Compositions and methods for modulation of 3-hydroxy-3-methylglutaryl-coa reductase (HMGCR) expression

Abstract

Disclosed herein are compositions and methods for the modulation of 3-hydroxy-3-methylglutaryl-CoA reductase (HMGCR) expression, wherein the compositions include an siRNA duplex or a conjugated siRNA duplex. Also disclosed herein are methods, and compositions for use in methods, of treating age-related macular degeneration (AMD) or hyperlipidemia. The compositions disclosed herein comprise an siRNA duplex that comprises a sense sequence and an antisense sequence, wherein the sense sequence and the antisense sequence are at least partially complementary to each other.

Description

[0001]Attorney Docket No.: 87JA-396165-WO COMPOSITIONS AND METHODS FOR MODULATION OF 3-HYDROXY-3- METHYLGLUTARYL-COA REDUCTASE (HMGCR) EXPRESSION CROSS REFERENCE TO RELATED APPLICATIONS This application claims the benefit under 35 U.S.C.119(e) of United States Provisional Applications 63 / 703,146 filed October 3, 2024 and 63 / 854,267 filed July 30, 2025, which are hereby incorporated by reference in their entirety. FIELD Disclosed herein are compositions and methods for the modulation of 3-hydroxy-3- methylglutaryl-CoA reductase (HMGCR) expression, for example, compositions including an siRNA duplex. Also disclosed herein are methods of treating HMGCR-mediated diseases and conditions such as dyslipidemia and age-related macular degeneration (AMD). BACKGROUND RNA interference (RNAi) is a phenomenon involving double-stranded (ds) RNA-dependent gene-specific posttranscriptional silencing. Synthetic duplexes of RNAs containing approximately 21 nucleotides can mediate gene specific RNAi in mammalian cells without stimulating generic antiviral defense mechanisms. As a result, small interfering RNAs (siRNAs), which are short double-stranded RNAs, have been widely used to inhibit gene expression and to understand gene function. siRNAs can also be used as therapeutics targeting disease-related mRNA transcripts and as a result, therapeutically modulate gene expression. siRNAs downregulate or silence (i.e., fully or partially inhibit) the expression of endogenous or exogenous genes / mRNAs. RNA interference is based on the ability of certain dsRNA species to enter a specific protein complex, where they are then targeted to complementary cellular RNAs and specifically degrade them. Thus, the RNA interference response features an endonuclease complex containing an siRNA, commonly referred to as an RNA-induced silencing complex (RISC), which mediates cleavage of single-stranded RNA having a sequence complementary to the antisense strand of the siRNA duplex. Cleavage of the target RNA may take place in the middle of the region complementary to the antisense strand of the siRNA duplex. In more detail, longer dsRNAs are digested into short (17-29 bp) dsRNA fragments (also referred to as short inhibitory RNAs or “siRNAs”) by type III RNAses. The RISC protein complex recognizes these fragments and complementary mRNA. The whole process is culminated by endonuclease cleavage of target mRNA. Attorney Docket No.: 87JA-396165-WO SUMMARY The compositions and methods disclosed herein are based, at least in part, on the discovery of novel siRNA duplexes targeting HMGCR mRNA, and therapeutic compositions targeting the HMGCR mRNA transcript. In some embodiments, the siRNA duplexes include modifications of the ribonucleotides and / or targeting moieties conjugated to the siRNA duplexes. Also provided herein are methods and pharmaceutical compositions for use in the treatment of HMGCR-mediated diseases and conditions. In certain embodiments, provided is an siRNA duplex comprising a sense sequence and an antisense sequence, wherein the sense sequence and the antisense sequence are at least partially complementary to each other, and wherein the sense sequence comprises a polynucleotide sequence that differs by no more than 1, 2, 3, 4, or 5 nucleotides from any one of the sense sequences recited in Table 1. In certain embodiments, provided is an siRNA duplex capable of inhibiting expression of the human HMGCR gene, wherein the siRNA duplex comprises a sense sequence and an antisense sequence, wherein the sense sequence and the antisense sequence are at least partially complementary to each other, wherein the sense sequence comprises modified ribonucleotides represented by one of the following formulae in a 5ʹ to 3ʹ orientation: X1-Y2-X3-Y4-X5-Y6-X7-Y8-X9-X10-X11-Y12-X13-Y14-X15-Y16-X17-Y18-X19-Y20-X21; or Y1-Y2-Y3-Y4-Y5-Y6-X7-Y8-X9-X10-X11-Y12-Y13-Y14-Y15-X16-X17-Y18-Y19-Y20-Y21; or Y1-Y2-Y3-Y4-Y5-Y6-X7-Y8-X9-X10-X11-Y12-Y13-Y14-Y15-Y16-Y17-Y18-Y19-Y20-Y21; or Y1-Y2-Y3-Y4-X5-Y6-Y7-Y8-X9-X10-X11-Y12-Y13-Y14-Y15-Y16-Y17-Y18-X19-Y20-Y21; and wherein the antisense sequence comprises modified ribonucleotides represented by one of the following formulae in a 5ʹ to 3ʹ orientation: Y1-X2-Y3-X4-Y5-X6-Y7-X8-Y9-X10-Y11-Y12-Y13-X14-Y15-X16-Y17-X18-Y19-X20-Y21-Y22-Y23; or Z1-X2-Y3-X4-Y5-X6-Y7-X8-Y9-X10-Y11-Y12-Y13-X14-Y15-X16-Y17-X18-Y19-X20-Y21-Y22-Y23; or Z1-X2-Y3-Y4-Y5-X6-Y7-X8-X9-Y10-Y11-Y12-Y13-X14-Y15-X16-Y17-Y18-Y19-Y20-Y21-Y22-Y23; or Z1-X2-Y3-Y4-Y5-X6-Y7-Y8-Y9-Y10-Y11-Y12-Y13-X14-Y15-X16-Y17-Y18-Y19-Y20-Y21-Y22-Y23; or Z1-X2-Y3-Y4-Y5-Y6-Y7-Y8-Y9-Y10-Y11-Y12-Y13-X14-Y15-Y16-Y17-Y18-Y19-Y20-Y21-Y22-Y23; wherein X represents a ribonucleotide having a 2ʹ-fluoro modification; Y represents a ribonucleotide having a 2ʹ-O-methyl modification, and Z represents a 5ʹ-vinylphosphonate-2ʹ-O-methyl modified uracil. In certain embodiments, the siRNA duplex provided herein is conjugated to a non-nucleotide moiety. The non-nucleotide moiety can be conjugated to the sense strand of the siRNA duplex via a linker. The non-nucleotide moiety can be conjugated at the 5ʹ-end, the 3ʹ-end or an internal 2ʹ-position of Attorney Docket No.: 87JA-396165-WO the sense strand. In certain embodiments, the non-nucleotide moiety comprises a carbohydrate cluster, such as a triantennary GalNAc3 ligand. In another embodiment, provided is a composition comprising the siRNA duplex as described herein, and one or more non-nucleotide moieties. The non-nucleotide moiety can be conjugated to the sense strand of the siRNA duplex via a linker. The non-nucleotide moiety can be conjugated at the 5ʹ- end, the 3ʹ-end or an internal 2ʹ-position of the sense strand. In certain embodiments, the non-nucleotide moiety comprises a carbohydrate cluster, such as a triantennary GalNAc3 ligand. Moreover, the disclosure provides a method of reducing a level of HMG-CoA reductase and / or HMGCR mRNA in a cell of a subject in need thereof, the method comprising contacting the cell with the siRNA duplex as described herein or a composition thereof in an amount effective to reduce a level of HMG-CoA reductase and / or HMGCR mRNA in the cell. Also provided is a method of reducing a level of HMG-CoA reductase and / or HMGCR mRNA in a cell of a subject, the method comprising administering to the subject the siRNA duplex as described herein or a composition thereof in an amount effective to reduce a level of HMG-CoA reductase and / or HMGCR mRNA in one or more cells in the subject. Also provided is an siRNA duplex or a composition thereof, for use in the treatment of an HMGCR-mediated disease or condition. In another embodiment, provided is a method of treating a subject diagnosed as having, or being at risk for, age-related macular degeneration (AMD), the method comprising administering to the subject a therapeutically effective amount of the siRNA duplex as described herein or a composition thereof. Moreover, the disclosure provides a method of treating a subject having AMD, the method comprising administering to the subject an siRNA duplex that reduces HMGCR expression wherein the duplex administered to the subject in need thereof is an intraocular injection. Further, the disclosure provides a method of treating a subject having AMD, the method comprising administering an siRNA duplex that reduces HMGCR expression wherein the siRNA administered to the subject having AMD is an intraocular injection in a dose range from about less than 1 mg / kg, preferably less than 0.1 mg / kg, even more preferably less than 0.01 mg / kg, and where the dose interval between injection is one week or more, one month or more, or three months or more. In other embodiments, provided is a method of treating a subject diagnosed as having, or being at risk for, hyperlipidemia, the method comprising administering to the subject a therapeutically effective amount of the siRNA duplex or the composition as described herein or a composition thereof. Moreover, the disclosure provides a method of treating a subject having hyperlipidemia, the method comprising administering to the subject an siRNA duplex that reduces HMGCR expression. In certain embodiments, the siRNA duplex or the composition is administered by subcutaneous injection. Attorney Docket No.: 87JA-396165-WO The description herein sets forth exemplary embodiments of the present technology. It should be recognized, however, that such description is not intended as a limitation on the scope of the present disclosure but is instead provided as a description of exemplary embodiments. For instances where the siRNA duplexes disclosed herein include chemical modifications, backbone modification, ribose modification, base modification, and terminal modification can advantageously enhance the properties of the siRNA duplexes, including stability improvement, reduction of off-target effects, and mitigation of immunogenicity. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials are described herein for use in the present invention; other, suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. Other features and advantages of the invention will be apparent from the following detailed description and figures, and from the claims. DESCRIPTION OF DRAWINGS FIG.1 is a schematic showing seven examples of modification patterns for siRNA duplexes including modified nucleotides. Nucleotide modifications depicted in the schematic include 2ʹ-fluoro, 2ʹ- O-methyl, phosphorothioate linkages, and 5'-(E)-vinylphosphonate modifications. FIG.2 is a schematic showing the treatment plan using GalNAc conjugated siRNA in the hyperlipidemic rabbit model. FIG.3A-3D are qPCR results showing the HMGCR and LDLR expression difference in the liver and muscle between the groups dosed with the conjugated siRNA or controls. (A) HMGCR expression in liver; (B) LDLR expression in the liver; (C) HMGCR expression in muscle; (B) LDLR expression in the muscle. DETAILED DESCRIPTION The compositions and methods disclosed herein relate generally to compounds that down- regulate expression of protein-coding genes, and in particular, the human HMGCR gene. The disclosure relates particularly to novel small interfering RNAs (siRNAs), and to the use of these novel siRNAs in the treatment of diseases and medical conditions related to the human HMGCR gene. Particular diseases and conditions to be treated include hyperlipidemia, cardiovascular diseases, autoimmune diseases, and age- Attorney Docket No.: 87JA-396165-WO related macular degeneration (AMD), such as dry AMD, wet AMD, intermediate AMD, and geographic atrophy. The siRNAs disclosed herein can include nucleotide modifications and novel patterns of nucleotide modifications, including 2ʹ-fluoro modifications, 2ʹ-O-methyl modifications, 5ʹ- vinylphosphonate-2ʹ-O-methyl modified uracils, and phosphorothioate linkages. The siRNAs disclosed herein can include one or more non-nucleotide moieties, for example, a hydrophobic moiety. Non- nucleotide moieties can include a small molecule, an agonist, an antagonist, a cytokine, a peptide, a protein, an antibody or fragment thereof, a vitamin, a folate, a natural product, an aptamer, or a targeting ligand. Non-nucleotide moieties associated with the siRNA complexes disclosed herein can promote uptake of the siRNA complexes by target cells. Target cells can include cells of the eye of a human subject, retinal cells of a subject, and retinal epithelium cell of a subject. Lists of siRNAs to be used in the compositions and methods disclosed herein are provided in Tables 1 and 2 below. As discussed in further detail below in the Examples, siRNAs disclosed herein are prioritized based on several criteria for targeting the expression of the human HMGCR gene and for predicted selectivity, specificity, and thus predicted therapeutic effect. 3-Hydroxy-3-Methylglutaryl-CoA Reductase (HMGCR) HMG-CoA reductase (HMGCR) is the rate-limiting enzyme for cholesterol synthesis and is regulated via a negative feedback mechanism mediated by sterols and non-sterol metabolites derived from mevalonate, the product of the reaction catalyzed by reductase. Normally in mammalian cells this enzyme is suppressed by cholesterol derived from the internalization and degradation of low-density lipoprotein (LDL) via the LDL receptor. Competitive inhibitors of the reductase induce the expression of LDL receptors in the liver, which in turn increases the catabolism of plasma LDL and lowers the plasma concentration of cholesterol, an important determinant of atherosclerosis. The human HMGCR enzyme is encoded by the HMGCR gene at cytogenetic location 5q13.3, with genomic coordinates (GRCh38): 5:75,336,529-75,362,116. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. The polynucleotide sequence of an example HMGCR mRNA transcript targeted by the compositions and methods disclosed herein is provided as SEQ ID NO: 1 below: >NM_000859.3 Homo sapiens 3-hydroxy-3-methylglutaryl-CoA reductase (HMGCR), transcript variant 1, mRNA Attorney Docket No.: 87JA-396165-WO CCTTCCGCTCCGCGACTGCGTTAACTGGAGCCAGGCTGAGCGTCGGCGCCGGGGTTCGGTGGCCTCTAGTGAGATCT GGAGGATCCAAGGATTCTGTAGCTACAATGTTGTCAAGACTTTTTCGAATGCATGGCCTCTTTGTGGCCTCCCATCC CTGGGAAGTCATAGTGGGGACAGTGACACTGACCATCTGCATGATGTCCATGAACATGTTTACTGGTAACAATAAGA TCTGTGGTTGGAATTATGAATGTCCAAAGTTTGAAGAGGATGTTTTGAGCAGTGACATTATAATTCTGACAATAACA CGATGCATAGCCATCCTGTATATTTACTTCCAGTTCCAGAATTTACGTCAACTTGGATCAAAATATATTTTGGGTAT TGCTGGCCTTTTCACAATTTTCTCAAGTTTTGTATTCAGTACAGTTGTCATTCACTTCTTAGACAAAGAATTGACAG GCTTGAATGAAGCTTTGCCCTTTTTCCTACTTTTGATTGACCTTTCCAGAGCAAGCACATTAGCAAAGTTTGCCCTC AGTTCCAACTCACAGGATGAAGTAAGGGAAAATATTGCTCGTGGAATGGCAATTTTAGGTCCTACGTTTACCCTCGA TGCTCTTGTTGAATGTCTTGTGATTGGAGTTGGTACCATGTCAGGGGTACGTCAGCTTGAAATTATGTGCTGCTTTG GCTGCATGTCAGTTCTTGCCAACTACTTCGTGTTCATGACTTTCTTCCCAGCTTGTGTGTCCTTGGTATTAGAGCTT TCTCGGGAAAGCCGCGAGGGTCGTCCAATTTGGCAGCTCAGCCATTTTGCCCGAGTTTTAGAAGAAGAAGAAAATAA GCCGAATCCTGTAACTCAGAGGGTCAAGATGATTATGTCTCTAGGCTTGGTTCTTGTTCATGCTCACAGTCGCTGGA TAGCTGATCCTTCTCCTCAAAACAGTACAGCAGATACTTCTAAGGTTTCATTAGGACTGGATGAAAATGTGTCCAAG AGAATTGAACCAAGTGTTTCCCTCTGGCAGTTTTATCTCTCTAAAATGATCAGCATGGATATTGAACAAGTTATTAC CCTAAGTTTAGCTCTCCTTCTGGCTGTCAAGTACATCTTCTTTGAACAAACAGAGACAGAATCTACACTCTCATTAA AAAACCCTATCACATCTCCTGTAGTGACACAAAAGAAAGTCCCAGACAATTGTTGTAGACGTGAACCTATGCTGGTC AGAAATAACCAGAAATGTGATTCAGTAGAGGAAGAGACAGGGATAAACCGAGAAAGAAAAGTTGAGGTTATAAAACC CTTAGTGGCTGAAACAGATACCCCAAACAGAGCTACATTTGTGGTTGGTAACTCCTCCTTACTCGATACTTCATCAG TACTGGTGACACAGGAACCTGAAATTGAACTTCCCAGGGAACCTCGGCCTAATGAAGAATGTCTACAGATACTTGGG AATGCAGAGAAAGGTGCAAAATTCCTTAGTGATGCTGAGATCATCCAGTTAGTCAATGCTAAGCATATCCCAGCCTA CAAGTTGGAAACTCTGATGGAAACTCATGAGCGTGGTGTATCTATTCGCCGACAGTTACTTTCCAAGAAGCTTTCAG AACCTTCTTCTCTCCAGTACCTACCTTACAGGGATTATAATTACTCCTTGGTGATGGGAGCTTGTTGTGAGAATGTT ATTGGATATATGCCCATCCCTGTTGGAGTGGCAGGACCCCTTTGCTTAGATGAAAAAGAATTTCAGGTTCCAATGGC AACAACAGAAGGTTGTCTTGTGGCCAGCACCAATAGAGGCTGCAGAGCAATAGGTCTTGGTGGAGGTGCCAGCAGCC GAGTCCTTGCAGATGGGATGACTCGTGGCCCAGTTGTGCGTCTTCCACGTGCTTGTGACTCTGCAGAAGTGAAAGCC TGGCTCGAAACATCTGAAGGGTTCGCAGTGATAAAGGAGGCATTTGACAGCACTAGCAGATTTGCACGTCTACAGAA ACTTCATACAAGTATAGCTGGACGCAACCTTTATATCCGTTTCCAGTCCAGGTCAGGGGATGCCATGGGGATGAACA TGATTTCAAAGGGTACAGAGAAAGCACTTTCAAAACTTCACGAGTATTTCCCTGAAATGCAGATTCTAGCCGTTAGT GGTAACTATTGTACTGACAAGAAACCTGCTGCTATAAATTGGATAGAGGGAAGAGGAAAATCTGTTGTTTGTGAAGC TGTCATTCCAGCCAAGGTTGTCAGAGAAGTATTAAAGACTACCACAGAGGCTATGATTGAGGTCAACATTAACAAGA ATTTAGTGGGCTCTGCCATGGCTGGGAGCATAGGAGGCTACAACGCCCATGCAGCAAACATTGTCACCGCCATCTAC ATTGCCTGTGGACAGGATGCAGCACAGAATGTTGGTAGTTCAAACTGTATTACTTTAATGGAAGCAAGTGGTCCCAC AAATGAAGATTTATATATCAGCTGCACCATGCCATCTATAGAGATAGGAACGGTGGGTGGTGGGACCAACCTACTAC CTCAGCAAGCCTGTTTGCAGATGCTAGGTGTTCAAGGAGCATGCAAAGATAATCCTGGGGAAAATGCCCGGCAGCTT GCCCGAATTGTGTGTGGGACCGTAATGGCTGGGGAATTGTCACTTATGGCAGCATTGGCAGCAGGACATCTTGTCAA AAGTCACATGATTCACAACAGGTCGAAGATCAATTTACAAGACCTCCAAGGAGCTTGCACCAAGAAGACAGCCTGAA TAGCCCGACAGTTCTGAACTGGAACATGGGCATTGGGTTCTAAAGGACTAACATAAAATCTGTGAATTAAAAAAGCT CAATGCATTGTCTTGTGGAGGATGAATAGATGTGATCACTGAGACAGCCACTTGGTTTTTGGCTCTTTCAGAGAGGT CTCAGGTTCTTTCCATGCAGACTCCTCAGATCTGAACACAGTTTAGTGCTTTACATGCTGTGCTCTTTGAAGAGATT TCAACAAGAATATTGTATGTTAAAGCATCAGAGATGGTAATCTACAGCTCACCTCTGAAGGCAAATATAAGCTGGGA AAAAAGTTTTGATGAAATTCTTGAAGTTCATGGTGATCAGTGCAATTGACCTTCTCCCTCACTCCTGCCAGTTGAAA ATGGATTTTTAAATTATACTGTAGCTGATGAAACTCCTGATTTTGTAGTTAATTTATTAAGTCTGGGATGTAGAACT TCAAGAAGTAAGAGCTAAGTTCTAAGTTCATGTTTGTAAATTAATACTTCATTTGGTGCTGGTCTATTTTGATTTTG GGGGGTAATCAGCATTATTCTTCAGAAGGGGACCTGTTTTCTTCAAGGGAAGAAACACTCTTATTCCCAAACTACAG AATAATGTGTTAAACATGCTAAATAGTTCTATCAGGAAAACAAATCACTGTATTTATCTCCGCAGGCTATTTGTTCA GAGAGGCCTTTTGTTTAAATATAAATGTTTAAATATAAATGTTTGTCTGGATTGGCTATAACATGTCTTTCAGCATT AGGCTTTTAAGAAACACAGGGTTTTGTATTCTTTACTAAAGATATCAGAGCTCTTAATGTTGCTTAGATGAGGGTGA CTGTCAAGTACAAGCAAGACTGGGACCTTAGAAATCATTGTAGAAACACAGTTTTGAAAGAAAAATACCATGTCTCT AAGCCAACTTTAATTGCTTAAAAGACATTTTTATTTAGTTGAAAAATCTAGTTTTTTTTGTAAACTGTATCAAATCT GTATATGTTGTAATAAAACTTATGCTAGTTTATTGGAAGTGTTCAAGAAATAAAAATCAACTTGTGTACTGATAAAA TACTCTAGCCTGGGCCAGAGAAGATAATGTTCTTTAATGTTGTCCAGGAAACCCTGGCTTGCTTGCCGAGCCTAATG AAAGGGAAAGTCAGCTTTCAGAGCCAGTGAAGGAGCCACGTGAATGGCCCTAGAACTGTGCCTAGTTCCTGTGGCCA GGAGGTTGGTGACTGAAACATTCACACAGGGCTCTTTGATGGACCCACGAACGCTCTTAGCTTTCTCAGGGGGTCAG CAGAGTTATTGAATCTTAATTTTTTTTAATGTACAAGTTTTGTATAAATAATAAAGAACTCCTTATTTTGTATTACA TCTAATGCTTCAAGTGTTGCTCTTGGAAAGCTGATGATGTCTCTTGTAGAAGATGGACTCTGAAAAACATTCCAGGA AACCATGGCAGCATGGAGAGCCTCTTAGTGATTGTGTCTGCATTGTTATTGTGGAAGATTTACCTTTTCTGTTGTAC Attorney Docket No.: 87JA-396165-WO GTAAAGCTTAAATTGCTTTTGTTGTGACTTTTTAGCCAGTGACTTTTTCTGAGCTTTTCATGGAAGTGGCAGTGAAA AATATGTTGAGTGTTCATTTTAGTGACTGTAATTAATATCTTGCTGGATTAATGTTTTGTACAATTACTAAATTGTA TACATTTTGTTATAGAATACTTTTTTCTAGTTTCAGTAAATAATGAAAAGGAAGTTAATACCAA (SEQ ID NO: 1) Hyperlipidemias Hyperlipidemia is a form of dyslipidemia and is characterized with abnormally high levels of any or all lipids (e.g., fats, triglycerides, cholesterol, phospholipids) or lipoproteins in the blood. Lipids (water-insoluble molecules) are transported in a protein capsule. Hyperlipidemias are divided into primary and secondary subtypes. Primary hyperlipidemia is usually due to genetic causes, such as a mutation in a receptor protein, while secondary hyperlipidemia arises due to other underlying causes such as diabetes. Lipid and lipoprotein abnormalities are common in the general population and are regarded as modifiable risk factors for cardiovascular disease due to their influence on atherosclerosis. Hyperlipidemias can be classified as either familial when caused by specific genetic abnormalities or acquired when resulting from another underlying disorder that leads to alterations in plasma lipid and lipoprotein metabolism. Also, hyperlipidemia may be idiopathic, that is, without a known cause. Hyperlipidemias are also classified according to which types of lipids are elevated, that is hypercholesterolemia, hypertriglyceridemia or both in combined hyperlipidemia. Elevated levels of lipoprotein may also be classified as a form of hyperlipidemia. HMGCR inhibition can be used to lower elevated cholesterol levels in people who have not yet developed cardiovascular disease but are at high risk of it due to factors like high cholesterol, hypertension, smoking, or family history. For people who have already had a heart attack, stroke, or other cardiovascular events, HMGCR inhibition can help prevent further events by reducing cholesterol levels. Cardiovascular Diseases Cardiovascular diseases (CVDs) are a group of disorders of the heart and blood vessels and are frequently associated with dyslipidemia. For instance, for coronary artery disease (CAD), HMGCR inhibition can reduce the risk of heart attacks by lowering LDL cholesterol, which contributes to the buildup of plaques in arteries. HMGCR inhibition can also reduce the risk of ischemic stroke by preventing the formation of cholesterol plaques that could block blood flow to the brain. Likewise, HMGCR inhibition can help reduce symptoms and the progression of peripheral artery disease (PAD), a condition where arteries in the legs become narrowed or blocked. Attorney Docket No.: 87JA-396165-WO Cancers HMGCR inhibition is also being explored for treating various types of cancers. An HMGCR siRNA can inhibit the mevalonate pathway, which is crucial for cholesterol synthesis, as well as for the growth and survival of certain cancer cells. Studies have indicated that HMGCR inhibition can induce cancer cell apoptosis and can inhibit proliferation, migration, and inflammation in various cancers, including lung, ovarian, and breast cancers. Meanwhile, in cancers such as lung cancer, HMGCR expression has been linked to resistance to chemotherapy drugs like cisplatin. HMGCR inhibition, therefore can enhance the effectiveness of these treatments. Diabetes, Non-Alcoholic Fatty Liver Disease (NAFLD) and Inflammatory Diseases HMGCR inhibition can also be useful in the treatment, prevention and / or management of other diseases, such as diabetes, NAFLD and inflammatory diseases. Diabetes increases the risk of cardiovascular diseases. Therefore, even in patients without elevated cholesterol levels, HMGCR inhibition can still be helpful in diabetic patients for reducing the risks of cardiovascular diseases. Some studies have suggested that statins may help in managing non-alcoholic fatty liver disease (NAFLD) by improving liver enzymes and reducing inflammation. The anti-inflammatory effects of HMGCR inhibitors have been demonstrated, which may be beneficial in conditions like rheumatoid arthritis and other chronic inflammatory diseases. Macular Degeneration Macular degeneration, also known as age-related macular degeneration (AMD), is a medical condition that may result in blurred or no vision in the center of the visual field. It is contemplated that the siRNA duplexes of the present disclosure are useful in the treatment and / or prevention or AMD, and / or the amelioration of its symptoms. Symptoms of AMD are usually progressive, with some patients experiencing a gradual worsening of vision that may affect one or both eyes. While AMD does not result in complete blindness, loss of central vision can make it hard to recognize faces, drive, read, or perform other activities of daily life. Visual hallucinations may also occur. Macular degeneration typically occurs in advanced age and is caused by damage to the macula of the retina. Genetic factors and smoking may play a role. The condition is diagnosed through a complete eye exam. Severity is divided into early, intermediate, and late types. The late type is additionally divided into “dry” and “wet” forms, with the dry form making up 90% of cases. The difference between the two Attorney Docket No.: 87JA-396165-WO forms is categorized by the change in the macula. Those with dry form AMD have drusen, made up primarily of lipid deposits located under the retinal pigment epithelium (RPE) layer on top of Bruch’s membrane. Drusen adversely impact RPE and the photoreceptors the RPE support, leading to vision loss. In wet form AMD, drusen are also present or preceding, but what differentiates it from the dry form is that blood vessels grow into and through Bruch’s membrane, causing blood and fluid to leak into the retina. Signs and symptoms of macular degeneration can include: • Distorted vision in the form of metamorphopsia, in which a grid of straight lines appears wavy and parts of the grid may appear blank: Patients often first notice this when looking at things like miniblinds in their home or telephone poles while driving. There may