ULK1 inhibitor for the treatment of a neurodegenerative disease

Abstract

The invention relates to a ULK1 inhibitor for use in the treatment of a human or mammalian patient being diagnosed for, suffering from, or being at risk of developing a neurodegenerative disease, or in the prevention of such condition.

Description

[0001] Dusseldorf, 14 Jul. 25

[0002] Our reference: ED42097

[0003] ETH Zuerich

[0004] ULK1 inhibitor for the treatment of a neurodegen erative disease

[0005] Reference to sequence listing submitted as a compliant xml 1.0 format file (.xml)

[0006] Pursuant to the EFS-Web legal framework and 37 CFR §§ 1.821-825 (see MPEP § 2442.03(a)), Rule 30 EPC, and § 11 PatV, an electronic sequence listing compliant with WIPO standard ST.26 in the form of an XML 1.0 format file is submitted concurrently with the instant application, and the entire contents of the sequence listing are incorporated herein by reference. For the avoidance of doubt, if discrepancies exist between the sequences mentioned in the specification and the electronic sequence listing, the sequences in the specification shall be deemed to be the correct ones.

[0007] Field of the invention

[0008] The invention relates to the field of neurodegenerative diseases, and the treatment thereof.

[0009] Incorporation by Reference

[0010] All publications, patents, patent applications and other documents cited in this application are hereby incorporated by reference in their entireties for all purposes to the same extent as if each individual publication, patent, patent application or other document were individually indicated to be incorporated by reference for all purposes. In the event that there are any inconsistencies between the teachings of one or more of the references incorporated herein and the present disclosure, the teachings of the present specification are intended. Background

[0011] Parkinson's disease (PD) is the second most important neurodegenerative disorder in humans. The main risk factor of PD is aging. With an increasing life expectancy worldwide, PD is expected to increase dramatically within the next few years. As an example of this, the World Health Organization indicates that the prevalence of PD has doubled in the past 25 years, and global estimates in 2019 showed over 8.5 million individuals with PD. Current estimates suggest that, in 2019, PD resulted in 5.8 million disability adjusted life years (DALYs), an increase of 81% since 2000, and caused 329 000 deaths representing an increase of over 100% since 2000. PD and other neurodegenerative diseases (called Synucleinopathies or a- Synucleinopathies) result from the progressive accumulation of aberrant forms of the protein called alpha-Synuclein. In PD, alpha-Synuclein self-aggregates to form protein clumps which are toxic for the cells of the brain.

[0012] However, these aggregates appear in early and asymptomatic stages of the disease. In these stages, they are found in the peripheral nervous system, and only after 6 to 8 years of the appearance, they are found in the brain where they cause neuronal death making visible the symptoms of PD. At present, there is no therapy or strategy known, let alone available to patients, to stop the spreading of alpha-Synuclein aggregates and therefore interfere with, or delay or even stop, the progression of PD and other neurodegenerative diseases.

[0013] It is hence one object of the present invention to provide new therapeutic or preventive options for the treatment of neurodegenerative diseases, including a-Synucleinopathies.

[0014] It is another object of the present invention to provide ways to interfere with the accumulation of alpha-Synuclein in neuronal and non-neuronal cells.

[0015] It is another object of the present invention to provide ways to interfere with the aggregation of alpha-Synuclein in neuronal and non-neuronal cells.

[0016] It is another object of the present invention to provide ways to interfere with the spreading of alpha-Synuclein in neuronal and non-neuronal cells. Brief description of the Figures

[0017] Figures 1 : GFP, wt- or sp2-aSyn-expressing Cos7 cells were transfected with a control shRNA (shLUC) or a shRNA targeting the ULK1 gene (shULKl). 48h post transfection the cells were harvested and whole cell lysates were analysed by Western blot using the indicated antibodies. The y-tubulin blot is used as loading control Dashed line and scissor indicate that only the upper and lower part of the gel is shown. Stck, stacking gel. HMW, high molecular weight species.

[0018] Figures 2 and 3: GFP, wt- or sp2-aSyn-expressing Cos7 cells were treated for 16 h with SBI- 0206965 (SBI) (Fig. 2) or MRT-68921 (MRT) (Fig. 3). After treatment the cells were harvested and whole cell lysates were analysed by Western blot using the indicated antibodies. 0, vehicle- treated cells. HMW, high molecular weight species. KDa, kilodaltons.

[0019] Figure 4: Cell viability of Cos7 cells expressing GFP, wt-, or sp2-aSyn transfected with a control siRNA (siLUC) or a siRNA specific for ULK1 (siULKl). Cell viability was determined by the MTT assay. Data is shown as the media ± SD. * p < 0.05 compared to GFP-expressing cells (one-way ANOVA followed by the post hoc Dunnett’s test).

[0020] Figure 5: Generation of the recombinant DNA plasmid encoding an shRNA specific for mouse and human ULK1. Intracellular transcription of the shRNA, hairpin formation and processing is also shown.

[0021] Figure 6: GFP, wt- or sp2-aSyn-expressing Hek-293 cells were transfected with a commercially available control siRNA (siLUC) or a commercially available siRNA targeting the ULK1 gene (siULKl). 48h post transfection the cells were harvested and whole cell lysates were analysed by Western blot using the indicated antibodies. The S6 blot is used as loading control. HMW, high molecular weight species. KDa, kilodaltons. shULKl targets a slightly different sequence than the siULKl and therefore a possible off-target effect of the knockdown approach for ULK1 silencing is minimized.

