Neutralizing antibody against human parainfluenza virus type 3 and use thereof

Abstract

Provided are an antibody against human parainfluenza virus type 3, a bispecific antibody against human parainfluenza virus type 3 and respiratory syncytial virus, a nucleic acid molecule encoding the antibody and / or the bispecific antibody, a vector comprising the nucleic acid molecule, a host cell comprising the nucleic acid molecule or the vector, and a pharmaceutical composition comprising the antibody and / or the bispecific antibody. Also provided are a method for preparing and purifying the antibody and / or the bispecific antibody, and a use of the antibody and / or the bispecific antibody.

Description

Neutralizing antibodies against human parainfluenza virus type 3 and their uses

[0001] Related applications

[0002] This application claims priority and benefit to Chinese Patent Application No. CN 202411589866.0, filed on November 8, 2024, entitled “Anti-human Parainfluenza Virus Type 3 Neutralizing Antibody and Its Use Thereof,” which is incorporated herein by reference in its entirety for all purposes. Technical Field

[0003] This application generally relates to the fields of genetic engineering and antibody drugs; more specifically, it relates to antibodies against human parainfluenza virus type 3 (HPIV3), bispecific antibodies against human parainfluenza virus type 3 (HPIV3) and respiratory syncytial virus (RSV), and the use of said antibodies in the prevention or treatment of HPIV3 infection and related diseases, as well as the use of said bispecific antibodies in the prevention or treatment of HPIV3 infection and related diseases and RSV infection and related diseases. Background Technology

[0004] Human parainfluenza virus (HPIV) is one of the main pathogens causing lower respiratory tract infections in children, with at least 75% to 85% of children under 5 years old having been infected with HPIV. [1] Based on viral genetics and antigenicity, HPIV can be divided into types 1-4, with HPIV-4 further divided into subtypes A and B. [2] Human parainfluenza virus type 3 (HPIV3) is a major respiratory virus that causes acute respiratory infections, and its infection rate in children is second only to respiratory syncytial virus (RSV). HPIV3 mainly infects newborns, infants, and immunocompromised adults, causing pneumonia and bronchitis. Unlike other HPIVs, 40% of HPIV3 infections occur in the first year of life. Studies have shown that approximately 6.8% of hospitalizations for acute respiratory infections in children under 5 years old in the United States are caused by HPIV infection, with HPIV3 accounting for more than half of these cases. It is estimated that HPIV infection causes approximately 23,000 hospitalizations in children under 5 years old annually. [3] .

[0005] HPIV is a class of enveloped, non-segmented, single-stranded, negative-sense RNA viruses belonging to the Paramyxoviridae family. They are typically spherical, ranging in diameter from 125 to 250 nm, with a genome length of approximately 15,500 bp encoding six structural proteins. These include two membrane glycoproteins: hemagglutinin-neuraminidase (HN) and a fusion protein (F), as well as four intramembrane proteins: a matrix protein (M), a nucleocapsid protein (N), a phosphoprotein (P), and a large RNA polymerase protein (L). [4] Among them, the HN protein and the F protein are the main protective antigens on the surface of the viral envelope, which can induce the host to produce neutralizing antibodies.

[0006] F protein can regulate membrane fusion and promote viral nucleocapsid entry into host cells, while HN has hemagglutinin (HI) and neuraminidase (NA) activities. [1] HPIV fuses its viral envelope with the host cell membrane through the synergistic action of the F protein and HN. When HN binds to sialic acid (SA), the metastable pre-fused form of the F protein is activated, undergoing a series of structural rearrangements to become the stable post-fusion form, thereby driving membrane fusion. Studies have found that the glycosylation sites and numbers of HN vary among different viral subtypes, while the F protein is highly conserved across different viral subtypes. [5] .

[0007] Currently, there are no vaccines or drugs targeting HPIV3 available domestically or internationally. Based on clinical needs, the development of antibodies against HPIV3 and bispecific antibodies against both HPIV3 and RSV is of significant biological and medical importance for the prevention or treatment of HPIV3 infection and RSV infection and related diseases.

[0008] Invention Overview

[0009] In one aspect, this application provides an antibody against human parainfluenza virus type 3 (HPIV3), comprising a heavy chain variable region containing HCDR1, HCDR2, and HCDR3 and a light chain variable region containing LCDR1, LCDR2, and LCDR3, wherein...

[0010] The amino acid sequences of HCDR1 are shown in SEQ ID NO:1, HCDR2 are shown in SEQ ID NO:2, HCDR3 are shown in SEQ ID NO:3, LCDR1 is shown in SEQ ID NO:4, LCDR2 is shown in SEQ ID NO:5, and LCDR3 is shown in SEQ ID NO:6.

[0011] The amino acid sequences of HCDR and LCDR are defined according to Kabat.

[0012] In some embodiments of the first aspect, the amino acid sequence of the heavy chain variable region of the antibody is shown in SEQ ID NO:7.

[0013] In some embodiments of the first aspect, the amino acid sequence of the light chain variable region of the antibody is shown in SEQ ID NO:8.

[0014] In some embodiments of the first aspect, the amino acid sequence of the antibody heavy chain variable region is shown in SEQ ID NO:7, and the amino acid sequence of the antibody light chain variable region is shown in SEQ ID NO:8.

[0015] In some embodiments of the first aspect, the amino acid sequence of the heavy chain variable region of the antibody has at least 90% identity with SEQ ID NO:7, and the amino acid sequence of the light chain variable region of the antibody has at least 90% identity with SEQ ID NO:8.

[0016] In some embodiments of the first aspect, the antibody is a neutralizing antibody.

[0017] In some embodiments of the first aspect, the antibody is capable of binding to the F protein of HPIV3.

[0018] In some embodiments of the first aspect, the antibody is a Fab fragment, a whole antibody, an F(ab')2 fragment, or a single-chain Fv fragment (scFv).

[0019] In some embodiments of the first aspect, the antibody is a monoclonal antibody.

[0020] In some embodiments of the first aspect, the antibody further comprises a heavy chain constant region selected from IgG1, IgG2 or IgG4 subtypes.

[0021] In some embodiments of the first aspect, the antibody further comprises a light chain constant region selected from the κ or λ subtype.

[0022] Secondly, this application provides a bispecific antibody against human parainfluenza virus type 3 (HPIV3) and respiratory syncytial virus (RSV), said bispecific antibody comprising a first antigen-binding region for HPIV3 and a second antigen-binding region for RSV.

[0023] The first antigen-binding region includes a heavy chain variable region containing HCDR1 (as shown in SEQ ID NO:1), HCDR2 (as shown in SEQ ID NO:2), and HCDR3 (as shown in SEQ ID NO:3), and a light chain variable region containing LCDR1 (as shown in SEQ ID NO:4), LCDR2 (as shown in SEQ ID NO:5), and LCDR3 (as shown in SEQ ID NO:6).

[0024] The amino acid sequences of HCDR and LCDR are defined according to Kabat.

[0025] In some embodiments of the second aspect, the amino acid sequence of the heavy chain variable region of the first antigen-binding region has at least 90% identity with SEQ ID NO:7.

[0026] In some embodiments of the second aspect, the amino acid sequence of the light chain variable region of the first antigen-binding region has at least 90% identity with SEQ ID NO:8.

[0027] In some embodiments of the second aspect, the amino acid sequence of the heavy chain variable region of the first antigen-binding region is shown in SEQ ID NO:7.

[0028] In some embodiments of the second aspect, the amino acid sequence of the light chain variable region of the first antigen-binding region is shown in SEQ ID NO:8.

[0029] In some embodiments of the second aspect, the second antigen-binding region comprises a heavy chain variable region containing HCDR1 as shown in SEQ ID NO:34, HCDR2 as shown in SEQ ID NO:35, and HCDR3 as shown in SEQ ID NO:36, and a light chain variable region containing LCDR1 as shown in SEQ ID NO:37, LCDR2 as shown in SEQ ID NO:38, and LCDR3 as shown in SEQ ID NO:39;

[0030] The amino acid sequences of HCDR and LCDR are defined according to Kabat.

[0031] In some embodiments of the second aspect, the amino acid sequence of the heavy chain variable region of the second antigen-binding region has at least 90% identity with SEQ ID NO:41.

[0032] In some embodiments of the second aspect, the amino acid sequence of the light chain variable region of the second antigen-binding region has at least 90% identity with SEQ ID NO:42.

[0033] In some embodiments of the second aspect, the amino acid sequence of the heavy chain variable region of the second antigen-binding region is shown in SEQ ID NO:41.

[0034] In some embodiments of the second aspect, the amino acid sequence of the light chain variable region of the second antigen-binding region is shown in SEQ ID NO:42.

[0035] In some embodiments of the second aspect, the bispecific antibody is capable of binding the F protein of HPIV3 and / or the F protein of RSV, for example, the bispecific antibody is capable of binding the recombinant human HPIV3 F protein as shown in SEQ ID NO:9 and / or the recombinant RSV F protein as shown in SEQ ID NO:40.

[0036] Thirdly, this application provides a nucleic acid molecule that encodes the antibody described in the first aspect and / or the bispecific antibody described in the second aspect.

[0037] Fourthly, this application provides a pharmaceutical composition comprising the antibody described in the first aspect and / or the bispecific antibody described in the second aspect, as well as a pharmaceutically acceptable excipient, diluent, or carrier.

[0038] Fifthly, this application provides the use of the antibody described in the first aspect, the bispecific antibody described in the second aspect, the nucleic acid molecule described in the third aspect, or the pharmaceutical composition described in the fourth aspect in the preparation of a medicament for the prevention or treatment of HPIV3 infection and related diseases, or the use of the bispecific antibody described in the second aspect, the nucleic acid molecule described in the third aspect encoding the bispecific antibody, or the pharmaceutical composition described in the fourth aspect containing the bispecific antibody in the preparation of a medicament for the prevention or treatment of RSV infection and related diseases.

[0039] Sixthly, this application provides methods for preventing or treating HPIV3 infection and HPIV3 infection-related diseases, comprising administering to an individual in need the antibody described in the first aspect, the bispecific antibody described in the second aspect, the nucleic acid molecule described in the third aspect, or the pharmaceutical composition described in the fourth aspect.

[0040] In a seventh aspect, this application provides a method for preventing or treating RSV infection and RSV infection-related diseases, comprising administering to an individual in need the bispecific antibody described in the second aspect, a nucleic acid molecule encoding the bispecific antibody described in the third aspect, or a pharmaceutical composition comprising the bispecific antibody described in the fourth aspect. Attached Figure Description

[0041] Figure 1 shows the results of Biacore T200 analysis of the binding epitopes of anti-HPIV3 F protein monoclonal antibodies; where A represents advanced sample PI3-E12 re-injected with H1C5VH+R28H11VK, B represents advanced sample 3X1 re-injected with H1C5VH+R28H11VK, C represents advanced sample PIA174 re-injected with H1C5VH+R28H11VK, and D represents advanced sample H1C5VH+R28H11VK re-injected with 3X1, PI3-E12, and PIA174.

[0042] Figure 2 shows the results of the anti-HPIV3 F protein monoclonal antibody H1C5VH+R28H11VK inhibiting C243 virus infection of LLC-MK2 cells.