also be central scotomas, shadows or missing areas of vision • Slow recovery of visual function after exposure to bright light (photostress test) • Visual acuity drastically decreasing (two levels or more), e.g.: 20 / 20 to 20 / 80 • Blurred vision: Those with dry AMD may be asymptomatic or notice a gradual loss of central vision, whereas those with wet AMD often notice a rapid onset of vision loss (often caused by leakage and bleeding of abnormal blood vessels) • Trouble discerning colors, specifically dark ones from dark ones and light ones from light ones • A loss in contrast sensitivity • Formed visual hallucinations and flashing lights have also been associated with severe visual loss secondary to wet AMD. Small Interfering RNAs (siRNAs) Table 1 below describes nucleic acid sequences of sense and corresponding antisense oligonucleotides, useful in preparing corresponding siRNA duplexes. The siRNA compositions disclosed herein can decrease the abundance of a target protein by interfering with the mRNA, e.g., the human HMGCR mRNA transcript, according to the methods disclosed herein. The siRNA compositions disclosed herein are duplex oligoribonucleotides in which the sense strand is derived from the mRNA sequence of the target gene, and the antisense strand is complementary to the sense strand. In general, some deviation from the target mRNA sequence is tolerated without compromising the siRNA activity (see e.g., Czauderna et al., 2003, NAR 31(11), 2705-2716). Attorney Docket No.: 87JA-396165-WO Table 1 – Sense Strand and Antisense Strand Sequences for siRNA Duplexes Attorney Docket No.: 87JA-396165-WO Attorney Docket No.: 87JA-396165-WO Attorney Docket No.: 87JA-396165-WO Attorney Docket No.: 87JA-396165-WO Attorney Docket No.: 87JA-396165-WO Attorney Docket No.: 87JA-396165-WO Attorney Docket No.: 87JA-396165-WO Attorney Docket No.: 87JA-396165-WO Attorney Docket No.: 87JA-396165-WO Attorney Docket No.: 87JA-396165-WO In some embodiments, the sense sequence and the antisense sequence include, respectively, the nucleic acid sequences of SEQ ID NO: 2 and 537, 3 and 538, 4 and 539, 5 and 540, 6 and 541, 7 and 542, 8 and 543, 9 and 544, 10 and 545, 11 and 546, 12 and 547, 13 and 548, 14 and 549, 15 and 550, 16 and 551, 17 and 552, 18 and 553, 19 and 554, 20 and 555, 21 and 556, 22 and 557, 23 and 558, 24 and 559, 25 and 560, 26 and 561, 27 and 562, 28 and 563, 29 and 564, 30 and 565, 31 and 566, 32 and 567, 33 and 568, 34 and 569, 35 and 570, 36 and 571, 37 and 572, 38 and 573, 39 and 574, 40 and 575, 41 and 576, 42 and 577, 43 and 578, 44 and 579, 45 and 580, 46 and 581, 47 and 582, 48 and 583, 49 and 584, 50 and 585, 51 and 586, 52 and 587, 53 and 588, 54 and 589, 55 and 590, 56 and 591, 57 and 592, 58 and 593, 59 and 594, 60 and 595, 61 and 596, 62 and 597, 63 and 598, 64 and 599, 65 and 600, 66 and 601, 67 and 602, 68 and 603, 69 and 604, 70 and 605, 71 and 606, 72 and 607, 73 and 608, 74 and 609, 75 and 610, 76 and 611, 77 and 612, 78 and 613, 79 and 614, 80 and 615, 81 and 616, 82 and 617, 83 and 618, 84 and 619, 85 and 620, 86 and 621, 87 and 622, 88 and 623, 89 and 624, 90 and 625, 91 and 626, 92 and 627, 93 and 628, 94 and 629, 95 and 630, 96 and 631, 97 and 632, 98 and 633, 99 and 634, 100 and 635, 101 and 636, 102 and 637, 103 and 638, 104 and 639, 105 and 640, 106 and 641, 107 and 642, 108 and 643, 109 and 644, 110 and 645, 111 and 646, 112 and 647, 113 and 648, 114 and 649, 115 and 650, 116 and 651, 117 and 652, 118 and 653, 119 and 654, 120 and 655, 121 and 656, 122 and 657, 123 and 658, 124 and 659, 125 and 660, 126 and 661, 127 and 662, 128 and 663, 129 and 664, 130 and 665, 131 and 666, 132 and 667, 133 and 668, 134 and 669, 135 and 670, 136 and 671, 137 and 672, 138 and 673, 139 and 674, 140 and 675, 141 and 676, 142 and 677, 143 and 678, 144 and 679, 145 and 680, 146 and 681, 147 and 682, 148 and 683, 149 and 684, 150 and 685, 151 and 686, 152 and 687, 153 and 688, 154 and 689, 155 and 690, 156 and 691, 157 and 692, 158 and 693, 159 and 694, 160 and 695, 161 and 696, 162 and 697, 163 and 698, 164 and 699, 165 and 700, 166 and 701, 167 and 702, 168 and 703, 169 and 704, 170 and 705, 171 and 706, 172 and 707, 173 and 708, 174 and 709, 175 and 710, 176 and 711, 177 and 712, 178 and 713, 179 and 714, 180 and 715, 181 and 716, 182 and 717, 183 and 718, 184 and 719, 185 and 720, 186 and 721, 187 and 722, 188 and 723, 189 and 724, 190 and 725, 191 and 726, 192 and 727, 193 and 728, 194 and 729, 195 and 730, 196 and 731, 197 and 732, 198 and 733, 199 and 734, 200 and 735, 201 and 736, 202 and 737, 203 and 738, 204 and 739, 205 and 740, 206 and 741, 207 and 742, 208 and 743, 209 and 744, 210 and 745, 211 and 746, 212 and 747, 213 and 748, 214 and 749, 215 and 750, 216 Attorney Docket No.: 87JA-396165-WO and 751, 217 and 752, 218 and 753, 219 and 754, 220 and 755, 221 and 756, 222 and 757, 223 and 758, 224 and 759, 225 and 760, 226 and 761, 227 and 762, 228 and 763, 229 and 764, 230 and 765, 231 and 766, 232 and 767, 233 and 768, 234 and 769, 235 and 770, 236 and 771, 237 and 772, 238 and 773, 239 and 774, 240 and 775, 241 and 776, 242 and 777, 243 and 778, 244 and 779, 245 and 780, 246 and 781, 247 and 782, 248 and 783, 249 and 784, 250 and 785, 251 and 786, 252 and 787, 253 and 788, 254 and 789, 255 and 790, 256 and 791, 257 and 792, 258 and 793, 259 and 794, 260 and 795, 261 and 796, 262 and 797, 263 and 798, 264 and 799, 265 and 800, 266 and 801, 267 and 802, 268 and 803, 269 and 804, 270 and 805, 271 and 806, 272 and 807, 273 and 808, 274 and 809, 275 and 810, 276 and 811, 277 and 812, 278 and 813, 279 and 814, 280 and 815, 281 and 816, 282 and 817, 283 and 818, 284 and 819, 285 and 820, 286 and 821, 287 and 822, 288 and 823, 289 and 824, 290 and 825, 291 and 826, 292 and 827, 293 and 828, 294 and 829, 295 and 830, 296 and 831, 297 and 832, 298 and 833, 299 and 834, 300 and 835, 301 and 836, 302 and 837, 303 and 838, 304 and 839, 305 and 840, 306 and 841, 307 and 842, 308 and 843, 309 and 844, 310 and 845, 311 and 846, 312 and 847, 313 and 848, 314 and 849, 315 and 850, 316 and 851, 317 and 852, 318 and 853, 319 and 854, 320 and 855, 321 and 856, 322 and 857, 323 and 858, 324 and 859, 325 and 860, 326 and 861, 327 and 862, 328 and 863, 329 and 864, 330 and 865, 331 and 866, 332 and 867, 333 and 868, 334 and 869, 335 and 870, 336 and 871, 337 and 872, 338 and 873, 339 and 874, 340 and 875, 341 and 876, 342 and 877, 343 and 878, 344 and 879, 345 and 880, 346 and 881, 347 and 882, 348 and 883, 349 and 884, 350 and 885, 351 and 886, 352 and 887, 353 and 888, 354 and 889, 355 and 890, 356 and 891, 357 and 892, 358 and 893, 359 and 894, 360 and 895, 361 and 896, 362 and 897, 363 and 898, 364 and 899, 365 and 900, 366 and 901, 367 and 902, 368 and 903, 369 and 904, 370 and 905, 371 and 906, 372 and 907, 373 and 908, 374 and 909, 375 and 910, 376 and 911, 377 and 912, 378 and 913, 379 and 914, 380 and 915, 381 and 916, 382 and 917, 383 and 918, 384 and 919, 385 and 920, 386 and 921, 387 and 922, 388 and 923, 389 and 924, 390 and 925, 391 and 926, 392 and 927, 393 and 928, 394 and 929, 395 and 930, 396 and 931, 397 and 932, 398 and 933, 399 and 934, 400 and 935, 401 and 936, 402 and 937, 403 and 938, 404 and 939, 405 and 940, 406 and 941, 407 and 942, 408 and 943, 409 and 944, 410 and 945, 411 and 946, 412 and 947, 413 and 948, 414 and 949, 415 and 950, 416 and 951, 417 and 952, 418 and 953, 419 and 954, 420 and 955, 421 and 956, 422 and 957, 423 and 958, 424 and 959, 425 and 960, 426 and 961, 427 and 962, 428 and 963, 429 and 964, 430 and 965, 431 and 966, 432 and 967, 433 and 968, 434 and 969, 435 and 970, 436 and 971, 437 and 972, 438 and 973, 439 and 974, 440 and 975, 441 and 976, 442 and 977, 443 and 978, 444 and 979, 445 and 980, 446 and 981, 447 and 982, 448 and 983, 449 and 984, 450 and 985, 451 and 986, 452 and 987, 453 and 988, 454 and 989, 455 and 990, 456 and 991, 457 and 992, 458 and 993, 459 and 994, 460 and 995, 461 and 996, 462 and 997, 463 and 998, 464 and 999, 465 and 1000, 466 and 1001, 467 and 1002, 468 and 1003, 469 and 1004, 470 and 1005, 471 and 1006, 472 and 1007, 473 and 1008, 474 and 1009, 475 and 1010, Attorney Docket No.: 87JA-396165-WO 476 and 1011, 477 and 1012, 478 and 1013, 479 and 1014, 480 and 1015, 481 and 1016, 482 and 1017, 483 and 1018, 484 and 1019, 485 and 1020, 486 and 1021, 487 and 1022, 488 and 1023, 489 and 1024, 490 and 1025, 491 and 1026, 492 and 1027, 493 and 1028, 494 and 1029, 495 and 1030, 496 and 1031, 497 and 1032, 498 and 1033, 499 and 1034, 500 and 1035, 501 and 1036, 502 and 1037, 503 and 1038, 504 and 1039, 505 and 1040, 506 and 1041, 507 and 1042, 508 and 1043, 509 and 1044, 510 and 1045, 511 and 1046, 512 and 1047, 513 and 1048, 514 and 1049, 515 and 1050, 516 and 1051, 517 and 1052, 518 and 1053, 519 and 1054, 520 and 1055, 521 and 1056, 522 and 1057, 523 and 1058, 524 and 1059, 525 and 1060, 526 and 1061, 527 and 1062, 528 and 1063, 529 and 1064, 530 and 1065, 531 and 1066, 532 and 1067, 533 and 1068, 534 and 1069, 535 and 1070, or 536 and 1071. The siRNA can be blunt ended at one or both ends. In some embodiments, the siRNA is blunt ended on the end defined by the 5'-terminus of the antisense strand and the 3'-terminus of the sense strand, or the end defined by the 3'-terminus of the antisense strand and the 5'-terminus of the sense strand. In other embodiments, at least one of the two strands has an overhang of at least one nucleotide at the 5'- terminus. At least one of the strands can also optionally have an overhang of at least one nucleotide at the 3'-terminus. The overhang can consist of from about 1 to about 5 consecutive nucleotides. A nucleotide of the overhang can be a modified or unmodified ribonucleotide or deoxyribonucleotide. The length of each strand of the siRNA duplexes disclosed herein can be from about 18 to about 40 ribonucleotides, or 19, 21, or 23 ribonucleotides. Further, the length of each strand can independently have a length selected from the group consisting of about 15 to about 40 bases, 18 to 23 bases, or 19, 21, or 23 bases. The complementarity between said antisense strand and the target nucleic acid, e.g., an mRNA transcribed from the human HMGCR gene in a cell of a subject, can be perfect. In some embodiments, the strands are substantially complementary, i.e. having one, two or up to three mismatches between said antisense strand and the target nucleic acid. Modified siRNAs In general, the majority of nucleotides of each strand of an siRNA duplex molecule are ribonucleotides, but as described in detail herein, one or both strands can also include one or more non- ribonucleotides, e.g., a deoxyribonucleotide or a modified nucleotide. In addition, as used in this specification, a “modified siRNA” may include ribonucleotides with chemical modifications; a modified siRNA may include substantial modifications at multiple nucleotides. As used herein, the term “modified nucleotide” refers to a nucleotide having, independently, a modified sugar moiety, a modified internucleotide linkage, or modified nucleobase, or any combination thereof. Attorney Docket No.: 87JA-396165-WO Thus, the term modified nucleotide encompasses substitutions, additions, or removal of, e.g., a functional group or atom, to internucleoside linkages, sugar moieties, or nucleobases. The modifications suitable for use in the compositions disclosed herein include all types of modifications disclosed herein or known in the art. In certain embodiments, inclusion of a deoxy-nucleotide within an siRNA can be considered to constitute a modified nucleotide. Any such modifications, as used in a siRNA type molecule, are encompassed by “modified siRNA” or “RNA duplex” for the purposes of this specification and claims. Modifications to siRNA duplexes, including for example 2ʹ-fluoro modifications and 2ʹ-O-methyl modifications can increase potency of the siRNA duplex for mRNA knockdown. Further, including 2ʹ- fluoro modifications while also minimizing 2ʹ-fluoro content can be advantageous for several reasons, including for chemistry manufacturing and control (CMC), cost, and safety concerns in the context of a therapeutic composition. Presence of a 5'-phosphate is believed to be helpful for efficient RISC loading of the antisense strand by anchoring it to the mid-domain of the Argonaute2 (Ago2) protein (a core RISC component that has both mRNA inhibition and degradation functions), thereby improving the siRNA potency via promoting Ago2 loading and enhancing metabolic stability. In some embodiments, the 5'-phosphate can be substituted with metabolically stable phosphate mimics, such as 5'-vinylphosphonate or 5′- methylenephosphonate, or substituted analogs thereof. In some embodiments, the siRNA compositions disclosed herein include one or more modified nucleotides. In various embodiments the siRNA comprises an RNA duplex comprising an antisense strand and a sense strand, whereby the antisense strand comprises a ribonucleotide sequence at least partially complementary to about 18 to about 40 consecutive nucleotides of a target nucleic acid, for example, an mRNA transcribed from the human HMGCR gene in a cell of a subject, and the sense strand comprises ribonucleotide sequence at least partially complementary to the antisense strand and wherein said antisense strand and / or said sense strand comprises a plurality of groups of modified ribonucleotides having a modification at the 2'-position of the sugar moiety whereby within each strand each group of modified ribonucleotides is flanked on one or both sides by a group of flanking ribonucleotides whereby each ribonucleotide forming the group of flanking ribonucleotides is selected from an unmodified ribonucleotide or a ribonucleotide having a modification different from the modification of the groups of modified ribonucleotides. In some embodiments, the group of modified ribonucleotides and / or the group of flanking ribonucleotides comprise a number of ribonucleotides selected from the group consisting of an integer from 1 to 12. Accordingly, the group thus comprises one nucleotide, two nucleotides, three nucleotides, four nucleotides, five nucleotides, six nucleotides, seven nucleotides, eight nucleotides, nine nucleotides, ten nucleotides, eleven nucleotides or twelve nucleotides. Attorney Docket No.: 87JA-396165-WO The groups of modified nucleotides and flanking nucleotides can be organized in a pattern on at least one of the strands, sense, antisense, or both strands. In some embodiments the antisense and sense strands comprise a pattern of modified nucleotides. In another embodiment, only one strand comprises a pattern of modified nucleotides. In various embodiments the pattern of modified nucleotides of said antisense strand is identical relative to the pattern of modified nucleotides of the sense strand. In other embodiments the pattern of modified nucleotides of said antisense strand is shifted by one or more nucleotides relative to the pattern of modified nucleotides of the sense strand. In some embodiments the middle ribonucleotide in the antisense strand is an unmodified nucleotide. For example, in a 19-oligomer antisense strand, ribonucleotide number 10 is unmodified; in a 21-oligomer antisense strand, ribonucleotide number 11 is unmodified; and in a 23-oligomer antisense strand, ribonucleotide number 12 is unmodified. The modifications or pattern of modification, if any, of the siRNA duplexes can be designed to allow for this. As described in further detail in Example 3 below, Tables 6 and 7 provide examples of possible modification patterns of sense strands and antisense strands, respectively. In one embodiment, provided is an siRNA duplex that includes a sense sequence and an antisense sequence, wherein the sense sequence and the antisense sequence are at least partially complementary to each other. In some embodiments, the sense sequence includes modified ribonucleotides as represented by one of the following formulae in a 5ʹ to 3ʹ orientation: X1-Y2-X3-Y4-X5-Y6-X7-Y8-X9-X10-X11-Y12-X13-Y14-X15-Y16-X17-Y18-X19-Y20-X21; or Y1-Y2-Y3-Y4-Y5-Y6-X7-Y8-X9-X10-X11-Y12-Y13-Y14-Y15-X16-X17-Y18-Y19-Y20-Y21; or Y1-Y2-Y3-Y4-Y5-Y6-X7-Y8-X9-X10-X11-Y12-Y13-Y14-Y15-Y16-Y17-Y18-Y19-Y20-Y21; or Y1-Y2-Y3-Y4-X5-Y6-Y7-Y8-X9-X10-X11-Y12-Y13-Y14-Y15-Y16-Y17-Y18-X19-Y20-Y21. In some embodiments, the antisense sequence includes modified ribonucleotides represented by one of the following formulae in a 5ʹ to 3ʹ orientation: Y1-X2-Y3-X4-Y5-X6-Y7-X8-Y9-X10-Y11-Y12-Y13-X14-Y15-X16-Y17-X18-Y19-X20-Y21-Y22-Y23; or Z1-X2-Y3-X4-Y5-X6-Y7-X8-Y9-X10-Y11-Y12-Y13-X14-Y15-X16-Y17-X18-Y19-X20-Y21-Y22-Y23; or Z1-X2-Y3-Y4-Y5-X6-Y7-X8-X9-Y10-Y11-Y12-Y13-X14-Y15-X16-Y17-Y18-Y19-Y20-Y21-Y22-Y23; or Z1-X2-Y3-Y4-Y5-X6-Y7-Y8-Y9-Y10-Y11-Y12-Y13-X14-Y15-X16-Y17-Y18-Y19-Y20-Y21-Y22-Y23; or Z1-X2-Y3-Y4-Y5-Y6-Y7-Y8-Y9-Y10-Y11-Y12-Y13-X14-Y15-Y16-Y17-Y18-Y19-Y20-Y21-Y22-Y23. In this formulae, each X represents a ribonucleotide having a 2ʹ-fluoro modification; Y represents a ribonucleotide having a 2ʹ-O-methyl modification, and Z represents a 5ʹ-vinylphosphonate-2ʹ-O-methyl modified uracil. In some embodiments, the siRNA duplex is capable of inhibiting the expression of a human gene, such as the HMGCR gene. Attorney Docket No.: 87JA-396165-WO Specific sense strand-antisense strand combinations of modifications are also provided. In one embodiment, the sense sequence includes modified ribonucleotides represented by: X1-Y2-X3-Y4-X5-Y6- X7-Y8-X9-X10-X11-Y12-X13-Y14-X15-Y16-X17-Y18-X19-Y20-X21; and the antisense sequence includes modified ribonucleotides represented by: Y1-X2-Y3-X4-Y5-X6-Y7-X8-Y9-X10-Y11-Y12-Y13-X14-Y15-X16- Y17-X18-Y19-X20-Y21-Y22-Y23. In one embodiment, the sense sequence includes modified ribonucleotides represented by: X1-Y2- X3-Y4-X5-Y6-X7-Y8-X9-X10-X11-Y12-X13-Y14-X15-Y16-X17-Y18-X19-Y20-X21; and the antisense sequence includes modified ribonucleotides represented by: Z1-X2-Y3-X4-Y5-X6-Y7-X8-Y9-X10-Y11-Y12-Y13-X14- Y15-X16-Y17-X18-Y19-X20-Y21-Y22-Y23. In one embodiment, the sense sequence includes modified ribonucleotides represented by: Y1-Y2- Y3-Y4-Y5-Y6-X7-Y8-X9-X10-X11-Y12-Y13-Y14-Y15-X16-X17-Y18-Y19-Y20-Y21; and the antisense sequence includes modified ribonucleotides represented by: Z1-X2-Y3-Y4-Y5-X6-Y7-X8-X9-Y10-Y11-Y12-Y13-X14- Y15-X16-Y17-Y18-Y19-Y20-Y21-Y22-Y23. In one embodiment, the sense sequence includes modified ribonucleotides represented by:Y1-Y2- Y3-Y4-X5-Y6-Y7-Y8-X9-X10-X11-Y12-Y13-Y14-Y15-Y16-Y17-Y18-X19-Y20-Y21; and the antisense sequence includes modified ribonucleotides represented by: Z1-X2-Y3-Y4-Y5-X6-Y7-X8-X9-Y10-Y11-Y12-Y13-X14- Y15-X16-Y17-Y18-Y19-Y20-Y21-Y22-Y23. In one embodiment, the sense sequence includes modified ribonucleotides represented by: Y1-Y2- Y3-Y4-Y5-Y6-X7-Y8-X9-X10-X11-Y12-Y13-Y14-Y15-Y16-Y17-Y18-Y19-Y20-Y21; and the antisense sequence includes modified ribonucleotides represented by: Z1-X2-Y3-Y4-Y5-X6-Y7-X8-X9-Y10-Y11-Y12-Y13-X14- Y15-X16-Y17-Y18-Y19-Y20-Y21-Y22-Y23. In one embodiment, the sense sequence includes modified ribonucleotides represented by: Y1-Y2- Y3-Y4-Y5-Y6-X7-Y8-X9-X10-X11-Y12-Y13-Y14-Y15-Y16-Y17-Y18-Y19-Y20-Y21; and the antisense sequence includes modified ribonucleotides represented by: Z1-X2-Y3-Y4-Y5-X6-Y7-Y8-Y9-Y10-Y11-Y12-Y13-X14- Y15-X16-Y17-Y18-Y19-Y20-Y21-Y22-Y23. In one embodiment, the sense sequence includes modified ribonucleotides represented by:Y1-Y2- Y3-Y4-X5-Y6-Y7-Y8-X9-X10-X11-Y12-Y13-Y14-Y15-Y16-Y17-Y18-X19-Y20-Y21; and the antisense sequence includes modified ribonucleotides represented by: Z1-X2-Y3-Y4-Y5-Y6-Y7-Y8-Y9-Y10-Y11-Y12-Y13-X14- Y15-Y16-Y17-Y18-Y19-Y20-Y21-Y22-Y23. Sense strands and antisense strands of siRNA duplexes comprising modified nucleotides are provided in Table 2 below. As used in the polyribonucleotide sequences in Table 2, a capital letter followed by an “f” indicates that the nucleotide represented by the capital letter includes a 2ʹ-fluoro modification. For example, “-Gf-” indicates a guanine with a 2ʹ-fluoro modification. A lowercase letter indicates that the nucleotide represented by the lowercase letter includes a 2ʹ-O-methyl modification. For Attorney Docket No.: 87JA-396165-WO example, an “a” indicates an adenine with a 2ʹ-O-methyl modification. A lowercase “s” indicates a phosphorothioate linkage between the nucleotides immediately upstream and downstream of the “s,” wherein a sulfur atom is substituted for a non-bridging oxygen in the phosphate backbone of the polynucleotide. For example, “-asusu-” indicates an adenine with a 2ʹ-O-methyl modification, a uracil with a 2ʹ-O-methyl modification, and a second uracil with a 2ʹ-O-methyl modification, with a phosphorothioate linkage between the adenine and the first uracil, and a phosphorothioate linkage between the first uracil and the second uracil. The lowercase letters “vinu” indicate an uracil with a 5'- vinylphosphonate modification and a 2ʹ-O-methyl modification (5ʹ-vinylphosphonate-2ʹ-O-methyl). In some embodiments, the sense sequence and / or the antisense sequence comprises one or more phosphorothioate linkages. In some embodiments, the sense sequence comprises at least two phosphorothioate linkages at the 5ʹ terminus and at least two phosphorothioate linkages at the 3ʹ terminus and the antisense sequence comprises at least two phosphorothioate linkages at the 5ʹ terminus and at least two phosphorothioate linkages at the 3ʹ terminus. In some embodiments, the sense sequence comprises two phosphorothioate linkages at the 5ʹ terminus and two phosphorothioate linkages at the 3ʹ terminus and no phosphorothioate linkages at the remaining positions; and the antisense sequence comprises two phosphorothioate linkages at the 5ʹ terminus and two phosphorothioate linkages at the 3ʹ terminus and no phosphorothioate linkages at the remaining positions. Table 2 – Sense and Antisense Strand Sequences for Modified siRNA Duplexes Attorney Docket No.: 87JA-396165-WO Attorney Docket No.: 87JA-396165-WO Attorney Docket No.: 87JA-396165-WO Attorney Docket No.: 87JA-396165-WO Attorney Docket No.: 87JA-396165-WO Attorney Docket No.: 87JA-396165-WO Attorney Docket No.: 87JA-396165-WO Attorney Docket No.: 87JA-396165-WO Attorney Docket No.: 87JA-396165-WO Attorney Docket No.: 87JA-396165-WO Attorney Docket No.: 87JA-396165-WO Attorney Docket No.: 87JA-396165-WO Attorney Docket No.: 87JA-396165-WO Attorney Docket No.: 87JA-396165-WO Attorney Docket No.: 87JA-396165-WO Attorney Docket No.: 87JA-396165-WO Attorney Docket No.: 87JA-396165-WO Attorney Docket No.: 87JA-396165-WO Attorney Docket No.: 87JA-396165-WO Attorney Docket No.: 87JA-396165-WO In some embodiments, the sense sequence and the antisense sequence comprise, respectively, the nucleic acid sequences of SEQ ID NO: 1072 and 1607, 1073 and 1608, 1074 and 1609, 1075 and 1610, 1076 and 1611, 1077 and 1612, 1078 and 1613, 1079 and 1614, 1080 and 1615, 1081 and 1616, 1082 and 1617, 1083 and 1618, 1084 and 1619, 1085 and 1620, 1086 and 1621, 1087 and 1622, 1088 and 1623, 1089 and 1624, 1090 and 1625, 1091 and 1626, 1092 and 1627, 1093 and 1628, 1094 and 1629, 1095 and 1630, 1096 and 1631, 1097 and 1632, 1098 and 1633, 1099 and 1634, 1100 and 1635, 1101 and 1636, 1102 and 1637, 1103 and 1638, 1104 and 1639, 1105 and 1640, 1106 and 1641, 1107 and 1642, 1108 and 1643, 1109 and 1644, 1110 and 1645, 1111 and 1646, 1112 and 1647, 1113 and 1648, 1114 and 1649, 1115 and 1650, 1116 and 1651, 1117 and 1652, 1118 and 1653, 1119 and 1654, 1120 and 1655, 1121 and 1656, 1122 and 1657, 1123 and 1658, 1124 and 1659, 1125 and 1660, 1126 and 1661, 1127 and 1662, 1128 and 1663, 1129 and 1664, 1130 and 1665, 1131 and 1666, 1132 and 1667, 1133 and 1668, 1134 and 1669, 1135 and 1670, 1136 and 1671, 1137 and 1672, 1138 and 1673, 1139 and 1674, 1140 and 1675, 1141 and 1676, 1142 and 1677, 1143 and 1678, 1144 and 1679, 1145 and 1680, 1146 and 1681, 1147 and 1682, 1148 and 1683, 1149 and 1684, 1150 and 1685, 1151 and 1686, 1152 and 1687, 1153 and 1688, 1154 and 1689, 1155 and 1690, 1156 and 1691, 1157 and 1692, 1158 and 1693, 1159 and 1694, 1160 and 1695, 1161 and 1696, 1162 and 1697, 1163 and 1698, 1164 and 1699, 