Double-stranded sirna analog for inhibiting MSTN expression, preparation method therefor, and use thereof

By designing double-stranded siRNA analogs to inhibit MSTN expression, the problem of MSTN inhibition in existing technologies has been solved, achieving the effects of improving muscle mass and metabolic function.

WO2026098499A1PCT designated stage Publication Date: 2026-05-15SHENZHEN SALUBRIS PHARMA CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2025/132711
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2025-05-29
Filing Date
2025-11-05
Publication Date
2026-05-15

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively inhibit the expression of myostatin (MSTN), leading to the occurrence and development of diseases such as muscle atrophy and metabolic-related diseases, which affect health and quality of life.

Method used

Develop a double-stranded siRNA analog that specifically inhibits the expression of the MSTN gene. By designing the lengths and complementary regions of the sense and antisense strands, efficient inhibition of MSTN signaling can be ensured.

Benefits of technology

By specifically inhibiting MSTN expression, reducing MSTN signaling, improving muscle mass, enhancing metabolic function, and reducing the risk of metabolic-related diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure PCTCN2025132711-FTAPPB-I100001
    Figure PCTCN2025132711-FTAPPB-I100001
  • Figure PCTCN2025132711-FTAPPB-I100002
    Figure PCTCN2025132711-FTAPPB-I100002
  • Figure PCTCN2025132711-FTAPPB-I100003
    Figure PCTCN2025132711-FTAPPB-I100003
Patent Text Reader

Abstract

Provided are a double-stranded siRNA analog for inhibiting myostatin (MSTN) expression, a preparation method therefor, and use thereof. The double-stranded siRNA analog can inhibit MSTN expression and be used for preventing and / or treating MSTN-related diseases and disorders, such as myoatrophy.
Need to check novelty before this filing date? Find Prior Art

Description

Double-stranded siRNA analogs for inhibiting MSTN expression, their preparation methods and uses Technical Field

[0001] This invention relates to the field of medicine, and more specifically, to a double-stranded siRNA analog that acts on myostatin, its preparation method, and its uses. Background Technology

[0002] Myostatin (MSTN) is a member of the transforming growth factor β (TGF-β) superfamily. It is specifically expressed in skeletal muscle tissue. Activated MSTN mainly activates downstream signals by binding to the activin type IIB receptor. Subsequently, it sends signals through the smad2 / 3 signaling pathway to regulate the transcription of muscle regulatory factors such as MyoD, thereby inhibiting the proliferation and differentiation of myoblasts and inducing various diseases such as muscle atrophy.

[0003] Skeletal muscle is the main tissue responsible for movement and metabolic activities. Studies have shown that mice with MSTN gene knockout have a 25-30% increase in muscle mass. A "double-muscle" phenotype resulting from MSTN gene inactivation has been observed in cattle, sheep, dogs, horses, and even humans. As a negative regulator of muscle growth, MSTN is considered an effective target for treating muscle diseases such as amyotrophic lateral sclerosis, osteoporosis, and cachexia. Furthermore, MSTN not only inhibits skeletal muscle growth, leading to decreased muscle mass and reduced skeletal muscle metabolism, but it can also directly regulate glucose and lipid metabolism and improve insulin sensitivity, thereby influencing the occurrence and development of metabolic-related diseases. Multiple studies have shown that MSTN is closely related to metabolic diseases, including insulin resistance, diabetes, obesity, and hypertension.

[0004] Decreased muscle mass can severely impact health, reduce quality of life, and increase the risk of morbidity and mortality. Providing effective siRNAs to regulate muscle health and inhibit MSTN expression and / or activity to treat related diseases remains a pressing issue in this field. Summary of the Invention

[0005] This invention provides a double-stranded siRNA analog for inhibiting MSTN expression, a pharmaceutical composition thereof, and its use. The double-stranded siRNA analog can specifically inhibit the expression of the MSTN gene, has good inhibitory activity against MSTN mRNA, and can reduce MSTN signal transduction.

[0006] In a first aspect, the present invention provides a double-stranded siRNA analog or a pharmaceutically acceptable salt thereof for inhibiting MSTN expression, wherein the double-stranded siRNA analog or the pharmaceutically acceptable salt thereof comprises a sense strand and an antisense strand, wherein the length of the sense strand and the antisense strand is each independently 15-30 nucleotides, the antisense strand includes a complementary region that is complementary to the sense strand, and the antisense strand comprises at least 15 sequences, for example, 15, 16, 17, 18, 19, 20 or 21 consecutive nucleotides that differ from any of the sequences shown in SEQ ID NO:118-234, 357-478 by no more than 0, 1, 2 or 3 nucleotides.

[0007] As a preferred embodiment of the present invention, the lengths of the positive and negative strands are each independently 17-27 nucleotides, preferably 19-25 nucleotides, more preferably 19-23 nucleotides, and most preferably 19-21 nucleotides. In a specific embodiment, the lengths of the positive and negative strands are each independently 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. The lengths of the positive and negative strands can be the same or different; for example, the positive strand may contain 19 nucleotides and the negative strand may contain 21 nucleotides, or both may contain 19 nucleotides, or the positive strand may contain 21 nucleotides and the negative strand may contain 19 nucleotides.

[0008] As a preferred embodiment of the present invention, the positive and negative strands can be partially, substantially, or completely complementary to each other. For example, the positive and negative strands can be 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary. The length of the complementary region is at least 15, for example, 15, 16, 17, 18, or 19 nucleotide pairs. In one specific embodiment, the length of the complementary region is 15-25 nucleotide pairs. In one specific embodiment, the length of the complementary region is 17-23 nucleotide pairs. In one specific embodiment, the length of the complementary region is 19 nucleotide pairs. Generally, if any nucleotide overhangs as defined in the present invention are present, the sequences of these overhangs are not considered when determining the degree of complementarity between the two sequences. For example, a positive strand of 21 nucleotides in length with a 19 nucleotide pair complementary region having two nucleotide overhangs at the 3' end of each strand, formed by hybridization, and an antisense strand of 21 nucleotides in length will be considered 100% complementary.

[0009] As a preferred embodiment of the present invention, the sense strand and the antisense strand each independently include a 3' overhang and / or a 5' overhang having at least one nucleotide. For example, one or both of the sense strand and the antisense strand include a 3' overhang and / or a 5' overhang having at least two nucleotides. In one specific embodiment, the nucleotide of the overhang is selected from thymine deoxyribonucleotides or uracil ribonucleotides. For example, the nucleotide of the overhang is selected from two consecutive thymine deoxyribonucleotides or two consecutive uracil ribonucleotides. In some embodiments, when the overhang is present in the antisense strand, the nucleotide in the overhang may be complementary to the target gene sequence, forming a mismatch with the target gene sequence or containing some other sequences (e.g., polypyrimidine or polypurine sequences, UU, TT, AA, GG, etc.).

[0010] In a preferred embodiment of the present invention, the antisense strand comprises a sequence differing from any of the sequences shown in SEQ ID NO:118-234, 357-478 by no more than 3, 2, or 1 nucleotides. In some embodiments, the antisense strand comprises a continuous nucleotide sequence having at least 85%, for example, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide sequence identity with any of the sequences shown in SEQ ID NO:118-234, 357-489. In a specific embodiment, the antisense strand consists of any of the sequences shown in SEQ ID NO:118-234, 357-489.

[0011] In some embodiments, the antisense strand comprises a sequence differing from the antisense strand of any siRNA selected from Table 4 by no more than 3, 2, or 1 nucleotides, or comprises a continuous nucleotide sequence having at least 85%, such as 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide sequence identity with the antisense strand of any siRNA selected from Table 4. In some embodiments, the antisense strand comprises a sequence identical to the antisense strand of any siRNA selected from Table 4.

[0012] In some embodiments, the antisense strand comprises a sequence differing from the antisense strand of any siRNA selected from Table 6 by no more than 3, 2, or 1 nucleotides, or comprises a continuous nucleotide sequence having at least 85%, such as 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide sequence identity with the antisense strand of any siRNA selected from Table 6. In some embodiments, the antisense strand comprises a sequence identical to the antisense strand of any siRNA selected from Table 6.

[0013] In some embodiments, the antisense strand comprises a sequence differing from the sequence shown in any of SEQ ID NO: 359, 396, 404, 485, or 489 by no more than 3, 2, or 1 nucleotides; or, comprises a continuous nucleotide sequence having at least 85%, such as 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, nucleotide sequence identity with the sequence shown in any of SEQ ID NO: 359, 396, 404, 485, or 489. In some embodiments, the antisense strand comprises the sequence shown in any of SEQ ID NO: 359, 396, 404, 485, or 489.

[0014] As a preferred embodiment of the present invention, the antisense chain comprises, or is composed of, any of the sequences shown in SEQ ID NO: 119-123, 126, 128, 132, 133, 139, 146-148, 152, 153, 155, 158, 159, 161, 164, 168, 170, 175, 189, 192-194, 198-202, 206, 207, 216, 217, 220, 221, 228, 231-233.

[0015] As a preferred embodiment of the present invention, the antisense chain comprises or is composed of any of the sequences shown in 119-123, 126, 128, 132, 139, 153, 158, 159, 168, 189, 192, 199, 200, 206, 220, 231-233.

[0016] As a preferred embodiment of the present invention, the positive strand comprises at least 15 sequences, for example, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides, that differ from any of the sequences shown in SEQ ID NO:1-117, 235-356 by no more than 0, 1, 2, or 3 nucleotides. In some embodiments, the positive strand comprises a consecutive nucleotide sequence having at least 85%, for example, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide sequence identity with any of the sequences shown in SEQ ID NO:1-117, 235-356. In a specific embodiment, the positive strand comprises, or is composed of, any of the sequences shown in SEQ ID NO:1-117, 235-356.

[0017] In some embodiments, the positive strand comprises a sequence differing from the positive strand of any siRNA selected from Table 4 by no more than 3, 2, or 1 nucleotides, or comprises a continuous nucleotide sequence having at least 85%, for example, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide sequence identity with the positive strand of any siRNA selected from Table 4. In some embodiments, the positive strand comprises a sequence identical to the positive strand of any siRNA selected from Table 4.

[0018] In some embodiments, the positive strand comprises a sequence differing from the positive strand of any siRNA selected from Table 6 by no more than 3, 2, or 1 nucleotides, or comprises a continuous nucleotide sequence having at least 85%, for example, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide sequence identity with the positive strand of any siRNA selected from Table 6. In some embodiments, the positive strand comprises a sequence identical to the positive strand of any siRNA selected from Table 6.

[0019] In some embodiments, the positive strand comprises a sequence differing from the sequence shown in any of SEQ ID NO:237, 274, 282, 354, or 356 by no more than 3, 2, or 1 nucleotides; or, comprises a continuous nucleotide sequence having at least 85%, such as 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide sequence identity with the sequence shown in any of SEQ ID NO:237, 274, 282, 354, or 356. In some embodiments, the positive strand comprises the sequence shown in any of SEQ ID NO:237, 274, 282, 354, or 356.

[0020] In some embodiments, the antisense strand is substantially complementary or completely complementary to the MSTN target sequence. In some embodiments, the region of the antisense strand complementary to the MSTN target sequence is at least 15, 16, 17, 18, or 19 consecutive nucleotides in length. In some embodiments, the last one or two terminal nucleotides of the 3' end of the antisense strand are complementary to the target. In some embodiments, the last one or two nucleotides of the 3' end of the antisense strand are not complementary to the target. In some embodiments, the antisense strand is completely complementary to the MSTN target sequence.

[0021] As a preferred embodiment of the present invention, the double-stranded siRNA analog comprises, or is composed of, any of the paired sense and antisense sequences shown in Table 1.