[0022] Figure 7: Reduction of sp2-aSyn formation by AP-26113 (Brigatinib) and Hesperadin.Cos7 cells were transiently transfected with an expression vector encoding sp2-aSyn. 24h post transfection the cells were treated with DMSO (Vehicle), or three different doses of AP-26113 (Brigatinib) or Hesperadin. 24h later the cells were harvested and whole cell lysates were analysed by Western blot using the indicated antibodies. The GAPDH blot is used as loading control. Dashed line indicates the upper part of the gel were high-molecular weight species (BMW) are retained. The doses applied for both molecules are 1000, 100 and 10 nM (from left to right).

[0023] Detailed Description of embodiments

[0024] Before the invention is described in detail, it is to be understood that this invention is not limited to the particular component parts of the devices described or process steps of the methods described, as such devices and methods may vary. It is also to be understood that the terminology used herein is for purposes of describing particular embodiments only, and is not intended to be limiting. It must be noted that, as used in the specification and the appended claims, the singular forms "a", "an", and "the" include singular and / or plural referents unless the context clearly dictates otherwise. It is moreover to be understood that, in case parameter ranges are given which are delimited by numeric values, the ranges are deemed to include these limitation values.

[0025] It is further to be understood that embodiments disclosed herein are not meant to be understood as individual embodiments which would not relate to one another. Features discussed with one embodiment are meant to be disclosed also in connection with other embodiments shown herein. If, in one case, a specific feature is not disclosed with one embodiment, but with another, the skilled person would understand that does not necessarily mean that said feature is not meant to be disclosed with said other embodiment. The skilled person would understand that it is the gist of this application to disclose said feature also for the other embodiment, but that just for purposes of clarity and to keep the specification in a manageable volume this has not been done.

[0026] Furthermore, the content of the prior art documents referred to herein is incorporated by reference. This refers, particularly, for prior art documents that disclose standard or routine methods. In that case, the incorporation by reference has mainly the purpose to provide sufficient enabling disclosure, and avoid lengthy repetitions.

[0027] According to one aspect of the invention, a ULK1 inhibitor is provided for (the manufacture of a medicament for) use in the treatment of a human or mammalian patient (i) being diagnosed for,

[0028] (ii) suffering from, or

[0029] (iii) being at risk of developing a neurodegenerative disease, or in the prevention of such condition.

[0030] This language is deemed to encompass both the Swiss type claim language accepted in some countries (in this case, brackets are deemed absent) and EPC2000 language (in this case, brackets and content within the brackets is deemed absent).

[0031] The term “neurogenerative disease”, as used herein, relates to diseases caused by the progressive loss of neurons, in the process known as neurodegeneration. Neurodegeneration can be found in the brain at many different levels of neuronal circuitry, ranging from molecular to systemic. Because there is no known way to reverse the progressive degeneration of neurons, these diseases are considered to be incurable, and oftentimes lead to death.

[0032] In one embodiment, the claimed treatment relates to the prevention of a neurodegenerative disease in a human or mammalian patient (i) being diagnosed or (iii) being at risk of developing such disease. The term “prevention”, as used herein, encompasses complete prevention, as well as the amelioration of disease symptoms and the delay of disease onset.

[0033] In one embodiment, the claimed treatment relates to the amelioration and / or reversion of the symptoms of a neurodegenerative disease.

[0034] Unc-51 like kinase 1 (ULK1, also called ATG1, ATG1A, hATGl, UNC51, Unc51.1 or unc-51 like autophagy activating kinase 1) is an enzyme that in humans is encoded by the ULK1 gene.

[0035] ULK1 and ULK2 are two similar isoforms. ULK1 / 2 is an important protein in autophagy for mammalian cells, and is homologous to ATG1 in yeast. It is part of the ULKl-complex, which is needed in early steps of autophagosome biogenesis. The ULK1 complex also consists of the FAK family kinase interacting protein of 200 kDa (FIP200 or RB1CC1) and the HORMA (Hop / Rev7 / Mad2) domain-containing proteins ATG13 and ATG101. ULK1, specifically, appears to be the most essential for autophagy and is activated under conditions of nutrient deprivation by several upstream signals which is followed by the initiation of autophagy. However, ULK1 and ULK2 show high functional redundancy; studies have shown that ULK2 can compensate for the loss of ULK1. Nutrient dependent autophagy is only fully inhibited if both ULK1 and ULK2 are knocked out.

[0036] ULK1 has many downstream phosphorylation targets to aid in this induction of the isolation membrane / autophagosome. Recently, a mechanism for autophagy has been elucidated. Models have proposed that the active ULK1 directly phosphorylates Beclin-1 at Ser 14 and activates the pro-autophagy class III phosphoinositide 3-kinase (PI(3)K), VPS34 complex, to promote autophagy induction and maturation.

[0037] In cancer specifically, ULK1 has become an attractive therapeutic target. Since autophagy acts as a cell survival trait for cells, it enables tumors (once they are already formed) to survive energy deprivation and other stresses such as chemotherapeutics.

[0038] The enzyme is specifically a kinase that is involved with autophagy, particularly in response to amino acid withdrawal. ULK1 is an important protein in autophagy for mammalian cells, and is homologous to ATG1 in yeast.

[0039] ULK1 has many downstream phosphorylation targets to aid in this induction of the isolation membrane / autophagosome. Models have proposed that the active ULK1 directly phosphorylates Beclin-1 at Ser 14 and activates the pro-autophagy class III phosphoinositide 3- kinase (PI(3)K), VPS34 complex, to promote autophagy induction and maturation.