[0043] Figure 3 shows the results of the anti-HPIV3 F protein monoclonal antibody H1C5VH+R28H11VK inhibiting the infection of LLC-MK2 cells with HPIV3 isolated from clinical samples.

[0044] Figure 4 shows the results of the protective effect of the anti-HPIV3 F protein monoclonal antibody H1C5VH+R28H11VK against C243 virus infection in golden hamsters.

[0045] Figures 5A, 5B, and 5C show the results of the bispecific antibody R3B1h1+H1C5VH+R28H11VK BsAb inhibiting Hep-2 cells infected with different RSV strains, respectively. Figure 5A shows the inhibitory effect of the bispecific antibody on RSV subtype A strain A2, Figure 5B shows the inhibitory effect of the bispecific antibody on RSV subtype B strain 18537, and Figure 5C shows the inhibitory effect of the bispecific antibody on RSV strains isolated from clinical samples.

[0046] Figure 6 shows the results of the bispecific antibody R3B1h1+H1C5VH+R28H11VK BsAb inhibiting LLC-MK2 cells infected with C243 virus (Figure A) and HPIV3 strain isolated from clinical samples (Figure B).

[0047] Figure 7 shows the results of the protective effect of the bispecific antibody R3B1h1+H1C5VH+R28H11VK BsAb against HPIV3 and RSV on BALB / c Nude mice infected with RSV subtype A strain A2.

[0048] Figure 8 shows the results of the protective effect of the bispecific antibody R3B1h1+H1C5VH+R28H11VK BsAb against HPIV3 and RSV against C243 virus infection in golden hamsters.

[0049] Sequence Description

[0050] SEQ ID NO:1-3 show the amino acid sequences of HCDR1, HCDR2 and HCDR3 of the antibody clone H1C5VH+R28H11VK against HPIV3 F protein, respectively.

[0051] SEQ ID NO:4-6 show the amino acid sequences of LCDR1, LCDR2 and LCDR3 of the antibody clone H1C5VH+R28H11VK against HPIV3 F protein, respectively.

[0052] SEQ ID NO:7 shows the amino acid sequence of the heavy chain variable region of the antibody clone H1C5VH+R28H11VK against HPIV3 F protein.

[0053] SEQ ID NO:8 shows the amino acid sequence of the light chain variable region of the antibody clone H1C5VH+R28H11VK against HPIV3 F protein.

[0054] SEQ ID NO:9 shows the amino acid sequence of HPIV3 PreF2, the pre-fusion HPIV3 F protein mutant.

[0055] SEQ ID NO:10 shows the amino acid sequence of the His tag.

[0056] SEQ ID NO:11 shows the amino acid sequence of the constant region of the heavy chain of the human (homo sapiens) IgG1 subtype.

[0057] SEQ ID NO:12 shows the amino acid sequence of the mutant IgG1-YTE of the human IgG1 subtype heavy chain constant region.

[0058] SEQ ID NO:13 shows the amino acid sequence of the constant region of the heavy chain of mouse (mus musculus) IgG2a subtype.

[0059] SEQ ID NO:14 shows the amino acid sequence of the constant region of the light chain of the human (homo sapiens) κ subtype.

[0060] SEQ ID NO:15 shows the amino acid sequence of the constant region of the light chain of the human (homo sapiens) λ subtype.

[0061] SEQ ID NO:16 shows the amino acid sequence of the constant region of the light chain of the mouse (mus musculus) κ subtype.

[0062] SEQ ID NO:17 shows the amino acid sequence of the constant region of the light chain in the mouse (mus musculus) λ subtype.

[0063] SEQ ID NO:18 shows the amino acid sequence of the heavy chain variable region of the human anti-HPIV3 antibody clone PI3-E12.

[0064] SEQ ID NO:19 shows the amino acid sequence of the light chain variable region of the human anti-HPIV3 antibody clone PI3-E12.

[0065] SEQ ID NO:20 shows the amino acid sequence of the heavy chain variable region of human anti-HPIV3 antibody clone 3X1.

[0066] SEQ ID NO:21 shows the amino acid sequence of the light chain variable region of human anti-HPIV3 antibody clone 3X1.

[0067] SEQ ID NO:22 shows the amino acid sequence of the heavy chain variable region of the human anti-HPIV3 antibody clone PIA174.

[0068] SEQ ID NO:23 shows the amino acid sequence of the light chain variable region of the human anti-HPIV3 antibody clone PIA174.

[0069] SEQ ID NO:24 shows the nucleotide sequence of the reverse transcription primer for detecting HPIV3 titers in golden hamster lung tissue.

[0070] SEQ ID NO:25 shows the nucleotide sequence of HPIV3 in a standard quality plasmid used to detect HPIV3 titers in golden hamster lung tissue.

[0071] SEQ ID NO:26 shows the nucleotide sequence of the upstream primer used to detect HPIV3 titers in golden hamster lung tissue.

[0072] SEQ ID NO:27 shows the nucleotide sequence of the downstream primer for detecting HPIV3 titers in golden hamster lung tissue.

[0073] SEQ ID NO:28 shows the amino acid sequence of the heavy chain of the bispecific antibody against HPIV3 and RSV, R3B1h1+H1C5VH+R28H11VK BsAb.

[0074] SEQ ID NO:29 shows the amino acid sequence of the light chain of the bispecific antibody against HPIV3 and RSV, R3B1h1+H1C5VH+R28H11VK BsAb.

[0075] SEQ ID NO:30 shows the nucleotide sequence of the reverse transcription primers used to detect RSV titers in lung tissue of BALB / c Nude mice.

[0076] SEQ ID NO:31 shows the nucleotide sequence of RSV in a standard plasmid used to detect RSV titers in lung tissue of BALB / c Nude mice.

[0077] SEQ ID NO:32 shows the nucleotide sequence of the upstream primer used to detect RSV titers in lung tissue of BALB / c Nude mice.

[0078] SEQ ID NO:33 shows the nucleotide sequence of the downstream primer for detecting RSV titers in lung tissue of BALB / c Nude mice.

[0079] SEQ ID NO:34-36 shows the amino acid sequences of HCDR1, HCDR2, and HCDR3 in the second antigen-binding region of the bispecific antibody R3B1h1+H1C5VH+R28H11VK BsAb, which binds to RSV.

[0080] SEQ ID NO:37-39 shows the amino acid sequences of LCDR1, LCDR2, and LCDR3, the second antigen-binding regions of the bispecific antibody R3B1h1+H1C5VH+R28H11VK BsAb that binds to RSV.

[0081] SEQ ID NO:40 shows the amino acid sequence of the pre-fusion F protein mutant RSV-DS-Cav1-A polypeptide.

[0082] SEQ ID NO:41 shows the amino acid sequence of the heavy chain variable region of the second antigen-binding region of the bispecific antibody R3B1h1+H1C5VH+R28H11VK BsAb, which binds to RSV.

[0083] SEQ ID NO:42 shows the amino acid sequence of the light chain variable region of the second antigen-binding region of the bispecific antibody R3B1h1+H1C5VH+R28H11VK BsAb, which binds to RSV.

[0084] Invention Details

[0085] The inventors of this application have obtained novel antibodies against human parainfluenza virus type 3 (HPIV3) and bispecific antibodies against HPIV3 and respiratory syncytial virus (RSV) through antibody engineering technology. In various aspects of this application, novel antibodies against HPIV3 (e.g., HPIV3 F protein) and bispecific antibodies against HPIV3 and RSV (e.g., simultaneously binding to HPIV3 F protein and RSV F protein) are provided, along with nucleic acid molecules encoding said antibodies and / or bispecific antibodies, vectors containing said nucleic acid molecules, host cells containing said nucleic acid molecules or vectors, pharmaceutical compositions containing said antibodies and / or bispecific antibodies, methods for preparing and purifying said antibodies and / or bispecific antibodies, and medical and biological uses of said antibodies and / or bispecific antibodies. Based on the amino acid sequences of the variable regions of the antibodies and / or bispecific antibodies provided in this application, full-length antibody molecules can be constructed as drugs for the prevention or treatment of HPIV3 infection and related diseases and / or RSV infection and related diseases.

[0086] Unless otherwise specified, this application is implemented using conventional molecular biology, microbiology, cell biology, biochemistry and immunology techniques in the art.

[0087] Unless otherwise specified, the terms used in this application have the meanings commonly understood by those skilled in the art.

[0088] definition

[0089] As used herein, an "antibody" refers to an immunoglobulin molecule capable of specifically binding to a target via at least one antigen recognition site located in the variable region of an immunoglobulin molecule. Targets include, but are not limited to, carbohydrates, polynucleotides, lipids, peptides, etc. The term "antibody" as used herein includes not only complete (i.e., full-length) antibodies, but also their antigen-binding fragments (e.g., Fab, Fab', F(ab')2, Fv), their variants, fusion proteins containing antibody portions, humanized antibodies, chimeric antibodies, biantibodies, linear antibodies, single-chain antibodies, multispecific antibodies (e.g., bispecific antibodies), and any other modified configurations of immunoglobulin molecules containing antigen recognition sites of desired specificity, including glycosylated variants of antibodies, amino acid sequence variants of antibodies, and covalently modified antibodies.

[0090] Typically, a full-length or complete antibody consists of two heavy chains and two light chains. Each heavy chain contains a heavy chain variable region (VH) and first, second, and third constant regions (CH1, CH2, and CH3). Each light chain contains a light chain variable region (VL) and a constant region (CL). Full-length antibodies can be any type of antibody, such as IgD, IgE, IgG, IgA, or IgM (or subclasses mentioned above), but the antibody does not need to belong to any specific class. Immunoglobulins can be assigned to different classes based on the antibody's amino acid sequence of the heavy chain constant domain. Generally, there are five main classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM, and several of these classes can be further subdivided into subclasses (isotypes), such as IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2. The heavy chain constant domains corresponding to different immunoglobulin classes are called α, δ, ε, γ, and μ, respectively. The subunit structures and three-dimensional structures of different classes of immunoglobulins are well known.

[0091] As used herein, the term "antigen-binding fragment or antigen-binding region" refers to a portion or region of the complete antibody molecule responsible for binding the antigen. The antigen-binding domain may contain a heavy chain variable region (VH), a light chain variable region (VL), or both. Each of the VH and VL typically contains three complementarity-determining regions, CDR1, CDR2, and CDR3.

[0092] It is well known to those skilled in the art that complementarity-determining regions (CDRs, typically CDR1, CDR2, and CDR3) are the variable regions that have the greatest impact on antibody affinity and specificity. There are two common definitions for the CDR amino acid sequence of VH or VL: the Chothia definition and the Kabat definition. See, for example, Kabat, “Sequences of Proteins of Immunological Interest,” National Institutes of Health, Bethesda, MD. (1991). [6] ;A1-Lazikani et al., J.Mol.Biol.273:927-948 (1997) [7] ; and Martin et al., Proc. Natl. Acad. Sci. USA 86:9268-9272 (1989) [8] For a given antibody's variable region amino acid sequence, the CDR amino acid sequence in the VH and VL amino acid sequences can be determined according to the Chothia or Kabat definition. In the embodiments of this application, the Kabat definition of the CDR amino acid sequence is used.

