulation or the pharmaceutical composition to the subject results in antigen-specific T cell activation and a Thl response. In a further embodiment, the antigen-specific T cell activation includes both CD4+ T cells and CD8+ T cells. In yet a further embodiment administration of the vaccine formulation or the pharmaceutical composition to the subject does not induce the production of Th2 inflammatory cytokines. In another embodiment, administration of the vaccine formulation or the pharmaceutical composition to the subject slows the growth of cancer cells and / or tumors. In yet another embodiment, one or two doses of the vaccine formulation or the pharmaceutical composition can be used to immunize the subject to a cancer. In a further embodiment, the method further comprises concurrently or sequentially treating the subject with one or more cancer therapies. Examples of cancer therapies include, but are not limited to, surgery, chemotherapy, radiation therapy, hormone therapy, targeted therapy, immunotherapy, stem cell transplant, gene therapy, CAR T-cell therapy, and antibody -drug conjugate therapy.
[0012] In a particular embodiment, the disclosure also provides a method of immunizing a subject against an autoimmune disease or state comprising: administering one or more therapeutically effective doses of a vaccine formulation disclosed herein or a pharmaceutical composition disclosed herein to a subject having an autoimmune disease or suspected of having an autoimmune state. In another embodiment, the subject has an autoimmune disease selected from coeliac disease, type 1 diabetes, Graves' disease, inflammatory bowel diseases (such as Crohn's disease and ulcerative colitis), multiple sclerosis, Sjogren’s syndrome, SICCA, alopecia areata, Addison's disease, pernicious anemia, psoriasis, rheumatoid arthritis, Type I diabetes, and systemic lupus erythematosus. In yet another embodiment, the subject is suspected of having an autoimmune state selected from Alopecia areata, Autoimmune angioedema, Autoimmune progesterone dermatitis, Autoimmune urticaria, Bullous pemphigoid, Cicatricial pemphigoid, Dermatitis herpetiformis, Dermatomyositis, Discoid lupus erythematosus, Epidermolysis bullosa acquisita, Erythema nodosum,Atorney docket No. 00058-088W01Gestational pemphigoid, Hidradenitis suppurativa, Lichen planus, Lichen sclerosus, Linear IgA disease, Morphea, Psoriasis, Pemphigus vulgaris. Scleroderma (systemic sclerosis), Sjogren syndrome, Vitiligo, Autoimmune enteropathy. Autoimmune hepatitis, Celiac disease, Crohn's disease, Intestinal necrotizing arteriolitis, Pernicious anemia, Ulcerative colitis, Rheumatic heart disease, Kawasaki disease, Giant cell arteritis, Takayasu's arteritis, Behcet's disease, Eosinophilic granulomatosis with polyangiitis (EGPA), Granulomatosis with polyangiitis (GPA), IgA vasculitis (IgAV), Leukocytoclastic vasculitis. Lupus vasculitis. Rheumatoid vasculitis, Microscopic polyangiitis (MPA), Necrotizing arteriolitis, Polyarteritis nodosa (PAN), Polymyalgia rheumatica, Urticarial vasculitis, Goodpasture syndrome, IgA nephropathy, Membranous nephropathy, Lupus nephritis, Interstitial nephritis, Interstitial cystitis, Primary sclerosing cholangitis, Acute disseminated encephalomyelitis. Acute motor axonal neuropathy, Anti-NMDA receptor encephalitis. Autoimmune encephalitis, Balo concentric sclerosis, Bickerstaffs encephalitis, Chronic inflammatory demyelinating polyneuropathy, Guillain-Barre syndrome, Hashimoto's encephalopathy, Idiopathic inflammatory’ demyelinating diseases, Lambert-Eaton myasthenic syndrome, Multiple sclerosis. Myasthenia gravis, Neuromyelitis optica (Devic's disease) / NMOSD, Restless legs syndrome, Stiff-person syndrome, Sydenham's chorea, Transverse myelitis, Undifferentiated connective tissue disease (UCTD), Addison's disease, Autoimmune oophoritis, Autoimmune orchitis, Autoimmune pancreatitis, Autoimmune polyendocrine syndrome type 1 (APS1), Autoimmune polyendocrine syndrome type 2 (APS2), Autoimmune polyendocrine syndrome type 3 (APS3), Diabetes mellitus type 1, Endometriosis, Graves' disease, Hashimoto's thyroiditis, Ord's thyroiditis, Goodpasture syndrome, Eosinophilic granulomatosis with polyangiitis (EGPA), Granulomatosis with polyangiitis (GPA), Idiopathic pulmonary’ fibrosis, Interstitial lung disease. Pulmonary alveolar proteinosis, Rheumatoid lung disease, Sarcoidosis, Autoimmune hemolytic anemia. Immune thrombocytopenia. Thrombotic thrombocytopenic purpura, Antiphospholipid syndrome, and Paroxysmal nocturnal hemoglobinuria. In a further embodiment, the subject is a human subject. In a yet a further embodiment, the method further comprises concurrently or sequentially treating the subject with one or more therapies for autoimmune disease. In another embodiment, the therapies for autoimmune disease include immune checkpoint inhibitors. In yet another embodiment, the immune checkpoint inhibitors are selected from pembrolizumab, nivolumab, cemiplimab, dostarlimab, tislelizumab, penpulimab, retifanlimab, atezolizumab, avelumab, durvalumab,Atorney docket No. 00058-088W01 ipilimumab, rremelimumab, relatlimab, Lag3, ICOS, TIM 3, SIGLECs 7 and 9, VISTA, A2A and A2B, CD276,and N0X2. In a certain embodiment, the vaccine formulation or the pharmaceutical composition is tailored or designed to elicit a Th2 or Treg class immune response to counteract the autoimmune state or autoimmune disease in the subject.
[0013] In a certain embodiment, the disclosure provides for a vaccine formulation or preparation, pharmaceutical composition or a method as substantially described in the disclosure and figures presented herein.DESCRIPTION OF DRAWINGS
[0014] The accompanying drawings, which are incorporated into and constitute a part of this specification, illustrate one or more embodiments of the disclosure and, together with the detailed description, serve to explain the principles and implementations of the invention.
[0015] FIG. 1 demonstrates that MHC class I and II antigen peptides are recognized by CD8 and CD4 T cells.
[0016] FIG. 2 provides an embodiment of a vaccine delivery system of the disclosure where the nanoparticle is formed from E2 that has been derived from Geobacillus stearothermophilus . The E2-based nanoparticle has an interior canty and exterior surface that are available for conjugations. A vaccine delivery system comprising the E2-based nanoparticle can co-deliver adjuvants and antigens (class I and II) and is within the favored size range for passive lymphatic transport. DC uptake and lymphatic retention.
[0017] FIG. 3 provides an embodiment of a scheme to conjugate adjuvant to the interior cavity of E2 -based nanoparticles using BMPH, and to conjugate MHC I and MHC II antigenic peptide(s) to the exterior surface of the surface of the E2-based nanoparticles using Sulfo-SMCC.
[0018] FIG. 4A-D presents proposed routes by which NP vaccines designed to codeliver MHC class I and II peptides can improve anti-tumor immunity. Nanoparticle vaccine design is expected to influence anti-tumor immunity through the targeting of (A) only CD8+ T cells (single-antigen NPs), (B) CD8+ and CD4+ T cells but not necessarily simultaneously (NP mixture of single antigen NPs), or (C) CD8+ and CD4+ T cells simultaneously (coconjugated NPs). B and C may be induced by NPs delivering MHC class 1 and 11 epitopes, but while the former individually delivers each class of peptide on different NPs, coconjugated NP designs facilitate the delivery of both MHC classes of peptide to the same DC in its design. After NP uptake, DCs may traffic to secondary' lymphoid organs such as theAtorney docket No. 00058-088W01 spleen or LNs, wherein they encounter many T cells, including CD8+ and CD4+ T cells. Facilitated by the activated DC to T cell CD80:CD28 interaction, DCs which process the coconjugated NPs may activate both T cell subsets C, increasing local concentrations of crucial proliferation and survival cytokines such as IL-2; CD40:CD40L signaling between DCs and T cells for increased DC activation; and anti-tumor IFN-y secretion, collectively improving cellular immunity and tumor lysis. (D) This theoretical mechanistic model was expected to persist throughout multiple murine tumor models, including B16 / F10 melanoma in the black C57BL / 6 mouse strain and CT26 colon carcinoma in the albino BALB / c mouse strain.Within the gray E2 NPs, black dots represent CpG adjuvant. Medium gray and light gray peptides represent MHC class I and MHC class II antigens, respectively. Medium gray, gray, light gray, and dark gray cells represent DCs, CD4+ T cells, CD8+ T cells, and tumor cells, respectively. Small gray dots represent cytokines. NPs were designed, synthesized, and evaluated for the treatment of melanoma (B16 / F10 cells in Thl-biased C57BL / 6 mice) and colon carcinoma (CT26 cells in Th2 -biased BALB / c mice). IFN: interferon. IL: interleukin. MHC: major histocompatibility complex. NP: nanoparticle. TAA: tumor-associated antigen. TCR: T cell receptor.
[0019] FIG. 5 presents a summary of nanoparticles synthesized to co-deliver CpG and peptide antigens for the melanoma and colon carcinoma models. For each NP design, the visual representation and components are shown. CpG (SEQ ID NO: 14) (black dots) was conjugated to the internal cysteines of E2 NPs (gray). Peptides for the melanoma model [e.g, gplOO-I (SEQ ID NO:2) (dark gray) and gplOO-II (SEQ ID NO:4) (medium gray)] or peptides for the colon carcinoma model [<?.g, CT-I (SEQ ID NO: 6) (gray) and CT-II (SEQ ID NO: 8) (light gray)] were conjugated to exposed lysines of E2 NPs. The sequences of gplOO-I (SEQ ID NO:2), gplOO-II (SEQ ID NO:4), CT-I (SEQ ID NO:6). and CT-II (SEQ ID NO:8) are shown. The ratios of these components per E2 NP monomer following conjugation are described in Table 1 and Table 2. The three rows highlighted by the dark gray and gray bars are relevant for the melanoma and colon carcinoma models, respectively.
[0020] FIG. 6A-B presents SDS-PAGE gel analysis of confirmed conjugation of CpG and peptides. SDS-PAGE gels of E2 NPs as (A) melanoma or (B) colon carcinoma immunotherapeutic or controls. (A) Lanes: (1, 7) molecular weight ladder; (2) E2; (3) CpG- E2; (4) (gp!00-I)-CpG-E2; (5) (gpl00-II)-CpG-E2; and (6) (gpI00-I+II)-CpG-E2. (B) Lanes: (1, 7) molecular weight ladder; (2) E2; (3) CpG-E2; (4) (CT-I)-CpG-E2; (5) (CT-II)-CpG-E2;Atorney docket No. 00058-088W01 and (6) (CT-I+II)-CpG-E2. The conjugation of CpG or peptides onto E2 monomers is supported by the shift in bands.
[0021] FIG. 7A-D shows E2 NPs decorated with gplOO or CT peptides maintained NP structure and solubility. (A) Representative DLS and average hydrodynamic diameters of E2 NPs relevant to gplOO melanoma antigens [E2, CpG-E2, (gpl00-I)-CpG-E2, (gplOO-II)- CpG-E2, and (gpl00-I+II)-CpG-E2]. Mean ± SD. N=3. (B) Representative DLS and the average hydrodynamic diameters of E2 NPs relevant to CT26 colon carcinoma antigens [E2. CpG-E2, (CT-I)-CpG-E2, (CT-II)-CpG-E2, and (CT-I+II)-CpG-E2], Mean ± SD. N=3. (C) Representative TEM image of (gpl00-I+II)-CpG-E2 NPs and (D) (CT-I+II)-CpG-E2 NPs. Scale bars = 100 nm.
[0022] FIG. 8A-D shows that immunization with E2 NPs displaying MHC class II melanoma TAA induced antigen-specific splenocyte proliferation and modulated immune populations. (A) Immunization schedule. (B) Nanoparticle vaccine components per immunization dose, including the amount of E2, CpG, and gplOO-II peptide per dose. (C) Normalized ratio of proliferated versus non-proliferated CFSE-stained splenocytes incubated with gplOO-II or irrelevant peptide SIINFEKL (control). Mean ± SEM. N>3. Statistics: Two- way ANOVA with post-hoc Bonferroni ’s test. (D) Percentages of DCs, macrophages, B cells, T cells, CD8+ T cells, and CD4+ T cells, in splenocytes after immunization with (gplOO-II)- CpG-E2 NPs or PBS. Mean ± SD. N=5. Statistics: One-way ANOVA with post-hoc Bonferroni 's test. *p < 0.05, **p < 0.01.
[0023] FIG. 9A-B demonstrates immunization doses with nanoparticle vaccines delivering gplOO or CT antigens and resulting spleens and lymph nodes (LNs) after immunization. (A) Nanoparticle vaccine components per immunization, including amount of E2. CpG. and peptide per dose (in both mass and molar amounts). (B) Representative images of spleens and LNs (axillary and inguinal) harvested on day 14 following immunization on day 0 and day 7 with conditions described in the table. All images are to scale with the ruler.
[0024] FIG. 10 presents representative histograms of proliferating and non-proliferating splenocytes stained with CFSE. Shown are histograms of gated cells which had been incubated for 72 h with PBS (negative control). ConA (positive control), or recall peptide. FITC signal correlating to CFSE content is shown along the horizontal axes. While populations Go represent non-proliferated cells, daughter generations are highlighted by Gn. Minimal numbers of cells within daughter generations were present following PBSAtorney docket No. 00058-088W01 incubation, while a significant amount of proliferation resulted following stimulation with ConA. ConA: Concanavalin A.
[0025] FIG. 11 shows immunization with E2 NPs displaying MHC class II melanoma TAA modulated immune populations in the LNs. Flow cytometry staining analyses for DCs, macrophages, B cells, T cells, CD8+ T cells, and CD4+ T cells from the LNs. Gray and light gray bars represent immunization with PBS or (gpl00-II)-CpG-E2, respectively. Mean ± SD. N=5. Statistics: One-way ANOVA with post-hoc Bonferroni ’s test. *p < 0.05. **p < 0.01.
[0026] FIG. 12A-F shows immunization with E2 NPs displaying MHC class I or class II melanoma TAAs induced antigen-specific Thl responses and T cell proliferation. (A) Immunization schedule. (B) Nanoparticle vaccine components (E2 NP, CpG adjuvant, and peptide) per immunization dose. For immunizations with NP mixtures, the contributions of each NP type are summarized in parentheses, in the same order as NPs listed in the group. CpG-E2 was included in Groups 3 and 4 to match E2 and CpG doses of Group 5. (C) IFN-y producing spots per million splenocytes. incubated with peptide indicated (SIINFEKL, gplOO-I, or gplOO-II). (D) IL-2 concentrations, in conditioned media from splenocytes incubated with peptide. (E, F) Normalized ratios of proliferated versus non-proliferated splenic (E) CD3+CD8+ cells (CD8+ T cells), or (F) CD3+CD4+ cells (CD4+ T cells), following 72 h incubation with the peptide indicated. Gray, dark gray, and light gray bars represent incubation with SIINFEKL (irrelevant peptide), gplOO-I, and gp 100-11. respectively. Mean ± SEM. N>6. 3 technical replicates. Statistics: Two-way ANOVA with post-hoc Bonferroni ’s test. *p < 0.05, **p < 0.01, ***p < 0.001, ****p <0.0001.
[0027] FIG. 13A-C presents melanoma treatment with E2 NPs co-conjugated with MHC class I and class II TAAs yielded the longest survival times. (A) Experimental schedule for tumor inoculation and treatment. (B) Summary of treatment groups. Compositions of these groups (NP, adjuvant, antigens) is described in FIG. 8B. (C) Overall survival of mice. Black, gray, light gray, and dark gray lines represent treatment by Groups 1, 2, 3, and 4, respectively, as described in (B). N=10. Statistics: log-rank test. *p < 0.05, **p < 0.01.
[0028] FIG. 14A-D shows treatment with E2 NPs decorated with MHC class I and II antigens delayed melanoma tumor growth. Tumor volumes of individual mice bearing melanoma over time. Tumor grow th was monitored over several weeks following initial tumor inoculation on day 0 for mice treated on days 1 and 8 with (A) PBS, (B) (gplOO-I)- CpG-E2 + CpG-E2, (C) (gpl00-I)-CpG-E2 + (gpI00-II)-CpG-E2 + CpG-E2. and (D)Attorney docket No. 00058-088W01(gpl00-I+II)-CpG-E2. Of the 4 groups, Groups 2 and 3 included treatments with singleantigen NPs, while Group 4 used NPs co-conjugated with both MHC class I and II epitopes. N=10 biological replicates.
[0029] FIG. 15 shows immune populations in the LNs following immunization with E2 NPs displaying MHC class II colon carcinoma. Flow cytometry staining analyses for DCs, macrophages, B cells, T cells, CD8+ T cells, and CD4+ T cells from the LNs. Gray and light gray bars represent immunization with PBS or (CT-Il)-CpG-E2, respectively. Mean ± SD. N=4.
[0030] FIG. 16A-D demonstrates immunization with E2 NPs displaying MHC class II antigen peptide from CT26 elicited antigen-specific IFN-y responses and modulated immune populations. (A) Immunization schedule. (B) Nanoparticle vaccine components per immunization dose, including the amount of E2, CpG, and peptide. (C) IFN-y response from splenocytes incubated with CT-II or an irrelevant peptide SIINFEKL (control) as determined via ELISpot. Mean ± SEM. N=4. Statistics: Two-way ANOVA with post-hoc Bonferroni 's test. (D) Percentages of DCs, macrophages, B cells, T cells. CD8+ T cells, and CD4+ T cells in splenocytes, after immunization with (CT-II)-CpG-E2 NPs or PBS. Mean ± SD. N=4. Statistics: One-way ANOVA with post-hoc Bonferroni ’s test. **p < 0.01, ****p < 0.0001.
[0031] FIG. 17A-C shows immunization with E2 NPs co-delivering MHC class I and II colon carcinoma epitopes induced higher antigen-specific IFN-y. (A) Immunization schedule. (B) Nanoparticle vaccine components per immunization, including the amounts of E2. CpG. and peptide per dose. For immunizations with NP mixtures, the contributions of each NP type are summarized in parentheses, in the same order as NPs listed in the group. CpG-E2 was included in Groups 2 and 4 to ensure that all NPs groups receive equivalent E2 and CpG doses. (C) IFN-y producing spots per million splenocytes incubated overnight with an irrelevant peptide (SIINFEKL), CT-I, or CT-II. Mean ± SEM. N>6. Statistics: Two-way ANOVA with post-hoc Bonferroni ’s test. **p < 0.01.