[0040] ULK1 is a 112-kDa protein. It contains a N-terminal kinase domain, a serine-proline rich region, and a C-terminal interacting domain. The serine-proline rich region has been shown experimentally to be the site of phosphorylation by mTORCl and AMPK — a negative and positive regulator of ULK1 activity, respectively. The C-terminal domain contains two microtubule-interacting and transport (MIT) domains and acts as a scaffold which links ULK1, ATG13, and FIFP200 together to form a complex that is essential to initiate autophagy. Early autophagy targeting / tethering (EAT) domains in the C-terminus are arranged as MIT domains consisting of two three-helix bundles. MIT domains also mediate interactions with membranes. The N-terminus contains a serine-threonine kinase domain. ULK1 also contains a large activation loop between the N and C terminus that is positively charged. This region may regulate kinase activity and play a role in recognizing different substrates. ULK1 and ULK2 share significant homology in both the C-terminal and N-terminal domains. ULK1 is phosphorylated by AMPK on Ser317 and Ser777 to activate autophagy; mTOR participates in inhibitory phosphorylation of ULK1 on Ser757. Additionally, ULK1 can autophosphorylate itself at Thrl80 to facilitate self-activation.

[0041] Viral targeting of ULK1 appears to disrupt host autophagy. Coxsackievirus B3 viral proteinase 3C can proteolytically process ULK1 by cleaving after glutamine (Q) residue 524, separating the N-terminal kinase domain from C-terminal early autophagy targeting / tethering (EAT) domain.

[0042] In cancer specifically, ULK1 has become an attractive therapeutic target. Since autophagy acts as a cell survival trait for cells, it enables tumors (once they are already formed) to survive energy deprivation and other stresses such as chemotherapeutics. For that reason, inhibiting autophagy may prove to be beneficial. Thus, inhibitors have been targeted towards ULK1.

[0043] The inventors have shown that the slow spreading of the alpha-Synuclein aggregates from the periphery to the brain is likely to result from to the cell-to-cell propagation of alpha-Synuclein via sequential steps of secretion and uptake. By this mechanism of transmission, alpha- Synuclein aggregates travel from the periphery to the brain using neuroanatomical interconnected areas. The inventors have further shown that the inhibition of ULK1 activity can contribute to stopping or delaying alpha-Synuclein cell-to-cell transmission.

[0044] These findings provide a therapeutic option that could be used to stop the progression of neurodegenerative diseases to stages where symptoms of the disease are still absent.

[0045] According to another aspect of the invention, a method for treating a human or mammalian patient is provided, which method comprises administration of one or more ULK1 inhibitors, wherein the human or mammalian patient

[0046] (i) is diagnosed for,

[0047] (ii) suffers from or

[0048] (iii) is at risk of developing a neurodegenerative disease. According to embodiments of the invention, the ULK1 inhibitor is a small molecular inhibitor selected from the group consisting of AP26113 (Brigatinib) or Hesperadin.

[0049] AP26113 (Brigatinib, CAS number 1197953-54-0) is a highly potent, selective and orally active inhibitor of ALK (anaplastic lymphoma kinase), with an IC50 of 0.6 nM. Brigatinib can be used for research of NSCLC (Camidge et al., 2022). Surprisingly, the inventors of the present invention have for the first shown that (i) Brigatinib is also capable of inhibiting ULK1, and that (ii) administration thereof suppresses the formation of aSyn.

[0050] Hesperadin (CAS number 422513-13-1) is an indolinone inhibitor of Aurora A and B kinase, and has been described to inhibit chromosome alignment and segregation (Hauf et al., 2003). Surprisingly, the inventors of the present invention have for the first shown that (i) Hesperadin is also capable of inhibiting ULK1, and that (ii) administration thereof suppresses the formation of aSyn.

[0051] According to embodiments of the invention, the ULK1 inhibitor is a small molecular inhibitor selected from the group consisting of SBI-0206965 (SB I) and MRT-68921 (MRT).

[0052] SBI-0206965 is a potent, selective and cell permeable autophagy kinase ULK1 inhibitor with IC50s of 108 nM for ULK1 kinase and 711 nM for the highly related kinase ULK2.

[0053] MRT-68921 is a potent inhibitor of ULK1 and ULK2, with IC50 values of 2.9 nM and 1.1 nM, respectively.

[0054] According to another embodiment of the invention, the ULK1 inhibitor is Dabrafenib. Dabrafenib (GSK2118436A) is an ATP-competitive inhibitor of Raf with IC50S of 5 nM and 0.6 nM for C-Raf and B-RafV600E, respectively. It has been shown to inhibit ULK1 (Phadke et al., 2018)

[0055] According to embodiments of the invention, the ULK1 inhibitor is a small molecular inhibitor selected from the list shown in table 1.

[0056] Again, it needs to be emphasized that contrary to the existing opinion in the art, namely that activation of ULK1 would enhance autophagy and as such has a therapeutic potential on neurodegenerative diseases like Parkinson’s disease, for instance by reducing aSyn aggregates, the inventors show herein that inhibition of ULK1 can open up new and efficacious ways to treat and / or prevent neurodegenerative diseases.

[0057] According to embodiments of the invention, the neurodegenerative disease is caused by accumulation of alpha-Synuclein.