[0093] For a given antibody's variable region amino acid sequence, the CDR amino acid sequence can be analyzed in various ways, such as using the online software Abysis (http: / / www.abysis.org / ).

[0094] Examples of antigen-binding fragments include, but are not limited to: (1) Fab fragments, which may be monovalent fragments having VL-CL chains and VH-CH1 chains; (2) F(ab')2 fragments, which may be divalent fragments having two Fab' fragments connected by disulfide bridges (i.e., Fab' dimers) in the hinge region; (3) Fv fragments having a single arm of antibody with VL and VH domains; (4) single-chain Fv(scFv), which may be a single multipeptide chain consisting of VH and VL domains connected by peptide linkers; and (5) (scFv)2, which may contain two VH domains and two VL domains connected by peptide linkers, the two VL domains being combined with the two VH domains via disulfide bridges.

[0095] In some specific embodiments of this application, the antibody is a Fab fragment, i.e., a monovalent fragment having a VL-CL chain and a VH-CH1 chain.

[0096] As used in this article, "specific binding" refers to a non-random binding reaction between two molecules, such as the binding of an antibody to an antigenic epitope.

[0097] As used in this article, a "neutralizing antibody" is an antibody that can bind to antigens on the surface of pathogenic microorganisms, thereby preventing the pathogenic microorganisms from adhering to target cell receptors or preventing the viral envelope from fusing with the cell membrane, thus preventing invasion of cells.

[0098] As used in this article, “monoclonal antibody” refers to an antibody obtained from a population of essentially homogeneous antibodies, that is, the individual antibodies that make up the population are identical except for the possibility of naturally occurring mutations in a small number of individuals.

[0099] As used herein, the term "bispecific antibody" refers to an antibody that simultaneously binds to two antigenic epitopes. These two epitopes can be on different antigens or on the same antigen. Bispecific antibodies can have various structural configurations. For example, a bispecific antibody can consist of two Fc fragments and two binding portions fused to them (similar to natural antibodies, except that the two arms bind to different antigenic targets or epitopes). The antigen-binding portions can be single-chain antibodies (scFv) or Fab fragments. When targeting two non-overlapping epitopes of the same antigen, the two different binding portions of the bispecific antibody each bind to the N-terminus of an Fc fragment. The antigen-binding portion configuration of the two arms can have four combinations: scFv + Fab fragment, Fab fragment + scFv, scFv + scFv, and Fab fragment + Fab fragment. The Fc fragment can contain mutations that ensure heavy chain heteropolymerization; KIH (knob-in-hole) technology is one strategy to address heavy chain heteropolymerization. Typically, KIH technology refers to modifying the amino acid sequence of the CH3 region to create a structure that facilitates the pairing of heterologous half-antibodies, thus forming a bispecific antibody while preserving as much of the normal antibody structure as possible. For guidance on KIH technology, see, for example, "An efficient route to human bispecific IgG," A. Margaret Merchant et al., Nature Biotechnology, Volume 16, 1998, which is incorporated herein by reference in its entirety. Furthermore, the structure of a bispecific antibody can be such that the antibody (e.g., in the form of a natural antibody) that binds to the first epitope of an antigen extends (through a flexible linker) from the C-terminus of the CH3 region to form an antigen-binding region that binds to the second epitope of the antigen. Bispecific antibodies can also be dual-variable-domain immunoglobulin (DVD-Ig) type bispecific antibodies, where the first antibody (e.g., in the form of a natural antibody) that binds to the first antigen can extend (through a flexible linker) from the N-terminus of its heavy chain to form a variable region of the heavy chain of the second antibody that binds to the second antigen, and the first antibody can extend (through a flexible linker) from the N-terminus of its light chain to form a variable region of the light chain of the second antibody. For information on DVD-Ig bispecific antibodies, please refer to the literature (Wu C, Ying H, Grinnell C, et al. Simultaneous targeting of multiple disease mediators by a dual-variable-domain immunoglobulin. Nat Biotechnol. 2007 Nov).

[0014] The full text of the reference is incorporated into this paper by way of citation.

[0100] As used herein, the term "therapeutic effective dose" or "effective dose" refers to a dose that has a therapeutic effect on a subject, such as: in subjects who have been given the dose, the symptoms or state of the disease are alleviated, reduced, or eliminated, or the development of the symptoms or state of the disease is delayed or suppressed compared to subjects who have not been given the dose.

[0101] In one aspect, this application provides an antibody against human parainfluenza virus type 3 (HPIV3), comprising a heavy chain variable region containing HCDR1, HCDR2, and HCDR3 and a light chain variable region containing LCDR1, LCDR2, and LCDR3, wherein...

[0102] The amino acid sequences of HCDR1 are shown in SEQ ID NO:1, HCDR2 are shown in SEQ ID NO:2, HCDR3 are shown in SEQ ID NO:3, LCDR1 is shown in SEQ ID NO:4, LCDR2 is shown in SEQ ID NO:5, and LCDR3 is shown in SEQ ID NO:6.

[0103] The amino acid sequences of HCDR and LCDR are defined according to Kabat.

[0104] In some embodiments of the first aspect, the amino acid sequence of the heavy chain variable region of the antibody is shown in SEQ ID NO:7.

[0105] In some embodiments of the first aspect, the amino acid sequence of the light chain variable region of the antibody is shown in SEQ ID NO:8.

[0106] In some embodiments of the first aspect, the amino acid sequence of the antibody heavy chain variable region is shown in SEQ ID NO:7, and the amino acid sequence of the antibody light chain variable region is shown in SEQ ID NO:8.

[0107] In some embodiments of the first aspect, the amino acid sequence of the heavy chain variable region of the antibody has at least 90% identity with SEQ ID NO:7, and the amino acid sequence of the light chain variable region of the antibody has at least 90% identity with SEQ ID NO:8.

[0108] In some embodiments of the first aspect, the amino acid sequence of the heavy chain variable region of the antibody has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher identity with SEQ ID NO:7.

[0109] In some embodiments of the first aspect, the amino acid sequence of the variable region of the light chain of the antibody has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher identity with SEQ ID NO:8.

[0110] In some embodiments of the first aspect, the amino acid sequence of the heavy chain variable region of the antibody differs from the amino acid sequence shown in SEQ ID NO:7 by substitution, deletion, and / or addition of approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids.

[0111] In some embodiments of the first aspect, the amino acid sequence of the variable region of the light chain of the antibody differs from the amino acid sequence shown in SEQ ID NO:8 by substitution, deletion, and / or addition of approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids.

[0112] In some embodiments of the first aspect, the C-terminal or N-terminal region of the amino acid sequence shown in SEQ ID NO:7 may also be truncated by about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids while still retaining the function of a similar heavy chain variable region of the antibody.

[0113] In some embodiments of the first aspect, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids may be added to the C-terminal or N-terminal region of the amino acid sequence shown in SEQ ID NO:7, and the resulting amino acid sequence still retains the function of the heavy chain variable region similar to that of the antibody.

[0114] In some embodiments of the first aspect, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids may be added or deleted in regions other than the C-terminus or N-terminus of the amino acid sequence shown in SEQ ID NO:7, as long as the altered amino acid sequence substantially maintains the function of the heavy chain variable region of the antibody.

[0115] In some embodiments of the first aspect, the C-terminal or N-terminal region of the amino acid sequence shown in SEQ ID NO:8 may also be truncated by about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids while still retaining the function of a similar light chain variable region of the antibody.

[0116] In some embodiments of the first aspect, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids may be added to the C-terminal or N-terminal region of the amino acid sequence shown in SEQ ID NO:8, and the resulting amino acid sequence still retains the function of the light chain variable region similar to that of the antibody.

[0117] In some embodiments of the first aspect, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids may be added or deleted in regions other than the C-terminus or N-terminus of the amino acid sequence shown in SEQ ID NO:8, as long as the altered amino acid sequence substantially maintains the function of the light chain variable region of the antibody.

[0118] In some embodiments of the first aspect, the antibody is a neutralizing antibody.

[0119] In some embodiments of the first aspect, the antibody is capable of binding to the F protein of HPIV3.

[0120] In some embodiments of the first aspect, the antibody is capable of binding to recombinant human HPIV3 F protein, such as the recombinant human HPIV3 F protein shown in SEQ ID NO:9.

[0121] In some embodiments of the first aspect, the antibody is a Fab fragment, a whole antibody, an F(ab')2 fragment, or a single-chain Fv fragment (scFv).

[0122] In some embodiments of the first aspect, the antibody is a Fab fragment.

[0123] In some embodiments of the first aspect, the antibody is a monoclonal antibody.

[0124] In some embodiments of the first aspect, the antibody further comprises a heavy chain constant region selected from IgG1, IgG2 or IgG4 subtypes.

[0125] In some embodiments of the first aspect, the heavy chain constant region is the IgG1 subtype.

[0126] In some embodiments of the first aspect, the heavy chain constant region comprises the Fc segment sequence of the IgG1 subtype heavy chain constant region and the amino acid sequences at positions 252, 254, and 256 of the Fc segment sequence are Y, T, and E, respectively, wherein the amino acid sequence of the antibody constant region is determined according to EU numbering.

[0127] In some embodiments of the first aspect, the antibody further comprises a light chain constant region selected from the κ or λ subtype.

[0128] In some embodiments of the first aspect, the light chain constant region is the κ subtype.

[0129] Secondly, this application provides a bispecific antibody against human parainfluenza virus type 3 (HPIV3) and respiratory syncytial virus (RSV), the bispecific antibody comprising a first antigen-binding region for HPIV3 and a second antigen-binding region for RSV, wherein the first antigen-binding region comprises a heavy chain variable region containing HCDR1 as shown in SEQ ID NO:1, HCDR2 as shown in SEQ ID NO:2, and HCDR3 as shown in SEQ ID NO:3, and a light chain variable region containing LCDR1 as shown in SEQ ID NO:4, LCDR2 as shown in SEQ ID NO:5, and LCDR3 as shown in SEQ ID NO:6;

[0130] The amino acid sequences of HCDR and LCDR are defined according to Kabat.

[0131] In some embodiments of the second aspect, the amino acid sequence of the heavy chain variable region of the first antigen-binding region has at least 90% identity with SEQ ID NO:7.

[0132] In some embodiments of the second aspect, the amino acid sequence of the light chain variable region of the first antigen-binding region has at least 90% identity with SEQ ID NO:8.

[0133] In some embodiments of the second aspect, the amino acid sequence of the heavy chain variable region of the first antigen-binding region has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher identity with SEQ ID NO:7.

[0134] In some embodiments of the second aspect, the amino acid sequence of the light chain variable region of the first antigen-binding region has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher identity with SEQ ID NO:8.

[0135] In some embodiments of the second aspect, the amino acid sequence of the heavy chain variable region of the first antigen-binding region differs from the amino acid sequence shown in SEQ ID NO:7 by approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid substitutions, deletions, and / or additions.

[0136] In some embodiments of the second aspect, the amino acid sequence of the light chain variable region of the first antigen-binding region differs from the amino acid sequence shown in SEQ ID NO:8 by substitution, deletion, and / or addition of approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids.