1165 and 1700, 1166 and 1701, 1167 and 1702, 1168 and 1703, 1169 and 1704, 1170 and 1705, 1171 and 1706, 1172 and 1707, 1173 and 1708, 1174 and 1709, 1175 and 1710, 1176 and 1711, 1177 and 1712, 1178 and 1713, 1179 and 1714, 1180 and 1715, 1181 and 1716, 1182 and 1717, 1183 and 1718, 1184 and 1719, 1185 and 1720, 1186 and 1721, 1187 and 1722, 1188 and 1723, 1189 and 1724, 1190 and 1725, 1191 and 1726, 1192 and 1727, 1193 and 1728, 1194 and 1729, 1195 and 1730, 1196 and 1731, 1197 and 1732, 1198 and 1733, 1199 and 1734, 1200 and 1735, 1201 and 1736, 1202 and 1737, 1203 and 1738, 1204 and 1739, 1205 and 1740, 1206 and 1741, 1207 and 1742, 1208 and 1743, 1209 and 1744, 1210 and 1745, 1211 and 1746, 1212 and 1747, 1213 and 1748, 1214 and 1749, 1215 and 1750, 1216 and 1751, 1217 and 1752, 1218 and 1753, 1219 and 1754, 1220 and 1755, 1221 and 1756, 1222 and 1757, 1223 and 1758, 1224 and 1759, 1225 and 1760, 1226 and 1761, 1227 and 1762, 1228 and 1763, 1229 and 1764, 1230 and 1765, 1231 and 1766, 1232 and 1767, 1233 and 1768, 1234 and 1769, 1235 and 1770, 1236 and 1771, 1237 and 1772, 1238 and 1773, 1239 and 1774, 1240 and 1775, 1241 and 1776, 1242 and 1777, 1243 and 1778, 1244 and 1779, 1245 and 1780, 1246 and 1781, 1247 and 1782, 1248 and 1783, 1249 and 1784, 1250 and 1785, 1251 and Attorney Docket No.: 87JA-396165-WO 1786, 1252 and 1787, 1253 and 1788, 1254 and 1789, 1255 and 1790, 1256 and 1791, 1257 and 1792, 1258 and 1793, 1259 and 1794, 1260 and 1795, 1261 and 1796, 1262 and 1797, 1263 and 1798, 1264 and 1799, 1265 and 1800, 1266 and 1801, 1267 and 1802, 1268 and 1803, 1269 and 1804, 1270 and 1805, 1271 and 1806, 1272 and 1807, 1273 and 1808, 1274 and 1809, 1275 and 1810, 1276 and 1811, 1277 and 1812, 1278 and 1813, 1279 and 1814, 1280 and 1815, 1281 and 1816, 1282 and 1817, 1283 and 1818, 1284 and 1819, 1285 and 1820, 1286 and 1821, 1287 and 1822, 1288 and 1823, 1289 and 1824, 1290 and 1825, 1291 and 1826, 1292 and 1827, 1293 and 1828, 1294 and 1829, 1295 and 1830, 1296 and 1831, 1297 and 1832, 1298 and 1833, 1299 and 1834, 1300 and 1835, 1301 and 1836, 1302 and 1837, 1303 and 1838, 1304 and 1839, 1305 and 1840, 1306 and 1841, 1307 and 1842, 1308 and 1843, 1309 and 1844, 1310 and 1845, 1311 and 1846, 1312 and 1847, 1313 and 1848, 1314 and 1849, 1315 and 1850, 1316 and 1851, 1317 and 1852, 1318 and 1853, 1319 and 1854, 1320 and 1855, 1321 and 1856, 1322 and 1857, 1323 and 1858, 1324 and 1859, 1325 and 1860, 1326 and 1861, 1327 and 1862, 1328 and 1863, 1329 and 1864, 1330 and 1865, 1331 and 1866, 1332 and 1867, 1333 and 1868, 1334 and 1869, 1335 and 1870, 1336 and 1871, 1337 and 1872, 1338 and 1873, 1339 and 1874, 1340 and 1875, 1341 and 1876, 1342 and 1877, 1343 and 1878, 1344 and 1879, 1345 and 1880, 1346 and 1881, 1347 and 1882, 1348 and 1883, 1349 and 1884, 1350 and 1885, 1351 and 1886, 1352 and 1887, 1353 and 1888, 1354 and 1889, 1355 and 1890, 1356 and 1891, 1357 and 1892, 1358 and 1893, 1359 and 1894, 1360 and 1895, 1361 and 1896, 1362 and 1897, 1363 and 1898, 1364 and 1899, 1365 and 1900, 1366 and 1901, 1367 and 1902, 1368 and 1903, 1369 and 1904, 1370 and 1905, 1371 and 1906, 1372 and 1907, 1373 and 1908, 1374 and 1909, 1375 and 1910, 1376 and 1911, 1377 and 1912, 1378 and 1913, 1379 and 1914, 1380 and 1915, 1381 and 1916, 1382 and 1917, 1383 and 1918, 1384 and 1919, 1385 and 1920, 1386 and 1921, 1387 and 1922, 1388 and 1923, 1389 and 1924, 1390 and 1925, 1391 and 1926, 1392 and 1927, 1393 and 1928, 1394 and 1929, 1395 and 1930, 1396 and 1931, 1397 and 1932, 1398 and 1933, 1399 and 1934, 1400 and 1935, 1401 and 1936, 1402 and 1937, 1403 and 1938, 1404 and 1939, 1405 and 1940, 1406 and 1941, 1407 and 1942, 1408 and 1943, 1409 and 1944, 1410 and 1945, 1411 and 1946, 1412 and 1947, 1413 and 1948, 1414 and 1949, 1415 and 1950, 1416 and 1951, 1417 and 1952, 1418 and 1953, 1419 and 1954, 1420 and 1955, 1421 and 1956, 1422 and 1957, 1423 and 1958, 1424 and 1959, 1425 and 1960, 1426 and 1961, 1427 and 1962, 1428 and 1963, 1429 and 1964, 1430 and 1965, 1431 and 1966, 1432 and 1967, 1433 and 1968, 1434 and 1969, 1435 and 1970, 1436 and 1971, 1437 and 1972, 1438 and 1973, 1439 and 1974, 1440 and 1975, 1441 and 1976, 1442 and 1977, 1443 and 1978, 1444 and 1979, 1445 and 1980, 1446 and 1981, 1447 and 1982, 1448 and 1983, 1449 and 1984, 1450 and 1985, 1451 and 1986, 1452 and 1987, 1453 and 1988, 1454 and 1989, 1455 and 1990, 1456 and 1991, 1457 and 1992, 1458 and 1993, 1459 and 1994, 1460 and 1995, 1461 and 1996, 1462 and 1997, 1463 and 1998, 1464 and 1999, 1465 and 2000, 1466 and 2001, 1467 and 2002, 1468 and 2003, 1469 and 2004, 1470 and 2005, 1471 and 2006, 1472 and Attorney Docket No.: 87JA-396165-WO 2007, 1473 and 2008, 1474 and 2009, 1475 and 2010, 1476 and 2011, 1477 and 2012, 1478 and 2013, 1479 and 2014, 1480 and 2015, 1481 and 2016, 1482 and 2017, 1483 and 2018, 1484 and 2019, 1485 and 2020, 1486 and 2021, 1487 and 2022, 1488 and 2023, 1489 and 2024, 1490 and 2025, 1491 and 2026, 1492 and 2027, 1493 and 2028, 1494 and 2029, 1495 and 2030, 1496 and 2031, 1497 and 2032, 1498 and 2033, 1499 and 2034, 1500 and 2035, 1501 and 2036, 1502 and 2037, 1503 and 2038, 1504 and 2039, 1505 and 2040, 1506 and 2041, 1507 and 2042, 1508 and 2043, 1509 and 2044, 1510 and 2045, 1511 and 2046, 1512 and 2047, 1513 and 2048, 1514 and 2049, 1515 and 2050, 1516 and 2051, 1517 and 2052, 1518 and 2053, 1519 and 2054, 1520 and 2055, 1521 and 2056, 1522 and 2057, 1523 and 2058, 1524 and 2059, 1525 and 2060, 1526 and 2061, 1527 and 2062, 1528 and 2063, 1529 and 2064, 1530 and 2065, 1531 and 2066, 1532 and 2067, 1533 and 2068, 1534 and 2069, 1535 and 2070, 1536 and 2071, 1537 and 2072, 1538 and 2073, 1539 and 2074, 1540 and 2075, 1541 and 2076, 1542 and 2077, 1543 and 2078, 1544 and 2079, 1545 and 2080, 1546 and 2081, 1547 and 2082, 1548 and 2083, 1549 and 2084, 1550 and 2085, 1551 and 2086, 1552 and 2087, 1553 and 2088, 1554 and 2089, 1555 and 2090, 1556 and 2091, 1557 and 2092, 1558 and 2093, 1559 and 2094, 1560 and 2095, 1561 and 2096, 1562 and 2097, 1563 and 2098, 1564 and 2099, 1565 and 2100, 1566 and 2101, 1567 and 2102, 1568 and 2103, 1569 and 2104, 1570 and 2105, 1571 and 2106, 1572 and 2107, 1573 and 2108, 1574 and 2109, 1575 and 2110, 1576 and 2111, 1577 and 2112, 1578 and 2113, 1579 and 2114, 1580 and 2115, 1581 and 2116, 1582 and 2117, 1583 and 2118, 1584 and 2119, 1585 and 2120, 1586 and 2121, 1587 and 2122, 1588 and 2123, 1589 and 2124, 1590 and 2125, 1591 and 2126, 1592 and 2127, 1593 and 2128, 1594 and 2129, 1595 and 2130, 1596 and 2131, 1597 and 2132, 1598 and 2133, 1599 and 2134, 1600 and 2135, 1601 and 2136, 1602 and 2137, 1603 and 2138, 1604 and 2139, 1605 and 2140, or 1606 and 2141. In some embodiments, the sense sequence and the antisense sequence comprise, respectively, the nucleic acid sequences of SEQ ID NO:199 and 734 (XD-60843). In some embodiments, the sense sequence and the antisense sequence comprise, respectively, the nucleic acid sequences of SEQ ID NO:1269 and 1804 (XD-60843 with modifications). In some embodiments, the sense sequence and the antisense sequence comprise, respectively, the nucleic acid sequences of SEQ ID NO:2142 and 2143 (XD-60843 with modifications). The siRNA compositions disclosed herein can include modified RNA backbones comprising, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3'-5' linkages, 2'-5'-linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5' to Attorney Docket No.: 87JA-396165-WO 5'-3' or 2'-5' to 5'-2'. Various salts, mixed salts and free acid forms are also included in the disclosure. In some embodiments of the compositions and methods disclosed herein, the siRNA compositions are in a free acid form. In other embodiments, the siRNA compositions are in a salt form. In some embodiments, the siRNA compositions are in a sodium salt form. Modified RNAs of the siRNA compositions disclosed herein can also include one or more substituted sugar moieties. The siRNAs of the siRNA duplexes disclosed herein can include one of the following at the 2'-position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O- alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl can be substituted or unsubstituted C1 to C10 alkyl or C2to C10alkenyl and alkynyl. Additional modifications include O[(CH2)nO]mCH3, O(CH2)-nOCH3, O(CH2)nNH2, O(CH2)nCH3, O(CH2)nONH2, and O(CH2)nON[(CH2)nCH3)2, where n and m are from 1 to about 10. In other embodiments, RNAs of the siRNA duplexes disclosed herein include one of the following at the 2' position: C1 to C10 lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an siRNA duplex composition, or a group for improving the pharmacodynamic properties of an siRNA duplex composition, and other substituents having similar properties. As used herein, a dash (“-”) that is not between two letters or symbols is used to indicate a point of attachment for a substituent. For example, -C(O)NH2is attached through the carbon atom. A dash at the front or end of a chemical group is a matter of convenience; chemical groups may be depicted with or without one or more dashes without losing their ordinary meaning. A wavy line or a dashed line drawn through a line in a structure indicates a specified point of attachment of a group. Unless chemically or structurally required, no directionality or stereochemistry is indicated or implied by the order in which a chemical group is written or named. The prefix “Cu-v” indicates that the following group has from u to v carbon atoms. For example, “C1-6alkyl” indicates that the alkyl group has from 1 to 6 carbon atoms. “Alkyl” refers to an unbranched or branched saturated hydrocarbon chain. As used herein, alkyl has 1 to 20 carbon atoms (i.e., C1-20alkyl), 1 to 12 carbon atoms (i.e., C1-12alkyl), 1 to 8 carbon atoms (i.e., C1-8 alkyl), 1 to 6 carbon atoms (i.e., C1-6 alkyl) or 1 to 4 carbon atoms (i.e., C1-4 alkyl). Examples of alkyl groups include, e.g., methyl, ethyl, propyl, isopropyl, n-butyl, sec-butyl, iso-butyl, tert-butyl, pentyl, 2-pentyl, isopentyl, neopentyl, hexyl, 2-hexyl, 3-hexyl, and 3-methylpentyl. When an alkyl residue having a specific number of carbons is named by chemical name or identified by molecular formula, all positional isomers having that number of carbons may be encompassed; thus, for example, “butyl” includes n-butyl (i.e., -(CH2)3CH3), sec-butyl (i.e., -CH(CH3)CH2CH3), isobutyl (i.e., -CH2CH(CH3)2), Attorney Docket No.: 87JA-396165-WO and tert-butyl (i.e., -C(CH3)3); and “propyl” includes n-propyl (i.e., -(CH2)2CH3) and isopropyl (i.e., - CH(CH3)2). Certain commonly used alternative chemical names may be used. For example, a divalent group such as a divalent “alkyl” group, a divalent “aryl” group, a divalent heteroaryl group, etc., may also be referred to as an “alkylene” group or an “alkylenyl” group (for example, methylenyl, ethylenyl, and propylenyl), an “arylene” group or an “arylenyl” group (for example, phenylenyl or napthylenyl, or quinolinyl for heteroarylene), respectively. Also, unless indicated explicitly otherwise, where combinations of groups are referred to herein as one moiety, e.g., arylalkyl or aralkyl, the last-mentioned group contains the atom by which the moiety is attached to the rest of the molecule. “Alkenyl” refers to an alkyl group containing at least one (e.g., 1-3, or 1) carbon-carbon double bond and having from 2 to 20 carbon atoms (i.e., C2-20alkenyl), 2 to 12 carbon atoms (i.e., C2-12alkenyl), 2 to 8 carbon atoms (i.e., C2-8 alkenyl), 2 to 6 carbon atoms (i.e., C2-6 alkenyl), or 2 to 4 carbon atoms (i.e., C2-4alkenyl). Examples of alkenyl groups include, e.g., ethenyl, propenyl, butadienyl (including 1,2- butadienyl and 1,3-butadienyl). “Alkynyl” refers to an alkyl group containing at least one (e.g., 1-3, or 1) carbon-carbon triple bond and having from 2 to 20 carbon atoms (i.e., C2-20 alkynyl), 2 to 12 carbon atoms (i.e., C2-12 alkynyl), 2 to 8 carbon atoms (i.e., C2-8alkynyl), 2 to 6 carbon atoms (i.e., C2-6alkynyl), or 2 to 4 carbon atoms (i.e., C2-4 alkynyl). The term “alkynyl” also includes those groups having one triple bond and one double bond. “Alkoxy” refers to the group “alkyl-O-”. Examples of alkoxy groups include, e.g., methoxy, ethoxy, n-propoxy, iso-propoxy, n-butoxy, tert-butoxy, sec-butoxy, n-pentoxy, n-hexoxy, and 1,2- dimethylbutoxy. “Alkoxyalkyl” refers to the group “alkyl-O-alkyl”. “Alkylthio” refers to the group “alkyl-S-”. “Alkylsulfinyl” refers to the group “alkyl-S(O)-”. “Alkylsulfonyl” refers to the group “alkyl-S(O)2-”. “Alkylsulfonylalkyl” refers to -alkyl-S(O)2-alkyl. “Acyl” refers to a group -C(O)Ry, wherein Ryis hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl; each of which may be optionally substituted, as defined herein. Examples of acyl include, e.g., formyl, acetyl, cyclohexylcarbonyl, cyclohexylmethyl-carbonyl, and benzoyl. “Amido” refers to both a “C-amido” group which refers to the group -C(O)NRyRzand an “N- amido” group which refers to the group -NRyC(O)Rz, wherein Ryand Rzare independently hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl; each of which may be optionally substituted, as defined herein, or Ryand Rzare taken together to form a cycloalkyl or heterocyclyl; each of which may be optionally substituted, as defined herein. Attorney Docket No.: 87JA-396165-WO “Amino” refers to the group -NRyRzwherein Ryand Rzare independently hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl; each of which may be optionally substituted, as defined herein. “Amidino” refers to -C(NRy)(NRz2), wherein Ryand Rzare independently hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl; each of which may be optionally substituted, as defined herein. “Aryl” refers to an aromatic carbocyclic group having a single ring (e.g., monocyclic) or multiple rings (e.g., bicyclic or tricyclic) including fused systems. As used herein, aryl has 6 to 20 ring carbon atoms (i.e., C6-20 aryl), 6 to 12 carbon ring atoms (i.e., C6-12 aryl), or 6 to 10 carbon ring atoms (i.e., C6-10aryl). Examples of aryl groups include, e.g., phenyl, naphthyl, fluorenyl, and anthryl. Aryl, however, does not encompass or overlap in any way with heteroaryl defined below. If one or more aryl groups are fused with a heteroaryl, the resulting ring system is heteroaryl regardless of point of attachment. If one or more aryl groups are fused with a heterocyclyl, the resulting ring system is heterocyclyl regardless of point of attachment. If one or more aryl groups are fused with a cycloalkyl, the resulting ring system is cycloalkyl regardless of point of attachment. “Carbamoyl” refers to both an “O-carbamoyl” group which refers to the group -O-C(O)NRyRzand an “N-carbamoyl” group which refers to the group -NRyC(O)ORz, wherein Ryand Rzare independently hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl; each of which may be optionally substituted, as defined herein. “Carboxyl ester” or “ester” refer to both -OC(O)Rxand -C(O)ORx, wherein Rxis alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl; each of which may be optionally substituted, as defined herein. “Cyanoalkyl” refers to refers to an alkyl group as defined above, wherein one or more (e.g., 1 or 2) hydrogen atoms are replaced by a cyano (-CN) group. “Cycloalkyl” refers to a saturated or partially unsaturated cyclic alkyl group having a single ring or multiple rings including fused, bridged, and spiro ring systems. The term “cycloalkyl” includes cycloalkenyl groups (i.e., the cyclic group having at least one double bond) and carbocyclic fused ring systems having at least one sp3carbon atom (i.e., at least one non-aromatic ring). As used herein, cycloalkyl has from 3 to 20 ring carbon atoms (i.e., C3-20cycloalkyl), 3 to 14 ring carbon atoms (i.e., C3-12cycloalkyl), 3 to 12 ring carbon atoms (i.e., C3-12 cycloalkyl), 3 to 10 ring carbon atoms (i.e., C3-10 cycloalkyl), 3 to 8 ring carbon atoms (i.e., C3-8cycloalkyl), or 3 to 6 ring carbon atoms (i.e., C3-6cycloalkyl). Monocyclic groups include, for example, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl. Polycyclic groups include, for example, bicyclo[2.2.1]heptanyl, bicyclo[2.2.2]octanyl, adamantyl, norbornyl, decalinyl, 7,7-dimethyl-bicyclo[2.2.1]heptanyl, and the like. Further, the term cycloalkyl is intended to encompass any non-aromatic ring which may be fused to an Attorney Docket No.: 87JA-396165-WO aryl ring, regardless of the attachment to the remainder of the molecule. Still further, cycloalkyl also includes “spirocycloalkyl” when there are two positions for substitution on the same carbon atom, for example spiro[2.5]octanyl, spiro[4.5]decanyl, or spiro[5.5]undecanyl. “Heterocyclyl” (also referred to as “heterocycloalkyl”) refers to a saturated or partially unsaturated cyclic alkyl group, with one or more ring heteroatoms independently selected from nitrogen, oxygen, and sulfur. The term “heterocyclyl” includes heterocycloalkenyl groups (i.e., the heterocyclyl group having at least one double bond), bridged-heterocyclyl groups, fused-heterocyclyl groups, and spiro-heterocyclyl groups. A heterocyclyl may be a single ring or multiple rings wherein the multiple rings may be fused, bridged, or spiro, and may comprise one or more (e.g., 1 to 3) oxo (=O) or N-oxide (- O-) moieties. Any non-aromatic ring containing at least one heteroatom is considered a heterocyclyl, regardless of the attachment (i.e., can be bound through a carbon atom or a heteroatom). Further, the term heterocyclyl is intended to encompass any non-aromatic ring containing at least one heteroatom, which ring may be fused to a cycloalkyl, an aryl, or heteroaryl ring, regardless of the attachment to the remainder of the molecule. As used herein, heterocyclyl has 2 to 20 ring carbon atoms (i.e., C2-20 heterocyclyl), 2 to 12 ring carbon atoms (i.e., C2-12heterocyclyl), 2 to 10 ring carbon atoms (i.e., C2-10heterocyclyl), 2 to 8 ring carbon atoms (i.e., C2-8 heterocyclyl), 3 to 12 ring carbon atoms (i.e., C3-12 heterocyclyl), 3 to 8 ring carbon atoms (i.e., C3-8heterocyclyl), or 3 to 6 ring carbon atoms (i.e., C3-6heterocyclyl); having 1 to 5 ring heteroatoms, 1 to 4 ring heteroatoms, 1 to 3 ring heteroatoms, 1 to 2 ring heteroatoms, or 1 ring heteroatom independently selected from nitrogen, sulfur, or oxygen. Examples of heterocyclyl groups include, e.g., azetidinyl, azepinyl, benzodioxolyl, benzo[b][1,4]dioxepinyl, 1,4- benzodioxanyl, benzopyranyl, benzodioxinyl, benzopyranonyl, benzofuranonyl, dioxolanyl, dihydropyranyl, hydropyranyl, thienyl[1,3]dithianyl, decahydroisoquinolyl, furanonyl, imidazolinyl, imidazolidinyl, indolinyl, indolizinyl, isoindolinyl, isothiazolidinyl, isoxazolidinyl, morpholinyl, octahydroindolyl, octahydroisoindolyl, 2-oxopiperazinyl, 2-oxopiperidinyl, 2-oxopyrrolidinyl, oxazolidinyl, oxiranyl, oxetanyl, phenothiazinyl, phenoxazinyl, piperidinyl, piperazinyl, 4-piperidonyl, pyrrolidinyl, pyrazolidinyl, quinuclidinyl, thiazolidinyl, tetrahydrofuryl, tetrahydropyranyl, trithianyl, tetrahydroquinolinyl, thiomorpholinyl, thiamorpholinyl, 1-oxo-thiomorpholinyl, and 1,1-dioxo-thiomorpholinyl. The term “heterocyclyl” also includes “spiroheterocyclyl” when there are two positions for substitution on the same carbon atom. Examples of the spiro-heterocyclyl rings include, e.g., bicyclic and tricyclic ring systems, such as oxabicyclo[2.2.2]octanyl, 2-oxa-7-azaspiro[3.5]nonanyl, 2- oxa-6-azaspiro[3.4]octanyl, and 6-oxa-1-azaspiro[3.3]heptanyl. Examples of the fused-heterocyclyl rings include, but are not limited to, 1,2,3,4-tetrahydroisoquinolinyl, 4,5,6,7-tetrahydrothieno[2,3-c]pyridinyl, indolinyl, and isoindolinyl, where the heterocyclyl can be bound via either ring of the fused system. “Cycloalkylalkyl” refers to the group “cycloalkyl-alkyl-”. Attorney Docket No.: 87JA-396165-WO “Imino” refers to a group -C(NRy)Rz, wherein Ryand Rzare each independently hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl; each of which may be optionally substituted, as defined herein. “Imido” refers to a group -C(O)NRyC(O)Rz, wherein Ryand Rzare each independently hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl; each of which may be optionally substituted, as defined herein. “Halogen” or “halo” refers to atoms occupying group VIIA of the periodic table, such as fluoro, chloro, bromo, or iodo. “Haloalkyl” refers to an unbranched or branched alkyl group as defined above, wherein one or more (e.g., 1 to 6 or 1 to 3) hydrogen atoms are replaced by a halogen. For example, where a residue is substituted with more than one halogen, it may be referred to by using a prefix corresponding to the number of halogen moieties attached. Dihaloalkyl and trihaloalkyl refer to alkyl substituted with two (“di”) or three (“tri”) halo groups, which may be, but are not necessarily, the same halogen. Examples of haloalkyl include, e.g., trifluoromethyl, difluoromethyl, fluoromethyl, trichloromethyl, 2,2,2-trifluoroethyl, 1,2-difluoroethyl, 3-bromo-2-fluoropropyl, 1,2-dibromoethyl, and the like. “Haloalkoxy” refers to an alkoxy group as defined above, wherein one or more (e.g., 1 to 6 or 1 to 3) hydrogen atoms are replaced by a halogen. “Haloalkoxyalkyl” refers to an alkoxyalkyl group as defined above, wherein one or more (e.g., 1 to 6 or 1 to 3) hydrogen atoms are replaced by a halogen. “Hydroxyalkyl” refers to an alkyl group as defined above, wherein one or more (e.g., 1 to 6 or 1 to 3) hydrogen atoms are replaced by a hydroxy group. “Heteroalkyl” refers to an alkyl group in which one or more of the carbon atoms (and any associated hydrogen atoms), excluding any terminal carbon atom(s), are each independently replaced with the same or different heteroatomic group, provided the point of attachment to the remainder of the molecule is through a carbon atom. The term “heteroalkyl” includes unbranched or branched saturated chain having carbon and heteroatoms. By way of example, 1, 2 or 3 carbon atoms may be independently replaced with the same or different heteroatomic group. Heteroatomic groups include, but are not limited to, -NRy-, -O-, -S-, -S(O)-, -S(O)2-, and the like, wherein Ryis hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl; each of which may be optionally substituted, as defined herein. Examples of heteroalkyl groups include, e.g., ethers (e.g., -CH2OCH3, -CH(CH3)OCH3, -CH2CH2OCH3, -CH2CH2OCH2CH2OCH3, etc.), thioethers (e.g., -CH2SCH3, -CH(CH3)SCH3, -CH2CH2SCH3,-CH2CH2SCH2CH2SCH3, etc.), sulfones (e.g., -CH2S(O)2CH3, -CH(CH3)S(O)2CH3, -CH2CH2S(O)2CH3, -CH2CH2S(O)2CH2CH2OCH3, etc.), and amines (e.g., -CH2NRyCH3, -CH(CH3)NRyCH3, -CH2CH2NRyCH3, -CH2CH2NRyCH2CH2NRyCH3, etc., where Ry Attorney Docket No.: 87JA-396165-WO is hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl; each of which may be optionally substituted, as defined herein). As used herein, heteroalkyl includes 2 to 10 carbon atoms, 2 to 8 carbon atoms, or 2 to 4 carbon atoms; and 1 to 3 heteroatoms, 1 to 2 heteroatoms, or 1 heteroatom. “Heteroaryl” refers to an aromatic group having a single ring, multiple rings or multiple fused rings, with one or more ring heteroatoms independently selected from nitrogen, oxygen, and sulfur. As used herein, heteroaryl includes 1 to 20 ring carbon atoms (i.e., C1-20 heteroaryl), 3 to 12 ring carbon atoms (i.e., C3-12 heteroaryl), or 3 to 8 carbon ring atoms (i.e., C3-8 heteroaryl), and 1 to 5 ring heteroatoms, 1 to 4 ring heteroatoms, 1 to 3 ring heteroatoms, 1 to 2 ring heteroatoms, or 1 ring heteroatom independently selected from nitrogen, oxygen, and sulfur. In certain instances, heteroaryl includes 5-10 membered ring systems, 5-7 membered ring systems, or 5-6 membered ring systems, each independently having 1 to 4 ring heteroatoms, 1 to 3 ring heteroatoms, 1 to 2 ring heteroatoms, or 1 ring heteroatom independently selected from nitrogen, oxygen, and sulfur. Examples of heteroaryl groups include, e.g., acridinyl, benzimidazolyl, benzothiazolyl, benzindolyl, benzofuranyl, benzothiazolyl, benzothiadiazolyl, benzonaphthofuranyl, benzoxazolyl, benzothienyl (benzothiophenyl), benzotriazolyl, benzo[4,6]imidazo[1,2-a]pyridyl, carbazolyl, cinnolinyl, dibenzofuranyl, dibenzothiophenyl, furanyl, isothiazolyl, imidazolyl, indazolyl, indolyl, indazolyl, isoindolyl, isoquinolyl, isoxazolyl, naphthyridinyl, oxadiazolyl, oxazolyl, 