[0032] FIG. 18A-B presents immunization with differing doses of CT-I on NPs caused Thl or DC responses in the spleen. Mice were immunized on days 0 and 7 with PBS, a low- dose of (CT-I)-CpG-E2 NPs, or a high dose of (CT-I)-CpG-E2 NPs and then performed 1FN- y ELISpot and assessed DC populations on day 14. Low and high doses of NPs contained 7.5 pg and 30 pg of CT-I, respectively. (A) IFN-y producing spots per million splenocytes after overnight incubation with an irrelevant peptide (SIINFEKL) or CT-I. Mean ± SEM. N-3.Atorney docket No. 00058-088W01Statistics: One-way ANOVA with post-hoc Bonferroni ’s test. **p < 0.01; p = 0.067 between high dose and PBS groups following CT-I incubation. (B) Dendritic cell population in the spleen following immunization with a low or high dose of NPs. Mean ± SD. N>3. Statistics: One-way ANOVA with post-hoc Bonferroni ’s test. ****p < 0.0001.
[0033] FIG. 19A-D demonstrates immunization with E2 NPs co-delivering MHC class I and class II colon carcinoma antigens caused the greatest increase in antigen-specific IFN-y, TNF-a. IL-2. and IL-6 cytokine production. (A) IFN-y, (B) TNF-a. (C) IL-2, and (D) IL-6 concentrations as determined by LEGENDplex of conditioned media of splenocytes incubated with peptide. Gray, dark gray, and light gray bars represent SIINFEKL (irrelevant peptide), CT-I, or CT-II incubation conditions, respectively. Mean ± SEM. N>3. Statistics:
[0034] FIG. 20 demonstrates immunization with E2 nanoparticles displaying CT peptides modulated immune populations in the spleen. Flow cytometr ■ staining analyses for DCs, macrophages, B cells, T cells, CD8+ T cells, and CD4+ T cells from the spleen of immunized mice on day 16. Mice were immunized with PBS [Group 1], (CT-I)-CpG-E2 + CpG-E2 [Group 2], (CT-I)-CpG-E2 + (CT-II)-CpG-E2 [Group 3], and (CT-I+II)-CpG-E2 + CpG-E2 [Group 4] on day 0 and day 7. Mean ± SD. N>6. One-way ANOVA with post-hoc Bonferroni ’s test. *p < 0.05, **p < 0.01. Mean ± SD.
[0035] FIG. 21A-C shows colon carcinoma treatment with E2 NPs co-conjugated with MHC class I and class II epitopes most significantly increased survival. (A) Experimental schedule for tumor inoculation and treatment. CT26 cells w ere inoculated on day 0, and treatments were administered on days 3 and 10. (B) Summary of treatment groups.Composition of the treatment groups (NP, adjuvant, antigens) is described in FIG. 16B. (C) Overall survival of mice. Black, gray, light gray, and dark gray lines represent treatments by Groups 1, 2, 3, and 4, respectively, as described in panel (B). N>7. Statistics: log-rank test. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.
[0036] FIG. 22A-D shows treatment with E2 NPs decorated with MHC class I and II epitopes delayed colon carcinoma tumor growth. Tumor volumes of individual mice bearing colon carcinoma over time. Tumor growth was monitored over several weeks following initial tumor inoculation on day 0 for mice treated on days 3 and 10 with (A) PBS, (B) CpG- (CT-I)-E2 + CpG-E2, (C) CpG-(CT-I)-E2 + CpG-(CT-II)-E2 (D) CpG-(CT-I+II)-E2, and (E) CpG-(CT-I+II)-E2 + CpG-E2. Of the four groups, Groups 2 and 3 included treatments withAtorney docket No. 00058-088W01 single-antigen NPs, while Groups 4 used NPs co-conjugated with both MHC class I and II epitopes. N>7 biological replicates.
[0037] FIG. 23 provides a graphical abstract image depicting the advantages of using co-conjugated nanoparticles of the disclosure in comparison to single-antigen nanoparticles, or mixtures of single-antigen nanoparticles.DETAILED DESCRIPTION
[0038] As used herein and in the appended claims, the singular forms "a", "an", and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a vaccine" includes a plurality of such vaccines and reference to "the adjuvant" includes reference to one or more adjuvants and equivalents thereof known to those skilled in the art. and so forth.
[0039] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this disclosure belongs. Although many methods and reagents are similar or equivalent to those described herein, the exemplary methods and materials are disclosed herein.
[0040] All publications mentioned herein are incorporated by reference in full for the purpose of describing and disclosing methodologies that might be used in connection with the description herein. The publications are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior disclosure. Moreover, with respect to any term that is presented in one or more publications that is similar to, or identical with, a term that has been expressly defined in this disclosure, the definition of the term as expressly provided in this disclosure will control in all respects.
[0041] An "amino acid sequence" is a polymer of amino acids (a protein, polypeptide, etc.) or a character string representing an amino acid polymer, depending on context. The terms "protein" and "polypeptide" are used interchangeably herein. "Amino acid" is a molecule having the structure wherein a central carbon atom is linked to a hydrogen atom, a carboxylic acid group (the carbon atom of which is referred to herein as a "carboxyl carbon atom"), an amino group (the nitrogen atom of which is referred to herein as an "amino nitrogen atom"), and a side chain group, R. When incorporated into a peptide, polypeptide, or protein, an amino acid loses one or more atoms of its amino acid carboxylic groups in theAtorney docket No. 00058-088W01 dehydration reaction that links one amino acid to another. As a result, when incorporated into a protein, an amino acid is referred to as an "amino acid residue."
[0042] For purposes of the disclosure the term “cancer” will be used to encompass cell proliferative disorders, neoplasms, precancerous cell disorders and cancers, unless specifically delineated otherwise. Thus, a “cancer” refers to any cell that undergoes aberrant cell proliferation that can lead to metastasis or tumor growth. Exemplary cancers include but are not limited to, adrenocortical carcinoma. AIDS-related cancers. AIDS-related lymphoma, anal cancer, anorectal cancer, cancer of the anal canal, appendix cancer, childhood cerebellar astrocytoma, childhood cerebral astrocytoma, basal cell carcinoma, skin cancer (nonmelanoma), biliary cancer, extrahepatic bile duct cancer, intrahepatic bile duct cancer, bladder cancer, urinary bladder cancer, bone and joint cancer, osteosarcoma and malignant fibrous histiocytoma, brain cancer, brain tumor, brain stem glioma, cerebellar astrocytoma, cerebral astrocytoma / malignant glioma, ependymoma, medulloblastoma, supratentorial primitive neuroectodermal tumors, visual pathway and hypothalamic glioma, breast cancer, including triple negative breast cancer, bronchial adenomas / carcinoids, carcinoid tumor, gastrointestinal, nervous system cancer, nervous system lymphoma, central nervous system cancer, central nervous system lymphoma, cervical cancer, childhood cancers, chronic lymphocytic leukemia, chronic myelogenous leukemia, chronic myeloproliferative disorders, colon cancer, colorectal cancer, cutaneous T-cell lymphoma, lymphoid neoplasm, mycosis fungoides, Seziary Syndrome, endometrial cancer, esophageal cancer, extracranial germ cell tumor, extragonadal germ cell tumor, extrahepatic bile duct cancer, eye cancer, intraocular melanoma, retinoblastoma, gallbladder cancer, gastric (stomach) cancer, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor (GIST), germ cell tumor, ovarian germ cell tumor, gestational trophoblastic tumor glioma, head and neck cancer, hepatocellular (liver) cancer, Hodgkin lymphoma, hypopharyngeal cancer, intraocular melanoma, ocular cancer, islet cell tumors (endocrine pancreas), Kaposi Sarcoma, kidney cancer, renal cancer, laryngeal cancer, acute lymphoblastic leukemia, acute myeloid leukemia, chronic lymphocytic leukemia, chronic myelogenous leukemia, hairy cell leukemia, lip and oral cavity cancer, liver cancer, lung cancer, non-small cell lung cancer, small cell lung cancer. AIDS-related lymphoma, non-Hodgkin lymphoma, primary central nervous system lymphoma, Waldenstram macroglobulinemia, medulloblastoma, melanoma, intraocular (eye) melanoma, Merkel cell carcinoma, mesothelioma malignant, mesothelioma, metastaticAtorney docket No. 00058-088W01 squamous neck cancer, mouth cancer, cancer of the tongue, multiple endocrine neoplasia syndrome, mycosis fungoides. myelodysplastic syndromes, myelodysplastic / myeloproliferative diseases, chronic myelogenous leukemia, acute myeloid leukemia, multiple myeloma, chronic myeloproliferative disorders, nasopharyngeal cancer, neuroblastoma, oral cancer, oral cavity cancer, oropharyngeal cancer, ovarian cancer, ovarian epithelial cancer, ovarian low malignant potential tumor, pancreatic cancer, islet cell pancreatic cancer, paranasal sinus and nasal cavity cancer, parathyroid cancer, penile cancer, pharyngeal cancer, pheochromocytoma, pineoblastoma and supratentorial primitive neuroectodermal tumors, pituitary tumor, plasma cell neoplasm / multiple myeloma, pleuropulmonary blastoma, prostate cancer, rectal cancer, renal pelvis and ureter, transitional cell cancer, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, Ewing family of sarcoma tumors, soft tissue sarcoma, uterine cancer, uterine sarcoma, skin cancer (nonmelanoma), skin cancer (melanoma), papillomas, actinic keratosis and keratoacanthomas, merkel cell skin carcinoma, small intestine cancer, soft tissue sarcoma, squamous cell carcinoma, stomach (gastric) cancer, supratentorial primitive neuroectodermal tumors, testicular cancer, throat cancer, thymoma, thymoma and thymic carcinoma, thyroid cancer, transitional cell cancer of the renal pelvis and ureter and other urinary organs, gestational trophoblastic tumor, urethral cancer, endometrial uterine cancer, uterine sarcoma, uterine corpus cancer, vaginal cancer, vulvar cancer, and Wilm's Tumor. In a particular embodiment, the cancer is selected from the group consisting of melanoma, colorectal cancer, pancreatic cancer, bladder cancer, breast cancer, triple negative breast cancer, ovarian cancer and lung cancer.
[0043] For purposes of the disclosure the term ‘‘autoimmune diseases’" will be used to encompass diseases that are caused by a subject's immune system attacking their own cells or tissues by mistake, unless specifically delineated otherwise. Examples of autoimmune states diseases include, but are not limited to, coeliac disease, type 1 diabetes, Graves' disease, inflammatory bowel diseases (such as Crohn's disease and ulcerative colitis), multiple sclerosis. Sjogren's syndrome. SICCA, alopecia areata. Addison's disease, pernicious anemia, psoriasis, rheumatoid arthritis, Type 1 diabetes, and systemic lupus erythematosus.
[0044] For purposes of the disclosure the term “autoimmune states” will be used to encompass disorders or conditions that are likely caused or suspected of being caused by a subject's immune system attacking their own cells or tissues in their body by mistake, unlessAtorney docket No. 00058-088W01 specifically delineated otherwise. Examples of autoimmune states include, but are not limited to, Alopecia areata, Autoimmune angioedema, Autoimmune progesterone dermatitis, Autoimmune urticaria, Bullous pemphigoid. Cicatricial pemphigoid, Dermatitis herpetiformis, Dermatomyositis, Discoid lupus erythematosus, Epidermolysis bullosa acquisita, Erythema nodosum, Gestational pemphigoid, Hidradenitis suppurativa, Lichen planus, Lichen sclerosus, Linear IgA disease, Morphea, Psoriasis, Pemphigus vulgaris. Scleroderma (systemic sclerosis), Sjogren syndrome, Vitiligo, Autoimmune enteropathy. Autoimmune hepatitis, Celiac disease, Crohn's disease, Intestinal necrotizing arteriolitis, Pernicious anemia, Ulcerative colitis, Rheumatic heart disease, Kawasaki disease, Giant cell arteritis, Takayasu's arteritis. Behcet's disease. Eosinophilic granulomatosis with polyangiitis (EGPA), Granulomatosis with polyangiitis (GPA), IgA vasculitis (IgAV), Leukocytoclastic vasculitis. Lupus vasculitis. Rheumatoid vasculitis, Microscopic polyangiitis (MPA), Necrotizing arteriolitis, Polyarteritis nodosa (PAN), Polymyalgia rheumatica, Urticarial vasculitis, Goodpasture syndrome, IgA nephropathy , Membranous nephropathy, Lupus nephritis. Interstitial nephritis, Interstitial cystitis, Primary sclerosing cholangitis, Acute disseminated encephalomyelitis. Acute motor axonal neuropathy, Anti-NMDA receptor encephalitis, Autoimmune encephalitis, Balo concentric sclerosis, Bickerstaffs encephalitis, Chronic inflammatory demyelinating polyneuropathy, Guillain-Barre syndrome, Hashimoto's encephalopathy, Idiopathic inflammatory demyelinating diseases, Lambert-Eaton myasthenic syndrome, Multiple sclerosis, Myasthenia gravis, Neuromyelitis optica (Devic's disease) / NMOSD, Restless legs syndrome. Stiff-person syndrome, Sydenham's chorea. Transverse myelitis, Undifferentiated connective tissue disease (UCTD), Addison's disease, Autoimmune oophoritis, Autoimmune orchitis, Autoimmune pancreatitis, Autoimmune poly endocrine syndrome type 1 (APS1). Autoimmune polyendocrine syndrome type 2 (APS2), Autoimmune polyendocrine syndrome type 3 (APS3), Diabetes mellitus type 1, Endometriosis, Graves' disease, Hashimoto's thyroiditis, Ord's thyroiditis. Goodpasture syndrome, Eosinophilic granulomatosis with polyangiitis (EGPA), Granulomatosis with polyangiitis (GPA), Idiopathic pulmonary fibrosis, Interstitial lung disease. Pulmonary alveolar proteinosis. Rheumatoid lung disease, Sarcoidosis. Autoimmune hemolytic anemia. Immune thrombocytopenia, Thrombotic thrombocytopenic purpura. Antiphospholipid syndrome, and Paroxysmal nocturnal hemoglobinuria.Atorney docket No. 00058-088W01
[0045] As referred to herein, "sequence similarity" means the extent to which nucleotide or protein sequences are related. The extent of similarity between two sequences can be based on percent sequence identity and / or conservation. "Sequence identity" herein means the extent to which two nucleotide or amino acid sequences are invariant. For example, a nucleotide or amino acid sequence may have a sequence identity7of at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 97%, at least 98%, or at least 99% to the sequences presented in SEQ ID NOs: l to 15. In certain embodiments, the nucleotide or amino acid sequence comprises, consists essentially of, or consists of the sequence presented in SEQ ID NOs: l to 15. "Sequence alignment" means the process of lining up two or more sequences to achieve maximal levels of identity (and, in the case of amino acid sequences, conservation) for the purpose of assessing the degree of similarity7. Numerous methods for aligning sequences and assessing similarity / identity are known in the art such as, for example, the Cluster Method, wherein similarity' is based on the MEGALIGN algorithm, as well as BLASTN, BLASTP, and FASTA (Lipman and Pearson, 1985; Pearson and Lipman, 1988). When using all of these programs, the preferred settings are those that results in the highest sequence similarity'.
[0046] Immunotherapies such as cancer vaccines often aim to modulate the interplay between dendritic cells (DCs) and T cells to promote the activation of antigen-specific, be it anti-tumor or anti-autoimmune antigens. DCs have the unique property of cross-presentation; that is, the ability to present antigen to both CD8+ and CD4+ T cells on major histocompatibility complex (MHC) class I and MHC class II, respectively. Nanomaterials provide flexibility' in design to enable tuning of the resulting immune response. The nanoparticles (NPs) used in this work are preferentially taken up by DCs. and their use in the delivery of tumor-associated antigens (TAAs) has been shown to enhance anti -tumor efficacy relative to TAAs alone (no NPs). In studies presented herein, different strategies were examined to deliver MHC class I and MHC class II antigen epitopes, with the goal of improving antigen-specific immune responses and increasing survival.
[0047] Dendritic cells are the most efficient antigen-presenting immune cells and are important to orchestrate T cell immunity through the process of T cell priming, constituting T cell activation and proliferation. They7activate T cells through presenting antigen in the context of the appropriate MHC molecule and providing co-stimulatory signals. MHC class I molecules display compatible antigenic peptides to cytotoxic T cells (CD8+ T cells), whileAtorney docket No. 00058-088W01MHC class II molecules present peptides to T helper cells (CD4+ T cells). Cancer vaccine therapies conventionally focus on activating CD8+ T cells via presentation of MHC class I antigens to elicit an antigen-specific, cytolytic anti-tumor response. However, an accumulating body of evidence supports engaging both cytolytic and helper T cell responses. The activation of DCs with both sets of T cells elicits several biological responses, including facilitating DC maturation through the CD40-CD40L interactions, increasing CD8+ T cell secretion of pro-inflammatory cytokines (such as interleukin (IL)-2 and interferon (IFN)-y), and promoting cell proliferation (see FIG. 4C), relative to the DC-to-CD8+ T cell only interactions (see FIG. 4A-B). Despite this evidence supporting the immunological advantage of a DC activating both T cell subsets, the strategy by which NP-based vaccines should deliver MHC class I and II peptides for tumor treatment has not previously been evaluated.
[0048] A large body of evidence has demonstrated that targeting both T cell subsets can significantly improve cytotoxic T cell function. Early research utilizing knockout mice (such as MHC II- / - strains) demonstrated that CD4+ T cell interaction with the same DC was important for increased CD8+ T cell cytokine secretion (such as IL-2 and interferon (IFN)-y) and proliferation. While antigen-specific IFN-y secretion is indicative of improved Thl response and cytotoxic potential, IL-2 supports T cell proliferation, the expression of effector molecules and pro-inflammatory' cytokine secretion. Improved CD8+ T cell proliferation is contingent upon cognate CD4+ T cell help, which can improve the recruitment of those CD8+ T cells to that DC. Interestingly, CD8+ T cells can even help CD4+ T cells in return, acquiring DC membrane fragments (such as epitope-bound MHC II) through trogocytosis, enabling CD4+ T cell recruitment to the cognate DC and the stabilization of these ternary cellular complexes.