[0137] In some embodiments of the second aspect, the C-terminal or N-terminal region of the amino acid sequence shown in SEQ ID NO:7 may be truncated by about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids while still retaining the function of the heavy chain variable region similar to the first antigen-binding region.

[0138] In some embodiments of the second aspect, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids may be added to the C-terminal or N-terminal region of the amino acid sequence shown in SEQ ID NO:7, and the resulting amino acid sequence still retains the function of the heavy chain variable region similar to the first antigen-binding region.

[0139] In some embodiments of the second aspect, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids may be added or deleted in regions other than the C-terminus or N-terminus of the amino acid sequence shown in SEQ ID NO:7, as long as the altered amino acid sequence substantially maintains the function of the heavy chain variable region of the first antigen-binding region.

[0140] In some embodiments of the second aspect, the C-terminal or N-terminal region of the amino acid sequence shown in SEQ ID NO:8 may be truncated by about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids, while still retaining the function of the light chain variable region of the first antigen-binding region.

[0141] In some embodiments of the second aspect, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids may be added to the C-terminal or N-terminal region of the amino acid sequence shown in SEQ ID NO:8, and the resulting amino acid sequence still retains the function of the light chain variable region similar to the first antigen-binding region.

[0142] In some embodiments of the second aspect, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids may be added or deleted in regions other than the C-terminus or N-terminus of the amino acid sequence shown in SEQ ID NO:8, as long as the altered amino acid sequence substantially maintains the function of the light chain variable region of the first antigen-binding region.

[0143] In some embodiments of the second aspect, the second antigen-binding region comprises a heavy chain variable region containing HCDR1 as shown in SEQ ID NO:34, HCDR2 as shown in SEQ ID NO:35, and HCDR3 as shown in SEQ ID NO:36, and a light chain variable region containing LCDR1 as shown in SEQ ID NO:37, LCDR2 as shown in SEQ ID NO:38, and LCDR3 as shown in SEQ ID NO:39;

[0144] The amino acid sequences of HCDR and LCDR are defined according to Kabat.

[0145] In some embodiments of the second aspect, the amino acid sequence of the heavy chain variable region of the second antigen-binding region has at least 90% identity with SEQ ID NO:41.

[0146] In some embodiments of the second aspect, the amino acid sequence of the light chain variable region of the second antigen-binding region has at least 90% identity with SEQ ID NO:42.

[0147] In some embodiments of the second aspect, the amino acid sequence of the heavy chain variable region of the second antigen-binding region has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher identity with SEQ ID NO:41.

[0148] In some embodiments of the second aspect, the amino acid sequence of the light chain variable region of the second antigen-binding region has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher identity with SEQ ID NO:42.

[0149] In some embodiments of the second aspect, the amino acid sequence of the heavy chain variable region of the second antigen-binding region differs from the amino acid sequence shown in SEQ ID NO:41 by substitution, deletion, and / or addition of approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids.

[0150] In some embodiments of the second aspect, the amino acid sequence of the light chain variable region of the second antigen-binding region differs from the amino acid sequence shown in SEQ ID NO:42 by substitution, deletion, and / or addition of approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids.

[0151] In some embodiments of the second aspect, the C-terminal or N-terminal region of the amino acid sequence shown in SEQ ID NO:41 may be truncated by about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids, while still retaining the function of the heavy chain variable region of the second antigen-binding region.

[0152] In some embodiments of the second aspect, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids may be added to the C-terminal or N-terminal region of the amino acid sequence shown in SEQ ID NO:41, and the resulting amino acid sequence still retains the function of the heavy chain variable region of the second antigen-binding region.

[0153] In some embodiments of the second aspect, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids may be added or deleted in regions other than the C-terminus or N-terminus of the amino acid sequence shown in SEQ ID NO:41, as long as the altered amino acid sequence substantially maintains the function of the heavy chain variable region of the second antigen-binding region.

[0154] In some embodiments of the second aspect, the C-terminal or N-terminal region of the amino acid sequence shown in SEQ ID NO:42 may be truncated by about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids while still retaining the function of the light chain variable region of the second antigen-binding region.

[0155] In some embodiments of the second aspect, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids may be added to the C-terminal or N-terminal region of the amino acid sequence shown in SEQ ID NO:42, and the resulting amino acid sequence still retains the function of the light chain variable region similar to the second antigen-binding region.

[0156] In some embodiments of the second aspect, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids may be added or deleted in regions other than the C-terminus or N-terminus of the amino acid sequence shown in SEQ ID NO:42, as long as the altered amino acid sequence substantially maintains the function of the light chain variable region of the second antigen-binding region.

[0157] In some embodiments of the second aspect, the bispecific antibody is capable of binding to the HPIV3 F protein, such as the recombinant human HPIV3 F protein shown in SEQ ID NO:9.

[0158] In some embodiments of the second aspect, the bispecific antibody is capable of binding to the F protein of RSV, for example, the recombinant RSV F protein as shown in SEQ ID NO:40.

[0159] In some embodiments of the second aspect, the bispecific antibody is capable of simultaneously binding to the F protein of HPIV3 (e.g., recombinant human HPIV3 F protein as shown in SEQ ID NO:9) and the F protein of RSV (e.g., recombinant RSV F protein as shown in SEQ ID NO:40).

[0160] Thirdly, this application provides a nucleic acid molecule that encodes the antibody described in the first aspect and / or the bispecific antibody described in the second aspect.

[0161] In some embodiments of the third aspect, the nucleic acid molecule is operatively linked to a regulatory sequence that can be recognized by a host cell transformed with the vector. The host cell is, for example, a mammalian cell.

[0162] Fourthly, this application provides a pharmaceutical composition comprising the antibody described in the first aspect and / or the bispecific antibody described in the second aspect, as well as a pharmaceutically acceptable excipient, diluent, or carrier.

[0163] In some embodiments of the fourth aspect, the pharmaceutical composition comprises the antibody described in the first aspect, as well as a pharmaceutically acceptable excipient, diluent, or carrier.

[0164] In some embodiments of the fourth aspect, the pharmaceutical composition comprises the bispecific antibody described in the second aspect, as well as a pharmaceutically acceptable excipient, diluent, or carrier.

[0165] In some embodiments of the fourth aspect, the pharmaceutical composition comprises the antibody described in the first aspect, the bispecific antibody described in the second aspect, and a pharmaceutically acceptable excipient, diluent, or carrier.

[0166] In some embodiments of the fourth aspect, the pharmaceutical composition comprises the antibody described in the first aspect and / or the bispecific antibody described in the second aspect, as well as a pharmaceutically acceptable excipient, diluent, or carrier, for the prevention or treatment of HPIV3 infection and related diseases.

[0167] In some embodiments of the fourth aspect, the pharmaceutical composition comprises the bispecific antibody described in the second aspect, as well as a pharmaceutically acceptable excipient, diluent, or carrier, for the prevention or treatment of RSV infection and related diseases.

[0168] In some embodiments of the fourth aspect, the HPIV3 infection-related disease is a respiratory infection caused by HPIV3 infection, such as bronchitis, bronchiolitis, or pneumonia.

[0169] In some embodiments of the fourth aspect, the RSV infection-related disease is a respiratory infection caused by RSV infection, such as bronchiolitis or pneumonia.

[0170] In some embodiments of the fourth aspect, the pharmaceutical composition may further comprise one or more of the following: lubricants, such as talc, magnesium stearate, and mineral oil; wetting agents; emulsifiers; suspending agents; preservatives, such as benzoic acid, sorbic acid, and calcium propionate; sweeteners and / or flavoring agents, etc.

[0171] In some embodiments of the fourth aspect, the pharmaceutical composition of this application may be formulated as tablets, pills, powders, lozenges, elixirs, suspensions, emulsions, solutions, syrups, suppositories, or capsules.

[0172] In some embodiments of the fourth aspect, the pharmaceutical composition of this application may be delivered using any physiologically acceptable method of administration, including but not limited to: oral administration, parenteral administration, nasal administration, rectal administration, intraperitoneal administration, intravascular injection, subcutaneous administration, transdermal administration, inhalation administration, etc.

[0173] In some embodiments of the fourth aspect, a pharmaceutical composition for therapeutic use can be formulated for storage by mixing a reagent of the desired purity with, as appropriate, a pharmaceutically acceptable carrier, excipient, etc., in the form of a lyophilized formulation or an aqueous solution.

[0174] Fifthly, this application provides the use of the antibody described in the first aspect, the bispecific antibody described in the second aspect, the nucleic acid molecule described in the third aspect, or the pharmaceutical composition described in the fourth aspect in the preparation of a medicament for the prevention or treatment of HPIV3 infection and related diseases.

[0175] In some embodiments of the fifth aspect, the HPIV3 infection-related disease is a respiratory infection caused by HPIV3 infection, such as bronchitis, bronchiolitis, or pneumonia.

[0176] In a sixth aspect, this application provides the use of the bispecific antibody described in the second aspect, the nucleic acid molecule encoding the bispecific antibody described in the third aspect, or the pharmaceutical composition comprising the bispecific antibody described in the fourth aspect in the preparation of a medicament for the prevention or treatment of RSV infection and related diseases.

[0177] In some embodiments of the sixth aspect, the RSV infection-related disease is a respiratory infection caused by RSV infection, such as bronchiolitis or pneumonia.

[0178] In a seventh aspect, this application provides methods for preventing or treating HPIV3 infection and related diseases, comprising administering to an individual in need the antibody described in the first aspect, the bispecific antibody described in the second aspect, the nucleic acid molecule described in the third aspect, or the pharmaceutical composition described in the fourth aspect.

[0179] In some embodiments of the seventh aspect, the method includes administering to an individual in need an effective amount of the antibody described in the first aspect, the bispecific antibody described in the second aspect, the nucleic acid molecule described in the third aspect, or the pharmaceutical composition described in the fourth aspect.

[0180] In some embodiments of the seventh aspect, the HPIV3 infection-related disease is a respiratory infection caused by HPIV3 infection, such as bronchitis, bronchiolitis, or pneumonia.

[0181] Eighthly, this application provides a method for preventing or treating RSV infection and related diseases, comprising administering to an individual in need the antibody described in the second aspect, a nucleic acid molecule encoding the bispecific antibody described in the third aspect, or a pharmaceutical composition comprising the bispecific antibody described in the fourth aspect.

[0182] In some embodiments of the eighth aspect, the method includes administering to an individual in need an effective amount of the antibody described in the second aspect, a nucleic acid molecule described in the third aspect encoding the bispecific antibody, or a pharmaceutical composition described in the fourth aspect containing the bispecific antibody.

[0183] In some embodiments of the eighth aspect, the RSV infection-related disease is a respiratory infection caused by RSV infection, such as bronchiolitis or pneumonia.