1-oxidopyridinyl, 1-oxidopyrimidinyl, 1-oxidopyrazinyl, 1-oxidopyridazinyl, phenazinyl, phthalazinyl, pteridinyl, purinyl, pyrrolyl, pyrazolyl, pyridinyl, pyrazinyl, pyrimidinyl, pyridazinyl, quinazolinyl, quinoxalinyl, quinolinyl, quinuclidinyl, isoquinolinyl, thiazolyl, thiadiazolyl, triazolyl, thiophenyl (i.e., thienyl), tetrazolyl, and triazinyl. Examples of the fused-heteroaryl rings include, but are not limited to, benzo[d]thiazolyl, quinolinyl, isoquinolinyl, benzo[b]thiophenyl, indazolyl, benzo[d]imidazolyl, pyrazolo[1,5-a]pyridinyl, and imidazo[1,5-a]pyridinyl, where the heteroaryl can be bound via either ring of the fused system. Any aromatic ring, having a single or multiple fused rings, containing at least one heteroatom, is considered a heteroaryl regardless of the attachment to the remainder of the molecule (i.e., through any one of the fused rings). Heteroaryl does not encompass or overlap with aryl as defined above. “Oxime” refers to the group -CRy(=NOH) wherein Ryis hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl; each of which may be optionally substituted, as defined herein. “Sulfonyl” refers to the group -S(O)2Ry, where Ryis hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl; each of which may be optionally substituted, as defined herein. Examples of sulfonyl are methylsulfonyl, ethylsulfonyl, phenylsulfonyl, and toluenesulfonyl. Attorney Docket No.: 87JA-396165-WO “Sulfinyl” refers to the group -S(O)Ry, where Ryis hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl; each of which may be optionally substituted, as defined herein. Examples of sulfinyl are methylsulfinyl, ethylsulfinyl, phenylsulfinyl, and toluenesulfinyl. “Sulfonamido” refers to the groups -SO2NRyRzand -NRySO2Rz, where Ryand Rzare each independently hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl; each of which may be optionally substituted, as defined herein. “Alkaryl” or “alkylaryl” refers to the group “alkyl-aryl-”. “O-aralkyl” refers to the group “O-aryl-alkyl-”. “O-alkaryl” refers to the group “O-alkyl-aryl-”. “Heterocycloalkaryl” refers to the group “heterocyclyl-aryl-”. “Aminoalkyl” refers to the group “-alkyl-NRyRz,” wherein Ryand Rzare independently hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl; each of which may be optionally substituted, as defined herein. “Aminoalkylamino” refers to the group “-NRy-alkyl-NRyRz,” wherein each of Ryand Rzare independently hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl; each of which may be optionally substituted, as defined herein. “Polyalkyl” refers to an alkyl group that is generally derived from polyolefins which are polymers or copolymers of mono-olefins. “Polyalkylamino” refers to the group “polyalkyl-NRy-,” wherein Ryis hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl; each of which may be optionally substituted, as defined herein. “Silyl” refers to a functional group having a structure represented by -SiH3. “Substituted silyl” refers to a silyl group wherein at least one hydrogen atom is replaced by OH, Ryor -ORy; wherein each Ryis independently alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl, each of which may be optionally substituted, as defined herein. “Arylalkyl” or “Aralkyl” refers to the group “aryl-alkyl-”. “Arylalkenyl” refers to the group “aryl-alkenyl-”. “Arylalkynyl” refers to the group “aryl-alkynyl-”. “Heteroarylalkyl” refers to the group “heteroaryl-alkyl-”. “Heteroarylalkenyl” refers to the group “heteroaryl-alkenyl-”. “Heteroarylalkynyl” refers to the group “heteroaryl-alkynyl-”. “Heterocyclylalkyl” refers to the group “heterocyclyl-alkyl-.” “Heterocyclylalkenyl” refers to the group “heterocyclyl-alkenyl-.” “Heterocyclylalkynyl” refers to the group “heterocyclyl-alkynyl-.” Attorney Docket No.: 87JA-396165-WO “Alkylarylalkyl” refers to the group “alkyl-aryl-alkyl-.” “Alkylarylalkenyl” refers to the group “alkyl-aryl-alkenyl-.” “Alkylarylalkynyl” refers to the group “alkyl-aryl- alkynyl -.” “Alkenylarylalkyl” refers to the group “alkenyl-aryl-alkyl-.” “Alkenylarylalkenyl” refers to the group “alkenyl-aryl-alkenyl-.” “Alkenylarylalkynyl” refers to the group “alkenyl-aryl-alkynyl-.” “Alkynylarylalkyl” refers to the group “alkynyl-aryl-alkyl-.” “Alkynylarylalkenyl” refers to the group “alkynyl-aryl-alkenyl-.” “Alkynylarylalkynyl” refers to the group “alkynyl-aryl-alkynyl-.” “Alkylheteroarylalkyl” refers to the group “alkyl-heteroaryl-alkyl-.” “Alkylheteroarylalkenyl” refers to the group “alkyl-heteroaryl-alkenyl-.” “Alkylheteroarylalkynyl” refers to the group “alkyl-heteroaryl-alkynyl-.” “Alkenylheteroarylalkyl” refers to the group “alkenyl-heteroaryl-alkyl-.” “Alkenylheteroarylalkenyl” refers to the group “alkenyl-heteroaryl-alkenyl-.” “Alkenylheteroarylalkynyl” refers to the group “alkenyl-heteroaryl-alkynyl-.” The term “substituted” used herein means any of the above groups (i.e., alkyl, alkenyl, alkynyl, alkylene, alkoxy, haloalkyl, haloalkoxy, cycloalkyl, aryl, heterocyclyl, heteroaryl, and / or heteroalkyl) wherein at least one (e.g., 1 to 5 or 1 to 3) hydrogen atom is replaced by a bond to a non-hydrogen atom such as, but not limited to alkyl, alkenyl, alkynyl, alkoxy, alkylthio, acyl, amido, amino, amidino, aryl, aralkyl, azido, carbamoyl, carboxyl, carboxyl ester, cyano, cycloalkyl, cycloalkylalkyl, guanadino, halo, haloalkyl, haloalkoxy, hydroxyalkyl, heteroalkyl, heteroaryl, heteroarylalkyl, heterocyclyl, heterocyclylalkyl, -NHNH2, =NNH2, imino, imido, hydroxy, oxo, oxime, nitro, sulfonyl, sulfinyl, alkylsulfonyl, alkylsulfinyl, thiocyanate, -S(O)OH, -S(O)2OH, sulfonamido, thiol, thioxo, N-oxide, or - Si(Ry)3, wherein each Ryis independently hydrogen, alkyl, alkenyl, alkynyl, heteroalkyl, cycloalkyl, aryl, heteroaryl, or heterocyclyl. In certain embodiments, “substituted” includes any of the above alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, or heteroaryl groups in which one or more (e.g., 1 to 5 or 1 to 3) hydrogen atoms are independently replaced with deuterium, halo, cyano, nitro, azido, oxo, alkyl, alkenyl, alkynyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, -NRgRh, -NRgC(O)Rh, -OC(O)ORg, -OC(O)Rg, 2Rg, -S(O)1-2ORg, -OCF3. In certain embodiments, “substituted” also means any of the above groups in which one or more (e.g., 1 to 5 or 1 to 3) hydrogen atoms are replaced with -C(O)Rg, -C(O)ORg, -C(O)NRgRh, -CH2SO2Rg, or Attorney Docket No.: 87JA-396165-WO -CH2SO2NRgRh. In the foregoing, Rgand Rhare the same or different and independently hydrogen, alkyl, alkenyl, alkynyl, alkoxy, thioalkyl, aryl, aralkyl, cycloalkyl, cycloalkylalkyl, haloalkyl, heterocyclyl, heterocyclylalkyl, heteroaryl, and / or heteroarylalkyl. In certain embodiments, “substituted” also means any of the above groups in which one or more (e.g., 1 to 5 or 1 to 3) hydrogen atoms are replaced by a bond to an amino, cyano, hydroxy, imino, nitro, oxo, thioxo, halo, alkyl, alkoxy, alkylamino, thioalkyl, aryl, aralkyl, cycloalkyl, cycloalkylalkyl, haloalkyl, heterocyclyl, N-heterocyclyl, heterocyclylalkyl, heteroaryl, and / or heteroarylalkyl, or two of Rgand Rhand Riare taken together with the atoms to which they are attached to form a heterocyclyl ring optionally substituted with oxo, halo, or alkyl optionally substituted with oxo, halo, amino, hydroxy, or alkoxy. Conjugation of siRNA In some embodiments, the siRNA duplex, or siRNA composition is conjugated to a non- nucleotide moiety, which is usually coupled, preferably covalently, either directly or indirectly linked to the siRNA composition, optionally via a linker. In some embodiments, a non-nucleotide moiety alters the distribution, targeting or lifetime of the molecule into which it is incorporated. In some embodiments a non-nucleotide moiety provides an enhanced affinity for a selected target, e.g., molecule, cell or cell type, compartment, receptor e.g., a cellular or organ compartment, tissue, organ or region of the body, as, e.g., compared to a species absent such a non-nucleotide moiety. Non-nucleotide moieties providing enhanced affinity for a selected target are also termed targeting non-nucleotide moieties. Some non-nucleotide moieties can have endosomolytic properties. The endosomolytic non- nucleotide moieties promote the lysis of the endosome and / or transport of the composition of the invention, or its components, from the endosome to the cytoplasm of the cell. The endosomolytic non- nucleotide moiety may be a polyanionic peptide or peptidomimetic which shows pH-dependent membrane activity and fusogenicity. In one embodiment, the endosomolytic non-nucleotide moiety assumes its active conformation at endosomal pH. The "active" conformation is that conformation in which the endosomolytic non-nucleotide moiety promotes lysis of the endosome and / or transport of the composition of the invention, or its components, from the endosome to the cytoplasm of the cell. Exemplary endosomolytic non-nucleotide moieties include the GALA peptide (Subbarao et al, Biochemistry, 1987, 26: 2964-2972), the EALA peptide (Vogel et al, J. Am. Chem. Soc, 1996, 118: 1581- 1586), and their derivatives (Turk et al, Biochem. Biophys. Acta, 2002, 1559: 56-68). In one embodiment, the endosomolytic component may contain a chemical group (e.g., an amino acid) which will undergo a change in charge or protonation in response to a change in pH. The endosomolytic component may be linear or branched. Non-nucleotide moieties can improve transport, hybridization, and specificity Attorney Docket No.: 87JA-396165-WO properties and may also improve nuclease resistance of the resultant natural or modified oligoribonucleotide, or a polymeric molecule including any combination of monomers described herein and / or natural or modified ribonucleotides. In some embodiments, the non-nucleotide moieties include a small molecule, an agonist, an antagonist, a cytokine, a carbohydrate, a peptide, an antibody or fragment thereof, a vitamin, a folate, a natural product, an aptamer, or a cell-specific surface receptor, among other targeting ligands known in the art. Non-nucleotide moieties in general can include therapeutic modifiers, e.g., for enhancing uptake; diagnostic compounds or reporter groups e.g., for monitoring distribution; cross-linking agents; and nuclease-resistance conferring moieties. General examples include lipids, steroids, vitamins, sugars, proteins, peptides, polyamines, and peptide mimics. Non-nucleotide moieties can include a naturally occurring substance, such as a protein (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), high-density lipoprotein (HDL), or globulin); a carbohydrate (e.g., a dextran, pullulan, chitin, chitosan, inulin, cyclodextrin or hyaluronic acid); or a lipid. The non-nucleotide moiety may also be a recombinant or synthetic molecule, such as a synthetic polymer, e.g., a synthetic polyamino acid or an aptamer. Examples of polyamino acids include polyamino acid is a polylysine (PLL), poly L-aspartic acid, poly L-glutamic acid, styrene-maleic acid anhydride copolymer, poly(L-lactide-co-glycolied) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacryllic acid), N-isopropylacrylamide polymers, or polyphosphazine. Example of polyamines include: polyethylenimine, polylysine (PLL), spermine, spermidine, polyamine, pseudopeptide-polyamine, peptidomimetic polyamine, dendrimer polyamine, arginine, amidine, protamine, cationic lipid, cationic porphyrin, quaternary salt of a polyamine, or an alpha helical peptide. Non-nucleotide moieties can also include targeting groups, e.g., a cell or tissue targeting agent, e.g., a lectin, glycoprotein, lipid or protein, e.g., an antibody, that binds to a specified cell type such as a kidney cell. A targeting group can be a thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, Mucin carbohydrate, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl- glucosamine multivalent mannose, multivalent fucose, glycosylated polyaminoacids, multivalent galactose, transferrin, bisphosphonate, polyglutamate, polyaspartate, a lipid, cholesterol, a steroid, bile acid, folate, vitamin B12, biotin, an RGD peptide, an RGD peptide mimetic or an aptamer. Other examples of non-nucleotide moieties include dyes, intercalating agents (e.g. acridines), cross-linkers (e.g. psoralene, mitomycin C), porphyrins (TPPC4, texaphyrin, Sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases or a chelator (e.g. EDTA), lipophilic molecules, e.g, cholesterol, cholic acid, adamantane acetic acid, 1-pyrene butyric acid, Attorney Docket No.: 87JA-396165-WO dihydrotestosterone, 1,3-Bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3- propanediol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine)and peptide conjugates (e.g., antennapedia peptide, Tat peptide), alkylating agents, phosphate, amino, mercapto, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens (e.g. biotin), transport / absorption facilitators (e.g., aspirin, vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole, bisimidazole, histamine, imidazole clusters, acridine-imidazole conjugates, Eu3+ complexes of tetraazamacrocycles), dinitrophenyl, HRP, or AP. Non-nucleotide moieties can include proteins, e.g., glycoproteins, or peptides, e.g., molecules having a specific affinity for a co-non-nucleotide moiety, or antibodies e.g., an antibody, that binds to a specified cell type such as a cancer cell, endothelial cell, or bone cell. Non-nucleotide moieties may also include hormones and hormone receptors. They can also include non-peptidic species, such as lipids, lectins, carbohydrates, vitamins, cofactors, multivalent lactose, multivalent galactose, N-acetyl- galactosamine, N-acetyl-gulucosamine multivalent mannose, multivalent fucose, or aptamers. The non- nucleotide moiety can be, for example, a lipopolysaccharide, an activator of p38 MAP kinase, or an activator of NF-KB. The non-nucleotide moiety can include a substance, e.g, a drug, which can increase the uptake of the siRNA agent into the cell, for example, by disrupting the cell's cytoskeleton, e.g., by disrupting the cell's microtubules, microfilaments, and / or intermediate filaments. The drug can be, for example, taxon, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swinholide A, indanocine, or myoservin. The non-nucleotide moiety can increase the uptake of the oligonucleotide into the cell by activating an inflammatory response, for example. Exemplary non-nucleotide moieties that would have such an effect include tumor necrosis factor alpha (TNF alpha), interleukin-1 beta, or gamma interferon. In some embodiments, the non-nucleotide moiety includes any targeting ligand that is capable of targeting a specific receptor. Ligand–siRNA conjugates can transport the siRNA composition to desired tissues and cells by specific recognition and interactions between the ligand, e.g., a carbohydrate, peptide, antibody, aptamer, small molecule, etc., and a cell-specific surface receptor. The targeting ligand can be, for example, a small molecule, an agonist, an antagonist, a cytokine, a carbohydrate, a peptide, an antibody or fragment thereof, a vitamin, a folate, a natural product, or an aptamer, among other targeting ligands known in the art. In some embodiments, the targeting ligand is carbohydrate. In some embodiments, the carbohydrate ligand includes monosaccharide (such as GalNAc), disaccharide, trisaccharide, tetrasaccharide, oligosaccharide, or polysaccharide. These carbohydrate-conjugated siRNA target, in Attorney Docket No.: 87JA-396165-WO particular, the parenchymal cells of the liver. In one embodiment, the siRNA composition includes more than one carbohydrate ligand, preferably two or three. In one embodiment, the siRNA composition includes one or more galactose moiety. In another embodiment, the siRNA composition includes at least one (e.g., two or three or more) lactose molecules (lactose is a glucose coupled to a galactose). In another embodiment, the siRNA composition includes at least one (e.g., two or three or more) N-acetylgalactosamine (GalNAc), N-Ac-Glucosamine (GluNAc), or mannose (e.g., mannose-6-phosphate). In one embodiment, siRNA composition includes at least one mannose ligand, and the siRNA composition targets macrophages. In some embodiments, the siRNA composition includes carbohydrate cluster, such as clusters of sugars such as GalNAc cluster, mannose cluster, galactose cluster, or an aptamer. A "carbohydrate cluster" means a compound having one or more carbohydrate residues attached to a spacer group or a linker group. A carbohydrate cluster can include a targeting moiety (such as a targeting ligand) and, optionally, a spacer and / or a branch point. In certain embodiments, the carbohydrate cluster is identified by the number and identity of the ligand. For example, in certain embodiments, the carbohydrate cluster portion includes 3 GalNAc groups and is designated “GalNAc3”. In certain embodiments, the carbohydrate cluster portion includes 4 GalNAc groups and is designated “GalNAc4”. In one aspect, the present disclosure provides an siRNA composition including a carbohydrate ligand, and the presence of the carbohydrate ligand can increase delivery of the siRNA composition to the liver. Thus an siRNA composition including a carbohydrate ligand can be useful for targeting a gene for which expression is undesired in the liver. For example, an siRNA composition including a carbohydrate ligand can target a nucleic acid encoding HMGCR. In some embodiments, the siRNA compositions include at least one GalNAc. In some embodiments, the siRNA composition includes sequential conjugation of one or more GalNAc residues via nucleosidic linkages. In certain embodiments, the non-nucleotide moiety includes a galactose cluster. As used herein, a galactose cluster includes a molecule having two to four terminal galactose derivatives. As used herein, the term galactose derivative includes both galactose and derivatives of galactose having affinity for the asialoglycoprotein receptor equal to or greater than that of galactose. A terminal galactose derivative is attached to a molecule through its C-l carbon. The asialoglycoprotein receptor (ASGPR) is unique to hepatocytes and binds branched galactose-terminal glycoproteins. In certain embodiments, a galactose cluster has three terminal galactosamines or galactosamine derivatives each having affinity for the asialoglycoprotein receptor. In certain embodiments, A galactose cluster has three terminal GalNAcs. Other terms common in the art include tri-antennary galactose, tri-valent galactose and galactose trimer. It is known that tri-antennary galactose derivative clusters are bound to the ASGPR with greater affinity Attorney Docket No.: 87JA-396165-WO than bi-antennary or mono-antennary galactose derivative structures (Baenziger and Fiete, 1980, Cell, 22, 611-620; Connolly et al, 1982, J. Biol. Chem., 257, 939-945). Mulivalency is required to achieve nM affinity. The attachment of a single galactose derivative having affinity for the asialoglycoprotein receptor does not enable functional delivery of the RNAi polynucleotide to hepatocytes in vivo when co- administered with the delivery polymer. A galactose cluster contains three galactose derivatives each linked to a central branch point. The galactose derivatives are attached to the central branch point through the C-1 carbons of the saccharides. The galactose derivative is preferably linked to the branch point via spacers. In certain embodiments, a spacer is a flexible hydrophilic spacer (U.S. Patent 5885968; Biessen et al. J. Med. Chem.1995 Vol.39 p. 1538-1546). In certain embodiments, a flexible hydrophilic spacer is a PEG spacer. In certain embodiments, a PEG spacer is a PEG3 spacer. The branch point can be any small molecule which permits attachment of the three galactose derivatives and further permits attachment of the branch point to the siRNA duplex. An exemplary branch point group is a di-lysine. A di-lysine molecule contains three amine groups through which three galactose derivatives may be attached and a carboxyl reactive group through which the di-lysine may be attached to the siRNA duplex. Attachment of the branch point to the siRNA duplex may occur through a spacer. In certain embodiments, a spacer is a flexible hydrophilic spacer. In certain embodiments, a flexible hydrophilic spacer is a PEG spacer. In certain embodiments, a PEG spacer is a PEG3 spacer (three ethylene units). The galactose cluster may be attached to the 3' or 5' end of the siRNA duplex using methods known in the art. The galactose cluster may be attached to either strand of the siRNA duplex. In certain embodiments, a galactose derivative is an N-acetyl-galactosamine (GalNAc). Other saccharides having affinity for the asialoglycoprotein receptor may be selected from the list including: galactose, galactosamine, N-formylgalactosamine, N-acetylgalactosamine, N- propionyl-galactosamine, N-n-butanoylgalactosamine, and N-iso-butanoylgalactos-amine. The affinities of numerous galactose derivatives for the asialoglycoprotein receptor have been studied (see for example: Iobst, S.T. and Drickamer, K. J. B.C.1996, 271, 6686) or are readily determined using methods typical in the art. In one embodiment, a galactose cluster has a structure of formula I: (GalNAc-Cluster-COOH, or “GalNAc3”): Attorney Docket No.: 87JA-396165-WO In some embodiments, the non-nucleotide moieties disclosed herein include a lipid conjugate. In some embodiments, the siRNA lipid conjugate is formulated as a pharmaceutical composition as described herein. The lipid conjugate can be selected, for example, from the group consisting of 2'-O-C16, 5'-C16-NHC6, 3'-C16-NHC6, 5'-C18-NHC6, 5'-C18:1-NHC6, 5'-C12-NHC6, 5'-C14-NHC6, 3'-C14-NHC6, 5'-C14- PS, 5'-C16-PS, 5'-C18-PS, 3'-C18-NHC6, 5'-C18:2-NHC6, 5'-C20:4-NHC6, 5'-C22:6-NHC6, and 5'-Chol- NHC6. The lipid conjugate can be selected from the group consisting of palmitic acid, stearic acid, oleic acid, lauric acid, myristic acid, myristyl alcohol, palmityl alcohol, stearyl alcohol, linoleic acid, arachidonic acid, docosahexaenoic acid, and cholesterol. When two or more non-nucleotide moieties are present, the non-nucleotide moieties can all have the same properties, all have different properties or some non-nucleotide moieties have the same properties while others have different properties. For example, a ligand can have targeting properties, have endosomolytic activity or have PK modulating properties. In an embodiment, all the non-nucleotide moieties have different properties. In some embodiments, the non-nucleotide moiety can be conjugated to the siRNA composition via a linker. A “linker,” as used herein, includes any atom or group of atoms and which covalently link the sense or antisense strand to the non-nucleotide moiety. In some embodiments, the linkers are shown herein as radicals, providing a bond for forming covalent attachment to the siRNA duplex. In certain embodiments the point of attachment on the siRNA duplex is the 5'-oxygen atom of the 5'-hydroxyl group of the 5’ terminal nucleoside of the sense strand or antisense strand. In certain embodiments, the point of attachment on the siRNA duplex is the 3'-oxygen atom of the 3'-hydroxyl group of the 3’ terminal nucleoside of the sense strand or antisense strand. In certain embodiments, the linker can be selected from the group consisting of oxygen, sulfur, C(O), C(O)NH, SO, SO2, SO2NH, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, arylalkyl, arylalkenyl, arylalkynyl, heteroarylalkyl, heteroarylalkenyl, heteroarylalkynyl, heterocyclylalkyl, heterocyclylalkenyl, heterocyclylalkynyl, aralkynyl, heteroaryl, heterocyclyl, cycloalkyl, cycloalkenyl, alkylarylalkyl, alkylarylalkenyl, Attorney Docket No.: 87JA-396165-WO alkylarylalkynyl, alkenylarylalkyl, alkenylarylalkenyl, alkenylarylalkynyl, alkynylarylalkyl, alkynylarylalkenyl, alkynylarylalkynyl, alkylheteroarylalkyl, alkylheteroarylalkenyl, alkylheteroarylalkynyl, alkenylheteroarylalkyl, alkenylheteroarylalkenyl, and alkenylheteroarylalkynyl. In some