[0049] Despite established immunological evidence supporting the importance of a single DC activating T cell sub-sets, the application of this concept to peptide vaccines has been less straightforward. Multiple melanoma nanoparticle (NP)-based peptide vaccines codelivering MHC II and I peptides have been developed, improving anti-tumor response in mice over only CD8+ T cell targeting controls. However, in these studies, the necessity of these designs to co-deliver both MHC class I and MHC class II peptides through the same vehicle was not investigated. While recent immunization studies have supported superior DC activation or T cell response for co-delivering formulations (as compared to separately delivering NPs), this comparison was not necessarily extended to the tumor treatment setting.Atorney docket No. 00058-088W01Paradoxically, a clinical trial from the early 2010s demonstrated that vaccination with an emulsion of melanoma MHC class II and I peptides decreased antigen-specific circulating CD8+ T cell IFN-y responses, warranting further investigation into optimal peptide vaccine strategies.
[0050] E2 protein NPs are a subunit of pyruvate dehydrogenase and offer a number of advantages, including size within the optimal size (—30 nm diameter) for uptake by DCs. specific functionalization enabled by genetic engineering, and high thermal stability. The glycoprotein 100 (gplOO) is a melanocyte differentiation protein, which while present in normal cells, or molecules, and pro-inflammatory cytokine secretion is over-expressed in melanoma cells. Human gplOO epitopes were used due to previously observed improved zenologic responses while maintaining T cell cross-reactivity in mice. MHC class I epitope derived from gplOO was used with gplOO MHC class II epitopes. Epitopes like gplOO have been identified and shown to activate mouse or human CD4+ T cells. In the study presented herein, the E2 protein NP platform w as utilized to investigate the optimal design to deliver gplOO MHC class I and / or II gplOO epitopes. It was postulated herein that dual-targeting of CD8+ and CD4+ T cells would improve antigen-specific immunity over single-targeting of CD8+ T cells. Additionally, it was further postulated that dual-targeting benefits would require the co-delivery of both MHC classes of gplOO peptides simultaneously, rather than a mixture of single-targeting CD4+ T cell and CD8+ T cell NP designs due to less frequent ternary cognate interactions between DCs. CD4+ T cells, and CD8+ T cells.
[0051] In the literature, multiple studies utilize strategies targeting both CD4+ and CD8+ T cells simultaneously. Traditionally, regardless of tumor model, the targeting of CD8+ T cells through the use of MHC I restricted epitopes is much more common to those with only MHC II restricted epitopes. Cancer vaccines in recent years have trended towards the targeting of both major T cell subsets, however, such as in numerous polymer-based NP, nucleic acid-based NP, synthetic long peptides mixed with adjuvant, and protein NP designs. Some of these designs have even been evaluated in clinical settings, w ith promising trends for safety and melanoma treatment. Despite these many studies, no NP vaccine design studies have been conducted to evaluate whether MHC class I and II epitopes should be delivered simultaneously or in different NPs in the context of cancer treatment or vaccination. Such comparisons have been restricted to NP immunization studies using model ovalbumin antigens or are not included as controls at all in a tumor setting.Atorney docket No. 00058-088W01
[0052] It was postulated herein that NP cancer vaccines delivering MHC class I and class II antigens on the same NP would elicit a stronger specific CD8+ T cell response and robust anti-tumor response (see FIG. 4C) compared to alternative strategies with MHC class I antigen delivered alone (see FIG. 4A) or separately from MHC class II antigen (see FIG. 4B) on NPs. To test this hypothesis, single-antigen NPs (see FIG. 4A), single-antigen NP mixtures (see FIG. 4B), and dual-antigen NPs (see FIG. 4C) were synthesized for two distinct mouse tumor models. The effects of these NP strategies were compared in immunization and tumor treatment studies.
[0053] Previous studies examined a B 16 / F 10 melanoma vaccine using a protein NP (E2) for the simultaneous delivery of Toll-like receptor (TLR) agonist cytosine-phosphorothioate- guanine (CpG) (SEQ ID NO: 14) and the MHC class I melanoma peptide gplOO25-33 (KVPRNQDWL, abbreviated gplOO-I (SEQ ID NO:2); this NP is termed (gp!00-I)-CpG-E2. To show efficacy across multiple T helper (Th) polarized backgrounds and MHC haplotypes, the current studies assessed these NP design strategies (see FIG. 4) in two syngeneic tumor models, the Bl 6 / F 10 melanoma and CT26 colon carcinoma models. While Bl 6 / F 10 is on a Thl -biased C57BL / 6 background and has MHC Class I H2band Class II I-Abhaplotype, the CT26 model is on a Th2-biased BALB / c background and has an MHC haplotype of H2dand I-Ad. The following MHC class I and II antigens were chosen for their immunogenicity7to be conjugated to the NP platform: gplOO-I (gplOO25-33, KVPRNQDWL (SEQ ID NO:2)) and gplOO-II (gplOO45-59. NRQLYPEWTEAQRLD (SEQ ID NO:4)) for the melanoma model, and CT-I (gp70423-43i mimotope, SPSYAYHQF (SEQ ID NO: 6) and CT-II (CT26-ME1 neoantigen, LHSGQNHLKEMAISVLEARACAAAGQS (SEQ ID NO: 8) for the colon carcinoma model.
[0054] Thee E2 protein NP vaccine platform was used for co-delivery of antigen(s) and adjuvant (see FIG. 2), applying prior conjugation strategies that release both antigen and adjuvant after the NP is taken up by DCs. E2 NPs consist of 60 identical subunits from pyruvate dehydrogenase and offer a number of advantages, including particle size (~30 nm) within the optimal size range for uptake by DCs, specific functionalization enabled by genetic engineering, and high stability. Co-delivery of vaccine components by attachment to E2 NPs, rather than administering free antigen and adjuvant, improved potency, likely due to enhanced antigen display on activated DCs and reduced off-target effects.Atorney docket No. 00058-088W01
[0055] In the studies presented herein, the E2 protein NP platform was utilized to evaluate strategies that deliver MHC class I and II antigens to DCs for robust anti-tumor cytotoxic T cell responses, supported by T helper cells (see FIG. 4). This was examined for both B16 / F10 melanoma and CT26 colon carcinoma models, respectively, to assess the robustness of the approaches across tumor models. While C57BL / 6 mice are inherently biased towards Thl responses. BALB / c mice are Th2-biased. B16 / F10 is an aggressive cancer , but it was also important to test anti-CT26 efficacy in the Th2 -biased BALB / c mice, where generating Thl responses is still important for tumor eradication but could be more difficult to achieve. Vary ing Th biases have been demonstrated in humans, with contributing factors including race, sex. genetics, or psychological state. Therefore, developing therapeutic platforms that can elicit robust anti -tumor responses across the spectrum of Thl and Th2 bias is highly desirable, serving as motivation to evaluate the primary hypothesis (see FIG. 4) in multiple murine tumor models.
[0056] E2 NPs encapsulating CpG adjuvant and decorated with peptides of only MHC class I epitope [(gp!00-I)-CpG-E2 or (CT-I)-CpG-E2], only MHC class II epitope [(gplOO- II)-CpG-E2 or (CT-II)-CpG-E2], or both classes of epitopes [(gpl00-I+II)-CpG-E2 or (CT- I+II)-CpG-E2] were synthesized. Mice were immunized with MHC class I single-antigen NPs, a mixture of MHC class I single-antigen NPs and MHC class II single-antigen NPs, or co-conjugated MHC class I and II antigens on NPs (with equivalent CpG and peptide dosages), and subsequently assessed antigen-specific cytokine secretions (e.g., IFN-y and IL- 2) and splenocyte immune cell population changes. Each group was then evaluated for tumor grow th and survival in B16 / F10 melanoma or CT26 colon carcinoma treatment studies.
[0057] Although NP -based cancer vaccines conventionally incorporate solely MHC class I antigens, the studies presented herein support the use of MHC class II peptides (gplOO-II, CT-II) on NPs to improve anti-tumor efficacy. It was observed antigen-specific proliferation of splenocytes from mice immunized with gplOO-II on NPs (see FIG. SC). In both tumor models, cell population analysis of the splenocytes and LN cells also suggested the activation of T cells (see FIGs. 8D, 11, 15, and 16D); with increased DC trafficking to LNs. the decrease in percentages of T cells in lymphoid organs could suggest T cell egressing from the lymph organ to the periphery7. Furthermore, a higher number of IFN-y producing splenocytes resulted from CT-II stimulation in the BALB / c model (see FIG. 16C), indicating enhanced antigen-specific T cell activation and Thl response following NP immunizationAtorney docket No. 00058-088W01 despite using this Th2 -biased model. All of these effects are likely facilitated by DCs and CD4+ T cells. The data presented herein lend additional support to the accumulating evidence that CD4 T cell responses alone can play an important role in anti-tumor vaccine immune responses and efficacy, and they demonstrate the advantage of including an MHC class II epitope in NP-based cancer vaccines to induce T cell proliferation and elicit an antigen-specific IFN-y response, even in a Th2-biased murine model.
[0058] In both the melanoma and colon carcinoma models, immunization with dualantigen NPs yielded increased MHC class I-specific Thl cytokine responses (e.g., IFN-y, IL- 2, TNF-a) compared to the single-antigen NP mixtures or MHC class I peptide-only NPs. This indicated that the co-delivery of MHC class I and II antigens on the same NP, and hence likely to the same DC (e.g, see FIG. 4C). improved cell-mediated responses (see FIGs. 5C- D, 17C, and 19A-C). It was consistently observed that IFN-y immune responses (see FIGs. 12C and 17C) from MHC class I and II antigens on separate, single-antigen NPs were not enhanced compared to MHC class I peptide-only NPs (see FIG. 4A-B). A possible explanation is that in the mixture of single-antigen NPs. a large proportion of NPs displayed only MHC class II antigens. Although the total antigen, adjuvant, and NP doses were matched across groups, controlling the peptide-to-NP ratio was challenging. Therefore, the mixture may have reduced the probability7of the same DC simultaneously activating both CD4+ and CD8+ T cells, causing a diluted education towards MHC class I antigen.Alternatively, the data possibly indicate potential spatial and temporal constraints for optimal DC activation of T cells (see FIG. 4C), in addition to the recently appreciated spatial factors in the tumor microenvironment.
[0059] Higher MHC class II antigen-specific IL-2 cytokine secretion was also observed following immunization with dual-antigen (gpl00-I+II)-CpG-E2 and (CT-I+II)-CpG-E2 NPs (see FIGs. 12D and 17C). IL-2 can support T cell proliferation, expression of effector molecules, and pro-inflammatory cytokine secretion, so the data suggest the importance of CD4+ T cell support of CD8+ T cells for the dual-antigen vaccines. Notably, a Th2 cytokine response, which can be pro-tumor, was not observed following immunization with (CT-I+II)- CpG-E2 NPs, despite the use of CT-11 peptide and Th2-biased BALB / c mice; this could be the effect of using CpG, which is a Thl-inducing adjuvant.
[0060] Regardless of tumor model, the data presented herein support mechanistic advantages of delivering both MHC classes of antigens to the same DC, as well as theAtorney docket No. 00058-088W01 benefits of delivering both MHC class I and II antigens by NP vaccines to enhance antigen specific Thl cytokine secretion and promote greater CD4+ or CD8+ T cell proliferation (see FIG. 4C). Together with the findings from MHC class II peptide-only NP immunizations, the results presented herein suggest that while MHC class I single-antigen NPs can produce robust anti-tumor immune responses, the co-delivery of both MHC class I and II antigens on the same NPs can significantly amplify targeted cytotoxic T cell responses.
[0061] For both models, the data presented herein demonstrate that immunization with the dual-antigen NPs improved tumor treatment efficacy compared to other NP groups. Melanoma or colon carcinoma treatment with the dual-antigen NPs [Group 4] was significantly more efficacious than treatment with single-antigen NPs delivering only MHC class I antigen [Group 2] or both MHC class I and II antigens on separate vehicles [Group 3] (see FIGs. 13C and 21C). Furthermore, in both tumor models, there was no significant difference in survival between Groups 2 and 3, showing that addition of MHC class II peptides, delivered on a separate NP, did not improve efficacy. In other words, immunizations using MHC class II antigen improved survival only when co-delivered with MHC class I antigen on the same NPs. Previous studies did not perform comparisons between mixtures of MHC class I / II single-antigen NPs and dual-antigen NPs in a tumor treatment setting, so the studies presented herein have identified an important consideration in the design of peptide-delivering anti-cancer vaccine therapies.
[0062] Compared to other melanoma NP therapies, the (gpl00-I+II)-CpG-E2 NPs were relatively effective for their component dosages and administration schedule. Treatment with these dual-antigen NPs utilized much lower gplOO antigen doses (5-15 pg versus -100 pg in prior studies), implemented a two-dose rather than a three- or four-dose NP treatment schedule, and did not require combination with additional strategies, such as with checkpoint immunotherapy (e.g., anti-PDl) or DC-targeting ligands (such as mannose). Other proteinbased NP platforms complexed with gplOO proteins caused earlier onset and development of larger tumors within 30 days, compared to the two-dose treatment with (gpl00-I+II)-CpG-E2 NPs (see FIG. 14D)
[0063] The studies presented herein strongly support that both MHC classes of antigens should be co-delivered within the same NP vaccine vehicles, rather than on separate NPs or using MHC class I antigen alone (without MHC class II antigen), for significantly improved potency in the treatment of tumors. The consistency of the results across two tumor models,Atorney docket No. 00058-088W01 despite differing inherent Th biases in the mouse strains, reinforces the broad applicability of designing NP immunotherapies to educate DCs for the simultaneous activation of CD8+ and CD4+ T cells, and supports the DC presentation scheme suggested in FIG. 4C. Accordingly, the disclosure provides a more effective NP-based strategy for immune system education and potential cancer treatment over conventional methods of delivering only MHC class I epitopes.
[0064] The disclosure provides for a vaccine formulation or preparation that comprises an adjuvant along with MHC class I and II restricted antigens conjugated to the nanoparticles, wherein MHC class I and II restricted antigens elicit an antitumor effect in vivo. The studies presented herein indicates that MHC I and MHC II peptides on the same nanoparticle provided simultaneous delivery to the same immune (dendritic) cells to bring about significantly higher anti-tumor inflammatory response in comparison to MHC I and MHC II peptides on different nanoparticles. Moreover, this anti-tumor effect promoted longer survival of mice in various tumor models, and further of which, the mice remained tumor- free. In a further embodiment, the MHC class I and II restricted antigens are selected from CT, NY-ESO-1, gplOO, CT26, alphafetoprotein (AFP), carcinoembryonic antigen (CEA), CA-125, CA15-3, CA19-9, MUC-1, epithelial tumor antigen (ETA), tyrosinase, melanoma- associated antigen (MAGE), abnormal products of ras or p53, CTAG1B, MAGEA1, and HER2 / neu. In another embodiment, the ratio of MHC class I restricted antigen to MHC class II restricted antigen is 1: 10, 1:9, 1:8. 1 :7, 1 :6, 1 :5. 1:4, 1 :3, 1 :2. 1 : 1. 2: 1, 3: 1, 4: 1. 5: 1 6: 1, 7: 1, 8: 1, 9: 1, or 10: 1, or a range that includes or is between any two of the foregoing ratios.
[0065] In a particular embodiment, the vaccine formulation or preparation disclosed herein comprises nanoparticles that are hollow and comprise an outer surface and an accessible inner cavity, where the MHC class I and II restricted antigens and / or the adjuvant are conjugated to the outer surface of the nanoparticles, and / or where the MHC class I and II restricted antigens and / or the adjuvant are conjugated or loaded into the inner cavity of the nanoparticles. In a further embodiment, the MHC class I and II restricted antigens are conjugated to the outer surface of the nanoparticles, and wherein the adjuvant is conjugated or loaded into the inner cavity of the nanoparticles. In yet a further embodiment, the adjuvant is conjugated to the outer surface of the nanoparticles, and wherein the MHC class I and II restricted antigens are conjugated or loaded into the inner cavity of the nanoparticles. In another embodiment, the nanoparticles are hollow protein nanoparticles. In yet a furtherAtorney docket No. 00058-088W01 embodiment, the hollow protein nanoparticles are based on a heat shock protein(s). bacteriophage QP, human heavy chain ferritin, TIP60, or hepatitis B virus (HBV) surfaceantigen protein. In another embodiment, the hollow protein nanoparticles are based on the E2 subunit of the pyruvate dehydrogenase complex (PDC) from the Geobacillus stearothermophilus. The E2 subunit from Geobacillus stearothermophilus can self-assemble into a 60-mer hollow spherical protein cage of ~25 nm diameter and can be functionalized with non-native molecules on its external and internal surfaces. This platform has been shown to efficiently activate dendritic cells and elicit CD8 T cell responses in tumor vaccination models when using CD8 epitope peptide antigens. In order to facilitate the conjugation of the adjuvant and antigen to the E2 nanoparticles, one or more ammo acids of the E2 subunit have been recombinantly modified to substitute one or more amino acids with cysteines.
[0066] In a certain embodiment, the agent(s) (<?. g. , antigen and / or adj uvant) can be conjugated to the nanoparticles by using any number of methods and reagents know n in the art. For example, the methods and reagents for conjugating the agent(s) (e.g., antigen and / or adjuvant) to the nanoparticles can include, but are not limited to, mal-tNTA-Ni, sulfo-SMCC, sortase A ligation, and the SpyCatcher / SpyTag system. In a particular embodiment, the methods and reagents for conjugating antigens to the nanoparticles comprise sulfo-SMCC.