[0184] In other aspects, this application also provides nucleic acid molecules encoding the antibodies and / or bispecific antibodies of the present invention, or their light or heavy chains, vectors comprising said nucleic acid molecules, host cells comprising said nucleic acid molecules or said vectors, and methods for producing said antibodies and / or bispecific antibodies. In some embodiments, the nucleic acid molecule is operatively linked to a regulatory nucleotide sequence that can be recognized by host cells transformed with said vector. In some embodiments, the method of producing antibodies includes culturing host cells to express nucleic acids. In some embodiments, the method of producing antibodies further includes recovering antibodies from a host cell culture medium.

[0185] It should be understood that the above detailed description is only intended to provide a clearer understanding of the contents of this application to those skilled in the art, and is not intended to limit in any way. Those skilled in the art can make various modifications and variations to the described embodiments. Example

[0186] The following examples are for illustrative purposes only and are not intended to limit the scope of this application.

[0187] Example 1: Preparation of HPIV3 F protein and recombinant antibody

[0188] 1.1 Preparation of recombinant HPIV3 F protein

[0189] The HPIV3 F protein is required in the preparation of monoclonal antibodies against HPIV3 F protein. Refer to document WO 2022 / 207839 A2. [9] Application No. [Number] constructed a stable pre-fusion HPIV3F protein mutant, named HPIV3 PreF2 (its amino acid sequence is shown in SEQ ID NO: 9). Since the F protein undergoes post-translational modifications (such as glycosylation and disulfide bonds), using a mammalian cell expression system will be more conducive to maintaining the structure and function of the recombinant protein. Furthermore, a His tag (His, its amino acid sequence is shown in SEQ ID NO: 10) was added to the C-terminus of this recombinant protein, which will further facilitate the purification of the recombinant protein and the identification of monoclonal antibody functions.

[0190] The HPIV3 PreF2 gene was synthesized, and the synthesized gene was cloned into a suitable eukaryotic expression vector (such as pcDNA3.1 from Invitrogen) using conventional molecular biology techniques. Then, the prepared recombinant protein expression plasmid was transfected into HEK293 cells (such as HEK293F from Invitrogen) using liposomes (such as 293fectin from Invitrogen) or other cationic transfection reagents (such as PEI). The cells were cultured in serum-free suspension for 3-4 days. The culture supernatant was then harvested by centrifugation or other methods.

[0191] The recombinant protein in the supernatant was purified in one step using a metal chelate affinity chromatography column (such as GE's HisTrap FF). Then, the recombinant protein preservation buffer was replaced with PBS (pH 7.0) or other suitable buffer using a desalting column (such as GE's Hitrap desaulting). If necessary, the sample could be filtered for sterilization and then aliquoted and stored at -20°C.

[0192] 1.2 Preparation of recombinant antibodies

[0193] Using conventional molecular biology techniques, the nucleotide sequences encoding the variable regions of the antibody heavy chain and light chain were cloned into eukaryotic expression vectors (such as Invitrogen's pcDNA3.1) fused with nucleotide sequences encoding the constant regions of the heavy chain and light chain, respectively, to express the whole antibody. The constant region of the antibody heavy chain can be human IgG1 subtype (amino acid sequence shown in SEQ ID NO: 11), human IgG1 subtype mutant IgG1-YTE (amino acid sequence shown in SEQ ID NO: 12), or mouse IgG2a subtype (amino acid sequence shown in SEQ ID NO: 13); the constant region of the antibody light chain can be human κ subtype (amino acid sequence shown in SEQ ID NO: 14), human λ subtype (amino acid sequence shown in SEQ ID NO: 15), mouse κ subtype (amino acid sequence shown in SEQ ID NO: 16), or mouse λ subtype (amino acid sequence shown in SEQ ID NO: 17).

[0194] The prepared recombinant antibody expression plasmid was transfected into HEK293 cells (e.g., HEK293F from Invitrogen) using liposomes (e.g., Invitrogen's 293fectin) or other transfection reagents (e.g., PEI), and cultured in serum-free suspension for 3-5 days. The culture supernatant was then harvested by centrifugation and purified in one step using a Protein A / G affinity chromatography column (e.g., GE's Mabselect SURE). The recombinant protein preservation buffer was then replaced with PBS (pH 7.0) or other suitable buffer using a desalting column (e.g., GE's Hitrap desaulting). If necessary, the antibody sample could be filtered for sterilization and then aliquoted and stored at -20°C.

[0195] Example 2: Screening of human Fab libraries using HPIV3 F protein

[0196] Using HPIV3-PreF2-His prepared in Example 1 as the antigen, a solid-phase screening strategy was employed (experimental protocol referenced from Phage Display: A Universal Laboratory Guide / edited by Clackson, T., and Lowman, HB; translated by Ma Lan et al.).

[0010] (Chemical Industry Press, 2008.5) The human Fab phage library prepared by screening was subjected to five rounds of screening through binding, elution, neutralization, infection and amplification, and finally a human antibody H1C5VH+R28H11VK that specifically binds to HPIV3 F protein was obtained (its heavy chain variable region amino acid sequence is shown in SEQ ID NO:7; the light chain variable region amino acid sequence is shown in SEQ ID NO:8).

[0197] Example 3: Functional identification of recombinant anti-HPIV3 F protein monoclonal antibody

[0198] Using conventional molecular biology methods, nucleic acid molecules encoding the light and heavy chains of H1C5VH+R28H11VK were cloned into eukaryotic expression vectors to prepare recombinant human IgG1-κ monoclonal antibodies. Simultaneously, referring to WO 2022 / 183018A1...

[0011] Application No. [Number] prepared human anti-HPIV3 monoclonal antibody PI3-E12 (the amino acid sequence of its heavy chain variable region is shown in SEQ ID NO: 18; the amino acid sequence of its light chain variable region is shown in SEQ ID NO: 19) and human anti-HPIV3 monoclonal antibody 3X1 (the amino acid sequence of its heavy chain variable region is shown in SEQ ID NO: 20; the amino acid sequence of its light chain variable region is shown in SEQ ID NO: 21), referring to the literature Proc Natl Acad Sci US A. 2018 Nov 27; 115(48):12265-12270

[0012] Human anti-HPIV3 monoclonal antibody PIA174 (its heavy chain variable region amino acid sequence is shown in SEQ ID NO: 22; light chain variable region amino acid sequence is shown in SEQ ID NO: 23) was prepared as a positive control antibody.

[0199] 3.1 Affinity analysis of recombinant anti-HPIV3 F protein monoclonal antibody

[0200] Affinity for anti-HPIV3 F monoclonal antibodies was determined using surface plasmon resonance (SPR) technology with a Biacore T200. All reagents and consumables, including the amino-coupled antibody kit (BR100050), human antibody capture kit (BR-1008-39), S-series CM5 chip (14100530), and 10×HBS-EP (BR100669) at pH 7.4, were purchased from Cytiva. Following the kit instructions, the carboxylated CM5 chip surface was activated with 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) and N-hydroxysuccinimide (NHS). The anti-human IgG (Fc) antibody (capture antibody) was diluted to 25 μg / mL with 10 mM pH 5.0 sodium acetate and injected at a flow rate of 10 μL / min to achieve a conjugation volume of approximately 10,000 response units (RU). After injection of the capture antibody, 1M ethanolamine was injected to block unreacted groups. For kinetic measurements, the anti-HPIV3 F protein monoclonal antibody was diluted to 1 μg / mL and injected at a flow rate of 10 μL / min to ensure that approximately 100 RU of antibody was captured by the anti-human Fc antibody. Then, a series of concentration gradients of HPIV3-PreF2-His protein (e.g., 1.23 nM, 3.7 nM, 11.1 nM, 33.3 nM, and 100 nM) were set, and the protein was injected at 25 °C at a rate of 30 μL / min from low to high concentrations. The binding time was 120 s, and the dissociation time was 600 s–1200 s. The chip surface was then regenerated by injecting 3 M MgCl2 solution at a flow rate of 10 μL / min for 30 s. The binding rate (KB) was calculated using Biacore T200 evaluation software version 3.2.1 by fitting binding and dissociation sensor maps using a 1:1 binding model. a ) and dissociation rate (K d ). Using ratio K d / K a Calculate the dissociation equilibrium constant (K) D The fitting results are shown in Table 1.

[0201] Table 1. Affinity of anti-HPIV3 F protein monoclonal antibodies to recombinant HPIV3-PreF protein

[0202] 3.2 Binding epitope analysis of recombinant anti-HPIV3 F protein monoclonal antibody

[0203] The binding epitopes of anti-HPIV3 F antibody were analyzed using surface plasmon resonance technology with Biacore T200.

[0204] Reagents and consumables: The amino coupling reagent kit (BR-1000-50), His reagent kit (28995056), S series CM5 chip (BR100530) and pH 7.4 10×HBS-EP (BR100669) and other related reagents and consumables were all purchased from Cytiva.

[0205] Chip conjugation: Following the instructions in the amino-conjugation kit, the carboxylated CM5 chip surface was activated with 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) and N-hydroxysuccinimide (NHS). The anti-His antibody (capture antibody) was diluted to 25 μg / mL with 10 mM pH 5.0 sodium acetate and then injected at a flow rate of 10 μL / min to achieve a conjugation volume of approximately 12,000 response units (RU). After injection of the capture antibody, 1M ethanolamine was injected to block unreacted groups.

[0206] Epitope analysis: HPIV3-PreF2-His was diluted to 5 μg / mL with 1×HBS-EP and injected at 10 μL / min for 12 seconds to ensure that approximately 100 RU of HPIV3-PreF2-His was captured by the anti-His antibody. Anti-HPIV3 F protein monoclonal antibodies H1C5VH+R28H11VK, PI3-E12, 3X1, and PIA174 were diluted to 50 μg / ml with 1×HBS-EP, respectively. Using the dual-injection mode of the Biacore T200, different antibodies were sequentially injected: the first antibody was flown over the chip surface containing the captured HPIV3-PreF2-His antigen at a flow rate of 30 μL / min, followed immediately by the second antibody, with each antibody injected for 60 seconds. After injection, the chip surface was regenerated by injecting 1.7 mM glycine-HCl at 10 μL / min for 30 seconds. Using Biacore T200 evaluation software version 3.0, the capture level report point of HPIV3-PreF2-His was zeroed, and then the RU value was plotted against time (s) using GraphPad software (connecting line).

[0207] Epitope analysis results showed that: 1) When the first sample PI3-E12 was re-injected with H1C5VH+R28H11VK, no binding signal of H1C5VH+R28H11VK was detected (A in Figure 1, Table 2); similarly, when the first sample H1C5VH+R28H11VK was re-injected with PI3-E12, almost no binding signal of PI3-E12 was detected (D in Figure 1, Table 2), indicating that the HPIV3 F protein epitope bound by PI3-E12 and the HPIV3 F protein epitope bound by H1C5VH+R28H11VK overlapped. 2) When the first sample 3X1 was injected and then H1C5VH+R28H11VK was injected, the binding signals showed obvious superposition (B in Figure 1, Table 2). When the first sample H1C5VH+R28H11VK was injected and then 3X1 was injected, the binding signals showed obvious superposition (D in Figure 1, Table 2). This indicates that H1C5VH+R28H11VK and 3X1 recognize different epitopes of HPIV3 F protein. 3) When the first sample PIA174 was injected with H1C5VH+R28H11VK, no binding signal of H1C5VH+R28H11VK was detected (C in Figure 1, Table 2); similarly, when the first sample H1C5VH+R28H11VK was injected with PIA174, almost no binding signal of PIA174 was detected (D in Figure 1, Table 2), indicating that the binding epitope of HPIV3 F protein by PIA174 and the binding epitope of HPIV3 F protein by H1C5VH+R28H11VK overlapped.