embodiments, the linker includes a substituted or unsubstituted alkyl. In some embodiments the linker comprises a terminal functional group for coupling with the non-nucleotide moiety, e.g., a terminal amine. For example, in some embodiments, the linker includes a substituted or unsubstituted aminoalkyl linker, wherein the term “aminoalkyl” refers to an alkyl group having an amino functional group (e.g., -NH-alkyl). In some embodiments, the linker includes an aminohexyl linker (NHC6). In some embodiments, the non-nucleotide moiety is GalNAc3 and the linker is an amino hexyl linker, i.e., (GalNAc3)(NHC6): . In certain embodiments, the linker provided herein includes a cleavable moiety (e.g., a cleavable bond or cleavable nucleoside). “Cleavable moiety” means a bond or group that is capable of being split under physiological conditions. In certain embodiments, a cleavable moiety is cleaved inside a cell or sub-cellular compartments, such as a lysosome. In certain embodiments, a cleavable moiety is cleaved by endogenous enzymes, such as nucleases. In certain embodiments, a cleavable moiety includes a group of atoms having one, two, three, four, or more than four cleavable bonds. In certain embodiments, the bond for forming attachment to the oligomeric compound is a cleavable bond. In certain such embodiments, such cleavable bond constitutes all or part of a cleavable moiety. As noted, without wishing to be bound by mechanism, it is logical that the conjugate should remain on the compound long enough to provide enhancement in uptake, but after that, it is desirable for some portion or, ideally, all of the conjugates to be cleaved, releasing the parent compound (e.g., antisense compound) in its most active form. In certain embodiments, the cleavable moiety is a cleavable nucleoside. Such embodiments take advantage of endogenous nucleases in the cell by attaching the rest of the conjugate (the cluster) to the antisense oligonucleotide through a nucleoside via one or more cleavable bonds, such as those of a phosphodiester linkage. In certain embodiments, the cluster is bound to the Attorney Docket No.: 87JA-396165-WO cleavable nucleoside through a phosphodiester linkage. In certain embodiments, the cleavable nucleoside is attached to the antisense strand by a phosphodiester linkage. In certain embodiments, the conjugate group may include two or three cleavable nucleosides. In such embodiments, such cleavable nucleosides are linked to one another, to the antisense strand and / or to the cluster via cleavable bonds (such as those of a phosphodiester linkage). Certain conjugates herein do not include a cleavable nucleoside and instead include a cleavable bond. It is shown that that sufficient cleavage of the conjugate from the oligonucleotide is provided by at least one bond that is vulnerable to cleavage in the cell (a cleavable bond). In certain such embodiments, the cleavable moiety attaches directly to the non-nucleotide moiety. In certain such embodiments, the cleavable moiety attaches directly to the siRNA duplex. In certain embodiments, the cleavable moiety includes a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is a cleavable nucleoside or nucleoside analog. In certain embodiments, the nucleoside or nucleoside analog includes an optionally protected heterocyclic base selected from a purine, substituted purine, pyrimidine or substituted pyrimidine. In certain embodiments, the cleavable moiety is a nucleoside including an optionally protected heterocyclic base selected from uracil, thymine, cytosine, 4- N- benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine and 2-N-isobutyrylguanine. In certain embodiments, the cleavable moiety is attached to the antisense strand by a phosphodiester linkage. In certain embodiments, the cleavable moiety is attached to the linker by either a phosphodiester or a phosphorothioate linkage. In certain embodiments, the cleavable moiety is attached to the linker by a phosphodiester linkage. In certain embodiments, the linker does not include a cleavable moiety. In certain embodiments, the cleavable moiety is 2'-deoxy nucleoside that is attached to the 3' end of the antisense strand by a phosphodiester linkage and is attached to the linker by a phosphodiester or phosphorothioate linkage. In certain embodiments, the cleavable moiety is 2'- deoxy adenosine that is attached to the 3' end of the antisense strand by a phosphodiester linkage and is attached to the linker by a phosphodiester or phosphorothioate linkage. In certain embodiments, the cleavable moiety is 2'-deoxy adenosine that is attached to the 3' end of the antisense strand by a phosphodiester linkage and is attached to the linker by a phosphodiester linkage. In certain embodiments, the cleavable moiety is cleaved after the complex has been administered to an animal only after being internalized by a targeted cell. Inside the cell the cleavable moiety is cleaved thereby releasing the active antisense oligonucleotide. It is believed that the cleavable moiety is cleaved by one or more nucleases within the cell. In certain embodiments, the one or more nucleases cleave the phosphodiester linkage between the cleavable moiety and the linker. Attorney Docket No.: 87JA-396165-WO The non-nucleotide moiety provided herein can be conjugated to the siRNA composition at the 5ʹ-end, the 3ʹ-end, and / or an internal 2ʹ-position of the sense strand or antisense strand. In certain embodiments, the GalNAc cluster is made by attachment of three galactose derivative PEG3 groups to the amines on a di-lysine branch point. The carboxyl group on the di-lysine is then available for covalent attachment to the RNAi polynucleotide, such as an siRNA. In certain embodiments, the conjugated siRNA duplex has a structure: a galactose or galactose derivative cluster (ligand-spacer- branch point)-linker-5’ or 3’ end of the sense strand or antisense strand of the siRNA duplex. In one embodiments, a galactose cluster with an aminohexyl (NHC6) linker between the branch point and nucleic acid has a structure of formula II (5'-(GalNAc3)(NHC6)-sense strand): II. Evaluation of siRNA Compositions The siRNA compositions, e.g., siRNA duplexes targeting the human HMGCR gene as provided in Tables 1 and 2, or a conjugated siRNA duplex, can be evaluated for their ability to down-regulate target gene expression, e.g., down-regulation of expression of the human HMGCR gene and / or down- regulation of expression of the human HMGCR protein. For example, a candidate siRNA composition can be provided, and contacted with a cell, e.g., a cell line that expresses HMGCR. The level of target gene expression, e.g., HMGCR mRNA or HMGCR protein expression, can be measured prior to and following contact with the candidate siRNA composition. If it is determined that the amount of mRNA or protein expressed from the target gene is lower following contact with the candidate siRNA composition, then it can be concluded that the candidate siRNA composition down-regulates target gene expression. The level of target gene mRNA or protein, e.g., HMGCR mRNA or HMGCR protein, in the cell or tissue can be determined by any method known in the art. In addition to being evaluated for their ability to down-regulate target gene expression, e.g., HMGCR expression, the siRNA compositions disclosed herein can be evaluated and prioritized based on additional metrics. For example, siRNA compositions can be evaluated for whether or not they target loci in a target gene, e.g., the HMGCR gene, that include known single-nucleotide polymorphisms (SNPs) in Attorney Docket No.: 87JA-396165-WO the human genome. siRNA compositions that do not include a target locus including a SNP in the human genome can be prioritized for development as a therapeutic composition. Further, siRNA compositions can be evaluated for whether or not they cross-react with relevant model species, i.e., whether they also effectively target and bind to the target gene in the genome of a model species that is useful for experimental laboratory and clinical investigation, e.g., minipig, pig, rabbit, mouse, rat, or non-human primate. siRNA compositions that cross-react with relevant model species can be prioritized for development as a therapeutic composition to enable further testing in such animal models before starting human clinical trials. Further, siRNA compositions can be evaluated for whether or not they might target predicted off- target sites, i.e., sites that are not within the intended target genomic locus, e.g., the HMGCR locus. siRNA compositions that are predicted to include off-target sites can be de-prioritized for development as a therapeutic composition. Further, siRNA compositions can be evaluated for whether or not they might include known microRNA (miRNA) binding sites in off-target genes. siRNA compositions that include known microRNA (miRNA) binding sites can be de-prioritized for development as a therapeutic composition. Pharmaceutical Compositions Disclosed herein are pharmaceutical compositions comprising inhibitory nucleic acids, e.g., siRNA compositions, for use in treating a human subject. In some embodiments, the inhibitory nucleic acids comprise RNA. In some embodiments, the inhibitory nucleic acids comprise an RNA duplex. In some embodiments, the inhibitory nucleic acids are siRNAs. In some embodiments, the inhibitory nucleic acids comprise modified nucleotides. In some embodiments, the inhibitory nucleic acids are siRNAs that hybridize to an RNA transcript of the HMGCR gene. The pharmaceutical compositions disclosed herein can achieve a therapeutic effect, e.g., reducing or alleviating the symptoms of a disease in a patient. In some embodiments, the disease is a genetic disorder. In some embodiments, the disease is caused by one or more inherited mutations of a gene. The inherited mutation can be in the ARMS2 gene, the CFH gene, among other human genes harboring genetic variants associated with age-related macular degeneration (AMD), wet AMD, dry AMD, early AMD, intermediate AMD, and / or geographic atrophy. The therapeutic effect can include a reduction or elimination of symptoms including blurred vision; distorted vision; difficulty seeing colors; blank spots or dark spots in field of vision; among other symptoms of disease. The pharmaceutical compositions disclosed herein can comprise an inhibitory nucleic acid, e.g., an siRNA that is complementary to one or more RNA transcripts that may cause the disease in the patient. In some embodiments, as described in further detail below, the siRNAs can include different Attorney Docket No.: 87JA-396165-WO modifications, e.g., modifications to the nucleotides of the siRNA duplex sense strand and / or antisense strand. In some embodiments, the siRNA complex is conjugated to a moiety, e.g., a lipid moiety or a targeting ligand, such as a galactose cluster. In some embodiments, the pharmaceutical compositions include an siRNA composition, e.g., a double-stranded siRNA complex comprising the polynucleotide sequences disclosed herein, in an injectable dosage form. In some embodiments, the injectable dosage form of the pharmaceutical composition includes a sterile aqueous solution or dispersion mixed with a sterile powder. In some embodiments the sterile solution can include a diluent such as water; saline solution; fixed oils, polyethylene glycols, glycerin, or propylene glycol. The siRNA duplexes disclosed herein can be incorporated into pharmaceutical compositions. Such compositions typically include the siRNA duplex and a pharmaceutically acceptable carrier. As used herein the term “pharmaceutically acceptable carrier” is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration to a cell, e.g., a cell of the eye of a subject, a retinal cell of a subject, or a retinal pigment epithelium cell of a subject. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the siRNA duplex, use thereof in the compositions is contemplated. Supplementary active compounds can also be incorporated into the compositions. Pharmaceutical compositions disclosed herein can include, but are not limited to, solutions, emulsions, and liposome-containing formulations. These compositions can be generated from a variety of components that include, but are not limited to, preformed liquids, self-emulsifying solids, and self- emulsifying semisolids. Formulations include those that target, e.g., the eye, retina, and retinal pigment epithelium. The pharmaceutical formulations can conveniently be presented in unit dosage form and can be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the siRNA duplex with the pharmaceutical carrier(s) or excipient(s). In general, the formulations are prepared by uniformly and intimately bringing into association the siRNA duplex with liquid carriers. Administration of the pharmaceutical compositions disclosed herein can be systemic or local, including but are not limited to parenteral, transdermal, vaginal, buccal, rectal, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, oral routes and topical administration. The term “parenteral” as used herein refers to modes of administration which include intravenous (both bolus and infusion), intramuscular, intraperitoneal, intrasternal, subcutaneous and intra-articular injection and infusion. Attorney Docket No.: 87JA-396165-WO The amount of the siRNA duplex or conjugation thereof in a formulation can vary within the full range employed by those skilled in the art. Typically, the formulation will contain, on a weight percent (wt %) basis, from about 0.01-99.99 wt % of a compound of this disclosure based on the total formulation, with the balance being one or more suitable pharmaceutical excipients. In one embodiment, the siRNA duplex or conjugation thereof is present at a level of about 1-80 wt %. Representative pharmaceutical formulations are described below. The siRNA duplex or conjugation thereof of the present disclosure is administered to a subject at various dosing amounts for a single dose or multiple doses. For the single dose or each dose of the multiple doses, the dosing amount can range, for example, from about 0.1 mg to about 2000 mg, from about 0.1 mg to about 1500 mg, from about 0.1 mg to about 1000 mg, from about 0.1 mg to about 900 mg, from about 0.1 mg to about 800 mg, from about 0.1 mg to about 700 mg, from about 0.1 mg to about 600 mg, from about 0.1 mg to about 500 mg, from about 0.1 mg to about 400 mg, from about 0.1 mg to about 300 mg, from about 0.1 mg to about 200 mg, from about 0.1 mg to about 100 mg, from about 0.1 mg to about 90 mg, from about 0.1 mg to about 80 mg, from about 0.1 mg to about 70 mg, from about 0.1 mg to about 60 mg, from about 0.1 mg to about 50 mg, from about 0.1 mg to about 40 mg, from about 0.1 mg to about 30 mg, from about 0.1 mg to about 20 mg, from about 0.1 mg to about 10 mg, from about 0.1 mg to about 9 mg, from about 0.1 mg to about 8 mg, from about 0.1 mg to about 7 mg, from about 0.1 mg to about 6 mg, from about 0.1 mg to about 5 mg, from about 0.1 mg to about 4 mg, from about 0.1 mg to about 3 mg, from about 0.1 mg to about 2 mg, from about 0.1 mg to about 1 mg, from about 1 mg to about 2000 mg, from about 1 mg to about 900 mg, from about 1 mg to about 800 mg, from about 1 mg to about 700 mg, from about 1 mg to about 600 mg, from about 1 mg to about 500 mg, from about 1 mg to about 400 mg, from about 1 mg to about 300 mg, from about 1 mg to about 200 mg, from about 1 mg to about 100 mg, from about 1 mg to about 90 mg, from about 1 mg to about 80 mg, from about 1 mg to about 70 mg, from about 1 mg to about 60 mg, from about 1 mg to about 50 mg, from about 1 mg to about 40 mg, from about 1 mg to about 30 mg, from about 1 mg to about 20 mg, from about 1 mg to about 10 mg, from about 5 mg to about 2000 mg, from about 10 mg to about 2000 mg, from about 20 mg to about 2000 mg, from about 30 mg to about 2000 mg, from about 40 mg to about 2000 mg, from about 50 mg to about 2000 mg, from about 60 mg to about 2000 mg, from about 70 mg to about 2000 mg, from about 80 mg to about 2000 mg, from about 90 mg to about 2000 mg, from about 100 mg to about 2000 mg, from about 150 mg to about 2000 mg, from about 200 mg to about 2000 mg, from about 250 mg to about 2000 mg, from about 300 mg to about 2000 mg, from about 350 mg to about 2000 mg, from about 400 mg to about 2000 mg, from about 450 mg to about 2000 mg, from about 500 mg to about 2000 mg, from about 550 mg to about 2000 mg, from about 600 mg to about 2000 mg, from about 650 mg to about 2000 mg, from about 700 mg to about 2000 mg, from Attorney Docket No.: 87JA-396165-WO about 750 mg to about 2000 mg, from about 800 mg to about 2000 mg, from about 850 mg to about 2000 mg, from about 900 mg to about 2000 mg, from about 950 mg to about 2000 mg, from about 1000 mg to about 2000 mg, from about 1500 mg to about 2000 mg, from about 5 mg to about 1500 mg, from about 5 mg to about 1000 mg, from about 5 mg to about 900 mg, from about 10 mg to about 1000 mg, from about 10 mg to about 900 mg, from about 10 mg to about 800 mg, from about 10 mg to about 700 mg, from about 10 mg to about 600 mg, from about 10 mg to about 500 mg, from about 10 mg to about 400 mg, from about 10 mg to about 300 mg, from about 10 mg to about 200 mg, from about 10 mg to about 100 mg, from about 10 mg to about 90 mg, from about 10 mg to about 80 mg, from about 10 mg to about 70 mg, from about 10 mg to about 60 mg, from about 10 mg to about 50 mg, from about 10 mg to about 40 mg, from about 10 mg to about 30 mg, from about 10 mg to about 20 mg, from about 50 mg to about 1000 mg, from about 50 mg to about 900 mg, from about 50 mg to about 800 mg, from about 50 mg to about 700 mg, from about 50 mg to about 600 mg, from about 50 mg to about 500 mg, from about 50 mg to about 400 mg, from about 50 mg to about 300 mg, from about 50 mg to about 200 mg, from about 50 mg to about 100 mg, from about 50 mg to about 90 mg, from about 50 mg to about 80 mg, from about 50 mg to about 70 mg, from about 50 mg to about 60 mg. In certain embodiments, the dosing amount is less than about 0.1 mg, 0.5 mg, 1 mg, 5 mg, 10 mg, 20mg, 30 mg, 40mg, 50mg, 60 mg, 70mg, 80 mg, 90mg, 100mg, 150mg, 200 mg, 250mg, 300 mg, 350mg, 400mg, 450 mg, 500mg, 550 mg, 600mg, 650mg, 700mg, 750 mg, 800mg, 850 mg, 900mg, 950mg, 1000mg, 1200mg, 1500mg, or 2000mg. In certain embodiments, dosing amounts of the compounds of the present disclosure is from about 0.1 mg / kg to about 200 mg / kg, from about 0.1 mg / kg to about 100 mg / kg, from about 0.1 mg / kg to about 90 mg / kg, from about 0.1 mg / kg to about 80 mg / kg, from about 0.1 mg / kg to about 70 mg / kg, from about 0.1 mg / kg to about 60 mg / kg, from about 0.1 mg / kg to about 50 mg / kg, from about 0.1 mg / kg to about 40 mg / kg, from about 0.1 mg / kg to about 30 mg / kg, from about 0.1 mg / kg to about 20 mg / kg, from about 0.1 mg / kg to about 10 mg / kg, from about 0.1 mg / kg to about 9 mg / kg, from about 0.1 mg / kg to about 8 mg / kg, from about 0.1 mg / kg to about 7 mg / kg, from about 0.1 mg / kg to about 6 mg / kg, from about 0.1 mg / kg to about 5 mg / kg, from about 0.1 mg / kg to about 4 mg / kg, from about 0.1 mg / kg to about 3 mg / kg, from about 0.1 mg / kg to about 2 mg / kg, from about 0.1 mg / kg to about 1 mg / kg, from about 1 mg / kg to about 200 mg / kg, from about 5 mg / kg to about 200 mg / kg, from about 10 mg / kg to about 200 mg / kg, from about 20 mg / kg to about 200 mg / kg, from about 30 mg / kg to about 200 mg / kg, from about 40 mg / kg to about 200 mg / kg, from about 50 mg / kg to about 200 mg / kg, from about 60 mg / kg to about 200 mg / kg, from about 70 mg / kg to about 200 mg / kg, from about 80 mg / kg to about 200 mg / kg, from about 90 mg / kg to about 200 mg / kg, from about 100 mg / kg to about 200 mg / kg, from about 150 mg / kg to about 200 mg / kg, from about 5 mg / kg to about 150 mg / kg, from about 5 mg / kg to about 100 mg / kg, from about 5 mg / kg to about 90 mg / kg, from about 10 mg / kg to about 100 mg / kg, from about 10 mg / kg to Attorney Docket No.: 87JA-396165-WO about 90 mg / kg, from about 10 mg / kg to about 80 mg / kg, from about 10 mg / kg to about 70 mg / kg, from about 10 mg / kg to about 60 mg / kg, from about 10 mg / kg to about 50 mg / kg, from about 10 mg / kg to about 40 mg / kg, from about 10 mg / kg to about 30 mg / kg, from about 10 mg / kg to about 20 mg / kg, from about 10 mg / kg to about 15 mg / kg. In certain embodiments, the dosing amount of the compounds of the present disclosure is equivalent or less than about 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 0.6 mg / kg, 0.7 mg / kg, 0.8 mg / kg, 0.9 mg / kg, 1 mg / kg, 2 mg / kg, 3 mg / kg, 4 mg / kg, 5 mg / kg, 6 mg / kg, 7 mg / kg, 8 mg / kg, 9 mg / kg, 10 mg / kg, 15 mg / kg, 20mg / kg, 25 mg / kg, 30 mg / kg, 35 mg / kg, 40mg / kg, 45mg / kg, 50mg / kg, 55mg / kg, 60 mg / kg, 65mg / kg, 70mg / kg, 75mg / kg, 80 mg / kg, 85mg / kg, 90mg / kg, 95mg / kg, 100mg / kg, 150mg / kg, 180mg / kg, or 200 mg / kg. In some embodiments, the siRNA composition is conjugated to a non-nucleotide moiety, e.g., a targeting ligand. Ligand–siRNA conjugates can transport the siRNA composition to desired tissues and cells by specific recognition and interactions between the ligand, e.g., a carbohydrate, peptide, antibody, aptamer, small molecule, etc., and a cell-specific surface receptor. The targeting ligand can be, for example, a small molecule, an agonist, an antagonist, a cytokine, a carbohydrate, a peptide, an antibody or fragment thereof, a vitamin, a folate, a natural product, an aptamer, among other targeting ligands known in the art. In some embodiments, the siRNA compositions comprise N-acetylgalactosamine (GalNAc)- siRNA conjugates. In some embodiments, the siRNA composition comprises sequential conjugation of one or more GalNAc residues via nucleosidic linkages. In some embodiments, siRNA compositions disclosed herein include a lipid conjugate. In some embodiments, the siRNA lipid conjugate is formulated as a pharmaceutical composition as described herein. The lipid conjugate can be selected, for example, from the group consisting of 2'-O-C16, 5'-C16- NHC6, 3'-C16-NHC6, 5'-C18-NHC6, 5'-C18:1-NHC6, 5'-C12-NHC6, 5'-C14-NHC6, 3'-C14-NHC6, 5'-C14-PS, 5'- C16-PS, 5'-C18-PS, 3'-C18-NHC6, 5'-C18:2-NHC6, 5'-C20:4-NHC6, 5'-C22:6-NHC6, and 5'-Chol-NHC6. The lipid conjugate can be selected from the group consisting of palmitic acid, stearic acid, oleic acid, lauric acid, myristic acid, myristyl alcohol, palmityl alcohol, stearyl alcohol, linoleic acid, arachidonic acid, docosahexaenoic acid, and cholesterol. In some embodiments, the lipid conjugate can be conjugated to the siRNA composition by a linker. selected from the group consisting of oxygen, sulfur, C(O), C(O)NH, SO, SO2, SO2NH, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, arylalkyl, arylalkenyl, arylalkynyl, heteroarylalkyl, heteroarylalkenyl, heteroarylalkynyl, heterocyclylalkyl, heterocyclylalkenyl, heterocyclylalkynyl, aryl, heteroaryl, heterocyclyl, cycloalkyl, cycloalkenyl, alkylarylalkyl, alkylarylalkenyl, alkylarylalkynyl, alkenylarylalkyl, alkenylarylalkenyl, Attorney Docket No.: 87JA-396165-WO alkenylarylalkynyl, alkynylarylalkyl, alkynylarylalkenyl, alkynylarylalkynyl, alkylheteroarylalkyl, alkylheteroarylalkenyl, alkylheteroarylalkynyl, alkenylheteroarylalkyl, alkenylheteroarylalkenyl, and alkenylheteroarylalkynyl. The lipid conjugate can be conjugated to the siRNA composition at the 5ʹ-end of the sense strand, or the 3ʹ-end of the sense strand, or an internal 2ʹ-position of the sense strand. Methods of Treatment Also disclosed herein are methods of treating a disease in a human subject and compositions for use in treating HMGCR-mediated diseases and conditions. The term “HMGCR-mediated disease and condition” refers to diseases and conditions characterized with HMGCR overexpression or insufficient suppression. As provided above, non-limiting examples of HMGCR-mediated diseases and conditions include dyslipidemia (e.g., hyperlipidemias), cardiovascular diseases, cancers, diabetes, non-alcoholic