[0022] As a preferred embodiment of the present invention, the double-stranded siRNA analog is selected from GDF004, GDF005, GDF006, GDF007, GDF008, GDF011, GDF013, GDF017, GDF018, GDF024, GDF031, GDF032, GDF033, GDF037, GDF038, GDF040, GDF043, GDF044, and GDF046. GDF049, GDF053, GDF055, GDF060, GDF074, GDF077, GDF078, GDF079, GDF083, GDF084, GDF085, GDF086, GDF087, GDF091, GDF092, GDF101, GDF102, GDF105, GDF106, GDF113, GDF116, GDF117 and GDF118.

[0023] As a preferred embodiment of the present invention, the double-stranded siRNA analog is selected from GDF0004, GDF0005, GDF0006, GDF0007, GDF0008, GDF0011, GDF0013, GDF0017, GDF0024, GDF0038, GDF0043, GDF0044, GDF0053, GDF0074, GDF0077, GDF0084, GDF0085, GDF0091, GDF0105, GDF0116, GDF0117 and GDF0118.

[0024] In some embodiments, the sense strand and antisense strand each comprise sequences that differ from the sense strand and antisense strand sequences selected from any of the following groups by no more than 3, 2, or 1 nucleotides, or each comprise consecutive nucleotide sequences having at least 85%, such as 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide sequence identity with the sense strand and antisense strand sequences selected from any of the following groups:

[0025] (1) The sense chain shown in SEQ ID NO:4 and the antisense chain shown in SEQ ID NO:121;

[0026] (2) The sense chain shown in SEQ ID NO:5 and the antisense chain shown in SEQ ID NO:122;

[0027] (3) The positive chain shown in SEQ ID NO:9 and the negative chain shown in SEQ ID NO:126;

[0028] (4) The positive chain shown in SEQ ID NO:36 and the negative chain shown in SEQ ID NO:153;

[0029] (5) The sense chain shown in SEQ ID NO:41 and the antisense chain shown in SEQ ID NO:158;

[0030] (6) The sense chain shown in SEQ ID NO:42 and the antisense chain shown in SEQ ID NO:159;

[0031] (7) The positive chain shown in SEQ ID NO:103 and the negative chain shown in SEQ ID NO:220;

[0032] (8) The positive chain shown in SEQ ID NO:114 and the negative chain shown in SEQ ID NO:231;

[0033] (9) The positive chain shown in SEQ ID NO:116 and the negative chain shown in SEQ ID NO:233;

[0034] (10) The sense chain shown in SEQ ID NO:237 and the antisense chain shown in SEQ ID NO:359;

[0035] (11) The positive chain shown in SEQ ID NO:245 and the negative chain shown in SEQ ID NO:367;

[0036] (12) The positive chain shown in SEQ ID NO:251 and the negative chain shown in SEQ ID NO:373;

[0037] (13) The positive chain shown in SEQ ID NO:253 and the negative chain shown in SEQ ID NO:375;

[0038] (14) The positive chain shown in SEQ ID NO:259 and the negative chain shown in SEQ ID NO:381;

[0039] (15) The sense chain shown in SEQ ID NO:260 and the antisense chain shown in SEQ ID NO:382;

[0040] (16) The sense chain shown in SEQ ID NO:274 and the antisense chain shown in SEQ ID NO:396;

[0041] (17) The positive chain shown in SEQ ID NO:277 and the negative chain shown in SEQ ID NO:399;

[0042] (18) The positive chain shown in SEQ ID NO:280 and the negative chain shown in SEQ ID NO:402;

[0043] (19) The sense chain shown in SEQ ID NO:282 and the antisense chain shown in SEQ ID NO:404;

[0044] (20) The sense chain shown in SEQ ID NO:301 and the antisense chain shown in SEQ ID NO:423;

[0045] (21) The sense chain shown in SEQ ID NO:302 and the antisense chain shown in SEQ ID NO:424;

[0046] (22) The positive chain shown in SEQ ID NO:304 and the negative chain shown in SEQ ID NO:426;

[0047] (23) The positive chain shown in SEQ ID NO:307 and the negative chain shown in SEQ ID NO:429;

[0048] (24) The positive chain shown in SEQ ID NO:308 and the negative chain shown in SEQ ID NO:430;

[0049] (25) The sense chain shown in SEQ ID NO:309 and the antisense chain shown in SEQ ID NO:431;

[0050] (26) The positive chain shown in SEQ ID NO:315 and the negative chain shown in SEQ ID NO:437;

[0051] (27) The positive chain shown in SEQ ID NO:320 and the negative chain shown in SEQ ID NO:442;

[0052] (28) The justice chain shown in SEQ ID NO:322 and the antisense chain shown in SEQ ID NO:444;

[0053] (29) The justice chain shown in SEQ ID NO:324 and the antisense chain shown in SEQ ID NO:446;

[0054] (30) The positive chain shown in SEQ ID NO:325 and the negative chain shown in SEQ ID NO:447;

[0055] (31) The positive chain shown in SEQ ID NO:326 and the negative chain shown in SEQ ID NO:448;

[0056] (32) The positive chain shown in SEQ ID NO:327 and the negative chain shown in SEQ ID NO:449;

[0057] (33) The positive chain shown in SEQ ID NO:333 and the negative chain shown in SEQ ID NO:455;

[0058] (34) The justice chain shown in SEQ ID NO:339 and the antisense chain shown in SEQ ID NO:461;

[0059] (35) The positive chain shown in SEQ ID NO:345 and the negative chain shown in SEQ ID NO:467;

[0060] (36) The positive chain shown in SEQ ID NO:350 and the negative chain shown in SEQ ID NO:472; or

[0061] (37) The positive chain shown in SEQ ID NO:356 and the negative chain shown in SEQ ID NO:478.

[0062] In some embodiments, the antisense strand comprises a sequence differing from the sequence shown in SEQ ID NO:359 by no more than 3, 2, or 1 nucleotides, or comprises a continuous nucleotide sequence having at least 85%, such as 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide sequence identity with the sequence shown in SEQ ID NO:359; and the sense strand comprises a sequence differing from the sequence shown in SEQ ID NO:237 by no more than 3, 2, or 1 nucleotides, or comprises a continuous nucleotide sequence having at least 85%, such as 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide sequence identity with the sequence shown in SEQ ID NO:237.

[0063] In some embodiments, the antisense strand comprises a sequence differing from the sequence shown in SEQ ID NO:396 by no more than 3, 2, or 1 nucleotides, or comprises a continuous nucleotide sequence having at least 85%, such as 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide sequence identity with the sequence shown in SEQ ID NO:396; and the sense strand comprises a sequence differing from the sequence shown in SEQ ID NO:274 by no more than 3, 2, or 1 nucleotides, or comprises a continuous nucleotide sequence having at least 85%, such as 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide sequence identity with the sequence shown in SEQ ID NO:274.

[0064] In some embodiments, the antisense strand comprises a sequence differing from the sequence shown in SEQ ID NO:404 by no more than 3, 2, or 1 nucleotides, or comprises a continuous nucleotide sequence having at least 85%, such as 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide sequence identity with the sequence shown in SEQ ID NO:404; and the sense strand comprises a sequence differing from the sequence shown in SEQ ID NO:282 by no more than 3, 2, or 1 nucleotides, or comprises a continuous nucleotide sequence having at least 85%, such as 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide sequence identity with the sequence shown in SEQ ID NO:282.

[0065] In some embodiments, the antisense strand comprises a sequence differing from the sequence shown in SEQ ID NO:485 by no more than 3, 2, or 1 nucleotides, or comprises a continuous nucleotide sequence having at least 85%, such as 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide sequence identity with the sequence shown in SEQ ID NO:485; and the sense strand comprises a sequence differing from the sequence shown in SEQ ID NO:354 by no more than 3, 2, or 1 nucleotides, or comprises a continuous nucleotide sequence having at least 85%, such as 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide sequence identity with the sequence shown in SEQ ID NO:354.

[0066] In some embodiments, the antisense strand comprises a sequence differing from the sequence shown in SEQ ID NO:489 by no more than 3, 2, or 1 nucleotides, or comprises a continuous nucleotide sequence having at least 85%, such as 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide sequence identity with the sequence shown in SEQ ID NO:489; and the sense strand comprises a sequence differing from the sequence shown in SEQ ID NO:356 by no more than 3, 2, or 1 nucleotides, or comprises a continuous nucleotide sequence having at least 85%, such as 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide sequence identity with the sequence shown in SEQ ID NO:356.

[0067] As a preferred embodiment of the present invention, the double-stranded siRNA analog is selected from any one of the analogs in Table 4.

[0068] In some implementations, the justice chain and antisense chain are selected from any one of the following groups:

[0069] (1) The justice chain contains: GCAACUCUGUGUUUAUAUU, and the antisense chain contains: AAUAUAAACACAGAGUUGCAG;

[0070] (2) The justice chain contains: UGGAGAGUGUGAAUUUGUA, and the antisense chain contains: UACAAAUUCACACUCUCCAGA;

[0071] (3) The justice chain contains: GCUACAGUAUGUAAACUAA, and the antisense chain contains: UUAGUUUACAUACUGUAGCUU;

[0072] (4) The justice chain contains: GGCAAAGAACAAAUAAUAU, and the antisense chain contains: AUAUUAUUUGUUCUUUGCCAG; or

[0073] (5) The justice chain contains: CAAAGAACAAAUAAUAUAU, and the antisense chain contains: AUAUAUUAUUUGUUCUUUGCG.

[0074] In a preferred embodiment of the present invention, the double-stranded siRNA analog or its pharmaceutically acceptable salt comprises at least one modified nucleotide. In one specific embodiment, the sense strand and / or the antisense strand each independently comprises at least one modified nucleotide. In another specific embodiment, the sense strand comprises at least one modified nucleotide, and the nucleotides of the antisense strand are unmodified; or, the nucleotides of the sense strand are unmodified, and the antisense strand comprises at least one modified nucleotide. In some embodiments, substantially all nucleotides of the sense strand are modified nucleotides; substantially all nucleotides of the antisense strand are modified nucleotides; or substantially all nucleotides of both the sense strand and the antisense strand are modified nucleotides. In some preferred embodiments, both the sense strand and / or the antisense strand are modified nucleotides.

[0075] In some embodiments, the modified nucleotide is selected from: alkyl-modified nucleotides, methoxy-modified nucleotides (e.g., 2'-O-methyl-modified nucleotides), ethoxy-modified nucleotides (e.g., 2'-O-ethyl-modified nucleotides), 2'-O-allyl-modified nucleotides, 2'-hydroxy-modified nucleotides, methoxyethyl-modified nucleotides, amino-modified nucleotides, fluorinated nucleotides (e.g., 2'-fluorinated nucleotides), deoxynucleotides, 5'-methylphosphodiester nucleotides, 5'-C-methylphosphodiester nucleotides, 2'-deoxy-2'-fluoronucleotides, (E)-vinylphosphonate-modified nucleotides, nucleotides containing a thiophosphate group, nucleotides containing a dithiophosphate group, locked nucleic acids (LNAs), and morpholino oligonucleotides (PMOs). In some embodiments, the alkyl-modified nucleotide is selected from methyl-modified nucleotides and ethyl-modified nucleotides.

[0076] In some preferred embodiments, the modified nucleotide is selected from: 2'-O-methyl modified nucleotides, 2'-fluoro modified nucleotides, and nucleotides containing thiophosphate groups.

[0077] As a preferred embodiment of the present invention, the sense strand and / or the antisense strand each independently comprise at least one 2'-O-methyl modified nucleotide, at least one 2'-fluoro modified nucleotide, and at least one nucleotide containing a thiophosphate group.

[0078] As a preferred embodiment of the present invention, the number of 2'-O-methyl modified nucleotides is no more than 17, preferably 17 or 15. The number of 2'-fluoro modified nucleotides is no more than 4, preferably 4. The number of nucleotides containing thiophosphate groups is at most 4, preferably 4 or 2.