[0067] The disclosure provides for a vaccine formulation or preparation that comprises an adjuvant along with MHC class I and II restricted antigens conjugated to the nanoparticles, wherein the adjuvant increases or modulates the immune response in subjects receiving the vaccine. Adjuvants in immunology are often used to modify or augment the effects of a vaccine by stimulating the immune system to respond to the vaccine more vigorously, and thus providing increased immunity to a particular disease. Adjuvants accomplish this task by mimicking specific sets of evolutionarily conserved molecules, so called pathogen-associated molecular patterns, which include liposomes, lipopolysaccharide, molecular cages for antigens, components of bacterial cell walls, and endocytosed nucleic acids such as RNA, double-stranded RNA, single-stranded DNA, and unmethylated CpG dinucleotide-containing DNA. Because immune systems have evolved to recognize these specific antigenic moieties, the presence of an adjuvant in conjunction with the vaccine can greatly increase the innate immune response to the antigen by augmenting the activities of dendritic cells, lymphocytes, and macrophages by mimicking a natural infection. Examples of adjuvants include, but areAtorney docket No. 00058-088W01 not limited to, CpG oligodeoxynucleotide based adjuvants, ssRNA, aluminum salts (e.g.. aluminum hydroxide, aluminum phosphate, and aluminum potassium sulfate), AS04, MF59. ASOIB, and CpG 1018. In a particular embodiment, the adjuvant is loaded or conjugated to the inner cavity and / or the outer surface of the nanoparticles by use of a linker that binds to both the adjuvant and free cysteine groups on the outer surface and / or inner cavity of the nanoparticles. In yet another embodiment, the adjuvant has been modified to comprise a terminal aldehyde or benzaldehyde group, and wherein the linker is a A-(P- maleimidopropionic acid) hydrazide (BMPH) linker.
[0068] In another embodiment, the vaccine formulation or preparation of the disclosure provides for the simultaneous delivery of the antigen and adjuvant from the nanoparticle in vivo. It was found in the studies presented herein that the simultaneous delivery of the antigen and adjuvant from the nanoparticle using the vaccine formulation of the disclosure provided for unexpected results in that the immune response was greatly improved when both agents were conjugated to the nanoparticles as opposed to only one agent being conjugated to the nanoparticles and the other agent being administered separately, even if the other agent was administered at the same time as the nanoparticle.
[0069] In a particular embodiment, the vaccine formulation or preparation disclosed herein comprises an antigen and a CpG oligodeoxynucleotide based adjuvant that are conjugated to nanoparticles. Examples of CpG oligodeoxynucleotide based adjuvants include, but are not limited to, CpG1018, CpG1826, CpG1018, CpG1826, CpG ODN 1466, CpG ODN PB3, CpG ODN BW005, CpG Alum, CPG 21424, CpG 7909, CpG-ODN 2135, ODN K3, CpG ODN 10101, CpG-28, CpG ODN C274, CpG ODN C695, CpG ODN#17, CpG-ODN 2722. CpG 8916. CpG 8954. CpG ODN 678, CpG ODN BW015, CpG ODN 658, CpG ODN 640, CpG ODN PB9. CpG ODN BW004, CpG ODN BW103, CpG ODN 110, CpG ODN BW206, CpG ODN 607, CpG ODN 647, CpG ODN 111, CpG ODN 109, CpG ODN 656, CpG ODN 664, CpG ODN C9, CPG2429, CPG5475, CPG21608, CPG21797, CPG21796, CPG21799, CPG21800, CPG21802, CPG21889, CPG23409, CpG-c41, CPG23410, CPG23411, CPG23412. CPG23413, CPG23617, CPG23414, CPG 1681, CPG 2143. CPG 21425. and CPG 21426. The sequences and activities for the foregoing CpG oligodeoxynucleotide based adjuvants are known and can readily be found in the art (e.g., see BOC Sciences).Atorney docket No. 00058-088W01
[0070] Synthetic oligodeoxynucleotides (ODNs) containing unmethylated CpG motifs trigger cells that express Toll-like receptor 9 (including human plasmacytoid dendritic cells and B cells) to mount an innate immune response characterized by the production of Thl and proinflammatory cytokines. When used as vaccine adjuvants, CpG ODNs improve the function of professional antigen-presenting cells and boost the generation of humoral and cellular vaccine-specific immune responses. These effects are optimized by maintaining ODNs and vaccine in close proximity. CpG DNA directly activates pDCs and B cells, contributing to the induction of both innate and adaptive immune responses. The cascade of events initiated by CpG DNA indirectly supports the maturation, differentiation and proliferation of natural killer cells. T cells and monocytes / macrophages. TLR-9-stimulated B cells produce IL-6. IL-12 and the CXCR3 chemokines IP-10, Mig and I-TAC. They also secrete IgM in a process partially dependent on IL-6 expression. B cells activated by CpG DNA upregulate expression of their Fc receptor (FcR) and costimulatory molecules including MHC class II, CD40, CD80 and CD86. Subsequently, the CpG-stimulated B cells proliferate and differentiate into plasma cells and memory B cells. CpG-based adjuvants can also impact cellular immune responses. In a recent study, the number and survival of CD8+T cells was significantly enhanced when CpG ODN was administered 2 days before peptide vaccination. The persistence of the CD8+T cells in the circulation doubled when compared with vaccine alone (p < 0.001). These effects were not observed with other TLR ligands. In a particular embodiment, vaccine formulation or preparation of the disclosure works in tandem, and in some cases, synergistically with an anti-cancer agent to provide a multimodal therapy that is more effective as a chemo-immunotherapy to a cancer than use of the anticancer agent alone or use of the vaccine formulation or preparation alone. Examples, of anticancer agents that can be used with the vaccine formulation or preparation disclosed herein include, but are not limited to, alkylating agents such as thiotepa and CYTOXAN® cyclosphosphamide; alkyl sulfonates such as busulfan, improsulfan and piposulfan; aziridines such as benzodopa, carboquone, meturedopa, and uredopa; ethylenimines and methylamelamines including altretamine, triethylenemelamine, trietylenephosphoramide, triethiylenethiophosphoramide and tiimethylolomelamine; acetogenins (e.g.. bullatacin and bullatacinone); a camptothecin (including the synthetic analogue topotecan); bryostatin; callystatin; CC-1065 (including its adozelesin, carzelesin and bizelesin synthetic analogues); cryptophycins (particularly cryptophycin 1 and cryptophycin 8); dolastatin; duocarmycinAttorncy docket No. 00058-088W01(including the synthetic analogues, KW-2189 and CB1-TM1); eleutherobin; pancratistatin; a sarcodictyin; spongistatin; nitrogen mustards such as chlorambucil, chlomaphazine, cholophosphamide, estramustine, ifosfamide, mechlorethamine, mechlorethamine oxide hydrochloride, melphalan, novembichin, phenesterine, prednimustine, trofosfamide, uracil mustard; nitrosureas such as carmustine, chlorozotocin, fotemustine, lomustine, nimustine, and ranimnustine; vinca alkaloids; epipodophyllotoxins; antibiotics such as the enediyne antibiotics (e.g, cahcheamicin, especially calicheamicin gammall and calicheamicin omegall; L-asparaginase; anthracenedione substituted urea; methyl hydrazine derivatives; dynemicin, including dynemicin A; bisphosphonates, such as clodronate; an esperamicin; as well as neocarzinostatin chromophore and related chromoprotein enediyne antiobiotic chromophores), aclacinomysins. actinomycin, authramycin. azaserine, bleomycins, cactinomycin, carabicin, carminomycin, carzinophilin, chromomycinis, dactinomycin, daunorubicin, detorubicin, 6-diazo-5-oxo-L-norleucine, ADRIAMYCIN® doxorubicin (including morpholino-doxorubicin, cyanomorpholino-doxorubicin, 2-pyrrolino-doxorubicin and deoxydoxorubicin), epirubicin, esorubicin, idarubicin, marcellomycin, mitomycins such as mitomycin C, mycophenolic acid, nogalamycin, olivomycins, peplomycin, potfiromycin, puromycin, quelamycin, rodorubicin, streptonigrin, streptozocin, tubercidin, ubenimex, zinostatin, zorubicin; anti-metabolites such as methotrexate and 5 -fluorouracil (5-FU); folic acid analogs such as denopterin, methotrexate, pteropterin, trimetrexate; purine analogs such as fludarabine. 6-mercaptopurine, thiamiprine, thioguanine; pyrimidine analogs such as ancitabine, azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, doxifluridine, enocitabine, floxuridine; androgens such as calusterone, dromostanolone propionate, epitiostanol, mepitiostane, testolactone; anti-adrenals such as aminoglutethimide, mitotane, trilostane; immune checkpoint inhibitors such as pembrolizumab. nivolumab, nemiplimab. and dostarlimab; folic acid replenisher such as frolinic acid; aceglatone; aldophosphamide glycoside; aminolevulinic acid; eniluracil; amsacrine; bestrabucil; bisantrene; edatraxate; defofamine; demecolcine; diaziquone; elfomithine; elliptinium acetate; an epothilone; etoglucid; gallium nitrate; hydroxyurea; lentinan; lonidainine; maytansinoids such as maytansine and ansamitocins; mitoguazone; mitoxantrone; mopidanmol; nitiaerine; pentostatin; phenamet; pirarubicin; losoxantione; podophyllinic acid; 2-ethylhydrazide; procarbazine; PSK® polysaccharide complex (JHS Natural Products, Eugene, Oreg.); razoxane; rhizoxin; sizofiran; spirogermanium; tenuazonic acid; triaziquone; 2.2 2"-Atorney docket No. 00058-088W01 trichlorotiiethylamine; trichothecenes (especially T-2 toxin, verracurin A, roridin A and anguidine); urethan; vindesine; dacarbazine; mannomustine; mitobronitol; mitolactol; pipobroman; gacytosine; arabinoside ("Ara-C"); cyclophosphamide; thiotepa; taxoids, e.g., TAXOL® paclitaxel (Bristol-Myers Squibb Oncology, Princeton, N.J.), ABRAXANE® Cremophor-free, albumin-engineered nanoparticle formulation of paclitaxel (American Pharmaceutical Partners. Schaumberg, Ill.), and TAXOTERE® (docetaxel) (Rhone-Poulenc Rorer, Antony. France); chloranbucil; GEMZAR® (gemcitabine); 6-thioguanine; mercaptopurine; methotrexate; platinum coordination complexes such as cisplatin, oxaliplatin and carboplatin; vinblastine; platinum; etoposide (VP- 16); ifosfamide; mitoxantrone; vincristine; NAVELBINE® vinorelbine; novantrone; teniposide; edatrexate; daunomycin; aminopterin; xeloda; ibandronate; irinotecan (e.g.. CPT-11); topoisomerase inhibitor RFS 2000; difluoromethylomithine (DFMO); retinoids such as retinoic acid; capecitabine; leucovorin (LV); irenotecan; adrenocortical suppressant; adrenocorticosteroids; progestins; estrogens; androgens; gonadotropin-releasing hormone analogs; and pharmaceutically acceptable salts, acids or derivatives of any of the above. Also included anticancer agents are anti-hormonal agents that act to regulate or inhibit hormone action on tumors such as antiestrogens and selective estrogen receptor modulators (SERMs), including, for example, tamoxifen (including NOLVADEX® tamoxifen), raloxifene, droloxifene, 4- hydroxytamoxifen. trioxifene, keoxifene, LY117018, onapristone, and FARESTON- toremifene; aromatase inhibitors that inhibit the enzyme aromatase, which regulates estrogen production in the adrenal glands, such as, for example, 4(5)-imidazoles, aminoglutethimide, MEGASE® megestrol acetate, AROMASL® exemestane, formestanie, fadrozole, RIVISOR® vorozole, FEMARA® letrozole, and ARTMIDEX® anastrozole; and antiandrogens such as flutamide, nilutamide, bicalutamide, leuprolide, and goserelin; as well as troxacitabine (a 1,3-di oxolane nucleoside cytosine analog); antisense oligonucleotides, particularly those which inhibit expression of genes in signaling pathways implicated in abherant cell proliferation, such as, for example, PKC-alpha, Ralf and H-Ras; ribozy mes such as a VEGF-A expression inhibitor e.g., ANGIOZYME® ribozyme) and a HER2 expression inhibitor; vaccines such as gene therapy vaccines, for example. ALLOVECTIN® vaccine. LEUVECTIN® vaccine, and VAXID® vaccine; PROLEUKIN® rJL-2; LURTOTECAN® topoisomerase 1 inhibitor; ABARELLX® rmRH; antibodies such as trastuzumab and pharmaceutically acceptable salts, acids or derivatives of any of the above. In a particularAtorney docket No. 00058-088W01 embodiment, the disclosure provides for combined therapy comprising the vaccine formulation or preparation disclosed herein used in combination with a tyrosine kinase inhibitor (TKJ). Examples of protein kinase inhibitors, include but are not limited to, adavosertib, afatinib, axitinib, bosutinib, cetuximab, cobimetinib, crizotinib, cabozantinib, dasatinib, entrectinib, erdafitinib, erlotinib, fostamatinib, gefitinib, ibrutinib, imatinib, lapatinib. lenvatinib, mubritinib. nilotinib. pazopanib, pegaptanib, ruxolitinib, sorafenib, sunitinib. SU6656. vandetanib, and vemurafemb. In another embodiment, the disclosure provides for combined therapy comprising the vaccine preparation or fourmulation disclosed herein used in combination with an angiogenesis inhibitor. Examples of angiogenesis inhibitors, include but are not limited to. axitinib, bevacizumab, cabozantinib, everolimus, lenalidomide, lenvatinib mesylate, pazopanib. ramucirumab, regorafenib. sorafenib, sunitinib, thalidomide, vandetanib, and Ziv-aflibercept. In another embodiment, the disclosure provides for combined therapy comprising the vaccine formulation or preparation disclosed herein used in combination with a PARP inhibitor. Examples of PARP inhibitors, include but are not limited to, olaparib, niraparib, rucaparib, and talzoparib. The anticancer agent may be administered, by a route and in an amount commonly used therefore, simultaneously (at the same time or in the same formulation) or sequentially with a vaccine formulation or preparation as disclosed herein. In another embodiment, the disclosure provides for combined therapy comprising the vaccine formulation or preparation disclosed herein used in combination with an immune checkpoint inhibitor. Examples of immune checkpoint inhibitors, include but are not limited to, Pembrolizumab, Nivolumab, Cemiplimab, Dostarlimab, Tislelizumab, Penpulimab, Retifanlimab, Atezolizumab, Avelumab, Durvalumab, Ipilimumab, Tremelimumab, Relatlimab, Lag3, ICOS, TIM 3, SIGLECs 7 and 9, VISTA, A2A and A2B, CD276.and N0X2. Accordingly, the pharmaceutical compositions disclosed herein include those that also contain one or more anticancer agents in addition to vaccine formulation or preparation disclosed herein.
[0071] The vaccine formulation or preparation disclosed herein can be administered to any host, including a human or non-human animal, in an amount effective to inhibit or suppress the growth of a cancer or result in the death of cancer cells. Any of a variety of art- known methods can be used to administer the vaccine formulation or preparation disclosed herein with one or more additional anticancer agents. For example, administration can be parenterally, by injection or by gradual infusion over time. The vaccine formulation orAtorney docket No. 00058-088W01 preparation disclosed herein or with the anticancer agent can be administered intravenously, intraperitoneally, intramuscularly, subcutaneously, intracavity, by inhalation, or transdermally.
[0072] The disclosure further provides for specified modes of administration for administering the vaccine formulation or preparation disclosed herein. In one embodiment, the disclosure provides for a pharmaceutical composition that comprises a vaccine formulation or preparation disclosed herein and a pharmaceutically acceptable carrier. The term ‘‘pharmaceutically acceptable carrier" as used herein means a pharmaceutically acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, solvent or encapsulating material, involved in carrying or transporting the subject agents from one organ, or portion of the body, to another organ, or portion of the body. Each carrier should be “acceptable’’ in the sense of being compatible with the other ingredients of the composition and is compatible with administration to a subject, for example a human. Such compositions can be specifically formulated for administration via one or more of a number of routes, such as the routes of administration described herein. Supplementary active ingredients also can be incorporated into the compositions. When an agent, formulation or pharmaceutical composition described herein, is administered to a subject, preferably, a therapeutically effective amount is administered. As used herein, the term “therapeutically effective amount” refers to an amount that result in an improvement or remediation of the condition.
[0073] The disclosure further provides for the use of a vaccine formulation or preparation disclosed herein for vaccinating a subject. Suitable methods of administering a vaccine formulation or preparation described herein to a patient include by any route of in vivo administration that is suitable for delivering thermosensitive hydrogels to a patient. Examples of modes of administration include, but are not limited to, intravenous administration, intertumoral administration, intraperitoneal administration, intramuscular administration, intracoronary administration, intraarterial administration (e g., into a carotid artery), subcutaneous administration, transdermal deliver)’, intratracheal administration, subcutaneous administration, intraarticular administration, intraventricular administration, inhalation (e.g., aerosol), nasal, oral, pulmonary administration, impregnation of a catheter, and direct injection into a tissue.Atorney docket No. 00058-088W01
[0074] Intravenous, intraperitoneal, and intramuscular administrations can be performed using methods standard in the art. Aerosol (inhalation) delivery can also be performed using methods standard in the art (see, for example, Stribling et al., Proc. Natl. Acad. Set. USA 189: 11277-11281, 1992, which is incorporated herein by reference in its entirety). Oral delivery can be performed by complexing a vaccine formulation or preparation disclosed herein to a carrier capable of withstanding degradation by digestive enzymes in the gut of an animal. Examples of such carriers include plastic capsules or tablets, such as those known in the art.
[0075] Preparations for parenteral administration of a vaccine formulation or preparation disclosed herein include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils (e.g., olive oil), and injectable organic esters such as ethyl oleate. Examples of aqueous carriers include water, saline, and buffered media, alcoholic / aqueous solutions, and emulsions or suspensions. Examples of parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, and fixed oils.Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), and the like. Preservatives and other additives such as, other antimicrobial, anti-oxidants, cheating agents, inert gases and the like also can be included. Sterile injectable solutions can be prepared by incorporating the vaccine formulation or preparation disclosed herein in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the pharmaceutical composition into a sterile vehicle that contains a basic dispersion medium and the required other ingredients from those enumerated above.