[0058] Alpha-synuclein (aSyn) is a protein that, in humans, is encoded by the SNCA gene. Alpha- synuclein is a neuronal protein that regulates synaptic vesicle trafficking and subsequent neurotransmitter release. It is abundant in the brain, while smaller amounts are found in the heart, muscle and other tissues. In the brain, alpha-synuclein is found mainly in the axon terminals of presynaptic neurons. Within these terminals, alpha-synuclein interacts with phospholipids and proteins. Presynaptic terminals release chemical messengers, called neurotransmitters, from compartments known as synaptic vesicles. The release of neurotransmitters relays signals between neurons and is critical for normal brain function.

[0059] Neurodegenerative diseases caused by accumulation of alpha-Synuclein are also called Synucleinopathies or a-Synucleinopathies). The terms can be used interchangeably.

[0060] In these diseases, insoluble forms of alpha-synuclein accumulate in neuron cells, e.g., as inclusions in Lewy bodies. There are three main types of synucleinopathies: Parkinson's disease (PD), dementia with Lewy bodies (DLB), and multiple system atrophy (MSA), yet also other rare disorders, such as various neuroaxonal dystrophies. Additionally, autopsy studies have shown that a significant share of Alzheimer's Disease patients exhibit a-synuclein positive Lewy pathology, and are sub-classed as Alzheimer's Disease with Amygdalar Restricted Lewy Bodies (AD / ALB) (Hamilton 2000). Further, evidence exists that a-synuclein can contribute to the pathogenesis of amyotrophic lateral sclerosis (ALS) (Fyfe, 2024).

[0061] The inventors have surprisingly shown that ULK1 inhibition reduces accumulation of cell-to- cell transmitted alpha-Synuclein (aSyn) as well as wild type alpha-Synuclein. Without being bound to theory, this could be caused by inhibition of alpha-Synuclein secretion. As such, the inventors have provided a new therapeutic option to address, prevent and / or treat neurodegenerative diseases that are real. ULK1 is a master regulator of autophagy. ULK1 activation leads to activation of autophagy, whereas ULK1 inhibition leads to autophagy reduction.

[0062] In the prior art, some small-molecule agents that enhance autophagic activity have been described to have therapeutic potential on neurodegenerative diseases like Parkinson’s disease, for instance by reducing aSyn aggregates.

[0063] These include Latrepirdine, a neuroactive compound, can reduce aSyn accumulation in mouse neurons by stimulating autophagy (Steele et al., 2013). Isorhynchophylline was found to activate autophagy and expedite the degradation of aggregated aSyn in neuron cells (Lu et al., 2012). Trehalose is also an autophagic regulator to accelerate the clearance of aSyn in a PD model (Sarkar et al., 2007). PD180970 is a small molecule modulator of aggrephagy that regulates neuroinflammation to curb pathogenesis of neurodegeneration. PD 180970 clears toxic protein oligomers by inducing autophagy in the substantia nigra pars compacta, and mitigates neuronal loss in animal models of Parkinson’s disease such as the MPTP induction (Sn et al., 2019).

[0064] Autophagy, a mechanism of protein aggregate clearance, is activated by ULK1 activation. According to the art, therapies based on ULK1 activation (rather than inhibition) were proposed to clear aggregates. As such, ULK1 activation has been proposed to be a therapeutic opportunity for neurological disorders with protein aggregation aetiology.

[0065] Gao et al. (2019) showed that GSK621 and A769662 are two compounds that activate AMPK and ULK1 (Dong and Yang, 2024; Gao et al., 2019). Both compounds were considered to also induce autophagy pathway in SH-SY5Y cells, and to reduce levels of aSyn inclusions at 6 days post-PFF treatment. Therefore, ULK1 activation by these two AMPK / ULK1 activators has been proposed for the treatment of Parkinson’s disease.

[0066] Liu et al. (2023) demonstrated that BL-918, also called 33i is an ULK1 activator that induce cytoprotective autophagy via the ULK complex in human neuroblastoma SH-SY5Y cells as well as in mice. In this line, silencing of ULK1 or blocking autophagy induction lead to a decreased level of cytoprotective autophagy. BL-918 exerts its neuroprotective effects by increasing ULK 1 -modulated autophagy in vitro as well as in a MPTP-induced Parkinson’s disease mouse model, which is characterized by significant reduction in the loss of TH-positive neuron cells and MPTP-induced apoptosis. Importantly, due to its low molecular weight, BL- 918 may transport well across the blood-brain barrier and enter into the brain, thus making it a leading compound for PD drug development (Ouyang et al., 2018). BL-918 activates ULK1- dependent autophagy in vitro and induces cytoprotective autophagy by eliminating toxic superoxide dismutase 1 (SOD1) aggregates. Thus, the ULK1 activator BL-918 was considered to have therapeutic potential on SOD and protein aggregation-related diseases.

[0067] ULK1 expression can also be altered by the action of microRNAs, and the regulatory role of a variety of microRNAs in Parkinson’s disease has been reported. For instance, Lv et. al. (2021) demonstrated that miR-3473b target TREM2 / ULK1 expression to regulate the role of autophagy in the pathogenesis of inflammation in Parkinson's disease (Lv et al., 2021). They proposed that miR-3473b directly and indirectly decreases TREM2 and ULK1 expression, which both result in reduced autophagy. Conversely, blocking mir-3473b by exogenous delivery of an antagomir increase the expression of TREM2 and ULK1 in MPTP -treated mouse substantia nigra pars compacta in vivo leading to increased autophagy. Exogenous mir-3473b antagomir enhances the effects of MPTP treatment on TREM2 and P-ULK1 in the midbrain of mice to inhibit the activation of microglia and promote autophagy. This result suggests that mir- 3473b can target TREM2 and indirectly regulate the inflammatory response of microglia mediated by ULK1, which may be a candidate target for therapy in the inflammatory pathogenesis of PD.