[0208] Table 2. Binding amount of the second antibody after the first antibody is injected (RU)

[0209] 3.3 Recombinant anti-HPIV3 F protein monoclonal antibody inhibits HPIV3 infection of LLC-MK2 cells

[0210] 3.3.1 Recombinant anti-HPIV3 F protein monoclonal antibody inhibits C243 virus infection of LLC-MK2 cells

[0211] LLC-MK2 cells (rhesus monkey kidney cells, purchased from Nanjing Kebai Biotechnology Co., Ltd., catalog number CBP60594) in the logarithmic growth phase were digested and centrifuged. After counting, the cell suspension was diluted to 2×10⁻⁶ cells / cells in complete LLC-MK2 cell culture medium (DMEM + 10% FBS + 1% penicillin / streptomycin). 5 Single-cell suspensions of 100 μL / well were seeded into 96-well sterile permeable cell culture plates and incubated overnight in a cell culture incubator (37±1℃, 5±1% CO2).

[0212] On the second day, anti-HPIV3 F protein monoclonal antibodies (H1C5VH+R28H11VK, PI3-E12, 3X1, and PIA174) and negative isotype control antibodies were diluted in LLC-MK2 cell maintenance medium (DMEM + 2% FBS + 1% P / S) at an initial concentration of 40 nM. A total of 10 four-fold serial dilutions were performed, with 70 μL / well added to each well in a new 96-well sterile permeable cell culture plate. One vial of frozen virus solution C243 (human parainfluenza virus type 3, purchased from ATCC, catalog number VR-93) was slowly thawed in a P2 biosafety cabinet and diluted to 8.6 × 10⁻⁶ with LLC-MK2 cell maintenance medium. 2 PFU / mL, add 70 μL / well of the diluted virus solution to the diluted antibody and mix thoroughly. Separate cell control wells (140 μL / well of LLC-MK2 cell maintenance medium) and cell + virus solution wells (70 μL / well of LLC-MK2 cell maintenance medium + 70 μL / well of C243 dilution buffer) are also prepared. After all samples are added, cover the culture plate and place it in a cell culture incubator (37±1℃, 5±1% CO2) for 1 hour to neutralize. Remove the overnight 96-well sterile permeable cell culture plate, discard the LLC-MK2 cell complete medium, add the antibody-virus mixture that has been neutralized for 1 hour, and incubate in a cell culture incubator (37±1℃, 5±1% CO2) for 1 hour. After infection, remove the 96-well sterile permeable cell culture plate, discard the antibody-virus mixture, add 200 μL of 1% methylcellulose solution (methylcellulose, purchased from SIGMA, catalog number MO512-100G, prepared with LLC-MK2 cell maintenance medium), and incubate in a cell culture incubator (37±1℃, 5±1% CO2) for 96 h.

[0213] After incubation, wash twice with PBS, add 80% acetone, and fix at 2–8°C for 30 min. Discard the 80% acetone, wash twice with PBS, add 100 μL / well of the detection antibody S2E1 (prepared by our company) diluted to 10 μg / mL with PBS, and incubate at 37°C in the dark for 60 min. Discard the primary antibody, wash twice with PBS, add 100 μL / well of FITC-labeled goat anti-human IgG (Beijing Zhongshan Jinqiao Biotechnology Co., Ltd., ZF-0308) diluted 1:400 with PBS, and incubate at 37°C in the dark for 40 min. Discard the secondary antibody, wash twice with PBS, and detect the chemiluminescence value using a multi-functional microplate reader (SpectraMax I3). The results showed (Figure 2) that H1C5VH+R28H11VK had the best activity, according to IC50. 50 The values ​​were compared (Table 3). The activity of H1C5VH+R28H11VK was about 4 times higher than that of PI3-E12, about 11 times higher than that of 3X1, and about 3 times higher than that of PIA174.

[0214] Table 3. Half-inhibitory concentration of anti-HPIV3 F protein monoclonal antibody against VR-93-infected LLC-MK2 cells

[0215] 3.3.2 Recombinant anti-HPIV3 F protein monoclonal antibody inhibits HPIV3 infection of clinically isolated LLC-MK2 cells.

[0216] The neutralizing activity of anti-HPIV3 F protein monoclonal antibodies (H1C5VH+R28H11VK and PI3-E12) against clinically isolated HPIV3 was detected according to the protocol in 3.3.1.

[0217] Ten viral strains isolated from clinical samples during the 2023-2024 HPIV3 epidemic season were obtained from the Women and Children's Medical Center Affiliated to Guangzhou Medical University (numbered 0113-2473, 0217-2451, 0130-2433, 0129-2434, 0216-2416, 0129-2452, 0202-2440, 0201-2459, 0119-2441, and 0815-2494, respectively). The results showed (Figure 3) that both H1C5VH+R28H11VK and PI3-E12 could effectively neutralize HPIV3 clinically isolated samples, and the neutralizing activity of H1C5VH+R28H11VK was significantly better than that of PI3-E12.

[0218] Example 4: Evaluation of the in vivo protective effect of recombinant anti-HPIV3 F protein monoclonal antibody using a golden hamster model infected with human parainfluenza virus type 3 (C243).

[0219] Fifteen four-week-old male golden hamsters (Beijing Vital River Laboratory Animal Technology Co., Ltd.) were selected. The day of HPIV3 inoculation was defined as day 0 of the experiment, the day before HPIV3 inoculation as day -1, the day after HPIV3 inoculation as day 1, and so on. On day -1, the golden hamsters were treated with either the solvent or the test substance. The experiment was divided into four groups: monoclonal antibody H1C5VH+R28H11VK 5 mg / kg group (group 2, G2), monoclonal antibody H1C5VH+R28H11VK 1 mg / kg group (group 3, G3), monoclonal antibody H1C5VH+R28H11VK 0.2 mg / kg group (group 4, G4), monoclonal antibody PI3-E12 5 mg / kg group (group 5, G5), and the solvent PBS group (group 1, G1). Administration was by intramuscular injection at a volume of 0.5 mL / kg, administered only once. On day 0, golden hamsters were anesthetized with isoflurane and inoculated with the virus via nasal drops at a dose of 8.6 × 10⁶ per animal. 6PFU was inoculated at a volume of 100 μL. On day 3 of the experiment, all golden hamsters were euthanized by overdose anesthesia. Lung tissue was collected, weighed, and cryopreserved in 1 mL of PBS + 1% BSA cryopreservation solution.

[0220] Detection of HPIV3 titer in lung tissue by real-time PCR: (1) Sample preparation: The collected lung tissue samples were homogenized using a tissue homogenizer and the supernatant was collected by centrifugation; (2) Total RNA extraction: 140 μL of the supernatant from each lung tissue sample was taken and total RNA was extracted using a viral RNA extraction kit (TIANGEN, DP315-R); (3) Synthesis of first strand cDNA: 11 μL of RNA solution was taken as a template and reverse transcription was performed using a RevertAid first strand cDNA synthesis kit (Thermofisher, catalog number: K1621). The reverse transcription primers were CTAGAAGGTCAAGAAAAGGGAACTC (SEQ ID NO:24).

[0013] (4) Construction of standard quality plasmids: The synthesized gene CGGTGACACAGTGGATCAGATTGGGTCAATCATGCGGTCTCAACAGAGCTTGGTAACTCTTATGGTTGAGACA (SEQ ID NO:25) was cloned into a suitable eukaryotic expression vector (such as Invitrogen's pcDNA3.1) using conventional molecular biology techniques; (5) Preparation of the real-time PCR system: The solution of the first strand of cDNA synthesis was diluted 10-fold, and 5 μL of each solution was added to the PCR tube as template. The upstream primer was CGGTGACACAGTGGATCAGATT (SEQ ID NO:26), and the downstream primer was TGTCTCAACCATAAGAGTTACCAAGCT (SEQ ID NO:27).

[0013] Dilute each sample to 10 μM, and add 0.5 μL of each to a PCR tube, along with 12.5 μL of [unspecified ingredient]. Green qPCR SuperMix (Beijing TransGen Biotech Co., Ltd., AQ601-02) and 6.5 μL ddH2O; and (6) detection: detection was performed using a 4-channel quantitative PCR instrument (Hangzhou Bori Technology Co., Ltd., FQD-96A).

[0221] The results (Figure 4) showed that, compared with the PBS group, the anti-HPIV3 F protein monoclonal antibody H1C5VH+R28H11VK, administered 24 hours before infection at doses of 5 mg / kg, 1 mg / kg, and 0.2 mg / kg, significantly reduced the HPIV3 virus titer in the lung tissue of infected animals in a dose-dependent manner. At the same dose, H1C5VH+R28H11VK showed better activity than PI3-E12.

[0222] Example 5: Bispecific antibody against RSV and HPIV3

[0223] 5.1 Preparation of recombinant bispecific antibodies

[0224] References (Wu C, Ying H, Grinnell C, et al. Simultaneous targeting of multiple disease mediators by a dual-variable-domain immunoglobulin. Nat Biotechnol. 2007Nov

[0014] The construction technique for the DVD-Ig structure bispecific antibody described in [reference needed] is based on Chinese invention patent application 202210871810.9.

[0015] The recombinant anti-RSV F protein monoclonal antibody R3B1h1 reported and the recombinant anti-HPIV3 F protein monoclonal antibody H1C5VH+R28H11VK prepared in Example 1.2 of this application were used to prepare a DVD-Ig structure bispecific antibody against RSV F protein and HPIV3 F protein. Using conventional molecular biology techniques, the variable region of the heavy chain encoding R3B1h1 was fused to the N-terminus of the H1C5 heavy chain, and the variable region of the light chain encoding R3B1h1 was fused to the N-terminus of the R28H11 light chain. The constructed eukaryotic expression vectors expressing R3B1h1-VH-H1C5VH-CH-IgG1 (its amino acid sequence is shown in SEQ ID NO: 28) and R3B1h1VK-R28H11VK-CK (its amino acid sequence is shown in SEQ ID NO: 29) were co-transfected into HEK293F cells using liposomes to prepare recombinant bispecific antibodies (named R3B1h1+H1C5VH+R28H11VK BsAb in this paper).

[0225] 5.2 Affinity Analysis of Recombinant Bispecific Antibodies

[0226] Referring to Example 3.1, the affinity of the recombinant bispecific antibody was determined using surface plasmon resonance (SPR) technology with a Biacore T200. For kinetic measurements, the recombinant bispecific antibody was diluted to 1 μg / mL and injected at a rate of 10 μL / min to ensure that approximately 100 RU of antibody was captured by the anti-human Fc antibody. Then, RSV-DS-Cav1-A-His (information on this protein can be found in Chinese Patent Application 202210871810.9) was separately...