[0079] In a preferred embodiment of the present invention, the sense strand and / or the antisense strand each independently comprises at least one 2'-O-methyl-modified nucleotide. In one specific embodiment, the nucleotides at positions 1, 2, 3, 4, 6, 10, 11, 12, 13, 14, 15, 16, 17, 18, and / or 19 of the sense strand are each independently a 2'-O-methyl-modified nucleotide, following the 5'-to-3' direction. In another specific embodiment, the nucleotides at positions 1, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, and / or 21 of the antisense strand are each independently a 2'-O-methyl-modified nucleotide, following the 5'-to-3' direction.

[0080] In a preferred embodiment of the present invention, the sense strand and / or the antisense strand each independently comprises at least one 2'-fluorinated nucleotide. In one specific embodiment, the nucleotides at positions 5, 7, 8, and / or 9 of the sense strand are each independently 2'-fluorinated nucleotides, following a 5'-to-3' direction. In some embodiments, at least three consecutive nucleotides of the sense strand each independently contain a 2'-fluorinated modification; preferably, the nucleotides at positions 7, 8, and 9 of the sense strand each independently contain a 2'-fluorinated modification, following a 5'-to-3' direction. In one specific embodiment, the nucleotides at positions 2, 6, 14, and / or 16 of the antisense strand are each independently 2'-fluorinated nucleotides, following a 5'-to-3' direction.

[0081] As a preferred embodiment of the present invention, the positive strand and / or the negative strand each independently comprises at least one nucleotide containing a thiophosphate group. In a specific embodiment, the thiophosphate group is present at at least one of the following positions: between the first and second nucleotides of the positive strand, between the second and third nucleotides of the positive strand, between the first and second nucleotides of the negative strand, between the second and third nucleotides of the negative strand, between the penultimate and penultimate nucleotides of the negative strand, between the penultimate and penultimate nucleotides of the negative strand; and between the first and second nucleotides of the negative strand, and between the second and third nucleotides of the negative strand, in the direction from the 3' end to the 5' end.

[0082] In some embodiments, the 5th, 7th, 8th, and 9th nucleotides of the positive strand each independently contain a 2'-fluorine modification along the 5'-to-3' direction. Optionally, the remaining nucleotides of the positive strand are each independently selected from nucleotides modified with a 2'-O-methyl group and nucleotides containing a thiophosphate group. In some embodiments, the 5th, 7th, 8th, and 9th nucleotides of the positive strand each independently contain a 2'-fluorine modification along the 5'-to-3' direction, and the remaining nucleotides each independently contain a 2'-O-methyl modification. The thiophosphate group is present between the 1st and 2nd nucleotides and between the 2nd and 3rd nucleotides.

[0083] In some embodiments, the nucleotides at positions 2, 6, 14, and 16 of the antisense strand each independently contain a 2'-fluorine modification along the 5'-to-3' direction. Optionally, the remaining nucleotides of the antisense strand are each independently selected from nucleotides modified with a 2'-O-methyl group and nucleotides containing a thiophosphate group. In some embodiments, the nucleotides at positions 2, 6, 14, and 16 of the antisense strand each independently contain a 2'-fluorine modification along the 5'-to-3' direction, and the remaining nucleotides of the antisense strand each independently contain a 2'-O-methyl modification. The thiophosphate group is located between the 1st and 2nd nucleotides, between the 2nd and 3rd nucleotides, between the penultimate and penultimate nucleotides, and between the penultimate and penultimate nucleotides of the antisense strand.

[0084] As a preferred embodiment of the present invention, the double-stranded siRNA analog has the following formula:

[0085] Justice chain: NmsNmsNmNmNfNmNfNfNfNmNmNmNmNmNmNmNmNmNmNm

[0086] Antisense strand: NmsNfsNmNmNmNmNfNmNmNmNmNmNmNmNmNfNmNfNmNmNmsNmsNm

[0087] Where: “N” represents a nucleotide, such as A, G, U, and C; m indicates that the nucleotide adjacent to it on the left is a nucleotide modified with 2'-O-methyl, such as Am, Um, Gm, and Cm representing 2'-O-methyl modified A, U, G, and C, respectively; f indicates that the nucleotide adjacent to it on the left is a nucleotide modified with 2'-fluorine, such as Af, Uf, Gf, and Cf representing 2'-fluorine modified A, U, G, and C, respectively; s indicates that the two nucleotides adjacent to the letter s on the left and right are linked by a thiophosphate group.

[0088] As a preferred embodiment of the present invention, the antisense strand comprises any of the modified antisense nucleotide sequences shown in Table 2, and / or the sense strand comprises any of the modified sense nucleotide sequences shown in Table 2. In some preferred embodiments, the double-stranded siRNA analog comprises, or is composed of, any of the paired modified sense nucleotide sequences and modified antisense nucleotide sequences shown in Table 2.

[0089] As a preferred embodiment of the present invention, the double-stranded siRNA analog is selected from GDF004M, GDF005M, GDF006M, GDF007M, GDF008M, GDF011M, GDF013M, GDF017M, GDF018M, GDF024M, GDF031M, GDF032M, GDF033M, GDF037M, GDF038M, GDF040M, GDF043M, GDF044M, GDF046M, G... DF049M, GDF053M, GDF055M, GDF060M, GDF074M, GDF077M, GDF078M, GDF079M, GDF083M, GDF084M, GDF085M, GDF086M, GDF087M, GDF091M, GDF092M, GDF101M, GDF102M, GDF105M, GDF106M, GDF113M, GDF116M, GDF117M, and GDF118M.

[0090] As a preferred embodiment of the present invention, the double-stranded siRNA analog is selected from GDF0004M, GDF0005M, GDF0006M, GDF0007M, GDF0008M, GDF0011M, GDF0013M, GDF0017M, GDF0024M, GDF0038M, GDF0043M, GDF0044M, GDF0053M, GDF0074M, GDF0077M, GDF0084M, GDF0085M, GDF0091M, GDF0105M, GDF0116M, GDF0117M, and GDF0118M.

[0091] As a preferred embodiment of the present invention, the double-stranded siRNA analog is selected from any one of those shown in Table 3.

[0092] In some embodiments, the positive strand comprises a sequence differing from the modified positive strand of any siRNA selected from Table 3 by no more than 3, 2, or 1 nucleotides, or comprises a continuous nucleotide sequence having at least 85%, for example, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide sequence identity with the modified positive strand of any siRNA selected from Table 3. In some embodiments, the positive strand comprises a sequence identical to the modified positive strand of any siRNA selected from Table 4.

[0093] In some embodiments, the antisense strand comprises a sequence differing from the modified antisense strand of any siRNA selected from Table 3 by no more than 3, 2, or 1 nucleotides; or, it comprises a continuous nucleotide sequence having at least 85%, for example, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide sequence identity with the modified antisense strand of any siRNA selected from Table 3. In some embodiments, the antisense strand comprises a sequence identical to the modified antisense strand of any siRNA selected from Table 4.

[0094] In some embodiments, the antisense strand comprises a sequence differing from the modified antisense strand sequence of GDF122M by no more than 3, 2, or 1 nucleotides, or comprises a continuous nucleotide sequence having at least 85%, such as 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, nucleotide sequence identity with the modified antisense strand sequence of GDF122M; and the sense strand comprises a sequence differing from the modified sense strand sequence of GDF122M by no more than 3, 2, or 1 nucleotides, or comprises a continuous nucleotide sequence having at least 85%, such as 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, nucleotide sequence identity with the modified sense strand sequence of GDF122M.

[0095] In some embodiments, the antisense strand comprises a sequence differing from the modified antisense strand sequence of GDF159M by no more than 3, 2, or 1 nucleotides, or comprises a continuous nucleotide sequence having at least 85%, such as 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, nucleotide sequence identity with the modified antisense strand sequence of GDF159M; and the sense strand comprises a sequence differing from the modified sense strand sequence of GDF159M by no more than 3, 2, or 1 nucleotides, or comprises a continuous nucleotide sequence having at least 85%, such as 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, nucleotide sequence identity with the modified sense strand sequence of GDF159M.

[0096] In some embodiments, the antisense strand comprises a sequence differing from the modified antisense strand sequence of GDF167M by no more than 3, 2, or 1 nucleotides, or comprises a continuous nucleotide sequence having at least 85%, such as 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, nucleotide sequence identity with the modified antisense strand sequence of GDF167M; and the sense strand comprises a sequence differing from the modified sense strand sequence of GDF167M by no more than 3, 2, or 1 nucleotides, or comprises a continuous nucleotide sequence having at least 85%, such as 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, nucleotide sequence identity with the modified sense strand sequence of GDF167M.

[0097] In some embodiments, the antisense strand comprises a sequence differing from the modified antisense strand sequence of GDF248M by no more than 3, 2, or 1 nucleotides, or comprises a continuous nucleotide sequence having at least 85%, such as 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, nucleotide sequence identity with the modified antisense strand sequence of GDF248M; and the sense strand comprises a sequence differing from the modified sense strand sequence of GDF248M by no more than 3, 2, or 1 nucleotides, or comprises a continuous nucleotide sequence having at least 85%, such as 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, nucleotide sequence identity with the modified sense strand sequence of GDF248M.

[0098] In some embodiments, the antisense strand comprises a sequence differing from the modified antisense strand sequence of GDF252M by no more than 3, 2, or 1 nucleotides, or comprises a continuous nucleotide sequence having at least 85%, such as 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, nucleotide sequence identity with the modified antisense strand sequence of GDF252M; and the sense strand comprises a sequence differing from the modified sense strand sequence of GDF252M by no more than 3, 2, or 1 nucleotides, or comprises a continuous nucleotide sequence having at least 85%, such as 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, nucleotide sequence identity with the modified sense strand sequence of GDF252M.

[0099] In some implementations, the justice chain and antisense chain are selected from any one of the following groups:

[0100] (1) The justice chain contains: GmsCmsAmAmCfUmCfUfGfUmGmUmUmUmAmUmAmUmUm, and the antisense chain contains: AmsAfsUmAmUmAfAmAmCmAmCmAmGmAfGmUfUmGmCmsAmsGm;

[0101] (2) The justice chain contains: UmsGmsGmAmGfAmGfUfGfUmGmAmAmUmUmUmGmUmAm, and the antisense chain contains: UmsAfsCmAmAmAfUmUmCmAmCmAmCmUfCmUfCmCmAmsGmsAm;

[0102] (3) The justice chain contains: GmsCmsUmAmCfAmGfUfAfUmGmUmAmAmAmCmUmAmAmAm, and the antisense chain contains: UmsUfsAmGmUmUfUmAmCmAmUmAmCmUfGmUfAmGmCmsUmsUm;

[0103] (4) The justice chain contains: GmsGmsCmAmAfAmGfAfAfCmAmAmAmUmAmAmUmAmUm, and the antisense chain contains: AmsUfsAmUmUmAfUmUmUmGmUmUmCmUfUmUfGmCmCmsAmsGm; or

[0104] (5) The justice chain contains: CmsAmsAmAmGfAmAfCfAfAmAmUmAmAmUmAmUmAmUm, and the antisense chain contains: AmsUfsAmUmAmUfUmAmUmUmUmGmUmUfCmUfUmUmGmsCmsGm.

[0105] In a preferred embodiment of the present invention, the double-stranded siRNA analog is linked to a targeting ligand. The targeting ligand enhances the intracellular uptake, stability, and / or efficacy of the double-stranded siRNA analog. The targeting ligand may be monovalent, divalent, trivalent, tetravalent, or have a higher valence relative to its target.