[0068] Vasconcelos-Ferreira et al. (2022) showed that ULK1 / 2 overexpression reduces the toxic forms of mutATXN3 in the lentiviral-based mouse model of Machado-Joseph disease. ULK1 exerts an essential role in autophagy -mediated mutATXN3 clearance in vitro. ULK1 and ULK2 promoted a significant decrease of high-MW species, soluble mutATXN3, and 34-kDa fragment levels by 67.44% ± 7.21%, 88.45% ± 7.75%, and 68.81% ± 14.59%, respectively. Furthermore, upon immunohistochemistry, the quantification of the number of ubiquitinpositive inclusions further revealed a similar significant reduction upon ULK1 / 2 overexpression (37.78% ± 6.50% versus 100% ± 20.99% control). Thus, overexpression of ULK homologs has been proposed as a promising instrument for the treatment of Machado- Joseph disease and other neurodegenerative disorders.

[0069] (Lim et al., 2015) showed that ULK1 activation, through Phosphorylation of p62 at S409, potentiates autophagic degradation of polyQ-expanded Huntingtin (Htt) mutant. The presence of ULK1 and p62 p-S405 and p-S409 in poly-Ubiquitin (Ub) or polyQ-expanded protein aggregates causes the recruitment of autophagy machinery that is responsible for the degradation of poly-Ub or polyQ-Htt mutant proteins. ULKl-mediated phosphorylation of p62 is likely activated by mechanisms distinct from canonical nutrient pathways. Instead, it may involve sensing of proteotoxic stresses such as accumulation of misfolded poly-ubiquitinated proteins or disease-related protein aggregates. Their results thus provide a rationale for the development of therapeutics against human diseases associated with protein aggregates(proteinopathies), based on ULK1 activation and targeting p62 for phosphorylation.

[0070] There are patents related to increased autophagy by ULK1 activation as treatment for neurodegenerative diseases such as Parkinson’s disease. For instance, China patent CN106748892A related to target autophagy activator and its application in neurodegenerative disease therapeutic agent by an ULK1 activator. International application WO2018133756A1 related to target autophagy activator and its application in neurodegenerative disease therapeutic agent by an ULK1 agonist.

[0071] There are several patents related to autophagy activation for the treatment of neurodegenerative diseases, including Parkinson’s disease (PD). Autophagy is a crucial cellular process that removes damaged proteins and organelles, and its dysfunction is implicated in Parkinson’s disease pathology (Zhang et al., 2015).

[0072] US patent USS9005677B2 relates to autophagy enhancers for the treatment of neurodegenerative diseases and discloses the use and application of Onjisaponin B derived and isolated from Radix polygalae as novel autophagy enhancer. It further discloses a method of preventing, treating and / or delaying the onset of neurodegenerative diseases comprising administering an effective amount of Onjisaponin B is also provided.

[0073] US patent US9351946B2 relates to MTOR-independent activators of TFEB for autophagy enhancement and uses thereof, it discloses a composition comprising an autophagy enhancement compound. Small molecules that are able to enhance autophagy and lysosome biogenesis by activating the gene TFEB which can prevent the accumulation of toxic protein aggregates in treating neurodegenerative diseases are disclosed. US application US20210136626A1 relates to methods of treatment of neurodegenerative diseases through autophagy activation, and discloses the treatment of neurodegenerative diseases such as Parkinson's by activating autophagy with specific compounds.

[0074] International application W02020030158A relates to autophagy-activating compounds and uses thereof. It describes small molecules that induce autophagy and suggests potential uses in treating neurodegenerative diseases like Parkinson’s.

[0075] US patent US10851036B2 relates to small molecules for autophagy modulation and their use in neurodegenerative disorders. It discusses small molecule autophagy modulators and their therapeutic applications in diseases like Parkinson’s.

[0076] However, it appears that these approaches were not successful though. Without being bound to theory, reasons for the failure might be that autophagy is pleiotropic, and when aggregates accumulate it is already too late to treat the disease.

[0077] Parkinson’s disease is characterized by a massive loss of dopaminergic neurons in the substantia nigra. This neuronal loss results from the accumulation of neurotoxic alpha-Synuclein aggregates in this brain structure. Several cellular and animal models of Parkinson’s disease were generated by mimicking this effect with toxins that damage dopaminergic neurons such as the toxin l-methyl-4-phenyl-l,2,3,6-tetrahydropyridine (MPTP) that appears to target and lesion relatively specifically those neurons that are involved in Parkinson's disease. Thus, MPTP-derived lesions have been used as cellular and animal models of Parkinson's disease.

[0078] All previous studies fail to show any effect of ULK1 inhibition or reduced function on alpha- Synuclein or the aggregates.

[0079] As such, the inventors of the present invention have surprisingly shown that ULK1 inhibition targets alpha-Synuclein or the cell-to-cell transmitted alpha-Synuclein (made by sp2-aSyn) or in general alpha-Synuclein aggregates. The inventors have thus revealed a new way of interfering with the generation of the neurodegenerative diseases. According to embodiments of the invention, the neurodegenerative disease is at least one selected from the group consisting of

[0080] • Alzheimer’s Disease (AD)

[0081] • dementia with Lewy bodies (DLB)

[0082] • multiple system atrophy (MSA)

[0083] • Parkinson’s Disease (PD), and / or

[0084] • Amyotrophic Lateral Sclerosis (ALS)

[0085] In one embodiment, Alzheimer's Disease is Alzheimer's Disease with Amygdalar Restricted Lewy Bodies (AD / ALB).