[0076] The appropriate dosage and treatment regimen for the vaccine formulation or preparation described herein will vary with respect to the needed vaccination schedule of the subject. In certain cases, only one vaccine formulation or preparation may need to be administered to a subject to bring about effective immunity to a pathogen or noninfectious disease. In other cases, one or more booster shots of the vaccine formulation or preparation disclosed herein may be needed. In such a case, the one or more booster shots may have the same dose of targeted antigen(s) or be of a lower dose. For multiple doses of the vaccine formulation or preparation disclosed herein, they may be administered a week or more apart.Atorney docket No. 00058-088W01
[0077] The disclosure provides methods for immunizing a subject with a cancer or suspected of having a cancer comprising: administering a therapeutically effective amount of a vaccine formulation or preparation disclosed herein. A therapeutically effective amount can be measured as the amount sufficient to promote an anti-cancer or anti-tumor effect in a subject. Generally, the optimal dosage of a vaccine formulation or preparation disclosed herein will depend upon the type and stage of the cancer and factors such as the weight, sex, and condition of the subject. Nonetheless, suitable dosages can readily be determined by one skilled in the art. Typically, dosages used in vitro may provide useful guidance in the amounts useful for in situ administration of the pharmaceutical composition, and animal models may be used to determine effective dosages for treatment of specific infections. Various considerations are described, e.g.. in Langer, Science, 249: 1527, (1990);Gilman et al. (eds.) (1990), each of which is herein incorporated by reference. Typically, a suitable dosage for the vaccine formulation or preparation disclosed herein is 1 to 1000 mg / kg body weight, e.g., 10 to 500 mg / kg body weight.
[0078] For use in the therapeutic and diagnostic applications described herein, kits and articles of manufacture are also described herein. Such kits can comprise a carrier, package, or container that is compartmentalized to receive one or more containers such as vials, tubes, and the like, each of the container(s) comprising one of the separate elements to be used in a method described herein. Suitable containers include, for example, bottles, vials, syringes, and test tubes. The containers can be formed from a variety of materials such as glass or plastic.
[0079] For example, the container(s) can comprise a vaccine delivery platform described herein, optionally in a composition or in combination with another agent as disclosed herein. The container(s) optionally have a sterile access port (for example the container can be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle). Such kits optionally comprise an identifying description or label or instructions relating to its use in the methods described herein.
[0080] A kit will typically comprise one or more additional containers, each with one or more of various materials (such as reagents, optionally in concentrated form, and / or devices) desirable from a commercial and user standpoint for use of a compound described herein. Non-limiting examples of such materials include, but are not limited to, buffers, diluents, fdters, needles, syringes; carrier, package, container, vial and / or tube labels listing contentsAtorney docket No. 00058-088W01 and / or instructions for use, and package inserts with instructions for use. A set of instructions will also typically be included.
[0081] A label can be on or associated with the container. A label can be on a container when letters, numbers or other characters forming the label are attached, molded or etched into the container itself, a label can be associated with a container when it is present within a receptacle or earner that also holds the container, e.g, as a package insert. A label can be used to indicate that the contents are to be used for a specific therapeutic application. The label can also indicate directions for use of the contents, such as in the methods described herein. These other therapeutic agents may be used, for example, in the amounts indicated in the Physicians' Desk Reference (PDR) or as otherwise determined by one of ordinary skill in the art.
[0082] The disclosure further provides that the compositions, systems and methods described herein can be further defined by the following aspects (aspects 1 to 43):1. A vaccine formulation for the simultaneous deliver}' of MHC class I and II restricted antigens and an adjuvant, comprising: nanoparticles that are hollow and comprise an outer surface and an accessible inner cavity, wherein MHC class I and II restricted antigens and / or the adjuvant are conjugated to the outer surface of the nanoparticles, and / or wherein MHC class I and II restricted antigens and / or the adjuvant are conjugated or loaded into the inner cavity of the nanoparticles wherein the vaccine formulation is designed to elicit a targeted immune response in a subject having or suspected of having cancer, an autoimmune disease, or an autoimmune state.2. The vaccine formulation of aspect 1, wherein the MHC class I and II restricted antigens are peptides.3. The vaccine formulation of aspect 1 or aspect 2, wherein the MHC class I and II restricted antigens are associated with a cancer selected from lung cancer, colorectal cancer, melanoma, chronic myeloid leukemia, colorectal carcinoma, stomach cancer, gastric carcinoma, endometrial carcinoma, head and neck squamous cell carcinoma, myeloid leukemia, lung squamous CC, acute lymphoblastic leukemia, acute myelogenous leukemia, chronic lymphocytic leukemia, renal cell carcinoma, ovarian cancer, metastatic colorectalAtorney docket No. 00058-088W01 cancer, pancreatic adenocarcinoma, bladder cancer, lung squamous cell carcinoma, promyelocytic leukemia, sarcoma, breast cancer, prostate cancer, liver cancer, thyroid cancer, testicular cancer, kidney cancer, glioblastoma, pancreatic cancer, and retinal cancer.4. The vaccine formulation of any one of aspects 1 to 3, wherein the MHC class I and II restricted antigens are selected from CT, NY-ESO-1, gplOO, CT26, alphafetoprotein (AFP), carcinoembryonic antigen (CEA), CA-125, CA15-3, CA19-9. MUC-1, epithelial tumor antigen (ETA), tyrosinase, melanoma-associated antigen (MAGE), abnormal products of ras or p53, CTAG1B, MAGEA1, HER2 / neu, Melan-A, prostate specific antigen (PSA), prostate acid phosphatase (PAP), TRP1, TRP2, Cyclin A, myelin oligodendrocyte glycoprotein. PLP, Collagen type II, vimentin, PAD4. alpha-enolase, and CDR1.5. The vaccine formulation of any one of aspects 1 to 4. wherein the ratio of conjugated MHC class I restricted antigen to MHC class II restricted antigen is from 1 : 10 to 10: 1.6. The vaccine formulation of any one of aspects 1 to 5, wherein the ratio conjugated MHC class I restricted antigen to MHC class II restricted antigen is from 1 : 1 to 1 :8.7. The vaccine formulation of any one of aspects 1 to 6, wherein the nanoparticles have a diameter from 20 nm to 50 nm.8. The vaccine formulation of any one of aspects 1 to 7, wherein the nanoparticles have a diameter of around 30 nm.9. The vaccine formulation of any one of aspects 1 to 8, wherein the nanoparticles are hollow protein nanoparticles.10. The vaccine formulation of aspect 9, wherein the hollow protein nanoparticles are based on a heat shock protein(s), bacteriophage QP. human heavy chain ferritin, TIP60, or hepatitis B virus (HBV) surface-antigen protein.11. The vaccine formulation of aspect 9, wherein the hollow protein nanoparticles are based on the E2 subunit, or a portion thereof, of the pyruvate dehydrogenase complex (PDC) from the Geobacillus stearothermophilus .12. The vaccine formulation of aspect 1 1. wherein the E2 subunit of the PDC has been recombinantly modified to substitute one or more amino acids with cysteines.13. The vaccine formulation of aspect 11, wherein the E2 subunit of PDC has a sequence identity of at least 98% to SEQ ID NO: 15.Atorney docket No. 00058-088W0114. The vaccine formulation of any one of aspects 1 to 13, wherein the adjuvant is selected from CpG1826, CpG1018, MGN1703, ssRNA, aluminum hydroxide, aluminum phosphate, and aluminum potassium sulfate, AS04, MF59, ASOIB, CpG ODN 1466, CpG ODN PB3, CpG ODN BW005, CpG Alum, CPG 21424, CpG 7909, CpG-ODN 2135, ODN K3. CpG ODN 10101, CpG-28, CpG ODN C274. CpG ODN C695, CpG ODN# 17, CpG- ODN 2722, CpG 8916, CpG 8954, CpG ODN 678, CpG ODN BW015, CpG ODN 658, CpG ODN 640, CpG ODN PB9, CpG ODN BW004, CpG ODN BW103, CpG ODN 110, CpG ODN BW206, CpG ODN 607, CpG ODN 647, CpG ODN 111, CpG ODN 109, CpG ODN 656, CpG ODN 664, CpG ODN C9, CPG2429, CPG5475, CPG21608, CPG21797, CPG21796, CPG21799, CPG21800. CPG21802, CPG21889, CPG23409, CpG-c41, CPG23410, CPG23411, CPG23412, CPG23413, CPG23617, CPG23414, CPG 1681, CPG 2143, CPG 21425, and CPG 21426.15. The vaccine formulation of any one of aspects 1 to 14, wherein the adjuvant is CpG1018 or CpG1826.16. The vaccine formulation of any one of aspects 1 to 15, wherein the MHC class I and II restricted antigens are conjugated to the outer surface of the nanoparticles, and wherein the adjuvant is conjugated or loaded into the inner cavity of the nanoparticles.17. The vaccine formulation of any one of aspects 1 to 16, wherein the MHC class I and II restricted antigens are conjugated to the outer surface of the nanoparticles by use of mal-tNTA-Ni, sulfo-SMCC, sortase A ligation, or by use of SpyCatcher / SpyTag.1 . The vaccine formulation of aspect 17, wherein the MHC class I and II restricted antigens are conjugated to the outer surface of the nanoparticles by use of sulfo-SMCC.19. The vaccine formulation of any one of aspects 1 to 17, wherein the adjuvant is conjugated or loaded into the inner cavity of the nanoparticles by use of a linker that binds to both the adjuvant and free cysteine groups in the inner cavity of the nanoparticles.20. The vaccine formulation of aspect 19, wherein the adjuvant has been modified to comprise a terminal aldehyde or benzaldehyde group, and wherein the linker is a A-(P- maleimidopropionic acid) hydrazide (BMPH) linker.21. The vaccine formulation of any one of aspects 1 to 20, wherein the vaccine formulation is formulated for oral administration, intranasal administration, subcutaneous administration, intradermal administration, or intramuscular administration.Atorney docket No. 00058-088W0122. A pharmaceutical composition comprising the vaccine formulation of any one of aspects 1 to 21, wherein the pharmaceutical composition further comprises a pharmaceutically acceptable carrier, diluent, stabilizer and / or excipient.23. The pharmaceutical composition of aspect 22, wherein the pharmaceutical composition further comprises a buffered saline solution.24. A method of immunizing a subj ect against a cancer comprising: administering one or more therapeutically effective doses of the vaccine formulation of any one of aspects 1 to 21 or the pharmaceutical composition of aspects 22 or 23 to a subject having a cancer or suspected of having a cancer.25. The method of aspect 24, wherein the subject is a human subject.26. The method of aspect 24 or aspect 25. wherein the cancer is selected from lung cancer, colorectal cancer, melanoma, chronic myeloid leukemia, colorectal carcinoma, stomach cancer, gastric carcinoma, endometrial carcinoma, head and neck squamous cell carcinoma, myeloid leukemia, lung squamous CC, acute lymphoblastic leukemia, acute myelogenous leukemia, chronic lymphocytic leukemia, renal cell carcinoma, ovarian cancer, metastatic colorectal cancer, pancreatic adenocarcinoma, bladder cancer, lung squamous cell carcinoma, promyelocytic leukemia, sarcoma, breast cancer, prostate cancer, liver cancer, thyroid cancer, testicular cancer, kidney cancer, glioblastoma, pancreatic cancer, and retinal cancer.27. The method of any one of aspects 24 to 26, wherein the administration of the vaccine formulation or the pharmaceutical composition to the subject induces the production of Thl or pro-inflammatory cytokines.28. The method of aspect 27, wherein the Thl or pro-inflammatory cytokines include IFN-y, TNF-a, and IL-2.29. The method of any one of aspects 24 to 28, wherein the administration of the vaccine formulation or the pharmaceutical composition to the subject results in antigenspecific T cell activation and a Thl response.30. The method of aspect 29, wherein antigen-specific T cell activation includes both CD4+ T cells and CD8+ T cells.Atorney docket No. 00058-088W0131. The method of any one of aspects 24 to 30, wherein the administration of the vaccine formulation or the pharmaceutical composition to the subject does not induce the production of Th2 inflammatory cytokines.32. The method of any one of aspects 24 to 31, wherein the administration of the vaccine formulation or the pharmaceutical composition to the subject slows the growth of cancer cells and / or tumors.33. The method of any one of aspects 24 to 32, wherein one or two doses of the vaccine formulation or the pharmaceutical composition can be used to immunize the subject to a cancer.34. The method of any one of aspects 24 to 33, wherein the method further comprises concurrently or sequentially treating the subject with one or more cancer therapies.35. The method of aspect 34, wherein the one or more cancer therapies are selected from surgery, chemotherapy, radiation therapy, hormone therapy, targeted therapy, immunotherapy, stem cell transplant, gene therapy, CAR T-cell therapy, and antibody-drug conjugate therapy.36. A method of immunizing a subject against an autoimmune disease or state comprising: administering one or more therapeutically effective doses of the vaccine formulation of any one of aspects 1 to 21 or the pharmaceutical composition of aspects 22 or 23 to a subject having an autoimmune disease or suspected of having an autoimmune state.37. The method of aspect 36, wherein the subject has an autoimmune disease selected from coeliac disease, t pe 1 diabetes, Graves' disease, inflammatory bowel diseases (such as Crohn's disease and ulcerative colitis), multiple sclerosis, Sjogren’s syndrome, SICCA, alopecia areata, Addison's disease, pernicious anemia, psoriasis, rheumatoid arthritis, Type I diabetes, and systemic lupus erythematosus.38. The method of aspect 36, wherein the subject is suspected of having an autoimmune state selected from Alopecia areata, Autoimmune angioedema, Autoimmune progesterone dermatitis, Autoimmune urticaria, Bullous pemphigoid, Cicatricial pemphigoid, Dermatitis herpetiformis, Dermatomyositis. Discoid lupus erythematosus, Epidermolysis bullosa acquisita. Erythema nodosum, Gestational pemphigoid, Hidradenitis suppurativa. Lichen planus, Lichen sclerosus, Linear IgA disease, Morphea, Psoriasis, Pemphigus vulgaris, Scleroderma (systemic sclerosis), Sjogren syndrome, Vitiligo. AutoimmuneAtorney docket No. 00058-088W01 enteropathy, Autoimmune hepatitis, Celiac disease, Crohn's disease, Intestinal necrotizing arteriolitis, Pernicious anemia. Ulcerative colitis, Rheumatic heart disease, Kawasaki disease, Giant cell arteritis, Takayasu's arteritis, Behcet's disease. Eosinophilic granulomatosis with polyangiitis (EGPA), Granulomatosis with polyangiitis (GPA), IgA vasculitis (IgAV), Leukocytoclastic vasculitis, Lupus vasculitis, Rheumatoid vasculitis, Microscopic polyangiitis (MPA), Necrotizing arteriolitis. Polyarteritis nodosa (PAN), Polymyalgia rheumatica, Urticarial vasculitis. Goodpasture syndrome, IgA nephropathy, Membranous nephropathy, Lupus nephritis, Interstitial nephritis, Interstitial cystitis, Primary sclerosing cholangitis, Acute disseminated encephalomyelitis, Acute motor axonal neuropathy, Anti- NMDA receptor encephalitis, Autoimmune encephalitis, Balo concentric sclerosis, Bickerstaffs encephalitis, Chronic inflammatory demyelinating polyneuropathy, Guillain- Barre syndrome, Hashimoto's encephalopathy. Idiopathic inflammatory demyelinating diseases, Lambert-Eaton myasthenic syndrome, Multiple sclerosis, Myasthenia gravis, Neuromyelitis optica (Devic's disease) / NMOSD, Restless legs syndrome, Stiff-person syndrome, Sydenham's chorea, Transverse myelitis. Undifferentiated connective tissue disease (UCTD), Addison's disease. Autoimmune oophoritis. Autoimmune orchitis, Autoimmune pancreatitis, Autoimmune polyendocrine syndrome type 1 (APS1), Autoimmune polyendocrine syndrome type 2 (APS2), Autoimmune polyendocrine syndrome type 3 (APS3), Diabetes mellitus type 1. Endometriosis, Graves' disease, Hashimoto's thyroiditis. Ord's thyroiditis. Goodpasture syndrome, Eosinophilic granulomatosis with polyangiitis (EGPA), Granulomatosis with polyangiitis (GPA), Idiopathic pulmonary fibrosis, Interstitial lung disease, Pulmonary' alveolar proteinosis, Rheumatoid lung disease, Sarcoidosis, Autoimmune hemolytic anemia, Immune thrombocytopenia, Thrombotic thrombocytopenic purpura, Antiphospholipid syndrome, and Paroxysmal nocturnal hemoglobinuria.39. The method of any one of aspects 36 to 38, wherein the subject is a human subject.40. The method of any one of aspects 36 to 39, wherein the method further comprises concurrently or sequentially treating the subject with one or more therapies for autoimmune disease.41. The method of aspect 40, wherein the therapies for autoimmune disease include immune checkpoint inhibitors.Atorney docket No. 00058-088W0142. The method of aspect 41, wherein the immune checkpoint inhibitors are selected from pembrolizumab, nivolumab, cemiplimab, dostarlimab, tislelizumab. penpulimab, retifanlimab, atezolizumab, avelumab, durvalumab, ipilimumab, rremelimumab, relatlimab, Lag3, ICOS, TIM 3, SIGLECs 7 and 9, VISTA, A2A and A2B, CD276,and N0X2.43. The method of any one of aspects 36 to 42, wherein the vaccine formulation or the pharmaceutical composition is tailored or designed to elicit a Th2 or Treg class immune response to counteract the autoimmune state or autoimmune disease in the subject.
[0083] The following examples are intended to illustrate but not limit the disclosure. While they are typical of those that might be used, other procedures known to those skilled in the art may alternatively be used.EXAMPLES
[0084] The invention is illustrated in the following examples, which are provided by way of illustration and are not intended to be limiting.
[0085] Materials. All materials were purchased from Fisher Scientific unless otherwise indicated. Peptides were ordered from Genemed Synthesis; these included SIINFEKL (SEQ ID NOT), gplOO-I (gpl0025-33, KVPRNQDWL) (SEQ ID NO:2). C-gplOO-I (CKVPRNQDWL) (SEQ ID NOG), gplOO-II (gpl0045-59, NRQLYPEWTEAQRLD) (SEQ ID NO:4), C-gplOO-II (CNRQLYPEWTEAQRLD) (SEQ ID NO:5), CT-I (SPSYAYHQF) (SEQ ID NO:6), C-CT-I (CSPSYAYHQF) (SEQ ID NOT), CT-II (LHSGQNHLKEMAISVLEARACAAAGQS) (SEQ ID NO: 8), C-CT-II (CLHSGQNHLKEMAISVLEARACAAAGQS) (SEQ ID NOV), and C-terminal fluorescently-tagged peptides used to characterize conjugation ratios [FITC-C-gplOO-I (K- Fam-tagged CKVPRNQDWL) (SEQ ID NOTO), FITC-C-gplOO-II (K-Fam-tagged CNRQLYPEWTEAQRLD) (SEQ ID NO: 11), FITC-C-CT-I (K-Fam-tagged CSPSYAYHQF) (SEQ ID NO: 12), and TMR-C-CT-1I (K-TMR-tagged CLHSGQNHLKEMAISVLEARACAAAGQS)] (SEQ ID NOT3). Conjugatable aldehyde- modified CpG1826 (tccatgacgttcctgacgtt, abbreviated CpG) (SEQ ID NO: 14) was purchased from TriLink.