[0106] In some implementations, the targeting ligand is selected from:

[0107] In some embodiments, the targeting ligand is selected from cell or tissue-targeting agents that bind to muscle cells, such as molecules that specifically bind to antigens expressed on muscle cells. In some embodiments, the cell or tissue-targeting agent specifically binds to internalized cell surface receptors on muscle and is capable of internalization into muscle cells via receptor-mediated internalization. In some embodiments, the cell or tissue-targeting agent is a small molecule, protein, peptide, nucleic acid (e.g., aptamer), or antibody. In some embodiments, the antibody includes a fully human antibody or its binding fragment, a humanized antibody or its binding fragment, a chimeric antibody or its binding fragment, a monoclonal antibody or its binding fragment, a monovalent Fab', a bivalent Fab2, a single-chain variable fragment (scFv), a biantibody, a microantibody, a nanobody, a single-domain antibody (sdAb), or a camelid antibody or its binding fragment. In some embodiments, the cell or tissue-targeting agent is an antibody that specifically binds to the transferrin receptor (TFR1). In some embodiments, the antibody binds to the transferrin receptor with high specificity and affinity. In some implementations, the equilibrium dissociation constant (KD) for antibody binding to the transferrin receptor is 10. -12 M to 10 -7 M, preferred 10 -12 M to 10 -8 M, more preferably 10 -12 M to 10 -9 M, Optimal 10 -12 M to 10 -10 M or lower (e.g., less than 10) -12 M). In some embodiments, the antibody does not specifically bind to the transferrin binding site of the transferrin receptor, and / or the antibody does not inhibit the binding of transferrin to the transferrin receptor. In some embodiments, the antibody is cross-reactive with two or more extracellular sites of human, non-human primate, and rodent transferrin receptors. In some embodiments, anti-TFR1 antibodies have been previously characterized or disclosed, see, for example, CN201980092818.1, CN202180025161.4, CN202180064690.5, which are incorporated herein by reference in their entirety.

[0108] In some embodiments, the targeting ligand may be a lipophilic molecule, including but not limited to cholesterol, bile acids, vitamins (e.g., vitamin E), stearic acid, palmitic acid, oleic acid, oleyl alcohol, linolene, linoleic acid, myristic acid, sterols, dihydrotestosterone, testosterone derivatives, glycerol, alkyl chains, triphenylmethyl groups, and alkoxy acids. In some embodiments, the lipophilic molecule comprises a hydrocarbon chain, which may be cyclic or acyclic. The hydrocarbon chain may contain various substituents and / or one or more heteroatoms, such as oxygen or sulfur atoms. In some embodiments, the lipophilic molecule contains saturated or unsaturated C4-C atoms. 30 Hydrocarbon chain.

[0109] In some implementations, the targeting ligand mediates the targeted delivery of the double-stranded siRNA analog to muscle cells or muscle tissue.

[0110] In some specific embodiments, the targeting ligand may be attached to the 3' end of either the sense or antisense strand of the double-stranded siRNA analog. In some specific embodiments, the targeting ligand may be attached to the 5' end of either the sense or antisense strand of the double-stranded siRNA analog. In some specific embodiments, the targeting ligand is attached to the 5' end of the sense strand. In some specific embodiments, the targeting ligand is attached to the 3' end of the sense strand. In some specific embodiments, the targeting ligand may also be internally attached to a nucleotide on the sense and / or antisense strand of the double-stranded siRNA analog. In some specific embodiments, the targeting ligand may also be attached to the double-stranded siRNA analog via a adapter; for example, the targeting ligand may be attached to the 3' or 5' end of the sense strand via an adapter, or the targeting ligand may be attached to the 3' or 5' end of the antisense strand via an adapter, or the targeting ligand may be internally attached to a nucleotide on the sense and / or antisense strand of the double-stranded siRNA analog via an adapter. In some implementations, the linker for the double-stranded siRNA analog to the antibody may be selected from succinimide-4-(N-maleimide-methyl)cyclohexane-1-carboxylate (SMCC).

[0111] Secondly, the present invention provides a vector comprising a nucleotide sequence encoding the aforementioned double-stranded siRNA analog.

[0112] The vector is capable of amplifying or expressing the nucleotides linked to it that encode the double-stranded siRNA analogs described in this invention. The vector can be a viral vector or plasmid capable of transporting nucleic acid molecules, such as: (a) an adenovirus vector; (b) a retrovirus vector; (c) an adeno-associated virus vector; (d) a herpes simplex virus vector; (e) an SV40 vector; (f) a polyomavirus vector; (g) a papillomavirus vector; (h) a microRNA virus vector; (i) a poxvirus vector; and (j) a helper virus-dependent adenovirus or an enterovirus-free adenovirus.

[0113] Thirdly, the present invention provides a cell comprising the aforementioned double-stranded siRNA analog or its pharmaceutically acceptable salt, or the aforementioned vector. The double-stranded siRNA analog or vector of the present invention is capable of transcription in said cell.

[0114] Fourthly, the present invention provides a pharmaceutical composition for inhibiting MSTN expression, comprising the aforementioned double-stranded siRNA analog or its pharmaceutically acceptable salt, or the aforementioned carrier, or the aforementioned cell.

[0115] As a preferred embodiment of the present invention, the pharmaceutical composition further includes pharmaceutically acceptable excipients.

[0116] Fifthly, the present invention provides a kit comprising the aforementioned double-stranded siRNA analog or its pharmaceutically acceptable salt, or the aforementioned carrier, or the aforementioned cells, or the aforementioned pharmaceutical composition.

[0117] In a sixth aspect, the present invention also provides the use of the aforementioned double-stranded siRNA analog or its pharmaceutically acceptable salt, the aforementioned carrier, the aforementioned cell, the aforementioned pharmaceutical composition or the aforementioned kit in the preparation of a medicament for the prevention and / or treatment of diseases or conditions involving MSTN, for example, for the prevention and / or treatment of diseases or conditions mediated by abnormal or overexpression of MSTN.

[0118] In a seventh aspect, the present invention also provides a method for preventing or treating a disease or condition mediated by abnormal or overexpression of MSTN in a subject, comprising: administering to a subject in need a preventive or therapeutically effective amount of the aforementioned double-stranded siRNA analog or its pharmaceutically acceptable salt, the aforementioned carrier, the aforementioned cells, the aforementioned pharmaceutical composition, or the aforementioned kit.

[0119] In some embodiments, the drug is used to promote the proliferation and / or hypertrophy of muscle cells, increase muscle mass and / or inhibit myasthenia gravis, inhibit the production of myostatin gene mRNA, and inhibit the function of myostatin. Muscle cells are contractile cells that form muscle tissue in humans or animals, including skeletal muscle cells, smooth muscle cells, and cardiomyocytes.

[0120] In some implementations, the disease or condition is selected from: muscle atrophy (e.g., muscular dystrophy, myopathy, spinal muscular atrophy, sarcopenia, disuse atrophy, etc.), conditions or diseases that produce a therapeutic effect by restoring muscle mass (e.g., cancer cachexia, diabetes, circulatory system diseases (heart failure, arteriosclerosis, etc.), kidney diseases (chronic renal insufficiency, etc.), bone diseases (inflammatory arthritis, etc.), etc.), but is not limited to these. Considering that the inhibition of myostatin can increase skeletal muscle mass, it is believed that this treatment can be used to treat all diseases presenting with muscle atrophy, regardless of the cause. Increased skeletal muscle mass can lead to increased exercise capacity and also helps improve overall metabolism.

[0121] In some embodiments, the muscle atrophy is diabetes-related muscle atrophy. In some embodiments, the muscle atrophy is cancer cachexia-related muscle atrophy. In some embodiments, the muscle atrophy is associated with insulin deficiency. In some embodiments, the muscle atrophy is associated with chronic renal failure. In some embodiments, the muscle atrophy is associated with congestive heart failure. In some embodiments, the muscle atrophy is associated with chronic respiratory diseases. In some embodiments, the muscle atrophy is associated with chronic infections. In some embodiments, the muscle atrophy is associated with fasting. In some embodiments, the muscle atrophy is associated with denervation. In some embodiments, the muscle atrophy is associated with sarcopenia, glucocorticoid therapy, stroke, and / or heart attack.

[0122] Eighthly, the present invention also provides the use of the double-stranded siRNA analog or its pharmaceutically acceptable salt, carrier, pharmaceutical composition or kit as described above in the preparation of a medicament for reducing MSTN expression in cells or subjects. Reducing MSTN expression includes reducing the amount of its mRNA, the amount of its protein, or both.

[0123] In a ninth aspect, the present invention also provides a method for inhibiting MSTN expression in cells or tissues, comprising: contacting the cells or tissues with the aforementioned double-stranded siRNA analog or its pharmaceutically acceptable salt, the aforementioned carrier, the aforementioned cells, the aforementioned pharmaceutical composition, or the aforementioned kit.

[0124] In some implementations, the cells or tissues include muscle cells or muscle tissue.

[0125] In some implementations, the method can be performed in vitro or ex vivo.

[0126] The double-stranded siRNA analog provided by this invention for inhibiting MSTN expression has good inhibitory activity against MSTN and can be used to prevent and / or treat related diseases mediated by MSTN expression. Detailed Implementation

[0127] The present invention will be further described in detail below with reference to embodiments, but the implementation of the invention is not limited thereto.

[0128] The term "comprising" in this invention is used to mean the phrase "comprising (but not limited to)" and is used interchangeably with that phrase unless the context clearly indicates otherwise.

[0129] The term "or" in this invention is used herein to mean the term "and / or" and may be used interchangeably with that term unless the context clearly indicates otherwise.

[0130] In this invention, the terms "sequence" and "nucleotide sequence" refer to the order or sequence of nucleobases or nucleotides, described alphabetically using standard nomenclature.

[0131] The term “about” is used herein to mean a typical tolerance range in the field. For example, “about” can be understood as about 2 standard deviations from the average. In some embodiments, about means ±10%. In some embodiments, about means ±5%. When “about” appears before a series of numbers or ranges, it should be understood that “about” can modify each number in the series or range.

[0132] The term "siRNA analog" in this invention refers to a complex of ribonucleic acid molecules having a double-stranded structure that can mediate the silencing of a target RNA (e.g., mRNA) complementary to it. An siRNA analog comprises two antiparallel and substantially complementary nucleic acid strands, including an antisense strand complementary to the target RNA and a sense strand complementary to the antisense strand. When the two nucleic acid strands are "substantially complementary," they can be perfectly complementary, or they can form one or more, but typically no more than five, four, three, or two hybridized mismatched nucleotide pairs for a duplex of up to 30 nucleotide pairs, while retaining the ability to hybridize under conditions most relevant to its final application, such as in vitro or in vivo suppression of gene expression.

[0133] In this invention, "complementary" has the meaning known to those skilled in the art, namely, in a double-stranded nucleic acid molecule, the bases of one strand pair with the bases of the other strand in a complementary manner. Adenine (A) always pairs with uracil (U); guanine (C) always pairs with cytosine (G). Each base pair includes one purine and one pyrimidine. When adenine on one strand always pairs with uracil on the other strand, and guanine always pairs with cytosine, the two strands are considered complementary, and the sequence of the complementary strand can be inferred from its sequence.

[0134] In this invention, the term "complementary region" refers to a region on the antisense strand that is substantially complementary to a sequence (e.g., a target sequence) as defined herein. When the complementary region is not perfectly complementary to the target sequence, mismatches can occur within the molecule or in terminal regions. Typically, the most permissible mismatches are in terminal regions, for example, within 5, 4, 3, or 2 nucleotides at the 5' and / or 3' ends.

[0135] In this invention, the term "protrusion" refers to one or more unpaired nucleotides extending beyond the complementary region at the end of a strand. A nucleotide protrusion is typically formed when the 3' end of one strand extends beyond the 5' end of another strand, or when the 5' end of one strand extends beyond the 3' end of another strand. Double-stranded siRNA analogs may contain a protrusion having at least one nucleotide, for example, the protrusion may contain at least two nucleotides, at least three nucleotides, at least four nucleotides, at least five nucleotides, or more. The nucleotide protrusion may contain or consist of a nucleotide / nucleoside analog (including deoxynucleotides / nucleosides). One or more protrusions may be located on the sense strand, the antisense strand, or any combination thereof. One or more protrusions may be located at the 5' end, 3' end, or both ends of the antisense strand or the sense strand.