[0015] The protein comprises the RSV-DS-Cav1-A polypeptide with the amino acid sequence shown in SEQ ID NO:40 and a His tag with the amino acid sequence shown in SEQ ID NO:10 at the C-terminus of the polypeptide. A series of concentration gradients (e.g., 12.3 nM, 37 nM, 111 nM, 333 nM, 1000 nM) of HPIV3-PreF2-His protein were administered at 25 °C at a rate of 30 μL / min from low to high concentrations. The binding rate (Ka) and dissociation rate (Kd) were calculated using Biacore T200 evaluation software version 3.2.1 by fitting binding and dissociation sensor maps using a 1:1 binding model. The dissociation equilibrium constant (KD) was calculated using the ratio Kd / Ka. The fitting results are shown in Tables 4 and 5.

[0227] Table 4: Affinity of bispecific antibodies to recombinant RSV-DS-Cav1-A protein

[0228] Table 5: Affinity of bispecific antibodies to recombinant HPIV3-PreF2 protein

[0229] 5.3 Neutralizing activity of bispecific antibodies against RSV and HPIV3

[0230] 5.3.1 Bispecific antibody inhibits RSV infection of Hep-2 cells

[0231] Referring to Example 4.4 of Chinese Invention Patent Application 202210871810.9, the neutralizing activity of bispecific antibodies against RSV was detected. Recombinant bispecific antibody R3B1h1+H1C5VH+R28H11VK BsAb, anti-RSV F protein monoclonal antibodies (R3B1h1, Nirsevimab, Clesrovimab), anti-HPIV3 F protein monoclonal antibody H1C5VH+R28H11VK, and negative isotype control antibody were diluted with Hep-2 cell maintenance medium (DMEM + 2% FBS + 1% P / S + 2mM Glu) at an initial concentration of 40 nM. A 5-fold serial dilution was performed for a total of 10 concentration gradients, and 70 μL / well was added to each well of a 96-well sterile permeable cell culture plate. One vial of frozen A2 virus (RSV, purchased from ATCC, catalog number VR-1540) or 18537 virus (RSV, purchased from ATCC, catalog number VR-1580) or clinically isolated RSV (11 strains isolated from clinical samples during the 2021 RSV epidemic season, obtained from the Women and Children's Medical Center Affiliated to Guangzhou Medical University; 9 strains were subtype A, numbered 2033, 2064, 2066, 2406, 2410, 2416, 2425, 2430, and 2438; 2 strains were subtype B, numbered 2063 and 2427) was diluted to 1.5 × 10⁻⁶ with Hep-2 cell maintenance medium. 3 PFU / mL, add 70 μL / well of the diluted virus solution to the diluted antibody and mix thoroughly. After all samples have been added, cover the culture plate and place it in a cell culture incubator (37±1℃, 5±1% CO2) for 1 h to neutralize. Take Hep-2 cells (human laryngeal carcinoma epithelial cells, purchased from Nanjing Kebai Biotechnology Co., Ltd., catalog number CBP60246) in the logarithmic growth phase, digest and centrifuge, and then dilute the counted cell suspension to 4.3 × 10⁻⁶ cells / well with Hep-2 cell maintenance medium. 5Single-cell suspensions of 70 μL / well were seeded into neutralized 96-well cell culture plates and incubated at 37±1℃, 5±1% CO2 for 60–72 h. After viral infection, the cells were washed twice with PBS, and fixed with 80% acetone for 30 min at 2–8℃. The 80% acetone was discarded, and the cells were washed twice with PBS. Palivizumab (100 μL / well) diluted to 10 μg / mL with PBS was added, and the cells were incubated at 37℃ in the dark for 60 min. The primary antibody was discarded, and the cells were washed twice with PBS. FITC-labeled goat anti-human IgG (Beijing Zhongshan Jinqiao Biotechnology Co., Ltd., ZF-0308) diluted 1:400 with PBS (100 μL / well) was added, and the cells were incubated at 37℃ in the dark for 40 min. The secondary antibody was discarded, and the cells were washed twice with PBS. The chemiluminescence value was detected using a SpectraMax I3 microplate reader. The results showed that, based on the IC50 values ​​(Table 6), the neutralizing activity of R3B1h1+H1C5VH+R28H11VK BsAb against A2 was comparable to that of Clesrovimab, but weaker than that of R3B1h1 and Nirsevimab (Figure 5A); the neutralizing activity of R3B1h1+H1C5VH+R28H11VK BsAb against 18537 was comparable to that of Nirsevimab, but weaker than that of R3B1h1 and Clesrovimab (Figure 5B); all the tested anti-RSV antibodies were able to neutralize clinically isolated RSV samples (Figure 5C).

[0232] Table 6. Half-inhibitory concentrations of bispecific antibodies against RSV virus infection in Hep-2 cells

[0233] 5.3.2 Bispecific antibody inhibits HPIV3 infection of LLC-MK2 cells

[0234] Refer to Example 3.3 to detect the activity of the bispecific antibody in inhibiting HPIV3 infection of LLC-MK2 cells.

[0235] The results showed that, based on the IC50 values ​​(Table 7), the activity of R3B1h1+H1C5VH+R28H11VK BsAb was comparable to that of 3X1, but weaker than that of H1C5VH+R28H11, PI3-E12, and PIA174 (Figure 6, Figure A); all the tested anti-HPIV3 antibodies were able to neutralize the clinically isolated HPIV3 samples (Figure 6, Figure B).

[0236] Table 7. Half-inhibitory concentrations of bispecific antibodies against HPIV3 / C243 virus infection in LLC-MK2 cells

[0237] 5.4 In vivo protective effect of bispecific antibodies against viral infection

[0238] 5.4.1 In vivo protective effect of bispecific antibodies against RSV virus infection

[0239] Twenty-one 6-week-old male BALB / c Nude mice (Beijing Vital River Laboratory Animal Technology Co., Ltd.) were selected. The day of RSV inoculation was defined as day 0 of the experiment, the day before RSV inoculation was day -1, the day after RSV inoculation was day 1, and so on. On day -1, BALB / c Nude mice were treated with solvent or test substance. The experiment was divided into several groups: group 2 (G2) with recombinant bispecific antibody R3B1h1+H1C5VH+R28H11VK BsAb 13.33 mg / kg; group 3 (G3) with recombinant bispecific antibody R3B1h1+H1C5VH+R28H11VK BsAb 3.33 mg / kg; group 4 (G4) with recombinant bispecific antibody R3B1h1+H1C5VH+R28H11VK BsAb 0.83 mg / kg; group 5 (G5) with anti-RSV F protein monoclonal antibody R3B1h1 10 mg / kg; group 6 (G6) with anti-RSV F protein monoclonal antibody Nirsevimab 10 mg / kg; and group 7 (G6) with anti-HPIV3 F protein monoclonal antibody H1C5VH+R28H11VK. The mice were divided into two groups: a 10 mg / kg group (group 7, G7) and a PBS-based group (group 1, G1). Administration was intramuscular injection at a volume of 0.5 mL / kg, administered once. On day 0, BALB / c Nude mice were anesthetized with isoflurane and inoculated with the virus via intranasal drops at a dose of 7.0 × 10⁻⁶ per animal. 6 PFU was inoculated at a volume of 100 μL. On day 3 of the experiment, all BALB / c Nude mice were euthanized by overdose anesthesia. Lung tissue was collected, weighed, and cryopreserved in 0.5 mL of PBS + 1% BSA cryopreservation solution.

[0240] Detection of RSV titer in lung tissue by real-time PCR: (1) Sample preparation: The collected lung tissue samples were homogenized and centrifuged to obtain the supernatant; (2) Total RNA extraction: 140 μL of the supernatant of each lung tissue sample was taken and total RNA was extracted using a viral RNA extraction kit (TIANGEN, DP315-R); (3) Synthesis of first strand of cDNA: 11 μL of RNA solution was taken as a template and reverse transcription was performed using a RevertAid first strand cDNA synthesis kit (Thermofisher, catalog number: K1621). The reverse transcription primer was TCCAGCAAAATACACCATCCAAC (SEQ ID NO: 30); (4) Construction of standard plasmid: The gene ATGGGAGAGGTAGCTCCAGAATACAGGCATGACTCTCCTGATTGTGGGATGATAATATTATGTATAGCAGCATTAGTAATAACTAAATTAGCAGCAGGGGACAGATCTGGTCTTACAGCCGTGATTAGGAGAGCT (SEQ ID NO: 30) was synthesized. ID NO:31), using conventional molecular biology techniques, the synthesized gene was cloned into a suitable eukaryotic expression vector (such as Invitrogen's pcDNA3.1, etc.); (5) Preparation of the real-time PCR system: the solution of the first strand of cDNA was diluted 10 times, and 5 μL of each was added to the PCR tube as template. The upstream primer was ATGGGAGAGGTAGCTCCAGA (SEQ ID NO:32), and the downstream primer was AGCTCTCCTAATCACGGCTG (SEQ ID NO:33). They were diluted to 10 μM respectively, and 0.5 μL of each was added to the PCR tube. At the same time, 12.5 μL of the PCR system was added. Green qPCR SuperMix (Beijing TransGen Biotech Co., Ltd., AQ601-02) and 6.5 μL ddH2O; (6) Detection: Detection was performed using a 4-channel quantitative PCR instrument (Hangzhou Borui Technology Co., Ltd., FQD-96A).

[0241] The results (Figure 7) showed that, compared with the PBS group, the recombinant bispecific antibody R3B1h1+H1C5VH+R28H11VK BsAb, administered 24 hours before infection at doses of 13.33 mg / kg, 3.33 mg / kg, and 0.83 mg / kg, significantly reduced RSV viral titers in the lung tissue of infected animals in a dose-dependent manner. At the same dose, the recombinant bispecific antibody R3B1h1+H1C5VH+R28H11VK BsAb showed weaker activity than the anti-RSV F protein monoclonal antibody R3B1h1 and Nirsevimab.

[0242] 5.4.2 In vivo protective effect of bispecific antibodies against HPIV3 virus infection

[0243] The in vivo protective effect of bispecific antibodies against HPIV3 virus infection was analyzed according to Example 4. The experiment was divided into four groups: recombinant bispecific antibody R3B1h1+H1C5VH+R28H11VK BsAb 6.67 mg / kg group (Group 2, G2), 1.34 mg / kg group (Group 3, G3), 0.27 mg / kg group (Group 4, G4), anti-HPIV3 F protein monoclonal antibody H1C5VH+R28H11VK 5 mg / kg group (Group 5, G5), anti-HPIV3 F protein monoclonal antibody PI3-E12 5 mg / kg group (Group 6, G6), anti-RSV F protein monoclonal antibody R3B1h1 5 mg / kg group (Group 7, G7), and solvent PBS group (Group 1, G1).

[0244] The results (Figure 8) showed that, compared with the PBS group, the recombinant bispecific antibody R3B1h1+H1C5VH+R28H11VK BsAb, administered 24 hours before infection at doses of 6.67 mg / kg, 1.34 mg / kg, and 0.27 mg / kg, significantly reduced the HPIV3 virus titer in the lung tissue of infected animals in a dose-dependent manner. At the same dose, the recombinant bispecific antibody R3B1h1+H1C5VH+R28H11VK BsAb was less active than the anti-HPIV3 F protein monoclonal antibody H1C5VH+R28H11VK and PI3-E12.