fatty liver disease (NAFLD), and age-related macular degeneration (AMD). In one embodiment, a method is provided for treating hyperlipidemia in a subject in need thereof. In one embodiment, a method is provided for treating a subject diagnosed as having, or being at risk for, hyperlipidemia. In one embodiment, a method is provided for treating a subject diagnosed as having, or being at risk for, hypercholesterolemia. In one embodiment, a method is provided for treating a subject diagnosed as having, or being at risk for, hypertriglyceridemia. In one embodiment, a method is provided for treating a subject diagnosed as having, or being at risk for, hypercholesterolemia and hypertriglyceridemia. In some embodiments, the hyperlipidemia is a Type Ia, Ib, Ic, IIa, IIb, III, IV, or V familial hyperlipidemia. In some embodiments, the hyperlipidemia is an acquired hyperlipidemia, such as one caused by diabetes, use of drugs such as thiazide diuretics, beta blockers, and estrogens, hypothyroidism, kidney failure, nephrotic syndrome, alcohol consumption, endocrine disorders, and metabolic disorders. In some embodiments, the levels of HMG-CoA reductase and / or HMGCR mRNA are reduced by at least 40% in the liver cell of the subject. In one embodiment, a method is provided for treating cardiovascular disease in a subject in need thereof. In some embodiments, the cardiovascular disease is heart attack, ischemic stroke, or a peripheral artery disease (PAD). In one embodiment, a method is provided for treating cancer in a subject in need thereof. In some embodiments, the cancer is lung cancer, ovarian cancer, or breast cancer. In some embodiments, the cancer is bladder cancer, renal cancer, urethral cancer, colorectal cancer, head and neck cancer, squamous cell cancer, Merkel cell carcinoma, gastrointestinal cancer, stomach cancer, esophageal cancer, or renal cancer. Attorney Docket No.: 87JA-396165-WO In one embodiment, a method is provided for treating diabetes in a subject in need thereof. In one embodiment, a method is provided for treating non-alcoholic fatty liver disease (NAFLD) in a subject in need thereof. In one embodiment, a method is provided for treating an inflammatory disease in a subject in need thereof. In some embodiments, the inflammatory disease is rheumatoid arthritis or a chronic inflammatory disease. The methods of treating a disease in a human subject can include methods of treating age-related macular degeneration (AMD). In some embodiments the AMD is wet AMD. In some embodiments, the AMD is dry AMD. In some embodiments, the AMD is early AMD. In some embodiments, the AMD is intermediate AMD. In some embodiments, the AMD is geographic atrophy. The methods of treating a disease in a human subject can include methods of treating AMD using siRNA compositions. The methods of treatment described herein can include the administration of pharmaceutical compositions and formulations described herein and comprising siRNA compositions designed to target a disease-associated RNA transcript, e.g., a transcript transcribed from the HMGCR gene. In some embodiments, the compositions are formulated with a pharmaceutically acceptable carrier. In general, the pharmaceutical compositions and / or formulations are formulated to be administered to the eye. For example, the pharmaceutical compositions and / or formulations can be administered by intraocular injection. In some embodiments, the pharmaceutical compositions and / or formulations are administered by intravitreal or suprachoroidal injection. In some embodiments, administration of the injectable dosage form includes administration of a sterile aqueous solutions or dispersions including the siRNA compositions disclosed herein. In some embodiments administration of the injectable dosage form includes administration of a sterile solution including the siRNA compositions disclosed herein in combination with a diluent such as water; saline solution; fixed oils, polyethylene glycols, glycerin, or propylene glycol. The pharmaceutical compositions can be formulated in any way and can be administered in a variety of unit dosage forms depending upon the condition or disease and the degree of illness, the general medical condition of each patient, and the resulting method of administration. Details on techniques for formulation and administration of pharmaceuticals are well described in the scientific and patent literature, see, e.g., Remington: The Science and Practice of Pharmacy, 21st ed., 2005. The siRNA compositions can be administered alone or as a component of a pharmaceutical formulation (composition). The compositions can be formulated for administration in any convenient way for use in human or veterinary medicine. Formulations of the compositions disclosed herein include those suitable for intraocular administration. The formulations may conveniently be presented in unit dosage form and may be prepared by any methods known in the art of pharmacy. The amount of active ingredient (e.g., siRNA compositions Attorney Docket No.: 87JA-396165-WO disclosed herein) which can be combined with a carrier material or conjugate to produce a single dosage form can vary depending upon the subject or patient being treated, and the particular mode of administration. The amount of active ingredient that can be combined with a carrier material or conjugate to produce a single dosage form will generally be the amount of the compound that produces a therapeutic effect, e.g., degradation a target RNA transcript, e.g., an HMGCR transcript, and / or reduction in a symptom of a disease in a patient. In some embodiments, the compositions and formulations can be delivered by the use of liposomes. By using liposomes, particularly where the liposome surface carries ligands specific for target cells, or are otherwise preferentially directed to a specific organ, one can focus the delivery of the active agent into target cells in vivo. See, e.g., U.S. Patent Nos.6,063,400; 6,007,839; Al-Muhammed (1996) J. Microencapsul.13:293-306; Chonn (1995) Curr. Opin. Biotechnol.6:698-708; Ostro (1989) Am. J. Hosp. Pharm.46:1576-1587. As used herein, the term “liposome” means a vesicle composed of amphiphilic lipids arranged in a bilayer or bilayers. Liposomes are unilamellar or multilamellar vesicles that have a membrane formed from a lipophilic material and an aqueous interior that contains the composition to be delivered. Cationic liposomes are positively charged liposomes that are believed to interact with negatively charged DNA molecules to form a stable complex. Liposomes that are pH-sensitive or negatively-charged are believed to entrap, rather than complex with, the DNA. Both cationic and noncationic liposomes have been used to deliver DNA to cells. Liposomes can also include “sterically stabilized” liposomes, i.e., liposomes comprising one or more specialized lipids. When incorporated into liposomes, these specialized lipids result in liposomes with enhanced circulation lifetimes relative to liposomes lacking such specialized lipids. Examples of sterically stabilized liposomes are those in which part of the vesicle-forming lipid portion of the liposome comprises one or more glycolipids or is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety. Liposomes and their uses are further described in U.S. Pat. No. 6,287,860. The formulations disclosed herein can be administered for prophylactic and / or therapeutic treatments. In some embodiments, for therapeutic applications, compositions are administered to a subject who is in need of reduced HMGCR levels, or who is at risk of or has a disorder described herein, in an amount sufficient to cure, alleviate, or partially arrest the clinical manifestations of the disorder or its complications; this is called a “therapeutically effective amount” as used herein. For example, in some embodiments, pharmaceutical compositions are administered in an amount sufficient to decrease levels of HMGCR in cells of the subject. In some embodiments, the cells are retinal cells. In some embodiments, the cells are retinal pigment epithelium cells. Attorney Docket No.: 87JA-396165-WO The amount of a pharmaceutical composition adequate to accomplish this is a therapeutically effective amount. The dosage schedule and amounts effective for this use, i.e., the dosing regimen, will depend upon a variety of factors, including the stage of the disease or condition, the severity of the disease or condition, the general state of the patient's health, the patient’s physical status, age and the like. In calculating the dosage regimen for a patient, the mode of administration also is taken into consideration. The dosage regimen also takes into consideration pharmacokinetic parameters well-known in the art, i.e., the active agents’ rate of absorption, bioavailability, metabolism, clearance, and the like (see, e.g., Hidalgo-Aragones (1996) J. Steroid Biochem. Mol. Biol.58:611-617; Groning (1996) Pharmazie 51:337- 341; Fotherby (1996) Contraception 54:59-69; Johnson (1995) J. Pharm. Sci.84:1144-1146; Rohatagi (1995) Pharmazie 50:610-613; Brophy (1983) Eur. J. Clin. Pharmacol.24:103-108; Remington: The Science and Practice of Pharmacy, 21st ed., 2005). The state of the art allows the clinician to determine the dosage regimen for each individual patient, active agent and disease or condition treated. Guidelines provided for similar compositions used as pharmaceuticals can be used as guidance to determine the dosage regiment, i.e., dose schedule and dosage levels, for administration of the pharmaceutical compositions, e.g., siRNA compositions targeting the HMGCR gene, as disclosed herein. In some embodiments, the siRNA compositions are administered to the subject having AMD as an intraocular injection in a dose range of less than 1 mg / kg, less than 0.9 mg / kg, less than 0.8 mg / kg, less than 0.7 mg / kg, less than 0.6 mg / kg, less than 0.5 mg / kg, less than 0.4 mg / kg, less than 0.3 mg / kg, less than 0.2 mg / kg, less than 0.1 mg / kg, less than 0.09 mg / kg, less than 0.08 mg / kg, less than 0.07 mg / kg, less than 0.06 mg / kg, less than 0.05 mg / kg, less than 0.04 mg / kg, less than 0.03 mg / kg, less than 0.02 mg / kg, or less than 0.01 mg / kg. In some embodiments, the siRNA compositions are administered to the subject having AMD as an intraocular injection in a dose range from about less than 1 mg / kg, e.g., less than 0.1 mg / kg, e.g., less than 0.01 mg / kg. In some embodiments, the dose interval between injection is one week or more, one month or more, two months or more, or three months or more. In some embodiments, the dose interval between injections is at least about 1, 2, or 3 months. Single or multiple administrations of formulations can be given depending on for example: the dosage and frequency as required and tolerated by the patient, the degree and amount of therapeutic effect generated after each administration (e.g., extent of relieving AMD-related symptoms), and the like. The formulations should provide a sufficient quantity of active agent, e.g., siRNA duplex, to effectively treat, prevent or ameliorate conditions, diseases, or symptoms. Attorney Docket No.: 87JA-396165-WO EXAMPLES The invention is further described in the following examples, which do not limit the scope of the invention described in the claims. EXAMPLE 1: Evaluating siRNA Knockdown of HMGCR in Hep3B Cells To evaluate the activity of the siRNA compositions disclosed herein, the siRNAs disclosed in Table 2 (sense strands SEQ ID NOs: 1072-1606, antisense strands SEQ ID NOs: 1607-2141) were synthesized and tested in Hep3B cells at two doses: 20 nM and 0.3 nM. Cells were plated in 96-well plates at approximately 15,000 cells per well. siRNAs were added to each well to a final concentration of either 20 nM and 0.3 nM, with four wells per siRNA duplex for biological quadruplicates. LipofectamineTMRNAiMax transfection reagent was used at a concentration of 0.3 µL / well to mediate reverse transfection. After transfection, cells were incubated for 24 hours. HMGCR mRNA expression was quantified by branched DNA (bDNA) assay using the QuantiGeneTMSimpleplex gene expression assay. Results for HMGCR mRNA expression normalized to GAPDH for each of 535 siRNA duplexes are provided in Table 3 below. Means and standard deviations (SD) from biological quadruplicates are provided for the 20 nM doses and 0.3 nM doses. Table 3 – HMGCR Expression in Hep3B cells Attorney Docket No.: 87JA-396165-WO Attorney Docket No.: 87JA-396165-WO Attorney Docket No.: 87JA-396165-WO Attorney Docket No.: 87JA-396165-WO Attorney Docket No.: 87JA-396165-WO Attorney Docket No.: 87JA-396165-WO Attorney Docket No.: 87JA-396165-WO Attorney Docket No.: 87JA-396165-WO Attorney Docket No.: 87JA-396165-WO Attorney Docket No.: 87JA-396165-WO Based on the results for HMGCR mRNA expression normalized to GAPDH for each of 535 siRNA duplexes at 20 nM and 0.3 nM, 40 siRNA duplexes were prioritized for further characterization as described in Example 2 below. A potency cutoff of greater than 50% mRNA knockdown (KD) at a dose of 20 nM was used to prioritize siRNA duplexes. Selection of the 40 siRNA duplexes further characterized in Example 2 below was also based on species cross-reactivity and included enumeration of potential off-target sites across the entire human transcriptome for both the sense and antisense strands, assessment of overlap with known miRNA binding sites, and excluding siRNAs that overlapped with human single-nucleotide polymorphisms (SNPs). Attorney Docket No.: 87JA-396165-WO For compatibility with the preferred and minimal essential safety and efficacy species, and to circumvent the need for surrogate siRNAs, subset of siRNAs with cross-reactivity with one or more of rabbit, minipig, dog, and NHP were included among the 40 siRNA duplexes. To minimize the risk of off- target RNAi activity, the siRNAs were ranked and selected based on the number of sequence matches across the entire human transcriptome, allowing from 1 to 4 mismatches. To minimize the risk of miRNA-based off-target activity, sequences overlapping known miRNA binding sites in the transcriptomes of human or preclinical species were excluded or deprioritized, respectively. Finally, to minimize the potential for non-responders in the clinic due to single nucleotide polymorphisms (SNP), siRNA sequences overlapping with high-confidence human SNP were excluded. EXAMPLE 2: Dose Response Analysis for Selected siRNA Duplexes To evaluate the dose response of selected siRNA compositions disclosed herein, a subset of 40 of the siRNAs evaluated in Example 1 were further tested in a dose-response experiment. As described above, the 40 siRNA duplexes were prioritized based on species cross-reactivity, lack of human single- nucleotide polymorphisms (SNPs) within the siRNA target site, and lack of predicted off-target sites, and lack of known miRNA binding sites. The 40 siRNA duplexes were tested in Hep3B cells at doses ranging from 30 nM (maximum concentration) to 16 fM (lowest concentration) at 5-fold increments. Cells were plated in 96-well plates at approximately 15,000 cells per well. Each concentration was tested in four wells to generate biological quadruplicates. LipofectamineTMRNAiMax transfection reagent was used at a concentration of 0.3 µL / well to mediate reverse transfection. After transfection, cells were incubated for 24 hours. HMGCR mRNA expression was quantified by branched DNA (bDNA) assay using the QuantiGene Simpleplex gene expression assay. HMGCR mRNA expression was normalized to GAPDH for each well. IC50 and IC80 were quantified using XLfit® software. IC50, IC80, and maximum inhibition at 30 nM are provided in Table 4 below. Table 4 – Dose Response for Selected siRNA Duplexes with Hep3B Cells Attorney Docket No.: 87JA-396165-WO Based on these dose-response results, seven siRNA duplexes (XD-60671, XD-60690, XD-60785, XD- 60843, XD-60893, XD-61019, and XD-61081) were selected for lead optimization, as described in further detail in Example 3 below. The seven siRNA duplexes were selected based on a combination of potency in the dose-response assay, predicted cross-reactivity with rabbit and / or minipig, and the off- target specificity profiles against the human transcriptome. EXAMPLE 3: Evaluating siRNA Modification Patterns Based on the screening results provided in Examples 1 and 2, seven siRNA duplexes were prioritized for lead optimization. The seven siRNA duplexes were selected based on a combination of potency in the dose-response assay, predicted cross-reactivity with rabbit and / or minipig, and the off- target specificity profiles against the human transcriptome. The seven prioritized siRNA duplexes are provided in Table 5 below. Attorney Docket No.: 87JA-396165-WO Table 5 – Prioritized siRNA Duplexes Each of the seven siRNA duplexes provided in Table 5 were synthesized with each of seven unique nucleotide modification patterns. Nucleotide modifications included 2ʹ-fluoro, 2ʹ-O-methyl, phosphorothioate linkages between nucleotides, and 5ʹ-vinylphosphonate-2ʹ-O-methyl. The seven unique nucleotide modification patterns are shown graphically in FIG.1 and also provided in Tables 6 and 7 below. Table 6 - Sense strand modifications (5ʹ to 3ʹ orientation) Table 7 - Antisense strand modifications (5ʹ to 3ʹ orientation) _ _ In each of Tables 6 and 7, X represents a ribonucleotide having a 2ʹ-fluoro modification; Y represents a ribonucleotide having a 2ʹ-O-methyl modification, and Z represents a 5ʹ-vinylphosphonate-2ʹ- O-methyl modified uracil. Attorney Docket No.: 87JA-396165-WO Each of the seven siRNA duplexes provided in Table 5 were synthesized to include each of seven unique nucleotide modification patterns and tested in four wells to generate biological quadruplicates. The siRNA duplexes representing each of seven unique nucleotide modification patterns for the seven siRNA duplexes (49 species total) were tested in ARPE-19 cells at doses ranging from 30 nM (maximum concentration) to 16 fM (lowest concentration) at 5-fold increments. Cells were plated in 96-well plates at approximately 15,000 cells per well. DharmaFECT-3TMtransfection reagent was used at a concentration of 0.3 µL / well to mediate reverse transfection. After transfection, cells were incubated for 24 hours. HMGCR mRNA expression was quantified by a branched DNA (bDNA) assay using the QuantiGene™ SinglePlex gene expression assay. HMGCR mRNA expression was normalized to GAPDH for each well. IC50 and IC80 were quantified using XLfit® software. IC50, IC80, and maximum inhibition at 30 nM are provided in Table 8 below. Table 8 - Dose Response for Selected Modified siRNA Duplexes with ARPE-19 Cells Attorney Docket No.: 87JA-396165-WO EXAMPLE 4: Dose Response Analysis for Selected siRNA Duplexes in ARPE-19 Cells and Hep3B Cells To evaluate the dose response of selected siRNA compositions disclosed herein, a subset of 9 of the siRNAs were further tested in a dose-response experiment comparing activity when tested in ARPE- 19 cells or in Hep3B cells. The 9 siRNA duplexes were tested in ARPE-19 cells and in Hep3B cells at doses ranging from 30 nM (maximum concentration) to 16 fM (lowest concentration) at 5-fold increments. Cells were plated in 96-well plates at approximately 15,000 cells per well. Attorney Docket No.: 87JA-396165-WO Each concentration was tested in four wells to generate biological quadruplicates. LipofectamineTMRNAiMax transfection reagent was used at a concentration of 0.3 µL / well to mediate reverse transfection. After transfection, cells were incubated for 24 hours. HMGCR mRNA expression was quantified by branched DNA (bDNA) assay using the QuantiGene™ Singleplex gene expression assay. HMGCR mRNA expression was normalized to GAPDH for each well. IC50 was quantified using XLfit® software. IC50s in ARPE-19 cells and Hep3B cells and ratio of Hep3B IC50 to ARPE-19 IC50 are provided in Table 9 below. Table 9 – Dose Response for Selected siRNA Duplexes with Hep3B Cells These results indicate that the IC50 values against the two cell lines are not proportional, i.e., the IC50 ratios vary across the sequences by more than an order of magnitude. EXAMPLE 5: In Vivo Efficacy of GalNAc conjugated siRNA duplex To evaluate the in vivo efficacy of the selected siRNA compositions disclosed herein in reducing the mRNA expression of the HMGCR, a hyperlipidemic rabbit model was established. A triantennary GalNAc conjugated siRNA duplex (XD-60843) is used. GalNAc conjugated XD-60843 (1) sense (21mer) having the structure of formula II: 5'-(GalNAc3)(NHC6)csusacAfcucUfCfAfuuaaaaaAfscsa-3' (SEQ ID NO: 2142) (2) antisense (23mer) 5'-(vinu)sGfsuuuuuuaaugaGfaguguagsasu-3' (SEQ ID NO: 2143) Modifications: Lowercase n: 2’-O-methyl residues Nf: 2´-Fluoro residues Attorney Docket No.: 87JA-396165-WO s: phosphorothioate backbone modification (vinu): 5'-vinylphosphonate-2'-OMe-U (GalNAc3): Triantennary GalNAc3 ligand (NHC6): Aminohexyl linker The treatment regime is shown in FIG.2 and Tables 10-11 below. Table 10. Grouping and diet plan of rabbit Table 11. Dosing table in mg / kg *A “0” indicates a vehicle dose of saline was administered. N / A indicates no dose was given. Attorney Docket No.: 87JA-396165-WO • Necropsy: - Group 1 was sacrificed on Day 77 - Groups 2 – 6 were sacrificed on Day 78 - Liver and muscle tissue was collected in addition to other body tissues for potential future assays Analytical methods using Quantitative PCR (qPCR) were conducted. Quantitative PCR (qPCR) qPCR was performed in order to assess the influence of the siRNA on HMGCR gene expression as well as to quantify PCSK9 and LDLR expression within the liver and skeletal muscle. ABI Taqman gene expression assays were used using GAPDH and HPRT1 as reference genes for liver and muscle tissue, respectively. Tissue from the four lobes of the liver and from the biceps femoris was flash frozen in liquid nitrogen. 1. qPCR in the liver The difference of HMGCR expression in liver are shown in FIG.3A. (i) There is a 40% reduction of the HMGCR expression between Group 1 standard diet control and Group 6 high cholesterol diet control; (ii) No significant difference between Group 1 standard diet control and Group 2 statin positive control; (iii) About 45% increase in HMGCR expression between Group 2 statin positive control and Group 6 high cholesterol control; (iv) 70 – 75% reduction in expression in Groups 3 & 4 low and high dose siRNA arms vs Group 6 high cholesterol control. Note Group 3 & 4 received a 4th siRNA dose prior to termination; (v) 43% reduction in expression in Groups 5 high cholesterol high dose siRNA arms vs Group 6 high cholesterol control. The difference of LDLR expression in liver are shown in FIG.3B. Animals exposed to a high cholesterol diet (Groups 2 – 6) have reduced LDLR expression, and Groups 4 LDLR expression levels are higher than that of Group 2 statin control. 2 qPCR in the muscle The difference of HMGCR expression in the muscle are shown in FIG.3C, which shows that the HMGCR expression levels in Groups 2 – 5 are not significantly difference than that of Group 6. The difference of LDLR expression in the muscle are shown in FIG.3D, showing that animals exposed to a high cholesterol diet (Groups 2 – 6) have reductions in LDLR expression. The results above revealed that the GalNAc-siRNA is able to knock down HMGCR in the liver without impacting skeletal muscle HMGCR levels which have been implicated in the cause of statin associated muscle soreness (SAMS) and other side effects. The HMGCR knockdown effect in the liver is shown to be significant as well as durable over several weeks. The blood chemistry data did clearly show Attorney Docket No.: 87JA-396165-WO liver responses to siRNA and statin dosing (ALT, AST) further supporting the appropriate delivery of siRNA to its intended target in addition to the definitive qPCR results. Importantly, the rabbits did not have gross adverse reactions to the therapeutic dosing and injection-site irritation was no worse than vehicle controls. OTHER EMBODIMENTS It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