[0136] As used in this article, “virtually all nucleotides are modified” means largely but not entirely modified, and may contain no more than 5, 4, 3, 2 or 1 unmodified nucleotides.

[0137] The terms “complementary,” “fully complementary,” and “substantially complementary” used in this article may be used relative to the base match between the sense and antisense strands of a double-stranded siRNA analog, or between two oligonucleotides or polynucleotides (such as the antisense strand and target sequence of a double-stranded siRNA analog), as understood in the context in which they are used.

[0138] In this invention, the modified nucleotides include, but are not limited to: alkyl nucleotides, methoxy nucleotides, ethoxy nucleotides, methoxyethyl nucleotides, amino nucleotides, fluoronucleotides, deoxynucleotides, 5'-methylphosphonucleotides, 5'-C-methylphosphonucleotides, 2′-deoxy-2′-fluoronucleotides, (E)-vinylphosphonate modified nucleotides (VP), thiophosphonucleotides, dithiophosphonucleotides, locked nucleic acids (LNA), morpholino oligonucleotides (PMO), and inverse debased deoxyribose residues (invAb).

[0139] Among them, alkyl-modified nucleotides, such as 2'-methyl nucleotides, 2'-Ethylnucleotide, 2'-methoxy modified nucleotides, for example, 2'-Methoxyethyl nucleotide, for example, 2'-Methoxyethoxynucleotides, for example, 2'-Fluoronucleotides, for example, 5'-C-methylphosphonucleotide, for example (E)-vinylphosphonate modified nucleotides (VP), for example, Phospho-3-phosphate nucleotides (PS), for example, 2'-Deoxyribonucleotides, for example: Reverse debasing deoxyribose residues (invAb), for example:

[0140] Where Base represents a base, R represents an alkyl or alkoxy group, Me represents a methyl group, and Et represents an ethyl group.

[0141] The term "locked nucleic acid" is a nucleotide with a modified ribose moiety, wherein the ribose moiety includes an additional bridge connecting the 2′ and 4′ carbons. This structure effectively "locks" the ribose in a 3′-endonucleotide conformation. Adding locked nucleic acids to siRNA has been shown to increase the stability of siRNA in serum and reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(1): 439-447; Mook, OR. et al., (2007) MolCancTher 6(3): 833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12): 3185-3193).

[0142] Representative U.S. patents for the preparation of locked nucleic acid nucleotides include, but are not limited to, the following: U.S. Patent Nos. 6,268,490; 6,670,461; 6,794,499; 6,998,484; 7,053,207; 7,084,125 and 7,399,845, the entire contents of each of which are incorporated herein by reference.

[0143] The structure of the locked nucleic acid is as follows:

[0144] In some embodiments, the sugar substitute comprises a ring having more than 5 atoms and more than 1 heteroatom. For example, nucleosides comprising morpholine sugar moieties and their use in oligomeric compounds have been reported (see, for example: Braasch et al., Biochemistry, 2002, 41, 4503-4510; and U.S. Patents 5,698,685; 5,166,315; 5,185,444; and 5,034,506).

[0145] The term "morpholino" refers to a sugar substitute having the following formula:

[0146] In some embodiments, the morpholino group can be modified, for example, by adding or changing various substituents according to the morpholino structure described above. Such sugar substitutes are referred to herein as "modified morpholino groups".

[0147] In this invention, unless otherwise specified, C, G, U, and A represent the base composition of nucleotides. Cm, Gm, Um, and Am respectively indicate that the nucleotides they represent are modified with methoxy groups; f indicates that the nucleotides they represent are modified with fluorine groups; the spacer "s" indicates that the two nucleotide residues adjacent to the spacer "s" are linked by thiophosphate groups; VP indicates that the nucleotide to the right of the letter VP is a (E)-vinyl phosphate modified nucleotide. For example, "AsG" indicates that the A and G residues are linked by thiophosphate groups.

[0148] It should be emphasized that the “modification” of nucleotides described in this disclosure includes, but is not limited to, the examples above. Nucleotides may also be replaced with other nucleotides, such as (S)-glycerol nucleic acids.

[0149] The term "targeting ligand" can include naturally occurring substances such as proteins (e.g., human serum albumin (HAS), low-density lipoprotein (LDL), or globulins); carbohydrates (e.g., dextran, styrax, chitosan, chitosan, inulin, cyclodextrin, N-acetylglucosamine, N-acetylglucosamine, or hyaluronic acid); or lipids. Ligands can also be recombinant or synthetic molecules, such as synthetic polymers, for example, synthetic polyamino acids. Examples of polyamino acids include the following: polylysine (PLL), poly-L-aspartic acid, poly-L-glutamic acid, styrene-maleic anhydride copolymer, poly(L-lactide-co-glycolic acid) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacrylic acid), N-isopropylacrylamide polymer, or polyphosphazene. Examples of polyamines include: polyethyleneimine, polylysine (PLL), spermine, spermidine, polyamine, pseudopeptide-polyamine, peptide-mimicking polyamine, dendritic polyamine, arginine, amidine, protamine, cationic lipids, cationic porphyrins, quaternary salts of polyamines, or α-helical peptides.

[0150] The targeting ligand can also be a cell or tissue target that binds to a specific cell type, such as muscle cells, and said cell or tissue target is a molecule that specifically binds to an antigen expressed on the muscle cells. In some embodiments, said cell or tissue target specifically binds to an internalized cell surface receptor on muscle and is capable of being internalized into muscle cells via receptor-mediated internalization. In some embodiments, said cell or tissue target is a small molecule, protein, peptide, nucleic acid (e.g., aptamer), or antibody. In some embodiments, said cell or tissue target is an antibody that specifically binds to the transferrin receptor.

[0151] Targeting ligands can be thyroid-stimulating hormone, melanocyte-stimulating hormone, lectins, glycoproteins, surfactant protein A, mucin carbohydrates, polylactose, polygalactose, N-acetyl-galactosamine, N-acetyl-glucosamine, polymannose, polyfucose, glycosylated polyamino acids, polygalactose, transferrin, bisphosphonates, polyglutamic acid, polyaspartic acid, lipids, cholesterol, steroids, bile acids, folic acid, vitamin B12, vitamin A, biotin, or RGD peptides or RGD peptide mimics.

[0152] Targeting ligands can also be proteins, such as glycoproteins, or peptides, such as molecules with specific affinity for accessory ligands, or antibodies, such as antibodies targeting specific cell types, such as muscle. Ligands can also include hormones and hormone receptors. They can also include non-peptide species, such as lipids, lectins, carbohydrates, vitamins, cofactors, polylactose, polygalactose, N-acetyl-galactosamine, N-acetyl-glucosamine, polymannose, or polyfucose. Ligands can be, for example, lipopolysaccharides, activators of p38MAP kinase, or activators of NF-κB.

[0153] Targeting ligands can be substances that can increase the uptake of iRNA into cells, for example, by disrupting the cell's cytoskeleton (e.g., by disrupting cellular microtubules, microfilaments, and / or intermediate filaments), such as drugs. Drugs can be, for example, taxon, vincristine, vinblastine, pinocembrin, nocodazole, iaplakinolide, red sea sponge A, phalloidin, swinholide A, indanocine, or myoservin.

[0154] The term "internalized cell surface receptor" refers to a cell surface receptor that is internalized by the cell in response to external stimuli, such as ligand binding to the receptor. In some embodiments, the internalized cell surface receptor is internalized via endocytosis. In some embodiments, the internalized cell surface receptor is internalized via clathrin-mediated endocytosis. However, in some embodiments, the internalized cell surface receptor is internalized via clathrin-independent pathways, such as phagocytosis, macropinocytosis, pit and raft-mediated uptake, or constitutive clathrin-independent endocytosis. In some embodiments, the internalized cell surface receptor comprises an intracellular domain, a transmembrane domain, and / or an extracellular domain, and optionally also comprises a ligand-binding domain. In some embodiments, the cell surface receptor is internalized upon ligand binding. In some embodiments, the internalized cell surface receptor is a transferrin receptor.

[0155] The term "transferrin receptor (also known as CD71, p90, TFR, or TFR1)" refers to an internalized cell surface receptor that binds to transferrin to facilitate iron uptake via endocytosis. In some embodiments, the transferrin receptor may be of human origin (NCBI gene ID 7037), non-human primate origin (e.g., NCBI gene ID 711568 or NCBI gene ID 102136007), or rodent origin (e.g., NCBI gene ID 22042). Additionally, several human transcript variants encoding different isotypes of the receptor have been characterized (e.g., as annotated with the following GenBank RefSeq accession numbers: NP_001121620.1, NP_003225.2, NP_001300894.1, and NP_001300895.1).

[0156] The term "lipophilic molecule" broadly refers to any compound or chemical component that has an affinity for lipids.

[0157] The term "specific binding" refers to the ability of a molecule to bind to a binding ligand with a degree of affinity or affinity that allows the molecule to be used to distinguish the binding ligand from a suitable control in a binding assay or other binding setting. Regarding antibodies, the term "specific binding" refers to the ability of an antibody to bind to a specific antigen with a degree of affinity or affinity compared to one or more suitable reference antigens, such that the antibody can be used to distinguish the specific antigen from other antigens, for example, to the extent that it allows preferential targeting of certain cells (e.g., muscle cells) by binding to antigens as described herein. In some embodiments, if the KD of antibody binding to the target is at least about 10... -6 M, 10 -7 M, 10 -8 M, 10 -9M, 10 -10 M, 10 -11 M, 10 -12 M, 10 -13 If M is smaller, the antibody will bind specifically to the target.

[0158] The term "pharmaceuticalally acceptable excipient" refers to a substance other than the active pharmaceutical ingredient (API, therapeutic product, such as a double-stranded siRNA analog or conjugate of MSTN that inhibits it) that is intentionally included in a drug delivery system. Excipients are not intended to exert a therapeutic effect at the expected dose. Excipients may serve to: a) facilitate handling of the drug delivery system during preparation; b) protect, support, or enhance the stability, bioavailability, or patient acceptability of the API; c) facilitate product identification; and / or d) enhance any other properties of the API, including overall safety, efficacy, or delivery, during storage or use.

[0159] The excipients include (but are not limited to): absorption enhancers, anti-sticking agents, defoamers, antioxidants, adhesives, buffers, carriers, coating agents, colorants, delivery enhancers, delivery polymers, detergents, dextran, dextran, diluents, disintegrants, emulsifiers, swelling agents, fillers, flavoring agents, flow aids, wetting agents, oils, polymers, preservatives, brine, salts, solvents, sugars, surfactants, suspending agents, sustained-release matrices, sweeteners, thickeners, tensioning agents, mediators, waterproofing agents, wetting agents, lubricants such as sodium lauryl sulfate and magnesium stearate, flavoring agents, and fragrances.

[0160] The term "medicinal salt" refers to the salt of the compound (siRNA) of this invention, which is prepared by the compound with specific substituents discovered in this invention and a pharmaceutically acceptable acid or base. The salts mentioned above include, but are not limited to, sodium salts, potassium salts, calcium salts, magnesium salts, iron salts, ammonium salts, lithium salts, hydrochloride salts, trifluoroacetate salts, oxalate salts, maleate salts, benzoate salts, salicylate salts, etc.

[0161] The pharmaceutical compositions disclosed herein include those suitable for oral, nasal, topical, sublingual, sublingual, rectal, and / or parenteral administration. The formulations can be conveniently present in unit dosage form and can be prepared by any method known in the pharmaceutical field. The amount of active ingredient that can be combined with a carrier substance to prepare a single-dose form is generally the amount of the compound that produces the therapeutic effect. Generally, in percent units, this amount is from about 1% to about 99% of the active ingredient, preferably from about 5% to about 70%, and most preferably from about 10% to about 30%.