[0086] According to embodiments of the invention, the ULK1 inhibitor is at least one of

[0087] • a DNA or RNA oligonucleotide targeting the ULK1 capable of activating the RNA interference pathway, like e.g. an shRNA or an siRNA,

[0088] • a small molecular inhibitor,

[0089] • a moiety that is capable to directly or indirectly reduce the expression of the ULK1 gene, like e.g. a moiety encompassing or encoding inter alia a programmable endonuclease, and / or

[0090] • a monoclonal antibody, or a target binding fragment thereof.

[0091] RNA interference (RNAi) is the process by which the expression of a target gene is effectively silenced or knocked down by the selective inactivation of its corresponding mRNA by doublestranded RNA (dsRNA). RNAi is activated by dsRNA species delivered to the cytoplasm of cells. The silencing mechanisms can either lead to the degradation of a target mRNA, as induced by small interfering RNAs (siRNAs) or short hairpin RNAs (shRNAs), or the suppression of translation of specific mRNAs, as induced by microRNA (miRNA).

[0092] In siRNA technology, dsDNA consisting of a sense strand identical to the target sequence and an antisense strand, each of which having a 2 nt 3’ overhang, is transfected into a cell, where it is incorporated into the RISC, which is composed of Argonaute-2 (Ago-2), Dicer, and TAR- RNA-binding protein (TRBP). The RNA duplex is separated, and one strand is removed from the complex. The strand with the lowest duplex stability at its 5'-end is selected for stable incorporation into the RISC. In shRNA technology, a dsDNA is transfected into a cell by means of a suitable vector. The dsDNA comprises, in 5 ’->3’ direction, a sense strand identical to the target sequence, a loop structure and an antisense strand. pre-shRNA is then synthesized in the nucleus of the transfected cells by RNA pol II or III transcription, and form hairpin structures that consist of a stem region of paired antisense and sense strands connected by unpaired nucleotides that make up a loop. The pre-shRNA is processed Drosha, which is an RNase III enzyme and its dsRNA- binding partner DGCR8, to obtain shRNA. shRNAs are then exported by Exportin-5 to the cytoplasm where they associate with Dicer, resulting in the removal of the loop sequence. From this point, they are processed in the same manner as siRNAs, meaning that they are incorporated into RISC.

[0093] Once loaded onto the RISC, the process of target mRNA recognition and degradation by both shRNA and siRNA is essentially the same. As a moiety of the RISC, the siRNA binds to the target mRNA in a sequence-specific manner that is mediated by complementary base pairing, leading to cleavage of the target RNA phosphate backbone near the center of the duplex via the action of the RNase-H like activity of Ago-2. An interesting feature of this system in some organisms is that annealing of the siRNA to the target mRNA allows the siRNA to act as a primer, while the target mRNA acts as a template for an RNA-dependent RNA-polymerase. This creates a new dsRNA, which is then processed by Dicer, creating a positive feedback loop that increases the pool of siRNAs.

[0094] In order to design dsDNA molecules that can then be used either for shRNA- or siRNA based gene silencing the sequence of the target gene is necessary. Based thereon, the skilled artisan can then a) define a target sequence within the target gene, and b) define sequence stretches to design dsDNA which can then be used for shRNA- or siRNA based gene silencing.

[0095] Small molecule inhibitors in the meaning of this patent are inhibitors that reduce or ULK1 activity. The skilled person is able to determine ULK1 inhibition of candidate molecules by means of suitable assays, like e.g. the ULK1 Kinase Assay ADP-Glo™ Kinase Assay (Application Notes Ser-Thr Kinase Series: ULK1) manufactured by Promega. In several embodiments, these inhibitors are Tyrosin kinase inhibitors. Examples for small molecular inhibitors are shown in the following table:

[0096] Table 1: Examples for small molecular inhibitors

[0097] A moiety that is capable to directly or indirectly reduce the expression of the ULK1 gene, like e.g., a moiety encompassing or encoding inter alia a programmable endonuclease, is for example a vector, or a Lipid nanoparticle (LNP), comprising a nucleotide sequence (e.g., an mRNA) encoding for a CRISPR Cas9 enzyme and a suitable guide RNA (gRNA or sgRNA), so as to cleave within the ULK1 gene (Kazemian et al. 2022)). Other programmable endonucleases encompass Casl2a / Cpfl, CasX, CasLambda, TALEN, ZinkFinger and so forth (Wang et al. 2016).

[0098] Finding the right sequence for the guide RNA to cleave within the ULK1 gene is a matter of routine for the skilled artisan.

[0099] An “antibody” refers to a molecule of the immunoglobulin family comprising a tetrameric structural unit. Each tetramer is composed of two identical pairs of polypeptide chains, each pair having one “light” chain (about 25 kD) and one “heavy” chain (about 50-70 kD), connected through a disulfide bond. Recognized immunoglobulin genes include the K, , a, y, 5, a, and p constant region genes, as well as the myriad immunoglobulin variable region genes. Light chains are classified as either K or . Heavy chains are classified as y, p, a, 5, or a, which in turn define the immunoglobulin classes, IgG, IgM, IgA, IgD, and IgE, respectively. Antibodies can be of any isotype / class (e.g., IgG, IgM, IgA, IgD, and IgE), or any subclass (e.g., IgGl, IgG2, IgG3, IgG4, IgAl, IgA2).