Attorney Docket No.: 87JA-396165-WO WHAT IS CLAIMED IS:

1. An siRNA duplex, comprising a sense sequence and an antisense sequence, wherein the sense sequence and the antisense sequence are at least partially complementary to each other, and wherein the sense sequence comprises a polynucleotide sequence that differs by no more than 1, 2, 3, 4, or 5 nucleotides from any one of the sense sequences recited in Table 1.

2. The siRNA duplex of claim 1, wherein the antisense sequence comprises a polynucleotide sequence that differs by no more than 1, 2, 3, 4, or 5 nucleotides from any of the antisense sequences recited in Table 1.

3. The siRNA duplex of claim 1 or claim 2, wherein the sense sequence comprises 19-25 nucleotides and the antisense sequence comprises 19-25 nucleotides.

4. The siRNA duplex of any one of claims 1-4, wherein the sense sequence comprises 21 nucleotides and the antisense sequence comprises 23 nucleotides.

5. The siRNA duplex of any one of claims 1-4, wherein the sense sequence and the antisense sequence are complementary to each other for at least 19 continuous nucleotides.

6. The siRNA duplex of any one of claims 1-5, wherein the antisense sequence comprises an overhang of one or more nucleotides at the 3ʹ end of the antisense sequence, wherein the overhang is two nucleotides in length.

7. The siRNA duplex of any one of claims 1-6, wherein the sense sequence and / or the antisense sequence comprises one or more modified nucleotides.

8. The siRNA duplex of any one of claims 1-7, wherein the sense sequence and / or the antisense sequence comprises one or more deoxyribonucleotides.

9. The siRNA duplex of any one of claims 1-8, wherein the one or more modified nucleotides comprise a modification at the 2ʹ position of the nucleotide.Attorney Docket No.: 87JA-396165-WO 10. The siRNA duplex of claim 9, wherein the modification at the 2ʹ position of the nucleotide is selected from the group consisting of OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl can be substituted or unsubstituted C1 to C10 alkyl or C2 to C10 alkenyl and alkynyl.

11. The siRNA duplex of any one of claims 7-10, wherein the sense sequence and / or the antisense sequence comprises one or more 2ʹ-fluoro modified nucleotides.

12. The siRNA duplex of any one of claims 7-11, wherein the sense sequence and / or the antisense sequence comprises one or more 2ʹ-O-methyl modified nucleotides.