[0162] The term "vector" refers to a nucleic acid molecule that can amplify or express another nucleic acid linked to it.

[0163] As used herein, the term "myostatin (MSTN)," also known as growth / differentiation factor 8 (GDF-8) or MSLHP, refers to any myostatin molecule known to those skilled in the art, including variants of the MSTN gene, such as those available in the SNP database. Many sequence variations within the MSTN gene have been identified and can be found, for example, in NCBI dbSNP and UniProt (see, for example, www.ncbi.nlm.nih.gov / snp / ?term=MSTN, the entire contents of which are incorporated herein by reference as of the date of this application).

[0164] Exemplary sequences of human MSTN mRNA transcripts can be found, for example, GenBank accession number NM_005259.3. Sequences of mouse MSTN mRNA can be found, for example, GenBank accession number NM_010834.3. Sequences of rat MSTN mRNA can be found, for example, GenBank accession number NM_019151.1. Sequences of cynomolgus monkey MSTN mRNA can be found, for example, GenBank accession number NM_001287623.1. Sequences of rhesus monkey MSTN mRNA can be found, for example, GenBank accession number NM_001080119.1. Other examples of MSTN mRNA sequences are readily available through public databases such as GenBank, UniProt, OMIM, the UCSC Genome Browser, and the Rhesus Monkey Genome Project website. Further information on MSTN can be found, for example, at www.ncbi.nlm.nih.gov / gene / ?term=myostatin. As of the date of this application, the full contents of each of the aforementioned GenBank accession numbers and gene database numbers are incorporated herein by reference.

[0165] The term "treatment" is used to refer to achieving a desired pharmacological and / or physiological effect. This effect may be preventative in terms of complete or partial prevention of disease or its symptoms, and / or therapeutic in terms of partial or complete cure of disease and / or adverse effects caused by disease. As used herein, "treatment" covers diseases in mammals, particularly humans, including: (a) prevention of disease or the onset of disease in individuals susceptible to disease but not yet diagnosed with it; (b) inhibition of disease, such as blocking disease progression; or (c) relief of disease, such as reducing disease-related symptoms. As used herein, "treatment" encompasses any administration of a drug or compound to an individual to treat, cure, relieve, improve, reduce, or inhibit the individual's disease, including but not limited to administration of a drug containing a compound described herein to an individual in need.

[0166] The term “suppression” is used interchangeably with “reduction,” “silence,” “downsampling,” “knockdown,” and other similar terms and includes any level of suppression.

[0167] In this invention, the phrase "inhibit MSTN expression" includes inhibiting the expression of any MSTN gene (e.g., mouse, rat, monkey, or human MSTN gene) along with variants or mutants of the MSTN gene encoding the MSTN protein.

[0168] "Inhibition of MSTN expression" includes inhibition of the MSTN gene at any level, such as at least partial inhibition of MSTN gene expression, for example, inhibition of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.

[0169] MSTN gene expression can be assessed based on the level of any variable associated with MSTN gene expression, such as MSTN mRNA level or MSTN protein level. Inhibition can be assessed by a reduction in the absolute or relative level of one or more of these variables compared to a control level. The control level can be any type of control level utilized in the art, such as baseline levels before administration or levels determined from similar subjects, cells, or samples that have never been treated or have been treated with a control (e.g., a buffer-only control or a non-active agent control).

[0170] In one embodiment, at least partial inhibition of MSTN gene expression is assessed by a reduction in the amount of MSTN mRNA isolated or detected from a first cell or group of first cells (treated to suppress MSTN gene expression) in which the MSTN gene is transcribed, compared to a second cell or group of second cells (control cells), which is substantially the same as the first cell or group of first cells except that it has not been treated in this way. The degree of inhibition can be expressed as follows:

[0171] Example 1: Synthesis of the Targeting Ligand (L96)

[0172] Step A: Hydroxyproline amine (3.00 g, 7.15 mmol) and monomethyl dodecanoate (1.748 g, 7.15 mmol) were placed together in N,N-dimethylformamide (DMF) (50 mL). The peptide coupling reagent (HBTU) (3.25 g, 8.56 mmol) and N,N-diisopropylethylamine (DIEA) (3.7 mL, 21.24 mmol) were added and the mixture was stirred and reacted overnight.

[0173] The reaction mixture was poured into an ice-water mixture and extracted with dichloromethane (DCM). The mixture was washed with bicarbonate solution, water, and brine, and dried over sodium sulfate. The solvent was removed, and the residue was purified by chromatography (eluting with 50% ethyl acetate / hexane, ethyl acetate, followed by 5% methanol / dichloromethane) to give the desired compound 115 as a white solid (4.30 g, 93%). MS:C 39 H 51 NO7 was calculated to be 645.37, while the measured value was 646.35 (M+H).

[0174] Step B: Dissolve compound 101 (4.25 g, 6.58 mmol) in a mixture of tetrahydrofuran / methanol / water (50 mL, 2:1:1). Add lithium hydroxide (LiOH) (1.90 g, 45.2 mmol) and stir the mixture overnight.

[0175] The reaction mixture was examined by thin-layer chromatography (TLC) on silica gel plates. Acetic acid was added to neutralize the reaction mixture. The solvent was removed and the residue was extracted with dichloromethane (DCM). Triethanolamine (TEA, in excess) was added to the DCM solution and filtered through a small silica gel pad to obtain the desired product 102 as its triethanolamine (TEA) salt (4.15 g, 86%). MS:C 38 H 49 NO7, calculated value 631.35; measured value 630.34 (MH).

[0176] Step C: Compound 102 (1.30 g, 2.06 mmol) and peptide coupling reagent (HBTU) (0.821 g, 1.05 eq.) were added together to N,N-dimethylformamide (DMF) (30 mL). N,N-diisopropylethylamine (DIEA) (1.07 mL, 3 eq.) was added and the reaction mixture was stirred for 3–4 minutes. A solution of amine (3.00 g, 1.58 mmol) was added, followed by 1 eq of DIEA. The reaction mixture was stirred overnight at room temperature.

[0177] The solvent was removed under reduced pressure, and the residue was dissolved in dichloromethane (DCM) and washed with bicarbonate and water. The dichloromethane (DCM) was dried over sodium sulfate to remove the solvent. The residue was purified by chromatography (eluting first with ethyl acetate, then with 5-20% methanol / dichloromethane) to give product 103 as a white solid (3.35 g, 88%). MS: for C 117 H 175 N 11 O 42 The calculated value is 2406.19; the measured value is 2429.10 (M+Na).

[0178] Ligand 104 (L96) can be linked to siRNA via a phosphate ester group, a thiophosphate ester group, or another linker group.

[0179] For the specific synthesis route, refer to the document with international patent publication number WO2009073809.

[0180] Example 2: Synthesis of siRNA analogs

[0181] siRNA was prepared using an OligoMaker ApS192 RNA synthesizer (made in Denmark). The specific synthetic route can be found in, for example, patent document CN202280081735.4. The sequences of the siRNA analogs are shown in Table 1, and their modified sequences are shown in Table 2. Specifically, the double-stranded siRNA analogs shown in Table 1 were prepared into double-stranded siRNA analogs (5'-3' direction) with the following modified form:

[0182] Justice chain: NmsNmsNmNmNfNmNfNfNfNmNmNmNmNmNmNmNmNmNmNm;

[0183] Antisense strand: NmsNfsNmNmNmNfNmNmNmNmNmNmNmNmNfNmNfNmNmNmsNmsNm;

[0184] Where: "N" represents a nucleotide, such as A, G, U, and C;

[0185] m indicates that the nucleotide to its left is a nucleotide modified with 2'-O-methyl. For example, Am, Um, Gm and Cm represent A, U, G and C modified with 2'-O-methyl, respectively.

[0186] f indicates that the nucleotide adjacent to it on the left is a 2'-fluorinated nucleotide. For example, Af, Uf, Gf and Cf represent 2'-fluorinated A, U, G and C respectively.

[0187] The letter 's' indicates that the two nucleotides adjacent to the letter 's' on the left and right are linked by thiophosphate groups.

[0188] Table 1 shows the sequence listing of unmodified siRNA analogs.

[0189] Table 2 shows the modified siRNA sequence listing.

[0190] In Table 2: m indicates that the nucleotide adjacent to it on the left is a nucleotide modified with 2'-O-methyl, Am = 2'-O-methyladenosine-3'-phosphate, Um = 2'-O-methyluridine-3'-phosphate, Cm = 2'-O-methylcytidine-3'-phosphate, Gm = 2'-O-methylguanosine-3'-phosphate; f indicates that the nucleotide adjacent to it on the left is a nucleotide modified with 2'-fluoro, Af = 2'-fluoroadenosine-3'-phosphate, Uf = 2'-fluorouridine-3'-phosphate, Cf = 2'-fluorocytidine-3'-phosphate, Gf = 2'-fluoroguanosine-3'-phosphate; s indicates that the two nucleotides adjacent to the letter s on the left and right are linked by a thiophosphate group.

[0191] Example 3: In vitro testing in HuH7 cells

[0192] The cDNA of the human MSTN (GenBank accession number NM_005259.3) gene was cloned into the reporter-based selection plasmid psiCHECK2 (Promega-C8021) to generate Renegades luciferase / MSTN fusion mRNA. HuH7 cells were cultured in DMEM (Gibco-10313021) medium containing 10% fetal bovine serum (Gibco-10099141C), 1% glutamine (Gibco-35050061), 1% non-essential amino acids (Gibco-11140050), and 1% penicillin-streptomycin (Gibco-15070063). MSTN-psiCHECK2 plasmid, double-stranded siRNA analog, and Lipo2000 (Invitrogen-11668019) transfection reagent, diluted with Opti-MEM (Gibico-11058021), were added to the HuH7 cell suspension and added at a concentration of 1×10⁻⁶. 5Cells were seeded in 96-well plates at a density of 1 nM / mL to achieve final concentrations of 1 nM, 0.1 nM, 0.01 nM, or 0.05 nM of double-stranded siRNA analogs. After 24 hours of culture, the relative levels of *Rhizopus luciferase* luciferase, normalized to constitutively expressed firefly luciferase also present on the psiCHECK2 plasmid, were measured using a dual luciferase reporter assay (Promega-E2920).

[0193] The inhibition rate of the MSTN gene mediated by double-stranded siRNA analogs was calculated according to the following formula, and the results are shown in Tables 3 and 4, where A>Average inhibition% 70%.

[0194] MSTN gene inhibition rate (%) = (1 - relative level of Renal luciferase in the sample / relative level of Renal luciferase in the control group) × 100.

[0195] Table 3. MSTN gene inhibition rate of modified siRNA at a final concentration of 0.1 nM

[0196] Table 4. MSTN gene inhibition rate of unmodified siRNA at a final concentration of 0.1 nM

[0197] According to the patent document WO2023064530A1, an unmodified double-stranded RNA AD-1640773 was synthesized as a control example of unmodified siRNA. The specific sequences of the sense and antisense strands of this control example are shown in Table 5.

[0198] Table 5 Comparative sequences of unmodified siRNA

[0199] The in vitro inhibition rate of some preferred siRNAs of the present invention and comparative examples at different final concentrations of siRNA (0.1 nM, 0.01 nM) in HuH7 cells was compared, and the results are shown in Table 6.