[0245] References

[0246] [1]J Med Virol.2019Sep;91(9):1625-1632.

[0247] [2]Clin Microbiol Rev.2003Apr;16(2):242-64.

[0248] [3]J Pediatr.2009May;154(5):694-9.

[0249] [4]J Virol.1985Jan;53(1):228-34.

[0250] [5]J Virol.2001Jul;75(14):6310-20.

[0251] [6]Kabat, "Sequences of Proteins of Immunological Interest", National Institutes of Health, Bethesda, Md. (1991).

[0252] [7]A1-Lazikani, et al., J. Mol. Biol. 273:927-948 (1997).

[0253] [8]Martin, et al., Proc.Natl.Acad.Sci.USA86:9268-9272(1989).

[0254] [9]WO 2022 / 207839 A2

[0255]

[0010] Phage Display: A Universal Laboratory Guide / Edited by (US) Clackson, T., and (US) Lowman, HB; Translated by Ma Lan et al.

[0256]

[0011] WO 2022 / 183018A1

[0257]

[0012] Proc Natl Acad Sci US A.2018Nov 27;115(48):12265-12270.

[0258]

[0013] Nat Commun.2023Feb 13;14(1):798.

[0259]

[0014] Wu C, Ying H, Grinnell C, et al. Simultaneous targeting of multiple disease mediators by a dual-variable-domain immunoglobulin. Nat Biotechnol. 2007Nov.

[0260]

[0015] Chinese invention patent application CN 202210871810.9.

[0261] Sequence information

[0262] SEQ ID NO:1

[0263] SEQ ID NO:2

[0264] SEQ ID NO:3

[0265] SEQ ID NO:4

[0266] SEQ ID NO:5

[0267] SEQ ID NO:6

[0268] SEQ ID NO:7

[0269] SEQ ID NO:8

[0270] SEQ ID NO:9

[0271] SEQ ID NO:10

[0272] SEQ ID NO:11

[0273] SEQ ID NO:12

[0274] SEQ ID NO:13

[0275] SEQ ID NO:14

[0276] SEQ ID NO:15

[0277] SEQ ID NO:16

[0278] SEQ ID NO:17

[0279] SEQ ID NO:18

[0280] SEQ ID NO:19

[0281] SEQ ID NO:20

[0282] SEQ ID NO:21

[0283] SEQ ID NO:22

[0284] SEQ ID NO:23

[0285] SEQ ID NO:24

[0286] SEQ ID NO:25

[0287] SEQ ID NO:26

[0288] SEQ ID NO:27

[0289] SEQ ID NO:28

[0290] SEQ ID NO:29

[0291] SEQ ID NO:30

[0292] SEQ ID NO:31

[0293] SEQ ID NO:32

[0294] SEQ ID NO:33

[0295] SEQ ID NO:34

[0296] SEQ ID NO:35

[0297] SEQ ID NO:36

[0298] SEQ ID NO:37

[0299] SEQ ID NO:38

[0300] SEQ ID NO:39

[0301] SEQ ID NO:40

[0302] SEQ ID NO:41

[0303] SEQ ID NO:42

[0304] All patents, patent application publications, and non-patent documents mentioned and / or listed in this application are incorporated herein by reference in their entirety. Exemplary embodiments of the inventions described above have been described; however, those skilled in the art can modify or improve the exemplary embodiments described herein without departing from the spirit and scope of this application, and such variations or equivalents also fall within the scope of this application.

Claims

1. An antibody against human parainfluenza virus type 3 (HPIV3) containing heavy chain variable regions of HCDR1, HCDR2, and HCDR3, and light chain variable regions of LCDR1, LCDR2, and LCDR3, wherein... The amino acid sequences of HCDR1 are shown in SEQ ID NO:1, HCDR2 are shown in SEQ ID NO:2, HCDR3 are shown in SEQ ID NO:3, LCDR1 is shown in SEQ ID NO:4, LCDR2 is shown in SEQ ID NO:5, and LCDR3 is shown in SEQ ID NO:

6. in, The amino acid sequences of HCDR and LCDR are defined according to Kabat.

2. The antibody of claim 1, wherein the amino acid sequence of the heavy chain variable region of the antibody has at least 90% identity with SEQ ID NO:7, and / or the amino acid sequence of the light chain variable region of the antibody has at least 90% identity with SEQ ID NO:8; Preferably, the amino acid sequence of the antibody heavy chain variable region is as shown in SEQ ID NO:7, and / or the amino acid sequence of the antibody light chain variable region is as shown in SEQ ID NO:

8.

3. The antibody according to any one of claims 1-2, wherein The antibody is a neutralizing antibody; and / or The antibody is capable of binding to the HPIV3 F protein; preferably, the antibody is capable of binding to the recombinant human HPIV3 F protein as shown in SEQ ID NO:9; and / or The antibody is a Fab fragment, a whole antibody, an F(ab')2 fragment, or a single-chain Fv fragment (scFv); preferably, the antibody is a Fab fragment; and / or The antibody is a monoclonal antibody.

4. The antibody according to any one of claims 1-3, wherein The antibody further comprises a heavy chain constant region selected from IgG1, IgG2, or IgG4 subtypes; preferably, the heavy chain constant region comprises an Fc segment sequence of the IgG1 subtype heavy chain constant region and the Fc segment sequence comprises amino acid Y at position 252, amino acid T at position 254, and amino acid E at position 256, wherein the amino acid sequence of the antibody constant region is determined according to EU numbering; and / or The antibody further comprises a light chain constant region selected from the κ or λ subtype; preferably, the light chain constant region is the κ subtype.

5. A bispecific antibody against human parainfluenza virus type 3 (HPIV3) and respiratory syncytial virus (RSV), wherein the bispecific antibody comprises a first antigen-binding region for HPIV3 and a second antigen-binding region for RSV, wherein the first antigen-binding region comprises a heavy chain variable region containing HCDR1 as shown in SEQ ID NO:1, HCDR2 as shown in SEQ ID NO:2, and HCDR3 as shown in SEQ ID NO:3, and a light chain variable region containing LCDR1 as shown in SEQ ID NO:4, LCDR2 as shown in SEQ ID NO:5, and LCDR3 as shown in SEQ ID NO:6; Optionally, the second antigen-binding region includes a heavy chain variable region containing HCDR1 as shown in SEQ ID NO:34, HCDR2 as shown in SEQ ID NO:35, and HCDR3 as shown in SEQ ID NO:36, and a light chain variable region containing LCDR1 as shown in SEQ ID NO:37, LCDR2 as shown in SEQ ID NO:38, and LCDR3 as shown in SEQ ID NO:39; in, The amino acid sequences of HCDR and LCDR are defined according to Kabat.

6. The bispecific antibody of claim 5, wherein the amino acid sequence of the heavy chain variable region of the first antigen-binding region has at least 90% identity with SEQ ID NO:7, or the amino acid sequence of the heavy chain variable region of the first antigen-binding region is as shown in SEQ ID NO:7; and / or the amino acid sequence of the light chain variable region of the first antigen-binding region has at least 90% identity with SEQ ID NO:8, or the amino acid sequence of the light chain variable region of the first antigen-binding region is as shown in SEQ ID NO:8; Optionally, the amino acid sequence of the heavy chain variable region of the second antigen-binding region has at least 90% identity with SEQ ID NO:41, or the amino acid sequence of the heavy chain variable region of the second antigen-binding region is as shown in SEQ ID NO:41; and / or the amino acid sequence of the light chain variable region of the second antigen-binding region has at least 90% identity with SEQ ID NO:42, or the amino acid sequence of the light chain variable region of the second antigen-binding region is as shown in SEQ ID NO:

42.

7. The bispecific antibody according to any one of claims 5-6, wherein the bispecific antibody is capable of binding the F protein of HPIV3 and / or the F protein of RSV; preferably, the bispecific antibody is capable of binding the recombinant human HPIV3 F protein as shown in SEQ ID NO:9 and / or the recombinant RSV F protein as shown in SEQ ID NO:

40.

8. A nucleic acid molecule encoding an antibody as described in any one of claims 1-4 and / or a bispecific antibody as described in any one of claims 5-7.

9. A pharmaceutical composition comprising the antibody of any one of claims 1-4 and / or the bispecific antibody of any one of claims 5-7, as well as a pharmaceutically acceptable excipient, diluent, or carrier.

10. Use of the antibody of any one of claims 1-4, the bispecific antibody of any one of claims 5-7, the nucleic acid molecule of claim 8, or the pharmaceutical composition of claim 9 in the preparation of a medicament for the prevention or treatment of HPIV3 infection and related diseases; Preferably, the HPIV3 infection-related disease is a respiratory infection caused by HPIV3 infection; more preferably, the HPIV3 infection-related disease is bronchitis, bronchiolitis or pneumonia caused by HPIV3 infection.

11. Use of the bispecific antibody of any one of claims 5-7, the nucleic acid molecule of claim 8 encoding the bispecific antibody, or the pharmaceutical composition of claim 9 containing the bispecific antibody in the preparation of a medicament for the prevention or treatment of RSV infection and related diseases; Preferably, the RSV infection-related disease is a respiratory infection caused by RSV infection; more preferably, the RSV infection-related disease is bronchiolitis or pneumonia caused by RSV infection.

12. The antibody of any one of claims 1-4, the bispecific antibody of any one of claims 5-7, the nucleic acid molecule of claim 8, or the pharmaceutical composition of claim 9, for the prevention or treatment of HPIV3 infection and related diseases; Preferably, the HPIV3 infection-related disease is a respiratory infection caused by HPIV3 infection; more preferably, the HPIV3 infection-related disease is bronchitis, bronchiolitis or pneumonia caused by HPIV3 infection.

13. The bispecific antibody of any one of claims 5-7, the nucleic acid molecule of claim 8 encoding the bispecific antibody, or the pharmaceutical composition of claim 9 containing the bispecific antibody, for the prevention or treatment of RSV infection and related diseases; Preferably, the RSV infection-related disease is a respiratory infection caused by RSV infection; more preferably, the RSV infection-related disease is bronchiolitis or pneumonia caused by RSV infection.

14. A method for preventing or treating HPIV3 infection and related diseases, the method comprising administering to an individual in need an effective amount of the antibody of any one of claims 1-4, the bispecific antibody of any one of claims 5-7, the nucleic acid molecule of claim 8, or the pharmaceutical composition of claim 9; Preferably, the HPIV3 infection-related disease is a respiratory infection caused by HPIV3 infection; more preferably, the HPIV3 infection-related disease is bronchitis, bronchiolitis or pneumonia caused by HPIV3 infection.

15. A method for preventing or treating RSV infection and related diseases, the method comprising administering to an individual in need an effective amount of any one of claims 5-7, a nucleic acid molecule of claim 8 encoding the bispecific antibody, or a pharmaceutical composition of claim 9 containing the bispecific antibody; Preferably, the RSV infection-related disease is a respiratory infection caused by RSV infection; more preferably, the RSV infection-related disease is bronchiolitis or pneumonia caused by RSV infection.

Images