[0100] Both the light and heavy chains are divided into regions of structural and functional homology. The terms “constant” and “variable” are used structurally and functionally. The N-terminus of each chain defines a variable (V) region or domain of about 100 to 110 or more amino acids primarily responsible for antigen recognition. The terms variable light chain (VL) and variable heavy chain (VH) refer to these regions of light and heavy chains respectively. The pairing of a VH and VL together forms a single antigen-binding site. In addition to V regions, both heavy chains and light chains contain a constant (C) region or domain. A secreted form of an immunoglobulin C region is made up of three C domains, CHI, CH2, CH3, optionally CH4 (Cp), and a hinge region. A membrane-bound form of an immunoglobulin C region also has membrane and intracellular domains. Each light chain has a VL at the N-terminus followed by a constant domain (C) at its other end. The constant domains of the light chain (CL) and the heavy chain (CHI, CH2 or CH3) confer important biological properties such as secretion, transplacental mobility, Fc receptor binding, complement binding, and the like. By convention, the numbering of the constant region domains increases as they become more distal from the antigen binding site or amino-terminus of the antibody. The N-terminus is a variable region and at the C-terminus is a constant region; the CH3 and CL domains actually comprise the carboxy-terminal domains of the heavy and light chain, respectively. The VL is aligned with the VH and the CL is aligned with the first constant domain of the heavy chain. As used herein, an “antibody” encompasses conventional antibody structures and variations of antibodies. Thus, within the scope of this concept are full length antibodies, chimeric antibodies, humanized antibodies, human antibodies, and antibody fragments thereof.

[0101] Antibodies exist as intact immunoglobulin chains or as a number of well-characterized antibody fragments produced by digestion with various peptidases. The term “antibody fragment,” as used herein, refers to one or more portions of an antibody that retain the ability to specifically interact with (e.g., by binding, steric hindrance, stabilizing / destabilizing, spatial distribution) an epitope of an antigen. Thus, for example, pepsin digests an antibody below the disulfide linkages in the hinge region to produce F(ab)’2, a dimer of Fab’ which itself is a light chain joined to VH-CH1 by a disulfide bond. The F(ab)’2 may be reduced under mild conditions to break the disulfide linkage in the hinge region, thereby converting the F(ab)’2 dimer into a Fab’ monomer. The Fab’ monomer is essentially Fab with part of the hinge region. While various antibody fragments are defined in terms of the digestion of an intact antibody, one of skill will appreciate that such fragments may be synthesized de novo either chemically or by using recombinant DNA methodology. As used herein, an “antibody fragment” refers to one or more portions of an antibody, either produced by the modification of whole antibodies, or those synthesized de novo using recombinant DNA methodologies, that retain binding specificity and functional activity. Examples of antibody fragments include Fv fragments, single chain antibodies (ScFv), Fab, Fab', Fd (Vh and CHI domains), dAb (Vh and an isolated CDR); diabodies and single chain diabodies; and multimeric versions of these fragments (e.g., F(ab')2.) with the same binding specificity. Antibody fragments can also be incorporated into cytokine engrafted proteins to achieve the binding specificity and activity provided in the present disclosure.

[0102] A "Fab" domain as used herein comprises a heavy chain variable domain, a constant region CHI domain, a light chain variable domain, and a light chain constant region CL domain. The interaction of the domains is stabilized by a disulfide bond between the CHI and CL domains. In some embodiments, the heavy chain domains of the Fab are in the order, from N-terminus to C-terminus, VH-CH and the light chain domains of a Fab are in the order, from N-terminus to C-terminus, VL-CL. In some embodiments, the heavy chain domains of the Fab are in the order, from N-terminus to C-terminus, CH-VH and the light chain domains of the Fab are in the order CL-VL. Although Fabs were historically identified by papain digestion of an intact immunoglobulin, in the context of this disclosure, a “Fab” is typically produced recombinantly by any method. Each Fab fragment is monovalent with respect to antigen binding, i.e., it has a single antigen- binding site.

[0103] Methods for the production of a hybridoma cell and momoclonal antibodies are disclosed in Kohler & Milstein (1975). Methods for the production and / or selection of fully human mAbs are known in the art. These can involve the use of a transgenic animal which is immunized with the respective protein or peptide, or the use of a suitable display technique, like yeast display, phage display, B-cell display or ribosome display, where antibodies from a library are screened against CD2 in a stationary phase. In vitro antibody libraries are, among others, disclosed in US6300064 by MorphoSys and US6248516 by MRC / Scripps / Stratagene. Phage Display techniques are for example disclosed in US5223409 by Dyax. Transgenic mammal platforms are for example described in EP1480515A2 by Taconic Artemis. IgG, IgM, scFv, Fab and / or F(ab)2 are antibody formats well known to the skilled person. Related enabling techniques are available from the respective textbooks, and respective terms are described in, for example, Huston et al., (1993) or Pliickthun and Skerra (1990).

[0104] Antibodies capable of binding to ULK1 are commercially available, as shown in the following table:

[0105] Table 2 Examples of commercially available antibodies which bind to ULK1

[0106] For intracellular applications, the antibody can either be delivered intracellularly, for example by means of antibody -peptide fusions (Gaston et al., 2019) or by delivery of mRNA encoding for an anti ULK1 antibody (Zhao et al., 2023).