[0200] Table 6

[0201] Example 4: In vitro testing in HEK293 cells

[0202] The cDNA of the human MSTN gene (GenBank accession number NM_005259.3) was cloned into the reporter-based selection plasmid psiCHECK2 (Promega-C8021) to generate Renilla luciferase / MSTN fusion mRNA. HEK293 cells were cultured in DMEM (Gibco-10313021) medium containing 10% fetal bovine serum (Gibco-10099141C), 1% glutamine (Gibco-35050061), 1% non-essential amino acids (Gibco-11140050), and 1% penicillin-streptomycin (Gibco-15070063). MSTN-psiCHECK2 plasmid, double-stranded siRNA analog, and Lipo2000 (Invitrogen-11668019) transfection reagent, diluted with Opti-MEM (Gibico-11058021), were added to the HuH7 cell suspension and added at a concentration of 1×10⁻⁶. 5 Cells were seeded in 96-well plates at a density of 1 nM / mL to achieve final concentrations of 1 nM, 0.1 nM, 0.01 nM, or 0.05 nM of double-stranded siRNA analogs. After 24 hours of culture, the relative levels of *Rhizopus luciferase* luciferase, normalized to constitutively expressed firefly luciferase also present on the psiCHECK2 plasmid, were measured using a dual luciferase reporter assay (Promega-E2920).

[0203] Calculate the MSTN gene repression rate mediated by double-stranded siRNA analogs using the following formula:

[0204] MSTN gene inhibition rate (%) = (1 - relative level of Renal luciferase in the sample / relative level of Renal luciferase in the control group) × 100.

[0205] Example 5: In vitro testing in human rhabdomyosarcoma cells (RD cells)

[0206] To determine the in vitro efficacy of siRNA, siRNA was transfected into RD cells, and q-PCR was performed to determine the expression level of MSTN mRNA. Specifically, RD cells were cultured in DMEM medium (Gibco 11965-092) containing 10% fetal bovine serum (Gibco 10099141C), 1% glutamine (Gibco 35050061), 1% NEAA (Gibco 11140050), and 1% penicillin-streptomycin (Gibco 15070063). RD cells in logarithmic growth phase were cultured at a rate of 1×10⁻⁶ cells / cells. 4Cells were seeded at a density of 10 nM / well in 96-well cell culture plates. Simultaneously, siRNA was mixed with Lipofectamine™ RNAiMAX (INVITROGEN 13778150) to achieve final RNAi agent concentrations of 10 nM, 1 nM, 0.5 nM, 0.2 nM, 0.1 nM, or 0.01 nM. The RNAi agent mixture was then transfected into the cells. A Lipofectamine-containing solution was also prepared. TM The RNAiMAX compound-free cell control group. 48 h after transfection, the culture medium was removed, and total RNA was extracted and reverse transcribed (Transgen-AC301). Target cDNA was detected using the TaqMan assay, and GAPDH cDNA was detected as an internal control in parallel.

[0207] The expression level of the target gene mRNA in each sample was calculated using the ΔΔCT relative quantification method. The relative expression level of the target gene was expressed as 2-ΔΔCt. Specifically, the ΔCT value was obtained by subtracting the CT value of the internal control gene (GAPDH) from the CT value of the target gene in each sample. Then, the ΔCT value of the drug-treated group was subtracted from the ΔCT value of the control group containing only the transfection reagent (RNAiMAX Control) to obtain the ΔΔCT. Finally, the ΔΔCT was converted to 2-ΔΔCt to obtain the relative expression level of MSTN mRNA.

[0208] The inhibition rate of MSTN gene expression mediated by siRNA analogs was calculated using the following formula.

[0209] The inhibition rate of MSTN gene % = (1 – relative expression level of target gene in sample / mean relative expression level of target gene in control group) × 100.

[0210] The sequence list is based on WIPO Sequence Standard ST.26, in which Table 7 – Conventional Nucleotide Symbols, and Definition:

[0211] Table 7

[0212] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. A double-stranded siRNA analog or a pharmaceutically acceptable salt thereof for inhibiting MSTN expression, characterized in that, The double-stranded siRNA analog comprises a sense strand and an antisense strand, wherein the length of the sense strand and the antisense strand are each independently 15-30 nucleotides, the antisense strand includes a complementary region that is complementary to the sense strand, and the antisense strand contains at least 15 sequences, for example, 15, 16, 17, 18, 19, 20 or 21 consecutive nucleotides that differ from any of the sequences shown in SEQ ID NO:118-234, 357-478 by no more than 0, 1, 2 or 3 nucleotides. Preferably, the length of the sense strand and the antisense strand is independently 17-27 nucleotides, more preferably 19-25 nucleotides, and most preferably 19-23 nucleotides; Preferably, the length of the complementary region is at least 15, for example, 15, 16, 17, 18 or 19 nucleotide pairs; Preferably, the sense strand and the antisense strand each independently include a 3' overhang and / or a 5' overhang having at least one nucleotide, for example, one or both of the sense strand and the antisense strand include a 3' overhang and / or a 5' overhang having at least two nucleotides; Preferably, the antisense strand comprises a sequence that differs from any of the sequences shown in SEQ ID NO:118-234, 357-478 by no more than 3, 2, or 1 nucleotides, or the antisense strand comprises a continuous nucleotide sequence having at least 85%, for example, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide sequence identity with any of the sequences shown in SEQ ID NO:118-234, 357-478. Preferably, the antisense chain comprises any of the sequences shown in SEQ ID NO:118-234 and 357-489; Preferably, the antisense strand comprises a sequence that differs from the antisense strand of any siRNA selected from Table 4 or Table 6 by no more than 3, 2, or 1 nucleotides; or, it comprises a continuous nucleotide sequence that has at least 85%, for example, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide sequence identity with the antisense strand of any siRNA selected from Table 4 or Table 6. Preferably, the antisense strand comprises a sequence that differs from the sequence shown in any of SEQ ID NO:359, 396, 404, 485 or 489 by no more than 3, 2 or 1 nucleotides, or comprises a continuous nucleotide sequence having at least 85%, such as 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% nucleotide sequence identity with the sequence shown in any of SEQ ID NO:359, 396, 404, 485 or 489.

2. The double-stranded siRNA analog or its pharmaceutically acceptable salt according to claim 1, characterized in that, The positive strand comprises at least 15, for example, 15, 16, 17, 18, or 19 consecutive nucleotides that differ from any of the sequences shown in SEQ ID NO:1-117, 235-356 by no more than 0, 1, 2, or 3 nucleotides; or the positive strand comprises a consecutive nucleotide sequence that has at least 85%, for example, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide sequence identity with any of the sequences shown in SEQ ID NO:1-117, 235-356. Preferably, the justice chain comprises any of the sequences shown in SEQ ID NO:1-117 and 235-356; Preferably, the positive strand comprises a sequence that differs from the positive strand of any siRNA selected from Table 4 or Table 6 by no more than 3, 2, or 1 nucleotides, or comprises a continuous nucleotide sequence that has at least 85%, for example, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide sequence identity with the positive strand of any siRNA selected from Table 4 or Table 6. Preferably, the positive strand comprises a sequence that differs from the sequence shown in any of SEQ ID NO:237, 274, 282, 354 or 356 by no more than 3, 2 or 1 nucleotides, or comprises a continuous nucleotide sequence having at least 85%, such as 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% nucleotide sequence identity with the sequence shown in any of SEQ ID NO:237, 274, 282, 354 or 356.

3. The double-stranded siRNA analog or its pharmaceutically acceptable salt according to any one of claims 1-2, characterized in that, The double-stranded siRNA analog comprises paired sense and antisense sequences as shown in any of Table 1; Preferably, the antisense strand comprises a sequence differing from the sequence shown in SEQ ID NO:359 by no more than 3, 2, or 1 nucleotides, or comprises a continuous nucleotide sequence having at least 85%, such as 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide sequence identity with the sequence shown in SEQ ID NO:359; and the sense strand comprises a sequence differing from the sequence shown in SEQ ID NO:237 by no more than 3, 2, or 1 nucleotides, or comprises a continuous nucleotide sequence having at least 85%, such as 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide sequence identity with the sequence shown in SEQ ID NO:

237. Preferably, the sense strand and antisense strand each comprise sequences that differ from the sense strand and antisense strand sequences selected from any of the following groups by no more than 3, 2, or 1 nucleotides, or each comprise consecutive nucleotide sequences that have at least 85%, for example, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide sequence identity with the sense strand and antisense strand sequences selected from any of the following groups: (1) The sense chain shown in SEQ ID NO:4 and the antisense chain shown in SEQ ID NO:121; (2) The sense chain shown in SEQ ID NO:5 and the antisense chain shown in SEQ ID NO:122; (3) The positive chain shown in SEQ ID NO:9 and the negative chain shown in SEQ ID NO:126; (4) The positive chain shown in SEQ ID NO:36 and the negative chain shown in SEQ ID NO:153; (5) The sense chain shown in SEQ ID NO:41 and the antisense chain shown in SEQ ID NO:158; (6) The sense chain shown in SEQ ID NO:42 and the antisense chain shown in SEQ ID NO:159; (7) The positive chain shown in SEQ ID NO:103 and the negative chain shown in SEQ ID NO:220; (8) The positive chain shown in SEQ ID NO:114 and the negative chain shown in SEQ ID NO:231; (9) The positive chain shown in SEQ ID NO:116 and the negative chain shown in SEQ ID NO:233; (10) The sense chain shown in SEQ ID NO:237 and the antisense chain shown in SEQ ID NO:359; (11) The positive chain shown in SEQ ID NO:245 and the negative chain shown in SEQ ID NO:367; (12) The positive chain shown in SEQ ID NO:251 and the negative chain shown in SEQ ID NO:373; (13) The positive chain shown in SEQ ID NO:253 and the negative chain shown in SEQ ID NO:375; (14) The positive chain shown in SEQ ID NO:259 and the negative chain shown in SEQ ID NO:381; (15) The sense chain shown in SEQ ID NO:260 and the antisense chain shown in SEQ ID NO:382; (16) The sense chain shown in SEQ ID NO:274 and the antisense chain shown in SEQ ID NO:396; (17) The positive chain shown in SEQ ID NO:277 and the negative chain shown in SEQ ID NO:399; (18) The positive chain shown in SEQ ID NO:280 and the negative chain shown in SEQ ID NO:402; (19) The sense chain shown in SEQ ID NO:282 and the antisense chain shown in SEQ ID NO:404; (20) The sense chain shown in SEQ ID NO:301 and the antisense chain shown in SEQ ID NO:423; (21) The sense chain shown in SEQ ID NO:302 and the antisense chain shown in SEQ ID NO:424; (22) The positive chain shown in SEQ ID NO:304 and the negative chain shown in SEQ ID NO:426; (23) The positive chain shown in SEQ ID NO:307 and the negative chain shown in SEQ ID NO:429; (24) The positive chain shown in SEQ ID NO:308 and the negative chain shown in SEQ ID NO:430; (25) The sense chain shown in SEQ ID NO:309 and the antisense chain shown in SEQ ID NO:431; (26) The positive chain shown in SEQ ID NO:315 and the negative chain shown in SEQ ID NO:437; (27) The positive chain shown in SEQ ID NO:320 and the negative chain shown in SEQ ID NO:442; (28) The justice chain shown in SEQ ID NO:322 and the antisense chain shown in SEQ ID NO:444; (29) The justice chain shown in SEQ ID NO:324 and the antisense chain shown in SEQ ID NO:446; (30) The positive chain shown in SEQ ID NO:325 and the negative chain shown in SEQ ID NO:447; (31) The positive chain shown in SEQ ID NO:326 and the negative chain shown in SEQ ID NO:448; (32) The positive chain shown in SEQ ID NO:327 and the negative chain shown in SEQ ID NO:449; (33) The positive chain shown in SEQ ID NO:333 and the negative chain shown in SEQ ID NO:455; (34) The justice chain shown in SEQ ID NO:339 and the antisense chain shown in SEQ ID NO:461; (35) The positive chain shown in SEQ ID NO:345 and the negative chain shown in SEQ ID NO:467; (36) The positive chain shown in SEQ ID NO:350 and the negative chain shown in SEQ ID NO:472; or (37) The positive chain shown in SEQ ID NO:356 and the negative chain shown in SEQ ID NO:478; Preferably, the antisense strand comprises a sequence differing from the sequence shown in SEQ ID NO:396 by no more than 3, 2, or 1 nucleotides, or comprises a continuous nucleotide sequence having at least 85%, such as 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide sequence identity with the sequence shown in SEQ ID NO:396; and the sense strand comprises a sequence differing from the sequence shown in SEQ ID NO:274 by no more than 3, 2, or 1 nucleotides, or comprises a continuous nucleotide sequence having at least 85%, such as 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide sequence identity with the sequence shown in SEQ ID NO:

274. Preferably, the antisense strand comprises a sequence differing from the sequence shown in SEQ ID NO:404 by no more than 3, 2, or 1 nucleotides, or comprises a continuous nucleotide sequence having at least 85%, such as 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide sequence identity with the sequence shown in SEQ ID NO:404; and the sense strand comprises a sequence differing from the sequence shown in SEQ ID NO:282 by no more than 3, 2, or 1 nucleotides, or comprises a continuous nucleotide sequence having at least 85%, such as 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide sequence identity with the sequence shown in SEQ ID NO:

282. Preferably, the antisense strand comprises a sequence differing from the sequence shown in SEQ ID NO:485 by no more than 3, 2, or 1 nucleotides, or comprises a continuous nucleotide sequence having at least 85%, such as 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide sequence identity with the sequence shown in SEQ ID NO:485; and the sense strand comprises a sequence differing from the sequence shown in SEQ ID NO:354 by no more than 3, 2, or 1 nucleotides, or comprises a continuous nucleotide sequence having at least 85%, such as 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide sequence identity with the sequence shown in SEQ ID NO:

354. Preferably, the antisense strand comprises a sequence differing from the sequence shown in SEQ ID NO:489 by no more than 3, 2, or 1 nucleotides, or comprises a continuous nucleotide sequence having at least 85%, such as 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide sequence identity with the sequence shown in SEQ ID NO:489; and the sense strand comprises a sequence differing from the sequence shown in SEQ ID NO:356 by no more than 3, 2, or 1 nucleotides, or comprises a continuous nucleotide sequence having at least 85%, such as 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide sequence identity with the sequence shown in SEQ ID NO:

356.

4. The double-stranded siRNA analog or its pharmaceutically acceptable salt according to any one of claims 1-3, characterized in that, The double-stranded siRNA analog includes at least one modified nucleotide; Preferably, the modified nucleotide is selected from: alkyl-modified nucleotides, methoxy-modified nucleotides (e.g., 2'-O-methyl-modified nucleotides), ethoxy-modified nucleotides (e.g., 2'-O-ethyl-modified nucleotides), 2'-O-allyl-modified nucleotides, 2'-hydroxy-modified nucleotides, methoxyethyl-modified nucleotides, amino-modified nucleotides, fluorinated nucleotides (e.g., 2'-fluorinated nucleotides), deoxynucleotides, 5'-methylphosphonucleotides, 5'-C-methylphosphonucleotides, 2'-deoxy-2'-fluoronucleotides, (E)-vinylphosphonate-modified nucleotides, nucleotides containing thiophosphate groups, nucleotides containing dithiophosphate groups, locked nucleic acids (LNA), and morpholino oligonucleotides (PMO); More preferably, the sense strand and / or the antisense strand each independently comprise at least one 2'-O-methyl modified nucleotide, at least one 2'-fluoro modified nucleotide, and at least one nucleotide containing a thiophosphate group; More preferably, the nucleotides at positions 1, 2, 3, 4, 6, 10, 11, 12, 13, 14, 15, 16, 17, 18 and / or 19 of the sense strand are each independently a 2'-O-methyl modified nucleotide, in the direction from the 5' end to the 3' end; and / or, the nucleotides at positions 1, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20 and / or 21 of the antisense strand are each independently a 2'-O-methyl modified nucleotide, in the direction from the 5' end to the 3' end. More preferably, the nucleotides at positions 5, 7, 8 and / or 9 of the sense strand are each independently 2'-fluorinated nucleotides, in the direction from 5' end to 3' end; and / or, the nucleotides at positions 2, 6, 14 and / or 16 of the antisense strand are each independently 2'-fluorinated nucleotides, in the direction from 5' end to 3' end. More preferably, the thiophosphate group is present at at least one of the following positions: between the first and second nucleotides of the sense strand, between the second and third nucleotides of the sense strand, between the first and second nucleotides of the antisense strand, and between the second and third nucleotides of the antisense strand, in the direction from the 5' end to the 3' end; and between the first and second nucleotides of the antisense strand, and between the second and third nucleotides of the antisense strand, in the direction from the 3' end to the 5' end.

5. The double-stranded siRNA analog or its pharmaceutically acceptable salt according to any one of claims 1-4, characterized in that, Along the 5' to 3' direction, the 5th, 7th, 8th and 9th nucleotides of the sense strand each independently contain a 2'-fluorine modification; optionally, the remaining nucleotides of the sense strand are each independently selected from 2'-O-methyl modified nucleotides and nucleotides containing thiophosphate groups; and / or, the 2nd, 6th, 14th and 16th nucleotides of the antisense strand each independently contain a 2'-fluorine modification; optionally, the remaining nucleotides of the antisense strand are each independently selected from 2'-O-methyl modified nucleotides and nucleotides containing thiophosphate groups. Preferably, in the direction from the 5' end to the 3' end, the 5th, 7th, 8th, and 9th nucleotides of the sense strand each independently contain a 2'-fluorine modification, the remaining nucleotides each independently contain a 2'-O-methyl modification, and a thiophosphate group is present between the 1st and 2nd nucleotides and between the 2nd and 3rd nucleotides; and / or, the 2nd, 6th, 14th, and 16th nucleotides of the antisense strand each independently contain a 2'-fluorine modification, the remaining nucleotides of the antisense strand each independently contain a 2'-O-methyl modification, and a thiophosphate group is located between the 1st and 2nd nucleotides, between the 2nd and 3rd nucleotides, between the penultimate and penultimate nucleotides, and between the penultimate and penultimate nucleotides of the antisense strand.

6. The double-stranded siRNA analog or its pharmaceutically acceptable salt according to any one of claims 1-5, characterized in that, The antisense strand comprises any of the modified antisense strand nucleotide sequences shown in Table 2, and / or the sense strand comprises any of the modified sense strand nucleotide sequences shown in Table 2. Preferably, the double-stranded siRNA analog comprises any of the paired modified sense strand nucleotide sequences and modified antisense strand nucleotide sequences shown in Table 2; Preferably, in some embodiments, the positive strand comprises a sequence differing from the modified positive strand of any siRNA selected from Table 3 by no more than 3, 2, or 1 nucleotides, or comprises a sequence having at least 85%, for example 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide sequence identity with the modified positive strand of any siRNA selected from Table 3. The nucleotide sequence; and / or, the antisense strand comprises a sequence that differs from the sequence of the modified antisense strand selected from any of the siRNAs in Table 3 by no more than 3, 2, or 1 nucleotides, or comprises a sequence that has at least 85%, for example 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide sequence identity with the sequence of the modified antisense strand selected from any of the siRNAs in Table 3. Preferably, the antisense strand comprises a sequence differing from the modified antisense strand sequence of GDF122M by no more than 3, 2, or 1 nucleotides, or comprises a continuous nucleotide sequence having at least 85%, such as 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, nucleotide sequence identity with the modified antisense strand sequence of GDF122M; and the sense strand comprises a sequence differing from the modified sense strand sequence of GDF122M by no more than 3, 2, or 1 nucleotides, or comprises a continuous nucleotide sequence having at least 85%, such as 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, nucleotide sequence identity with the modified sense strand sequence of GDF122M. Preferably, the antisense strand comprises a sequence differing from the modified antisense strand sequence of GDF159M by no more than 3, 2, or 1 nucleotides, or comprises a continuous nucleotide sequence having at least 85%, such as 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, nucleotide sequence identity with the modified antisense strand sequence of GDF159M; and the sense strand comprises a sequence differing from the modified sense strand sequence of GDF159M by no more than 3, 2, or 1 nucleotides, or comprises a continuous nucleotide sequence having at least 85%, such as 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, nucleotide sequence identity with the modified sense strand sequence of GDF159M. Preferably, the antisense strand comprises a sequence differing from the modified antisense strand sequence of GDF167M by no more than 3, 2, or 1 nucleotides, or comprises a continuous nucleotide sequence having at least 85%, such as 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, nucleotide sequence identity with the modified antisense strand sequence of GDF167M; and the sense strand comprises a sequence differing from the modified sense strand sequence of GDF167M by no more than 3, 2, or 1 nucleotides, or comprises a continuous nucleotide sequence having at least 85%, such as 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, nucleotide sequence identity with the modified sense strand sequence of GDF167M. Preferably, the antisense strand comprises a sequence differing from the modified antisense strand sequence of GDF248M by no more than 3, 2, or 1 nucleotides, or comprises a continuous nucleotide sequence having at least 85%, such as 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, nucleotide sequence identity with the modified antisense strand sequence of GDF248M; and the sense strand comprises a sequence differing from the modified sense strand sequence of GDF248M by no more than 3, 2, or 1 nucleotides, or comprises a continuous nucleotide sequence having at least 85%, such as 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, nucleotide sequence identity with the modified sense strand sequence of GDF248M. Preferably, the antisense strand comprises a sequence differing from the modified antisense strand sequence of GDF252M by no more than 3, 2, or 1 nucleotides, or comprises a continuous nucleotide sequence having at least 85%, such as 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, nucleotide sequence identity with the modified antisense strand sequence of GDF252M; and the sense strand comprises a sequence differing from the modified sense strand sequence of GDF252M by no more than 3, 2, or 1 nucleotides, or comprises a continuous nucleotide sequence having at least 85%, such as 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, nucleotide sequence identity with the modified sense strand sequence of GDF252M. Wherein, m indicates that the nucleotide to its left is a 2'-O-methyl modified nucleotide; f indicates that the nucleotide to its left is a 2'-fluoro modified nucleotide; and s indicates that the two nucleotides to the left and right of the letter s are linked by a thiophosphate group.

7. The double-stranded siRNA analog or its pharmaceutically acceptable salt according to any one of claims 1-6, characterized in that, The double-stranded siRNA analog is linked to a targeting ligand; Preferably, the targeting ligand is selected from: Preferably, the targeting ligand is selected from cell or tissue targeting agents that bind to muscle cells; Preferably, the cell or tissue targeting agent is an antibody that specifically binds to the transferrin receptor (TFR1), the antibody binding to the transferrin receptor with high specificity and affinity, and / or the equilibrium dissociation constant (KD) of the antibody binding to the transferrin receptor is 10. -12 M to 10 -7 M, and / or the antibody does not inhibit the binding of transferrin to the transferrin receptor; Preferably, the targeting ligand is attached to the 3' or 5' end of the positive chain.

8. A vector comprising a nucleotide sequence encoding a double-stranded siRNA analog as described in any one of claims 1-7.

9. A cell comprising the double-stranded siRNA analog of any one of claims 1-7 or a pharmaceutically acceptable salt thereof or the vector of claim 8.

10. A pharmaceutical composition for inhibiting MSTN expression, comprising the double-stranded siRNA analog of any one of claims 1-7 or a pharmaceutically acceptable salt thereof, the vector of claim 8, or the cell of claim 9.

11. A kit comprising the double-stranded siRNA analog of any one of claims 1-7 or a pharmaceutically acceptable salt thereof, the vector of claim 8, the cell of claim 9, or the pharmaceutical composition of claim 10.

12. Use of the double-stranded siRNA analog of any one of claims 1-7 or a pharmaceutically acceptable salt thereof, the vector of claim 8, the cell of claim 9, the pharmaceutical composition of claim 10, or the kit of claim 11 in the preparation of a medicament for the prevention and / or treatment of diseases or conditions involving MSTN.