[0086] Culture media used for in vitro assays {e.g.. IFN-y enzyme-linked immunospot (ELISpot), IL-2 enzy me-linked immunosorbent assay (ELISA), and Thl / Th2 cytokine analysis via LEGENDplex] consisted of RPMI 1640 (Coming), heat-inactivated fetal bovine serum (10%, Life Technologies), sodium pyruvate (1 mM, HyClone), L-glutamine (2 mM.Atorney docket No. 00058-088W01Lonza), penicillin (100 U / mL, Gibco), streptomycin (100 pg / mL, Gibco), and nonessential amino acids (0.1 mM, Lonza). The B16 / F10 melanoma cell culture media contained DMEM (Coming), 10% heat-inactivated fetal bovine serum, 1 mM sodium pyruvate, 2 mM L- glutamine, 100 U / mL penicillin, and 100 pg / mL streptomycin. The CT26 colon carcinoma cell culture media contained RPMI 1640, 10% heat-inactivated fetal bovine serum, 1 mM sodium pyruvate, 2 mM L-glutamine, 100 U / mL penicillin, and 100 pg / mL streptomycin. Antibodies used to stain harvested immune cells from the spleen or lymph nodes (LNs) were purchased from BioLegend and included anti -mouse CD 16 / 32 for blocking non-specific binding, CDl lc (FITC) for DCs, F4 / 80 (APC) for macrophages, B220 (PE) for B cells, and CD3 (PE / Cy7) for T cells, with CD4 (PerCP / Cy5.5 or PerCP) for CD4+ T cells and CD8 (AF488 or APC) for CD8+ T cells.
[0087] Mice and cell lines. All animal studies were approved by the Institute for Animal Care and Use Committee (IACUC #AUP-22-094) at the University' of California, Irvine, which is internationally accredited by the Association for Assessment and Accreditation of Laboratory Animal Care (AAALAC #000238). Female C57BL / 6 and BALB / c mice were purchased from Jackson Laboratories at 6-8 weeks of age and housed in standard cages with standard enrichment. For tumor studies, surface tumor volume was measured every' day with a caliper and approximated as (0.5 x (shortest diameter)2x longest diameter).
[0088] Synthesis method for E2 based nanoparticles. The NPs used in this study are summarized in FIG. 5. To obtain the NP scaffolds, E2 (D381C E2) protein NPs were purified from E. coll lysates using methods described in Molino et al., ACS Biomater Sci Eng. 3(4):496-501 (2017), Molino et al., Biomaterials, 86, 83-91 (2016), and Teplensky et al. , Nat Biomed Eng 7(7):911-927 (2023). Characterization ofNPs included a combination of included dynamic light scattering (DLS), SDS-PAGE analysis (FIG. 6), bicinchoninic acid assay' (BCA) and transmission electron microscopy (TEM). To synthesize CpG-E2 NPs, the conjugation of CpG to the internal E2 cavity was achieved by utilizing a cysteine-reactive N- (0-maleimidopropionic acid (BMPH) linker, consistent with the methods described in Ridge et al.. Nature 393(6684):474-478 (1998) (see FIG. 3). Non-reacted adjuvant was removed over 24 h with dialysis into phosphate buffer (50 mM potassium phosphate, 100 mM NaCl, pH 7.4) using 300 kDa Float-A-Lyzer G2 Dialysis Devices (Spectrum Laboratories).Attorney docket No. 00058-088W01To decorate the exposed lysines of E2 NPs with only one MHC class of antigen, conjugation protocols were adapted from previously described methods presented in Neek et al., Adv Ther 3 (2020); Molino et al.. Biomaterials 86:83-91 (2016); Molino et al., ACS Nano 7:9743-9752 (2013); Neek et al.. Biomaterials 156: 194-203 (2018); Butkovich et al.. Biomater Sci, 11:596-610 (2023); and Li et al., Methods Mol Biol, 2671 :321-333 (2023). Briefly, E2 was incubated with 20-fold molar excess of 4-(N-maleimidomethyl)-cyclohexane- 1 -carboxylate (sulfo-SMCC) to E2 monomer for 30 minutes at room temperature (see FIG. 3), followed by removal of excess linker using 7 kDa cutoff Zeba desalting columns (Pierce). Cysteine- modified peptides were reduced with 10-fold molar excess of tris(2-carboxyethyl)phosphine (TCEP) for 30 minutes at ambient temperature prior to incubation with NPs. To synthesize (gpl00-I)-CpG-E2, (gpl00-II)-CpG-E2. (CT-I)-CpG-E2, or the fluorescently-tagged NPs FITC-(gpl00-I)-E2, FITC-(gpl00-II)-E2, or FITC-(CT-I)-E2, a 10-fold molar excess of reduced peptides to E2 monomer was reacted for 2 hr at room temperature, followed by removal of unreacted peptides over 24 hr by dialysis in phosphate buffer using 300 kDa Float-A-Lyzer G2 Dialysis Devices (Spectrum Laboratories). Similar conjugation protocols were used for (CT-II)-CpG-E2 and TMR-(CT-II)-E2 conjugations, except that a 2-fold molar excess of reduced peptides to E2 monomer was used. To determine the peptide-to-NP ratio, the peptide concentration was determined by measuring absorbance at 500 nm and 555 nm for the resulting FITC-labeled NPs and TMR-labeled NPs, respectively, while the E2 concentration was obtained by BCA assay.
[0089] For dual-antigen NPs, protocols were modified to co-conjugate both MHC class I and II peptides onto E2 NPs with sulfo-SMCC linker. Cysteine-modified peptide mixtures were first reduced with 10-fold molar excess of TCEP for 30 minutes at room temperature.To synthesize (gpl00-I+II)-CpG-E2 NPs or (CT-I+II)-CpG-E2 NPs, a 1 :2: 1 molar ratio of C- gpl00-I:C-gpl00-II : E2 monomer or 1:3.5: 1 molar ratio of C-CT-I : C-CT-II : E2 monomer, respectively, was utilized. To determine resulting conjugation ratios, only one MHC class of peptide per mixture was fluorescently -tagged to perform absorbance readings at 500 nm or 550 nm for one species at a time. For instance, to characterize the amount of gplOO-I conjugated in a co-conjugated NP. E2 was reacted with FITC-C-gpl00-l and C-gplOO-11. The average number of peptides conjugated per NP was calculated by dividing the molar peptide concentration by the molar E2 concentration. TEM was performed by staining dual-antigenAtorney docket No. 00058-088W01NPs with 2% uranyl acetate on carbon-coated copper grids (Ted Pella) and imaging on a JEM-21 OOF electron microscope.
[0090] Lipopolysaccharides (LPS) were removed using Triton X-l 14, and Limulus Amebocyte Lysate test (LAL) was used to confirm that there were <5 EU per milligram of E2 prior to CpG and peptide conjugation, consistent with prior studies. All NPs, including purified E2, CpG-E2, and antigen-conjugated CpG-E2 NPs were stored in phosphate buffer.
[0091] Immunizations. Mice were immunized subcutaneously, bilaterally at both flanks on days 0 and 7 with E2 NPs containing CpG and displaying melanoma antigens (gplOO-II and / or gplOO-I peptides for C57BL / 6 mice), E2 NPs containing CpG and displaying colon carcinoma antigens (CT-II and / or CT-I peptides for BALB / c mice), or PBS as a control. A summary of all groups and dosages for each component, including E2, CpG, and antigen, is described in FIGs. 12B, 17B, and 9A. To enable comparisons between groups, some formulations were adjusted with addition of CpG-E2 to obtain equivalent amounts of E2 and CpG, as needed. Experiments were terminated on day 14, and spleens and LNs were harvested. For studies using C57BL / 6 mice immunized with NPs decorated with melanoma antigens, spleens were homogenized, depleted of red blood cells using ACK lysing buffer (Gibco), and analyzed with a combination of carboxyfluorescein succinimidyl ester (CFSE, eBioScience) staining, flow cytometry', ELISA, or ELISpot assay. Immunization studies in the BALB / c model using NPs displaying the colon carcinoma peptides similarly included a combination of IFN-y ELISpot, flow cytometry, and cytokine analysis. Flow cytometry required blocking with anti-mouse CD 16 / 32 for 10 minutes to reduce non-specific staining, followed by anti-mouse antibody staining for (set 1) CD11c, F4 / 80, and B220 or (set 2) CD3, CD4, and CD8 for 30 minutes on ice.
[0092] CFSE proliferation. To quantify the proliferation of overall T cells, CD8+ T cells (CD3+CD8+), and CD4+ T cells (CD3+CD4+) in response to peptide recall, splenocytes were stained with 5 pM CFSE in PBS for 10 minutes at room temperature, washed 3 times with a 5-fold excess volume of ice-cold media, centrifuged at 300 x g for 5 minutes, and re-suspended in 500 pL of media.
[0093] CFSE-stained splenocytes (or non-stained controls) were plated into 96-well tissue culture-treated, U-bottom plates at 200,000 cells / well. Cells were incubated with a specific condition, such as PBS (negative control), 5 pg / mL ConA (concanavalin A, a potent mitogen as positive control), or 50 pg / mL of peptide, for 72 h at 37 °C. Relevant peptidesAtorney docket No. 00058-088W01 included gplOO-I or gplOO-II (without cysteine modification), while irrelevant peptide SIINFEKL (SEQ ID NO: 1) was used as a control. Afterwards, cells were collected for flow cytometry. Non-specific antibody binding was reduced with anti-mouse CD16 / 32 antibody for 10 minutes on ice, followed by washing with fluorescence-activated cell sorting buffer (PBS with 1% bovine serum albumin (BSA) and 0.1% sodium azide), centrifugation at 300 x g for 5 minutes, and discarding of supernatant. For immunization studies using dual-antigen NPs, cells were then stained for CD3, CD4, and CD8 expression using PE / Cy7, PerCP, or APC fluorescent antibodies, respectively. The FITC channel was used for the CFSE stain.
[0094] Non-proliferated cells or daughter generations were assessed within all cells, CD4+ T cell, or CD8+ T cell populations, as described in FIG. 10. Relative proliferation ratio — G following a specific incubation condition was calculated as the number of proliferated o cells (generations n > 0; Gn) divided by the number of non-proliferated cells (generation 0; Go), and normalized to the analogous ratio for non-stimulated control for the same biological replicate as presented in Eq. 1 :where — c is the relative proliferation ratio. Ni is the number of cells in generation (G) number o i, and n is the total number of generations. Incubation conditions included SIINFEKL, ConA, and relevant peptides.
[0095] IFN-y ELISpot. IFN-y ELISpot assays were performed as described in Butkovich et al., (Methods Mol Biol 267: 1321-333 (2023)). High binding 96-well plates (Millipore) were coated overnight with IFN-y capture antibody (Pharmingen). After ACK lysing buffer treatment and quenching as described above, 800,000 or 500,000 cells from each spleen of the C57BL / 6 or BALB / c mice, respectively, were plated per well. Cells were incubated overnight (~18 h) with 1 pg of peptide (SIINFEKL (SEQ ID NO: 1), gplOO-I (SEQ ID NO:2), gplO -II (SEQ ID NO:4), CT-1 (SEQ ID NO:6). or CT-11 (SEQ ID NO:8)) or 0.5 pg ConA as a positive control. After incubation, conditioned media was recovered for IL-2 ELISA analysis.
[0096] IFN-y ELISpot plates were washed with PBS-T (PBS with 0.05% Tween 20) or PBS, incubated with a biotinylated detection antibody (Pharmingen) in 1% BSA in PBS-T for 1 h, incubated with streptavidin-alkaline phosphatase diluted in 1% BSA in PBS for 30Atorney docket No. 00058-088W01 minutes, incubated with developer (Thermo Scientific), and stopped by washing extensively with water. After air-drying overnight, plates were scanned and analyzed using an ELISpot plate reader (Cellular Technology) and an immunospot analysis software package (Immunospot Analysis Pack).
[0097] IL-2 ELISA. To determine IL-2 secretion levels, an IL-2 ELISA kit (BioLegend) was used according to the recommended protocols. For IL-2 standard (BioLegend), 2-fold dilutions of standard were prepared according to the standard’s lot number. For processing, IL-2 ELISA plates were washed with wash buffer (PBS-T), coated with capture antibody in coating buffer (8.4 g NaHCCh, 3.56 g Na2COs, in 1.0 L of water at pH 9.5), blocked for non-specific binding with assay diluent (PBS with 1% BSA) for 1 h, incubated with samples or standard for 2 h, incubated with detection antibody for 1 h, incubated with avidin-horseradish peroxidase solution for 30 minutes, incubated with TMB substrate solution (BioLegend) in the dark, and stopped with 2N H2SO4. Absorbance at 450 nm was immediately read by plate reader. Per-plate standard curves were generated with seven titrations of IL-2 standard. A 5-parameter logistics curve-fitting algorithm was used to correlate IL-2 concentration to absorbance for each standard curve.
[0098] Thl and Th2 cytokine analyses. To analyze the concentrations of cytokines (IFN-y, tumor necrosis factor (TNF)-a, IL-2, IL-4, IL-5, IL-6, IL-10, and IL-13) secreted by splenocytes stimulated with CT-I, CT-II, and SIINFEKL, the LEGENDplex MU Thl / Th2 Panel (8-plex) (BioLegend) was used. Per well in a 96-well plate. 500,000 splenocytes were plated and stimulated with 1 pg of peptide (CT-I, CT-II, or SIINFEKL) overnight. The supernatant was then collected for cytokine analysis following the manufacturer’s recommended protocol. The final cytokine concentrations were determined using the LEGENDplex Data Analysis Software Suite after data acquisition on a flow cytometer (NovoCyte 3000).
[0099] B16 / F10 melanoma tumor treatment. For the melanoma model, 6-8-week-old female C57BL / 6 mice were subcutaneously inoculated with 1 x 104B16 / F10 tumor cells (ATCC, Cat. CRL-6475) in the right flank, defined as day 0 of tumor treatment studies. On days 1 and 8. mice were subcutaneously, bi-laterally treated with NPs or PBS negative control (see FIG. 13A). The treatment groups are summarized in FIG. 13B and include: PBS (Group 1); (gpl00-I)-CpG-E2 with CpG-E2 (Group 2); (gp!00-I)-CpG-E2, (gplOO-II)-CpG- E2, and CpG-E2 (Group 3); and (gpl00-I+II)-CpG-E2 (Group 4). The amounts of allAtorney docket No. 00058-088W01 components for each group are described in FIGs. 12B and 9A. To enable comparisons between groups, Groups 2 and 3 were adjusted with the addition of CpG-E2 to obtain equivalent amounts of E2 and CpG. Tumor volumes were measured every day with a caliper and approximated as [0.5 x (shortest diameter)2x longest diameter]. Palpable and terminal tumor volumes were ~50 mm3and 1,000 mm3, respectively.
[0100] CT26 colon carcinoma treatment. For the CT26 colon carcinoma model. 6-8- week-old female BALB / c mice were subcutaneously inoculated with 5 x 104CT26 tumor cells (ATCC, Cat. CRL-2638) in the right flank, defined as day 0 of the tumor treatment studies. On days 3 and 10, mice were subcutaneously, bilaterally treated with NPs or PBS negative control (see FIG. 21A). The experimental groups are summarized in FIG. 21B and include: PBS (Group 1); (CT-I)-CpG-E2 with CpG-E2 (Group 2); (CT-I)-CpG-E2 and (CT- II)-CpG-E2 (Group 3); and (CT-I+II)-CpG-E2 with CpG-E2 (Group 4). The amounts of each component are also described in FIGs. 17B and 9A. To enable comparisons between groups, Groups 2 and 4 were adjusted with the addition of CpG-E2 to obtain equivalent amounts of E2 and CpG. Tumor volumes were measured daily with a caliper, as described above.
[0101] Statistical analyses. At least three independent syntheses were performed to characterize NP sizes and component conjugation ratios (e.g., components CpG (SEQ ID NO: 14), gplOO-I (SEQ ID NO:2), and gplOO-II (SEQ ID NO:4); or CpG (SEQ ID NO: 14), CT-I (SEQ ID NO:6), and CT-II (SEQ ID NO:8), with measurements presented as the mean ± standard deviation (SD). Immunization studies utilized N>3 biological replicates per group. For CFSE and IFN-y assays, each biological replicate had 3 technical replicates per incubation condition, while for LEGENDplex analysis, each biological replicate had 2 technical replicates per condition. Data were presented as mean ± standard error of the mean (SEM) unless noted otherwise. Flow cytometry to determine immune populations in the spleen or LNs was analyzed using one-way ANOVA with post-hoc Bonferroni’s test. CFSE, IFN-y ELISpot, and Thl / Th2 cytokine assays were analyzed using two-way ANOVA with post-hoc Bonferroni's test unless noted otherw ise. The B16 / F10 tumor treatment study utilized N=10 biological replicates per group, while the CT26 tumor treatment study used N>7 biological replicates per group, with tumor survival assessed with log-rank tests, p- values less than 0.05 were considered statistically significant.
[0102] E2 protein NPs displaying MHC class I and II epitopes for the melanoma and colon carcinoma models were synthesized and characterized. In these studies,Atorney docket No. 00058-088W01 several different NPs were synthesized by conjugating the E2 NP with the CpG adjuvant and MHC class I and II antigens from the B16 / F10 melanoma or CT26 colon carcinoma models. As summarized in FIG. 5, CpG-E2 NPs encapsulated CpG but were not conjugated to antigen peptides. Antigens were attached to these CpG-E2 NPs to examine the response of CD8+ and CD4+ T cells following immunization; melanoma antigens included MHC class I and class II peptides derived from gplOO TAA (abbreviated gplOO-I and gplOO-II peptides, respectively), conjugated to NPs individually [yielding (gpl00-I)-CpG-E2 and (gp 100-11)- CpG-E2], or co-conjugated together on NPs [yielding (gpl00-I+II)-CpG-E2]. Similarly, colon carcinoma antigen peptides included MHC class I and class II peptides (abbreviated CT-I and CT-II, respectively), and single-antigen NPs [yielding (CT-I)-CpG-E2 and (CT-II)- CpG-E2)] or dual-antigen NPs [yielding (CT-I+II)-CpG-E2] were synthesized. The linkers used for attaching CpG and peptides to E2 NPs were acid-hydrolyzable and / or degradable in vivo, respectively, allowing the components’ release in endosomal environments of DCs.