13. An siRNA duplex, wherein the siRNA duplex comprises a sense sequence and an antisense sequence, wherein the sense sequence and the antisense sequence are at least partially complementary to each other, wherein the sense sequence comprises modified ribonucleotides represented by one of the following formulae in a 5ʹ to 3ʹ orientation: X1-Y2-X3-Y4-X5-Y6-X7-Y8-X9-X10-X11-Y12-X13-Y14-X15-Y16-X17-Y18-X19-Y20-X21; or Y1-Y2-Y3-Y4-Y5-Y6-X7-Y8-X9-X10-X11-Y12-Y13-Y14-Y15-X16-X17-Y18-Y19-Y20-Y21; or Y1-Y2-Y3-Y4-Y5-Y6-X7-Y8-X9-X10-X11-Y12-Y13-Y14-Y15-Y16-Y17-Y18-Y19-Y20-Y21; or Y1-Y2-Y3-Y4-X5-Y6-Y7-Y8-X9-X10-X11-Y12-Y13-Y14-Y15-Y16-Y17-Y18-X19-Y20-Y21; and wherein the antisense sequence comprises modified ribonucleotides represented by one of the following formulae in a 5ʹ to 3ʹ orientation: Y1-X2-Y3-X4-Y5-X6-Y7-X8-Y9-X10-Y11-Y12-Y13-X14-Y15-X16-Y17-X18-Y19-X20-Y21-Y22-Y23; or Z1-X2-Y3-X4-Y5-X6-Y7-X8-Y9-X10-Y11-Y12-Y13-X14-Y15-X16-Y17-X18-Y19-X20-Y21-Y22-Y23; or Z1-X2-Y3-Y4-Y5-X6-Y7-X8-X9-Y10-Y11-Y12-Y13-X14-Y15-X16-Y17-Y18-Y19-Y20-Y21-Y22-Y23; or Z1-X2-Y3-Y4-Y5-X6-Y7-Y8-Y9-Y10-Y11-Y12-Y13-X14-Y15-X16-Y17-Y18-Y19-Y20-Y21-Y22-Y23; or Z1-X2-Y3-Y4-Y5-Y6-Y7-Y8-Y9-Y10-Y11-Y12-Y13-X14-Y15-Y16-Y17-Y18-Y19-Y20-Y21-Y22-Y23; wherein X represents a ribonucleotide having a 2ʹ-fluoro modification; Y represents a ribonucleotide having a 2ʹ-O-methyl modification, and Z represents a 5ʹ-vinylphosphonate-2ʹ-O-methyl modified uracil.

14. The siRNA duplex of claim 13, which is capable of inhibiting the expression of the human HMGCR gene.Attorney Docket No.: 87JA-396165-WO 15. The siRNA duplex of claim 13 or claim 14, wherein the sense sequence comprises modified ribonucleotides represented by the following formula in a 5ʹ to 3ʹ orientation: X1-Y2-X3-Y4-X5-Y6-X7-Y8-X9-X10-X11-Y12-X13-Y14-X15-Y16-X17-Y18-X19-Y20-X21; and the antisense sequence comprises modified ribonucleotides represented by the following formula in a 5ʹ to 3ʹ orientation: Y1-X2-Y3-X4-Y5-X6-Y7-X8-Y9-X10-Y11-Y12-Y13-X14-Y15-X16-Y17-X18-Y19-X20-Y21-Y22-Y23.

16. The siRNA duplex of claim 13 or claim 14, wherein the sense sequence comprises modified ribonucleotides represented by the following formula in a 5ʹ to 3ʹ orientation: X1-Y2-X3-Y4-X5-Y6-X7-Y8-X9-X10-X11-Y12-X13-Y14-X15-Y16-X17-Y18-X19-Y20-X21; and the antisense sequence comprises modified ribonucleotides represented by the following formula in a 5ʹ to 3ʹ orientation: Z1-X2-Y3-X4-Y5-X6-Y7-X8-Y9-X10-Y11-Y12-Y13-X14-Y15-X16-Y17-X18-Y19-X20-Y21-Y22-Y23.

17. The siRNA duplex of claim 13 or claim 14, wherein the sense sequence comprises modified ribonucleotides represented by the following formula in a 5ʹ to 3ʹ orientation: Y1-Y2-Y3-Y4-Y5-Y6-X7-Y8-X9-X10-X11-Y12-Y13-Y14-Y15-X16-X17-Y18-Y19-Y20-Y21; and the antisense sequence comprises modified ribonucleotides represented by the following formula in a 5ʹ to 3ʹ orientation: Z1-X2-Y3-Y4-Y5-X6-Y7-X8-X9-Y10-Y11-Y12-Y13-X14-Y15-X16-Y17-Y18-Y19-Y20-Y21-Y22-Y23.

18. The siRNA duplex of claim 13 or claim 14, wherein the sense sequence comprises modified ribonucleotides represented by the following formula in a 5ʹ to 3ʹ orientation: Y1-Y2-Y3-Y4-X5-Y6-Y7-Y8-X9-X10-X11-Y12-Y13-Y14-Y15-Y16-Y17-Y18-X19-Y20-Y21; and the antisense sequence comprises modified ribonucleotides represented by the following formula in a 5ʹ to 3ʹ orientation: Z1-X2-Y3-Y4-Y5-X6-Y7-X8-X9-Y10-Y11-Y12-Y13-X14-Y15-X16-Y17-Y18-Y19-Y20-Y21-Y22-Y23.

19. The siRNA duplex of claim 13 or claim 14, wherein the sense sequence comprises modified ribonucleotides represented by the following formula in a 5ʹ to 3ʹ orientation: Y1-Y2-Y3-Y4-Y5-Y6-X7-Y8-X9-X10-X11-Y12-Y13-Y14-Y15-Y16-Y17-Y18-Y19-Y20-Y21; and the antisense sequence comprises modified ribonucleotides represented by the following formula in a 5ʹ to 3ʹ orientation: Z1-X2-Y3-Y4-Y5-X6-Y7-X8-X9-Y10-Y11-Y12-Y13-X14-Y15-X16-Y17-Y18-Y19-Y20-Y21-Y22-Y23.Attorney Docket No.: 87JA-396165-WO 20. The siRNA duplex of claim 13 or claim 14, wherein the sense sequence comprises modified ribonucleotides represented by the following formula in a 5ʹ to 3ʹ orientation: Y1-Y2-Y3-Y4-Y5-Y6-X7-Y8-X9-X10-X11-Y12-Y13-Y14-Y15-Y16-Y17-Y18-Y19-Y20-Y21; and the antisense sequence comprises modified ribonucleotides represented by the following formula in a 5ʹ to 3ʹ orientation: Z1-X2-Y3-Y4-Y5-X6-Y7-Y8-Y9-Y10-Y11-Y12-Y13-X14-Y15-X16-Y17-Y18-Y19-Y20-Y21-Y22-Y23.

21. The siRNA duplex of claim 13 or claim 14, wherein the sense sequence comprises modified ribonucleotides represented by the following formula in a 5ʹ to 3ʹ orientation: Y1-Y2-Y3-Y4-X5-Y6-Y7-Y8-X9-X10-X11-Y12-Y13-Y14-Y15-Y16-Y17-Y18-X19-Y20-Y21; and the antisense sequence comprises modified ribonucleotides represented by the following formula in a 5ʹ to 3ʹ orientation: Z1-X2-Y3-Y4-Y5-Y6-Y7-Y8-Y9-Y10-Y11-Y12-Y13-X14-Y15-Y16-Y17-Y18-Y19-Y20-Y21-Y22-Y23.

22. The siRNA duplex of any one of claims 13-21, wherein the sense sequence and / or the antisense sequence comprises one or more phosphorothioate linkages.

23. The siRNA duplex of claim 22, wherein the sense sequence comprises at least two phosphorothioate linkages at the 5ʹ terminus and at least two phosphorothioate linkages at the 3ʹ terminus and the antisense sequence comprises at least two phosphorothioate linkages at the 5ʹ terminus and at least two phosphorothioate linkages at the 3ʹ terminus.

24. The siRNA duplex of claim 23,wherein the sense sequence comprises two phosphorothioate linkages at the 5ʹ terminus and two phosphorothioate linkages at the 3ʹ terminus and no phosphorothioate linkages at the remaining positions; and the antisense sequence comprises two phosphorothioate linkages at the 5ʹ terminus and two phosphorothioate linkages at the 3ʹ terminus and no phosphorothioate linkages at the remaining positions.

25. The siRNA duplex of any one of claims 13-24, which is conjugated to a non-nucleotide moiety.

26. The siRNA duplex of claim 25, wherein a ligand is conjugated at the 5ʹ-end, the 3ʹ-end or an internal 2ʹ-position of the sense strand.Attorney Docket No.: 87JA-396165-WO 27. The siRNA duplex of claim 25 or 26, wherein the non-nucleotide moiety comprises a targeting ligand comprising a small molecule, an agonist, an antagonist, a cytokine, a carbohydrate, a peptide, an antibody or fragment thereof, a vitamin, a folate, a natural product, an aptamer, or a cell-specific surface receptor.

28. The siRNA duplex of claim 27, wherein the non-nucleotide moiety comprises a carbohydrate cluster.

29. The siRNA duplex of claim 28, wherein the carbohydrate cluster is a triantennary (GalNAc)3 ligand having a structure of formula I:

30. The siRNA duplex of any one of claims 25-29, wherein the non-nucleotide moiety is conjugated to the sense strand via a linker.

31. The siRNA duplex of claim 30, wherein the linker is selected from the group consisting of oxygen, sulfur, C(O), C(O)NH, SO, SO2, SO2NH, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, arylalkyl, arylalkenyl, arylalkynyl, heteroarylalkyl, heteroarylalkenyl, heteroarylalkynyl, heterocyclylalkyl, heterocyclylalkenyl, heterocyclylalkynyl, aryl, heteroaryl, heterocyclyl, cycloalkyl, cycloalkenyl, alkylarylalkyl, alkylarylalkenyl, alkylarylalkynyl, alkenylarylalkyl, alkenylarylalkenyl, alkenylarylalkynyl, alkynylarylalkyl, alkynylarylalkenyl, alkynylarylalkynyl, alkylheteroarylalkyl, alkylheteroarylalkenyl, alkylheteroarylalkynyl, alkenylheteroarylalkyl, alkenylheteroarylalkenyl, and alkenylheteroarylalkynyl.

32. The siRNA duplex of claim 31, wherein the linker comprises a terminal functional group for coupling with the non-nucleotide moiety.Attorney Docket No.: 87JA-396165-WO 33. The siRNA duplex of claim 32, wherein the linker comprises aminohexyl.

34. The siRNA duplex of any one of claims 1-33, wherein the sense sequence and the antisense sequence comprise, respectively, the nucleic acid sequences of SEQ ID NO: 2 and 537, 3 and 538, 4 and 539, 5 and 540, 6 and 541, 7 and 542, 8 and 543, 9 and 544, 10 and 545, 11 and 546, 12 and 547, 13 and 548, 14 and 549, 15 and 550, 16 and 551, 17 and 552, 18 and 553, 19 and 554, 20 and 555, 21 and 556, 22 and 557, 23 and 558, 24 and 559, 25 and 560, 26 and 561, 27 and 562, 28 and 563, 29 and 564, 30 and 565, 31 and 566, 32 and 567, 33 and 568, 34 and 569, 35 and 570, 36 and 571, 37 and 572, 38 and 573, 39 and 574, 40 and 575, 41 and 576, 42 and 577, 43 and 578, 44 and 579, 45 and 580, 46 and 581, 47 and 582, 48 and 583, 49 and 584, 50 and 585, 51 and 586, 52 and 587, 53 and 588, 54 and 589, 55 and 590, 56 and 591, 57 and 592, 58 and 593, 59 and 594, 60 and 595, 61 and 596, 62 and 597, 63 and 598, 64 and 599, 65 and 600, 66 and 601, 67 and 602, 68 and 603, 69 and 604, 70 and 605, 71 and 606, 72 and 607, 73 and 608, 74 and 609, 75 and 610, 76 and 611, 77 and 612, 78 and 613, 79 and 614, 80 and 615, 81 and 616, 82 and 617, 83 and 618, 84 and 619, 85 and 620, 86 and 621, 87 and 622, 88 and 623, 89 and 624, 90 and 625, 91 and 626, 92 and 627, 93 and 628, 94 and 629, 95 and 630, 96 and 631, 97 and 632, 98 and 633, 99 and 634, 100 and 635, 101 and 636, 102 and 637, 103 and 638, 104 and 639, 105 and 640, 106 and 641, 107 and 642, 108 and 643, 109 and 644, 110 and 645, 111 and 646, 112 and 647, 113 and 648, 114 and 649, 115 and 650, 116 and 651, 117 and 652, 118 and 653, 119 and 654, 120 and 655, 121 and 656, 122 and 657, 123 and 658, 124 and 659, 125 and 660, 126 and 661, 127 and 662, 128 and 663, 129 and 664, 130 and 665, 131 and 666, 132 and 667, 133 and 668, 134 and 669, 135 and 670, 136 and 671, 137 and 672, 138 and 673, 139 and 674, 140 and 675, 141 and 676, 142 and 677, 143 and 678, 144 and 679, 145 and 680, 146 and 681, 147 and 682, 148 and 683, 149 and 684, 150 and 685, 151 and 686, 152 and 687, 153 and 688, 154 and 689, 155 and 690, 156 and 691, 157 and 692, 158 and 693, 159 and 694, 160 and 695, 161 and 696, 162 and 697, 163 and 698, 164 and 699, 165 and 700, 166 and 701, 167 and 702, 168 and 703, 169 and 704, 170 and 705, 171 and 706, 172 and 707, 173 and 708, 174 and 709, 175 and 710, 176 and 711, 177 and 712, 178 and 713, 179 and 714, 180 and 715, 181 and 716, 182 and 717, 183 and 718, 184 and 719, 185 and 720, 186 and 721, 187 and 722, 188 and 723, 189 and 724, 190 and 725, 191 and 726, 192 and 727, 193 and 728, 194 and 729, 195 and 730, 196 and 731, 197 and 732, 198 and 733, 199 and 734, 200 and 735, 201 and 736, 202 and 737, 203 and 738, 204 and 739, 205 and 740, 206 and 741, 207 and 742, 208 and 743, 209 and 744, 210 and 745, 211 and 746, 212 and 747, 213 and 748, 214 and 749, 215 and 750, 216 and 751, 217 and 752, 218 and 753, 219 and 754, 220 and 755, 221 and 756, 222 and 757, 223 and 758, 224 and 759, 225 and 760, 226 and 761, 227 and 762, 228 and 763, 229 and 764, 230 and 765, 231 and 766, 232 and 767, 233 and 768, 234 and 769, 235 and 770, 236 and 771, 237 and 772, 238 and 773, 239 and 774, 240 and 775, 241 and 776, 242 and 777, 243 and 778, 244Attorney Docket No.: 87JA-396165-WO and 779, 245 and 780, 246 and 781, 247 and 782, 248 and 783, 249 and 784, 250 and 785, 251 and 786, 252 and 787, 253 and 788, 254 and 789, 255 and 790, 256 and 791, 257 and 792, 258 and 793, 259 and 794, 260 and 795, 261 and 796, 262 and 797, 263 and 798, 264 and 799, 265 and 800, 266 and 801, 267 and 802, 268 and 803, 269 and 804, 270 and 805, 271 and 806, 272 and 807, 273 and 808, 274 and 809, 275 and 810, 276 and 811, 277 and 812, 278 and 813, 279 and 814, 280 and 815, 281 and 816, 282 and 817, 283 and 818, 284 and 819, 285 and 820, 286 and 821, 287 and 822, 288 and 823, 289 and 824, 290 and 825, 291 and 826, 292 and 827, 293 and 828, 294 and 829, 295 and 830, 296 and 831, 297 and 832, 298 and 833, 299 and 834, 300 and 835, 301 and 836, 302 and 837, 303 and 838, 304 and 839, 305 and 840, 306 and 841, 307 and 842, 308 and 843, 309 and 844, 310 and 845, 311 and 846, 312 and 847, 313 and 848, 314 and 849, 315 and 850, 316 and 851, 317 and 852, 318 and 853, 319 and 854, 320 and 855, 321 and 856, 322 and 857, 323 and 858, 324 and 859, 325 and 860, 326 and 861, 327 and 862, 328 and 863, 329 and 864, 330 and 865, 331 and 866, 332 and 867, 333 and 868, 334 and 869, 335 and 870, 336 and 871, 337 and 872, 338 and 873, 339 and 874, 340 and 875, 341 and 876, 342 and 877, 343 and 878, 344 and 879, 345 and 880, 346 and 881, 347 and 882, 348 and 883, 349 and 884, 350 and 885, 351 and 886, 352 and 887, 353 and 888, 354 and 889, 355 and 890, 356 and 891, 357 and 892, 358 and 893, 359 and 894, 360 and 895, 361 and 896, 362 and 897, 363 and 898, 364 and 899, 365 and 900, 366 and 901, 367 and 902, 368 and 903, 369 and 904, 370 and 905, 371 and 906, 372 and 907, 373 and 908, 374 and 909, 375 and 910, 376 and 911, 377 and 912, 378 and 913, 379 and 914, 380 and 915, 381 and 916, 382 and 917, 383 and 918, 384 and 919, 385 and 920, 386 and 921, 387 and 922, 388 and 923, 389 and 924, 390 and 925, 391 and 926, 392 and 927, 393 and 928, 394 and 929, 395 and 930, 396 and 931, 397 and 932, 398 and 933, 399 and 934, 400 and 935, 401 and 936, 402 and 937, 403 and 938, 404 and 939, 405 and 940, 406 and 941, 407 and 942, 408 and 943, 409 and 944, 410 and 945, 411 and 946, 412 and 947, 413 and 948, 414 and 949, 415 and 950, 416 and 951, 417 and 952, 418 and 953, 419 and 954, 420 and 955, 421 and 956, 422 and 957, 423 and 958, 424 and 959, 425 and 960, 426 and 961, 427 and 962, 428 and 963, 429 and 964, 430 and 965, 431 and 966, 432 and 967, 433 and 968, 434 and 969, 435 and 970, 436 and 971, 437 and 972, 438 and 973, 439 and 974, 440 and 975, 441 and 976, 442 and 977, 443 and 978, 444 and 979, 445 and 980, 446 and 981, 447 and 982, 448 and 983, 449 and 984, 450 and 985, 451 and 986, 452 and 987, 453 and 988, 454 and 989, 455 and 990, 456 and 991, 457 and 992, 458 and 993, 459 and 994, 460 and 995, 461 and 996, 462 and 997, 463 and 998, 464 and 999, 465 and 1000, 466 and 1001, 467 and 1002, 468 and 1003, 469 and 1004, 470 and 1005, 471 and 1006, 472 and 1007, 473 and 1008, 474 and 1009, 475 and 1010, 476 and 1011, 477 and 1012, 478 and 1013, 479 and 1014, 480 and 1015, 481 and 1016, 482 and 1017, 483 and 1018, 484 and 1019, 485 and 1020, 486 and 1021, 487 and 1022, 488 and 1023, 489 and 1024, 490 and 1025, 491 and 1026, 492 and 1027, 493 and 1028, 494 and 1029, 495 and 1030, 496 and 1031, 497 and 1032, 498 and 1033, 499 and 1034, 500 and 1035, 501 andAttorney Docket No.: 87JA-396165-WO 1036, 502 and 1037, 503 and 1038, 504 and 1039, 505 and 1040, 506 and 1041, 507 and 1042, 508 and 1043, 509 and 1044, 510 and 1045, 511 and 1046, 512 and 1047, 513 and 1048, 514 and 1049, 515 and 1050, 516 and 1051, 517 and 1052, 518 and 1053, 519 and 1054, 520 and 1055, 521 and 1056, 522 and 1057, 523 and 1058, 524 and 1059, 525 and 1060, 526 and 1061, 527 and 1062, 528 and 1063, 529 and 1064, 530 and 1065, 531 and 1066, 532 and 1067, 533 and 1068, 534 and 1069, 535 and 1070, or 536 and 1071.

35. The siRNA duplex of claim 34, wherein the sense sequence comprises the nucleic acid sequence of SEQ ID NO: 199 and the antisense sequence comprises the nucleic acid sequence of SEQ ID NO:

734.

36. The siRNA duplex of claim 35, wherein the sense sequence comprises the nucleic acid sequence of SEQ ID NO: 2142 and the antisense sequence comprises the nucleic acid sequence of SEQ ID NO: 2143.

37. The siRNA duplex of any one of claims 25-36, which has a structure of formula II:

38. An in vitro method of reducing a level of HMG-CoA reductase and / or HMGCR mRNA in a cell, the method comprising contacting the cell with the siRNA duplex of any one of claims 1-37.

39. A method of reducing a level of HMG-CoA reductase and / or HMGCR mRNA in a subject, the method comprising administering to the subject the siRNA duplex of any one of claims 1-37 in an amount effective to reduce a level of HMG-CoA reductase and / or HMGCR mRNA in one or more cells in the subject.

40. The method of claim 39, wherein the cell is in a subject having an HMGCR-mediated disease or condition.Attorney Docket No.: 87JA-396165-WO 41. The method of claim 40, wherein the HMGCR-mediated disease or condition is selected from the group consisting of hyperlipidemia, a cardiovascular disease, cancer, diabetes, non-alcoholic fatty liver disease (NAFLD), and age-related macular degeneration (AMD).

42. The method of claim 41, wherein the HMGCR-mediated disease or condition is AMD or hyperlipidemia.

43. The method of claim 42, wherein the subject is a human subject.

44. The method of claim 38, wherein the cell is a retinal cell or a liver cell.

45. The method of claim 44, wherein the cell is a retinal pigment epithelium cell.

46. The method of claim 38, wherein the cell is a parenchymal cells of the liver.

47. A method of treating a subject diagnosed as having, or being at risk for, age-related macular degeneration (AMD), the method comprising administering to the subject a therapeutically effective amount of the siRNA duplex of any one of claims 1-37.

48. The method of claim 47, wherein the AMD is dry AMD.

49. The method of claim 47, wherein the AMD is geographic atrophy.

50. The method of claim 47, wherein the AMD is intermediate AMD.

51. The method of claim 47, wherein the AMD is wet AMD.

52. The method of any one of claims 39-51, wherein the siRNA duplex is administered to the eye.

53. The method of claim 52, wherein the siRNA duplex is administered by intravitreal or suprachoroidal injection.Attorney Docket No.: 87JA-396165-WO 54. A method of treating a subject having, or being at risk for, hyperlipidemia, the method comprising administering to the subject a therapeutically effective amount of the siRNA duplex of any one of claims 1-37.

55. The method of claim 54, wherein the hyperlipidemia is selected from hypercholesterolemia, hypertriglyceridemia or the combination thereof.

Images