[0103] All nanoparticles, including E2, CpG-E2, (gpl00-I)-CpG-E2. (gplOO-II)-CpG- E2. (gpI00-I+II)-CpG-E2, (CT-I)-CpG-E2, (CT-II)-CpG-E2, and (CT-I+II)-CpG-E2, exhibited hydrodynamic diameters of ~30 nm, as measured by DLS (see FIG. 7A-B). The intact and symmetric structure of NPs was confirmed by TEM, following the conjugation of CpG, gplOO-I, and gplOO-II to yield (gpl00-I+II)-CpG-E2 NPs (see FIG. 7C), and CpG, CT- I, and CT-II to yield (CT-I+II)-CpG-E2 NPs (see FIG. 7D). These NP sizes are within the optimal size range for endocytosis by DCs, the most potent antigen-presenting cells.
[0104] The conjugation of CpG and antigen peptides to E2 monomers was confirmed and quantified (see FIG. 6, Table 1 and Table 2). E2 NPs are self-assembled from 60 identical monomers, and the theoretical molecular weight of a single E2 subunit monomer is 28.1 kDa, observable as a band on SDS-PAGE gels (see FIG. 6, lane 2). The conjugation of a CpG molecule via the linker to the single cysteine of an E2 monomer would increase the theoretical molecular weight of the monomer to 34.9 kDa, which correlates to the observable shift in a fraction of the monomers following CpG conjugation reactions (see FIG. 6, lane 3). Based on these intensities, an average of 19 ± 2 CpG molecules were conjugated per 60-mer E2 NP.
[0105] Broad bands were observed on SDS-PAGE for E2 NPs after single- (MHC class I peptide or MHC class II peptide) or dual-antigen (MHC class I + II peptides) conjugation for both the melanoma and colon carcinoma models, indicative of a range of peptide numbersAttorney docket No. 00058-088W01 conjugated per E2 monomer (see FIG. 6, lanes 4-6), consistent with previous E2 NP formulations. To quantify the conjugation ratio, fluorescently-tagged peptides were used; for single-antigen NPs, the number of peptides displayed was on average -214 for gplOO-I (SEQ ID NO:2), -129 for gplOO-II (SEQ ID NON), -209 for CT-I (SEQ ID NO:6), and -83 for CT-II (SEQ ID NO: 8), per 60-mer E2 NP (see Table 1 and Table 2).Table 1. Conjugation molar ratios of components to E2 NP for each vaccine design.The "mixed molar ratio" indicates the ratio added into the reaction mixture to achieve the final conjugation ratio ("molar ratio achieved"), per monomer. Each E2 NP is composed of 60 identical subunit monomers; therefore, the average antigen-to-NP ratio can be estimated by multiplying the antigen-to-monomer ratio by 60. Mean ± SD. N> 3.Table 2. Conjugation mass ratios of components to E2 NP for each vaccine design.The "mixed molar ratio" indicates the ratio added into the reaction mixture to achieve the final conjugation ratio ("molar ratio achieved"), per monomer. Each E2 NP is composed of 60 identical subunit monomers; therefore, the average antigen-to-NP ratio can be estimated by multiplying the antigen-to-monomer ratio by 60. Mean ± SD. N> 3.Atorney docket No. 00058-088W01
[0106] Target antigen ratios were based on in vivo doses that could elicit a biological effect, described below in sections 3.2.1-3.2.2 and 3.3. 1-3.3.2. For the dual-antigen NPs. a molar ratio of melanoma peptides gplOO-I : gplOO-II of 1:2 was targeted, yielding an actual number of 42 ± 11 gplOO-I and 73 ± 20 gplOO-II peptides conjugated to a 60-mer E2 NP [abbreviated (gpl00-I+II)-CpG-E2] (see Table 1 and Table 2). Similarly, for colon carcinoma peptides, the target molar ratio of CT-ECT-II on dual-antigen NPs was 1 :3, yielding 39 ± 2.6 CT-1 and 111 ± 9.4 CT-11 peptides per 60-mer E2 NP [abbreviated (CT- l+II)-CpG-E2] (see Table 1 and Table 2).
[0107] Nanoparticle vaccine investigations for the B16 / F10 melanoma model. The previous work examined vaccines comprised of MHC class I antigens on NPs [(gplOO-I)- CpG-E2] for the prevention and treatment of B16 / F10 melanoma in C57BL / 6 mice. Immunization with (gpl00-I)-CpG-E2 NPs induced antigen-specific activation and proliferation of CD8+ T cells and increased survival in tumor-bearing mice. However, the delivery' of MHC class II melanoma antigens (e.g., gplOO-II) by NPs, either alone or in combination with the MHC class I peptide (gplOO-I) were not tested. It was expected that the co-delivery of these antigens by NP vaccines would be important for facilitating CD4+ T cell support of CD8+ T cell activity (see FIG. 4C), and these results are described below.proliferation. First was examined whether immunization with the MHC class II antigen (gplOO-II) on NPs. without MHC class I antigen, could specifically educate CD4+ T cells. C57BL / 6 mice were immunized with (gpl00-II)-CpG-E2 NPs (see FIG. 8A-B), antigenspecific splenocyte proliferation (see FIGs. 8C and 10) and immune cell populations were quantified in the spleen and lymph nodes (LNs) (see FIGs. 8D and 11). Following TCR engagement with DCs. CD4+ T cells produce lower levels of IFN-y than CD8+ T cells, so for these immunization studies with (gpl00-II)-CpG-E2 NPs without MHC class I antigen peptides, the CFSE proliferation assay was performed to determine the functional activation of T cells rather than measuring IFN-y levels.
[0109] Previous studies consistently showed that E2 NP immunotherapies elicited the highest immune responses (e.g.. specific IFN-y secretion. T cell-mediated tumor cell lysis, and DC activation) when both antigen and adjuvant were attached onto the NP (antigen-CpG- E2), compared to conditions in w hich any of the individual components remained unbound to the NP (e.g., antigen-E2 [NP] + CpG; antigen + CpG-E2 [NP]; antigen + CpG + E2 [NP];Atorney docket No. 00058-088W01 etc.). Furthermore, these immune responses elicited by the E2-based immunotherapies were always antigen-specific. Due to the consistent results of these controls, irrespective of the tumor-associated antigens investigated, similar unbound controls were not performed here to minimize animal numbers.
[0110] Splenocytes from animals immunized with (gp 100-II)-CpG-E2 NPs proliferated when incubated with gplOO-II but not with irrelevant peptide SIINFEKL, demonstrating a ~4-fold increase in the normalized ratio of proliferated versus non-proliferated (Gn / Go) cell numbers (see FIG. SC). This was consistent with the slightly larger spleens and LNs from the NP group compared with the PBS group (see FIG. 9B, lane B vs. A). Phenotypical analysis of immune cell populations showed significant reductions in the percentages of T cell populations (including CD8+ T cells and CD4+ T cells) in the spleen (see FIG. 8D) and LNs (see FIG. 11) from the mice immunized with (gpl00-II)-CpG-E2 NPs. These mice also had higher DC percentages in the LNs compared to PBS (see FIG. 11). It was noted that previous melanoma immunotherapy studies in murine models have used 100-200 pg of MHC class II antigenic peptide per dose and 5-20 pg of CpG adjuvant per dose (both free in solution; no NPs); this is an order of magnitude higher than the antigen levels used here in the investigation to yield an immune response, demonstrating the increased efficacy due NP attachment of the antigen and adjuvant.robust antigen-specific Thl responses and T cell proliferation. The hypothesis that immunization with NPs co-delivering MHC class I and II antigens [(gpl00-I+II)-CpG-E2; Group 5] would elicit the greatest increase in specific immunity’, relative to conventional MHC class I peptide-bound NPs alone [Groups 2 and 3] or mixtures of MHC class I peptide- bound NPs with MHC class II peptide-bound NPs [Group 4] was tested (see FIG. 12). To enable comparisons, antigen and adjuvant doses were equivalently matched between groups (see FIG. 12B), and the same amount of gplOO-I (SEQ ID NO:2) in all NP groups [Groups 2- 5] were used as in Neek et al. , Adv Ther 3 (2020). The amount of gplOO-II peptide (SEQ ID NO:4) per dose [Groups 4-5] (see FIG. 12A-B) was also the same as for studies in FIG. 8.
[0112] In splenocytes harvested from mice that were immunized with the dual-antigen NP [(gpl00-I+II)-CpG-E2; Group 5], both IFN-y (see FIG. 12C) and IL-2 (see FIG. 12D) were secreted at the highest levels relative to other groups. After gplOO-I incubation, splenocytes collected from Group 5 yielded an average 1.8- and 8.0-fold higher IFN-yAttorncy docket No. 00058-088W01 secretion spot formation compared to those from Group 3 (gplOO-I only) and Group 4 (with gplOO-I and gplOO-II, but delivered by separate NPs), respectively (see FIG. 12C). Group 3 gave ~4.5-fold more IFN-y-producing splenocyte spots on average than Group 2, likely due to a higher amount of CpG. No group yielded gplOO-II-specific IFN-y levels that was above background. Average secreted IL-2 levels were highest for immunizations with dual-antigen NPs [Group 5] and with single-antigen gplOO-I NPs [Group 3] (see FIG. 12D).
[0113] The greatest and second-greatest increase in CD8+ and CD4+ T cell proliferation, respectively, was observed after immunization with dual-antigen NPs containing both gplOO- I and gplOO-II peptides [Group 5] (see FIG. 12E-F). The normalized proliferation ratio (Gn / Go) for CD8+ T cells was ~1.9-fold higher for Group 5 than Group 3 (only gplOO-I on NPs) after gplOO-I incubation. Both Group 4 (gplOO-I on NPs mixed with gplOO-II on NPs) and Group 5 showed high gplOO-II-specific CD4+ T cell proliferation (see FIG. 12F), but only the dual-antigen NP [Group 5] gave a statistically significant increase in gplOO-I- specific CD8+ T cell proliferation compared to the single-antigen NPs (Groups 2 and 3) (see FIG. 12E)significantly increased survival for mice with melanoma tumors. The potency of the (gplOO- I+II)-CpG-E2 NPs to treat B16 / F10 melanoma was examined (see FIG.13). Groups in this tumor study included immunization with PBS [Group 1]; conventional NPs displaying gplOO-I [Group 2] a mixture of NPs individually displaying either gplOO-I (SEQ ID NO:2) or gplOO-II (SEQ ID NO:4), though not on the same NP [Group 3]; and dual -conjugated NPs [Group 4], Overall survival and tumor volumes are presented in FIGs. 13C and 14, respectively.
[0115] The data shows that mice immunized with the dual-antigen NPs [Group 4] outperformed all other groups to prolong survival (see FIG. 13C). While 70% of mice in Group 4 survived past day 40, only 0%, 10%, and 10% survived for Groups 1, 2, and 3, respectively. Furthermore, 50% of mice with palpable tumors in Group 4 showed linear tumor growth from day 25 and onward, in contrast to all mice in Groups 1, 2, and 3, which experienced exponential tumor growth (see FIG. 14). All mice treated with PBS developed terminal-sized tumors by day 30, and 40% of mice treated with a mixture of single-antigen NPs [Group 3] had terminal tumors by this time. Mice from Group 2 and Group 3 followed similar tumor growth trends over time (see FIG. 14B-C). Therefore, the results demonstrate that the dual-Atorney docket No. 00058-088W01 antigen NP vaccine gave the highest survival numbers and the slowest average tumor growth rate, even out-performing Group 3, which consisted of the same individual components and doses, but delivered antigens in two different NPs.
[0116] Nanoparticle vaccine investigations for the CT26 colon carcinoma model.The studies with the B16 / F10 melanoma model above demonstrated the advantage of incorporating an MHC class II epitope onto MHC class I peptide-decorated NPs to activate CD4+ T cells in support of the cytotoxic CD8+ T cells. To examine the extent of applicability of this strategy, this approach was tested in an alternative tumor model: CT26 colon carcinoma in its syngeneic mouse strain, BALB / c. The melanoma model used C57BL / 6 mice, a strain biased towards Thl responses. Thl cells secrete inflammatory' cytokines (e.g., IFN- y), which promote CD8+ T cell cytotoxicity and induce immune-mediated tumor cell death. In contrast, BALB / c mice are Th2 -biased. Th2 cells produce cytokines e.g., IL-10) that suppress Thl responses and T cell cytotoxicity while supporting B cells for humoral immunity. Therefore, Th2 responses are associated with poor cancer prognoses, and antitumor immunity in the BALB / c model would likely be more difficult. Furthermore, Thl / Th2 cytokine biases have been observed in humans and are dependent upon many factors, including genetics, race, and psychological state, so evaluating therapeutics across a range of Th biases is important for clinical translation. Therefore, it was investigated w hether NPs delivering an MHC class II epitope could also effectively treat CT26 colon carcinoma tumors in the BALB / c mouse model.
[0117] Immunization with single-antigen CT-IINPs induced an antigen-specific Thl response, even in Th2-biased BALB, c mice. BALB / c mice were immunized with (CT-II)- CpG-E2 NPs to evaluate antigen-specific IFN-y secretion, cytokines for Thl responses, and changes in immune cell populations in secondary lymphoid tissue, potentially associated with immune activation (see FIGs. 15 and 16). The CT-II peptide (SEQ ID NO:8) was selected as the MHC II antigen (see FIG. 5), based on its previously reported immunogenicity7.
[0118] Splenocytes from mice immunized with (CT-II)-CpG-E2 showed a significantly higher CT-II-specific IFN-y response compared to those from PBS-treated mice (~ 13-fold difference in IFN-y-producing cells), with negligible IFN-y responses to the irrelevant SIINFEKL peptide (SEQ ID NO: 1) (see FIG. 16C). Furthermore, the resulting cell population trends of splenocytes were similar to those observed in the (gpl00-II)-CpG-E2 immunization studies, including increased macrophage percentages and lower T cellAtorney docket No. 00058-088W01 percentages (including CD8+ and CD4+ T cells) (see FIG. 16D). Average macrophages and T cell percentages in the draining LNs (see FIG. 15) also exhibited similar trends to those observed in the spleen. Spleen, inguinal LNs, and axillary LNs collected from (CT-II)-CpG- E2 NP-immunized mice were larger than those from the PBS group (see FIG. 9B, lane G vs. A), indicating that more immune cells were present in these secondary7lymphoid tissues after (CT-II)-CpG-E2 immunizations. Because these (CT-II)-CpG-E2 NPs could induce a Thl response, even in the BALB / c mice, this dosage of CT-11 was used in the subsequent studies that included the MHC class I antigen.greater antigen-specific Thl responses in BALB'c mice. To evaluate co-delivery of MHC class I and II epitopes by NPs to Th2-biased mice, animals were immunized with the following: PBS [Group 1], CT-I peptide (SEQ ID NO:6) on CpG-E2 NPs [Group 2], CT-I peptide (SEQ ID NO:6) and CT-II peptide (SEQ ID NO:8) on separate NPs [Group 3], and dual-antigen CT-I peptide (SEQ ID NO:6) and CT-II peptide (SEQ ID NO:8) on the same NPs [Group 4] (see FIG. 17A-B). To enable group-to-group comparisons, the CpG and E2 amounts were set equivalent across all NP groups by addition of CpG-E2 NPs to Groups 2 and 4. A 7.5-pg dose of the MHC class I peptide (CT-I) on NPs was selected for experiments, as this was sufficient to induce IFN-y responses in mice (see FIG. ISA), while not being a saturating dose based on DC numbers (see FIG. 18B).
[0120] Effects of the MHC Class II peptide. After immunization, the average number of CT-I-specific IFN-y-producing splenocytes from the dual-antigen NPs [(CT-I+II)-CpG-E2 ; Group 4] was ~1.4-times higher than the effects from the NPs with only MHC class I peptides [(CT-l)-CpG-E2; Group 2], as measured by ELISpot (see FIG. 17C). Although this difference was not statistically significant, cytokine secretion analyses showed significantly higher concentrations of the Thl-related molecules IFN-y (~8.8-fold), TNF-a (~2.9-fold), and IL-2 (~2.6-fold), relative to immunization with CT-I-only NPs [Group 2] after stimulation with CT-I (see FIG. 19). All NP groups also gave higher specific cytokine responses than the PBS control group. The data for IFN-y, taken together, suggest that more IFN-y was produced on average per cell in Group 4 than in Group 2.
[0121] Paracrine IL-2 production has been proposed as a mechanism for CD4+ T cells to augment CD8+ T cell expansion and effector differentiation. Because mice immunized with single-antigen CT-I NPs [Group 2] or dual-antigen NPs [Group 4] received the same doses ofAttorney docket No. 00058-088W01CT-I, the significant increase in Thl cytokine production following CT-I stimulation ex vivo (see FIG. 19) is likely due to the incorporation of the MHC class II peptide for CD4+ T cell recognition. Therefore, the combined data in FIGs. 17 and 18 strongly support that the dualpeptide NPs elicit a greater Thl response than NPs with only the MHC class-I peptide, even in a Th2-biased mouse model.
[0122] Th2 cytokines (IL-4, IL-5. IL-10, and IL-13) were assessed but were below the detection limit for all groups. This could be attributed to the co-delivery of the Thl -skewing CpG adjuvant. Although immunization with either (CT-I)-CpG-E2 or (CT-I+II)-CpG-E2 induced higher IL-6 secretion compared to the PBS controls, there was no significant difference between these NP immunization groups (see FIG. 19D). IL-6 is a pleotropic cytokine that can support Th2 responses, but it also exerts pro-inflammatory effects, promotes cytotoxic T cell differentiation, and suppresses regulatory T cell differentiation, which are favorable outcomes for anti-tumor vaccine efficacy. Thus, the attachment of CT-II peptides onto (CT-I)-CpG-E2 NPs did not increase Th2 cytokine production compared to (CT-I)-CpG-E2 alone; this was a desirable result, given that Th2 responses can suppress antitumor activity.
[0123] Effects of antigen localization on the same vs. different NPs. The data shows that immunization with the dual-antigen NPs [(CT-I+II)-CpG-E2; Group 4] led to a ~1.7-fold increase in CT-I-specific IFN-y-producing cells, compared to the mixture of the two singleantigen NPs [(CT-I)-CpG-E2 + (CT-II)-CpG-E2; Group 3] with p < 0.01 (see FIG. 17C) and a significantly higher percentage of DCs in the spleen (see FIG. 20). Additionally, Group 4 exhibited a lower average percentage of T cells (including all T cells and their CD4+ and CD8+ subsets) than Group 3, though differences were not statistically significant. Thus, codelivery of the MHC class I and II antigens on a single particle elicited higher immune responses than mixtures of the single-antigen particles.
[0124] Co-delivery of MHC class I and II CT26 peptides on dual-antigen NPs significantly increased survival for mice with colon carcinoma. To test colon carcinoma treatment efficacy, BALB / c mice were inoculated with CT26 cells, immunized with NPs or PBS control, and evaluated for tumor growth and overall survival (see FIG. 21). Groups included PBS as vehicle control [Group 1], single-antgen NPs delivering CT-I [Group 2], a mixture of single-antigen NPs delivering CT-I and CT-II on separate NPs [Group 3], and dual-antigen NPs co-delivering CT-I and CT-II [Group 4] (see FIG. 21B). CpG-E2 wasAtorney docket No. 00058-088W01 included in NP formulations to match the amounts of E2 scaffold and CpG adjuvant between the groups.
[0125] All NP-treated groups [Groups 2-4] exhibited significantly improved survival rates compared to the PBS control [Group 1], with co-conjugated NP immunization [Group 4] yielding a significantly higher survival percentage than all other groups (see FIG. 21C, and FIG. 22). On day 60, -71% of mice in Group 4 survived, compared to only 25% of mice treated with NPs with single-antigen, CT-I only [Group 2] or -13% for mice treated with a mixture of single-antigen NPs [Group 3], No significant difference in survival rates were observed between Groups 2 and 3. The data shows that MHC class I and class II antigens should be co-delivered on the same NPs for greater efficacy.
[0126] Conclusions. In these studies, it was examined whether designing NP peptide vaccines to co-deliver or separately deliver MHC class I and II antigens would more effectively treat cancer. Both melanoma and colon carcinoma models were used to evaluate the breadth of efficacy for these designed NPs, which represented a range of MHC haplotypes and Th-biases, similar to variations observed in patient populations. Regardless of the tumor model, immunization with dual-antigen NPs, which enabled the co-delivery of MHC class I and II epitopes to the same DC (see FIG. 4C), resulted in enhanced antigenspecific secretion of Thl or pro-inflammatory cytokines, such as IFN-y.
[0127] Tumor treatment studies were performed to determine the functional efficacy of the co-dehvery design. In both tumor models, the long-term survival of mice bearing tumors was significantly enhanced following treatment with dual-antigen NPs over all other groups, confirming that the trends that were observed in immunization studies remained consistent in a tumor treatment setting. Furthermore, most mice treated with co-conjugated NPs exhibited a delay in exponential tumor growth by multiple weeks. The robustness of these trends is supported by consistency between immunizations and treatments in either the Thl -biased C57BL / 6 or Th2 -biased BALB / c mouse models. This work strongly supports that cancer NP immunotherapies should be designed to take advantage of DCs’ abilities to simultaneously activate both CD8+ T cells and CD4+ T cells through the co-dehvery of MHC I and II antigens in the same NP deliver}' vehicle.
[0128] The results were unexpected, in that the immune responses to the different formulations does not necessarily correlate with survival, as many factors can influence the immune cells' ability to act in vivo. Further, the vast differences in the survival rate betweenAttorney docket No. 00058-088W01 the different tested groups, especially between MHC Class I and II molecules that are attached to the same particle [Group 4] v. MHC Class I and II molecules are attached to separate particles [Group 3] indicates synergy, as it was greater than the sum of its parts, in that the significantly improved immune response seen when MHC Class I and II molecules are attached to the same particle as compared to separate particles, despite all individual components being present in the same amounts.
[0129] A number of embodiments have been described herein. Nevertheless, it will be understood that various modifications may be made without departing from the spirit and scope of this disclosure. Accordingly, other embodiments are within the scope of the following claims.
Claims
Atorney docket No. 00058-088W01WHAT IS CLAIMED IS:1 . A vaccine formulation for the simultaneous delivery of MHC class I and II restricted antigens and an adjuvant, comprising: nanoparticles that are hollow and comprise an outer surface and an accessible inner cavity, wherein MHC class I and II restricted antigens and / or the adjuvant are conjugated to the outer surface of the nanoparticles, and / or wherein MHC class I and II restricted antigens and / or the adjuvant are conjugated or loaded into the inner cavity of the nanoparticles wherein the vaccine formulation is designed to elicit a targeted immune response in a subject having or suspected of having cancer, an autoimmune disease, or an autoimmune state.
2. The vaccine formulation of claim 1. wherein the MHC class I and II restricted antigens are peptides.
3. The vaccine formulation of claim 1, wherein the MHC class I and II restricted antigens are associated with a cancer selected from lung cancer, colorectal cancer, melanoma, chronic myeloid leukemia, colorectal carcinoma, stomach cancer, gastric carcinoma, endometrial carcinoma, head and neck squamous cell carcinoma, myeloid leukemia, lung squamous CC, acute lymphoblastic leukemia, acute myelogenous leukemia, chronic lymphocytic leukemia, renal cell carcinoma, ovarian cancer, metastatic colorectal cancer, pancreatic adenocarcinoma, bladder cancer, lung squamous cell carcinoma, promyelocytic leukemia, sarcoma, breast cancer, prostate cancer, liver cancer, thyroid cancer, testicular cancer, kidney cancer, glioblastoma, pancreatic cancer, and retinal cancer.
4. The vaccine formulation of claim 1, wherein the MHC class I and II restricted antigens are selected from CT, NY-ESO-1, gplOO, CT26, alphafetoprotein (AFP), carcinoembryonic antigen (CEA), CA-125, CA15-3, CA19-9, MUC-1, epithelial tumor antigen (ETA), tyrosinase, melanoma-associated antigen (MAGE), abnormal products of ras or p53, CTAG1B, MAGEA1, HER2 / neu. Melan-A, prostate specific antigen (PSA), prostate acidAtorney docket No. 00058-088W01 phosphatase (PAP), TRP1, TRP2, Cyclin A, myelin oligodendrocyte glycoprotein, PLP, Collagen type II. vimentin, PAD4. alpha-enolase, and CDR1.
5. The vaccine formulation of claim 1, wherein the ratio of conjugated MHC class I restricted antigen to MHC class II restricted antigen is from 1: 10 to 10: 1.
6. The vaccine formulation of claim 1. wherein the ratio conjugated MHC class 1 restricted antigen to MHC class II restricted antigen is from 1 : 1 to 1 :8.
7. The vaccine formulation of claim 1, wherein the nanoparticles have a diameter from 20 nm to 50 nm.
8. The vaccine formulation of claim 7, wherein the nanoparticles have a diameter of around 30 nm.
9. The vaccine formulation of claim 1, wherein the nanoparticles are hollow protein nanoparticles.
10. The vaccine formulation of claim 9, wherein the hollow protein nanoparticles are based on a heat shock protein(s). bacteriophage QP, human heavy chain ferritin, TIP60, or hepatitis B vims (HBV) surface-antigen protein.
11. The vaccine formulation of claim 9, wherein the hollow protein nanoparticles are based on the E2 subunit, or a portion thereof, of the pyruvate dehydrogenase complex (PDC) from the Geobacillus stearothermophilus .
12. The vaccine formulation of claim 11, wherein the E2 subunit of the PDC has been recombinantly modified to substitute one or more amino acids with cysteines.
13. The vaccine formulation of claim 11, wherein the E2 subunit of PDC has a sequence identity of at least 98% to SEQ ID NO: 15.Atorney docket No. 00058-088W0114. The vaccine formulation of claim 1, wherein the adjuvant is selected from CpG1826, CpG1018, MGN1703, ssRNA, aluminum hydroxide, aluminum phosphate, and aluminum potassium sulfate, AS04, MF59, ASOIB, CpG ODN 1466, CpG ODN PB3, CpG ODN BW005, CpG Alum, CPG 21424, CpG 7909, CpG-ODN 2135, ODN K3, CpG ODN 10101, CpG-28, CpG ODN C274, CpG ODN C695, CpG ODN# 17, CpG-ODN 2722, CpG 8916, CpG 8954, CpG ODN 678, CpG ODN BW015, CpG ODN 658, CpG ODN 640, CpG ODN PB9. CpG ODN BW004, CpG ODN BW103. CpG ODN 110, CpG ODN BW206. CpG ODN 607, CpG ODN 647, CpG ODN 111, CpG ODN 109, CpG ODN 656, CpG ODN 664, CpG ODN C9, CPG2429, CPG5475, CPG21608, CPG21797, CPG21796, CPG21799, CPG21800, CPG21802, CPG21889, CPG23409, CpG-c41, CPG23410, CPG23411, CPG23412, CPG23413, CPG23617, CPG23414. CPG 1681. CPG 2143, CPG 21425, and CPG 21426.
15. The vaccine formulation of claim 14, wherein the adjuvant is CpG1018 or CpG1826.
16. The vaccine formulation of claim 1, wherein the MHC class I and II restricted antigens are conjugated to the outer surface of the nanoparticles, and wherein the adjuvant is conjugated or loaded into the inner cavity of the nanoparticles.
17. The vaccine formulation of claim 16, wherein the MHC class I and II restricted antigens are conjugated to the outer surface of the nanoparticles by use of mal-tNTA-Ni. sulfo-SMCC, sortase A ligation, or by use of SpyCatcher / SpyTag.
18. The vaccine formulation of claim 17, wherein the MHC class I and II restricted antigens are conjugated to the outer surface of the nanoparticles by use of sulfo-SMCC.
19. The vaccine formulation of claim 16, wherein the adjuvant is conjugated or loaded into the inner cavity of the nanoparticles by use of a linker that binds to both the adjuvant and free cysteine groups in the inner cavity of the nanoparticles.
20. The vaccine formulation of claim 19, wherein the adjuvant has been modified to comprise a terminal aldehyde or benzaldehyde group, and wherein the linker is a V-(|3- maleimidopropionic acid) hydrazide (BMPH) linker.Atorney docket No. 00058-088W0121. The vaccine formulation of claim 1, wherein the vaccine formulation is formulated for oral administration, intranasal administration, subcutaneous administration, intradermal administration, or intramuscular administration.
22. A pharmaceutical composition comprising the vaccine formulation of claim 1, wherein the pharmaceutical composition further comprises a pharmaceutically acceptable carrier, diluent, stabilizer and / or excipient.
23. The pharmaceutical composition of claim 22, wherein the pharmaceutical composition further comprises a buffered saline solution.
24. A method of immunizing a subject against a cancer comprising: administering one or more therapeutically effective doses of the vaccine formulation of any one of claims 1 to 21 or the pharmaceutical composition of claims 22 or 23 to a subject having a cancer or suspected of having a cancer.
25. The method of claim 24, wherein the subject is a human subject.
26. The method of claim 24. wherein the cancer is selected from lung cancer, colorectal cancer, melanoma, chronic myeloid leukemia, colorectal carcinoma, stomach cancer, gastric carcinoma, endometrial carcinoma, head and neck squamous cell carcinoma, myeloid leukemia, lung squamous CC, acute lymphoblastic leukemia, acute myelogenous leukemia, chronic lymphocytic leukemia, renal cell carcinoma, ovarian cancer, metastatic colorectal cancer, pancreatic adenocarcinoma, bladder cancer, lung squamous cell carcinoma, promyelocytic leukemia, sarcoma, breast cancer, prostate cancer, liver cancer, thyroid cancer, testicular cancer, kidney cancer, glioblastoma, pancreatic cancer, and retinal cancer.
27. The method of claim 24. wherein the administration of the vaccine formulation or the pharmaceutical composition to the subject induces the production of Thl or pro- inflammatory cytokines.Atorney docket No. 00058-088W0128. The method of claim 27, wherein the Thl or pro-inflammatory cytokines include IFN- y, TNF-a, and IL-2.
29. The method of claim 24, wherein the administration of the vaccine formulation or the pharmaceutical composition to the subject results in antigen-specific T cell activation and a Thl response.
30. The method of claim 29, wherein antigen-specific T cell activation includes both CD4+ T cells and CD8+ T cells.
31. The method of claim 24, wherein the administration of the vaccine formulation or the pharmaceutical composition to the subject does not induce the production of Th2 inflammatory cytokines.
32. The method of claim 24. wherein the administration of the vaccine formulation or the pharmaceutical composition to the subject slows the grow th of cancer cells and / or tumors.
33. The method of claim 24, wherein one or tw o doses of the vaccine formulation or the pharmaceutical composition can be used to immunize the subject to a cancer.
34. The method of claim 24, wherein the method further comprises concurrently or sequentially treating the subject with one or more cancer therapies.
35. The method of claim 34. wherein the one or more cancer therapies are selected from surgery, chemotherapy, radiation therapy, hormone therapy, targeted therapy, immunotherapy, stem cell transplant, gene therapy, CAR T-cell therapy, and antibody-drug conjugate therapy.
36. A method of immunizing a subject against an autoimmune disease or state comprising: administering one or more therapeutically effective doses of the vaccine formulation of any one of claims 1 to 21 or the pharmaceutical composition of claims 22 or 23 to a subject having an autoimmune disease or suspected of having an autoimmune state.Atorney docket No. 00058-088W0137. The method of claim 36. wherein the subject has an autoimmune disease selected from coeliac disease, type 1 diabetes, Graves' disease, inflammatory bowel diseases (such as Crohn's disease and ulcerative colitis), multiple sclerosis, Sjogren’s syndrome, SICCA, alopecia areata, Addison's disease, pernicious anemia, psoriasis, rheumatoid arthritis. Type I diabetes, and systemic lupus erythematosus.
38. The method of claim 36, wherein the subject is suspected of having an autoimmune state selected from Alopecia areata, Autoimmune angioedema, Autoimmune progesterone dermatitis, Autoimmune urticaria, Bullous pemphigoid, Cicatricial pemphigoid, Dermatitis herpetiformis, Dermatomyositis. Discoid lupus erythematosus, Epidermolysis bullosa acquisita. Erythema nodosum, Gestational pemphigoid, Hidradenitis suppurativa. Lichen planus, Lichen sclerosus, Linear IgA disease, Morphea, Psoriasis, Pemphigus vulgaris, Scleroderma (systemic sclerosis), Sjogren syndrome, Vitiligo, Autoimmune enteropathy. Autoimmune hepatitis. Celiac disease. Crohn's disease, Intestinal necrotizing arteriolitis, Pernicious anemia. Ulcerative colitis, Rheumatic heart disease, Kawasaki disease, Giant cell arteritis, Takayasu's arteritis, Behcet's disease, Eosinophilic granulomatosis with polyangiitis (EGPA), Granulomatosis with polyangiitis (GPA), IgA vasculitis (IgAV), Leukocytoclastic vasculitis, Lupus vasculitis, Rheumatoid vasculitis, Microscopic polyangiitis (MPA), Necrotizing arteriolitis, Polyarteritis nodosa (PAN). Polymyalgia rheumatica, Urticarial vasculitis. Goodpasture syndrome, IgA nephropathy, Membranous nephropathy, Lupus nephritis, Interstitial nephritis, Interstitial cystitis, Primary sclerosing cholangitis, Acute disseminated encephalomyelitis, Acute motor axonal neuropathy, Anti-NMDA receptor encephalitis, Autoimmune encephalitis, Balo concentric sclerosis, Bickerstaffs encephalitis, Chronic inflammatory demyelinating polyneuropathy, Guillain-Barre syndrome, Hashimoto's encephalopathy, Idiopathic inflammatory demyelinating diseases, Lambert-Eaton myasthenic syndrome, Multiple sclerosis, Myasthenia gravis, Neuromyelitis optica (Devic's disease) / NMOSD, Restless legs syndrome, Stiff-person syndrome, Sydenham's chorea, Transverse myelitis. Undifferentiated connective tissue disease (UCTD). Addison's disease, Autoimmune oophoritis, Autoimmune orchitis, Autoimmune pancreatitis. Autoimmune poly endocrine syndrome type 1 (APS1), Autoimmune poly endocrine syndrome type 2 (APS2), Autoimmune polyendocrine syndrome type 3 (APS3), Diabetes mellitus type 1,Atorney docket No. 00058-088W01Endometriosis, Graves' disease, Hashimoto's thyroiditis, Ord's thyroiditis, Goodpasture syndrome, Eosinophilic granulomatosis with polyangiitis (EGPA), Granulomatosis with polyangiitis (GPA), Idiopathic pulmonary fibrosis. Interstitial lung disease, Pulmonary alveolar proteinosis, Rheumatoid lung disease. Sarcoidosis, Autoimmune hemolytic anemia, Immune thrombocytopenia, Thrombotic thrombocytopenic purpura, Antiphospholipid syndrome, and Paroxysmal nocturnal hemoglobinuria.
39. The method of claim 36, wherein the subject is a human subject.
40. The method of claim 36, wherein the method further comprises concurrently or sequentially treating the subject with one or more therapies for autoimmune disease.
41. The method of claim 40, wherein the therapies for autoimmune disease include immune checkpoint inhibitors.
42. The method of claim 41, wherein the immune checkpoint inhibitors are selected from pembrolizumab, nivolumab, cemiplimab, dostarlimab, tislelizumab, penpulimab, retifanlimab, atezolizumab, avelumab, durvalumab, ipilimumab, rremelimumab, relatlimab, Lag3, ICOS, TIM 3, SIGLECs 7 and 9, VISTA, A2A and A2B. CD276,and N0X2.
43. The method of any one of claims 36 to 42, wherein the vaccine formulation or the pharmaceutical composition is tailored or designed to elicit a Th2 or Treg class immune response to counteract the autoimmune state or autoimmune disease in the subject.
Citation Information
Patent Citations
Multimodal imaging probes for in vivo targeted and non-targeted imaging and therapeutics
US20100183504A1
Alloy Nanoparticles Loaded Network Structure and Method for Producing Alloy Nanoparticles Loaded Porous Body
US20220305468A1
Targeting multiple t cell types using spherical nucleic acid vaccine architecture
US20240165263A1
A conjugate consisting of or comprising at least a ß-glucan or a mannan
WO2023161527A1