[0107] According to another aspect of the invention, a kit or dosage form comprising the ULK1 inhibitor for use according to the above description is provided.

[0108] According to an embodiment of the method of the invention, the ULK-1 inhibitor is provided in a kit or dosage form.

[0109] According to further embodiments of the invention,

[0110] • the ULK1 inhibitor is for systemic or topical administration, or is systemically or topically administered

[0111] • the ULK1 inhibitor is for at least one of oral, nasal, inhalation, transcutaneous, iv, im, sc or intrathecal administration, or is administered orally, nasally, by inhalation, transcutaneous, iv, im, sc or intrathecally,

[0112] • or the dosage form comprises at least one of a tablet, lozenge capsule, powder, syrup, syringe, infusion bag, and / or injection pen.

[0113] “sc” as used herein means subcutaneous administration, “iv” as used herein means intravenous administration, "im” as used herein means intramuscular administration

[0114] EXAMPLES

[0115] While the invention has been illustrated and described in detail in the drawings and foregoing description, such illustration and description are to be considered illustrative or exemplary and not restrictive; the invention is not limited to the disclosed embodiments. Other variations to the disclosed embodiments can be understood and effected by those skilled in the art in 777444 Examples

[0116] Example 1: RNA interference (shRNA) mediated inhibition of ULK1 gene expression reduces accumulation of aSyn

[0117] A variant of alpha-Synuclein (aSyn) that is cell-to-cell transmitted was developed. This variant is called sp2-aSyn (Prymaczok et al, 2024) In contrast, an intracellular form of this protein is called wt-aSyn. It has been shown that wt-aSyn can also be cell-to-cell transmitted but at much lesser extent than sp2-aSyn.

[0118] An shRNA which targets the sequence 5 ' TGGAGCAAGAGCACACGGA ' 3 (SEQ ID NO: 1) contained in the genes encoding human and Mus musculus ULK1 was prepared. This sequence is found as 5 ' UGGAGCAAGAGCACACGGA ' 3 (SEQ ID NO: 7) within the mRNA transcripts encoding human and Mus musculus ULK1, as well as the siRNA generated by this shRNA.

[0119] In order to create the desired shRNA, a single-stranded DNA oligonucleotide of sequence

[0120] 5 ' GATCCCTGGAGCAAGAGCACACGGATTCAAGAGATCCGTGTGCTCTTGCTCCATTT

[0121] TA' 3 (SEQ ID NO: 5) was annealed with a single-stranded DNA oligonucleotide of sequence

[0122] 5 ' AGCTTAAAATGGAGCAAGAGCACACGGATCTCTTGAATCCGTGTGCTCTTGCTCCA GG ' 3 . (SEQ ID NO: 6).

[0123] See Figure 5 for an illustration.

[0124] The resulting double-stranded DNA oligonucleotide was then inserted by standard cloning procedures into the plasmid pSUPERIOR™. In this way an shRNA / siRNA targeting mRNA transcripts containing the sequence 5 ' UGGAGCAAGAGCACACGGA ' 3 (SEQ ID NO: 7) is expressed in mammalian cells upon intracellular delivery of the recombinant plasmid. To effect the silencing of a specific gene, the pSUPERIOR vector is used in concert with a pair of custom oligonucleotides that contain, among other features, a unique 19-nt sequence derived from the mRNA transcript of the gene targeted for suppression (the “N-19 target sequence”).

[0125] The N-19 target sequence corresponds to the sense strand of the pSUPERIOR-gen erated siRNA, which in turn corresponds to a 19-nt sequence within the mRNA. In the mechanism of RNAi, the antisense strand of the siRNA duplex hybridizes to this region of the mRNA to mediate cleavage of the molecule. These forward and reverse oligos are annealed and cloned by the user into the vector, between the unique Bglll and Hindlll enzyme sites. This positions the forward oligo at the correct position downstream from the Hl promoter’s TATA box to generate the desired siRNA duplex. The sequence of this forward oligo includes the unique N- 19 target in both sense and antisense orientation, separated by a 9-nt spacer sequence.

[0126] The 5’ end corresponds to the Bglll site, while the 3’ end contains the T5 sequence and any Hindlll-corresponding nucleotides. NOTE that while the 5’ overhang of the oligo corresponds to the 3’ Bglll overhang of the plasmid, the overhang sequence of the oligo actually corresponds to the BamHl, and thus destroys the Bglll site upon ligation to enable more efficient screening of positive clones. The resulting transcript of the recombinant vector is predicted to fold back on itself to form a 19-base pair stem-loop structure. Analysis indicates that the stem-loop precursor transcript is quickly cleaved in the cell to produce a functional siRNA.

[0127] Additionally, we have used siRNAs for ULK1 gene silencing. The siRNA targets the sequence 5’TCATGGAGCAAGAGCACACGGA‘3 (SEQ ID NO: 2) within the genes encoding human and Mus musculus ULK1.

[0128] The preparation of the shRNA is illustrated in Figure 5. Based on this information already, the skilled artisan is able to design suitable siRNA molecules or shRNA molecules able to interfere with gene expression of ULK1, even if other target sequences of ULK1 are addressed.

[0129] Figure 1 shows a Western blot obtained from whole cell lysates of Cos7 transfected with plasmids encoding GFP (control protein), wt-aSyn or the secreted sp2-aSyn. The cells were cotransfected with the pSUPERIOR vector encoding a control shRNA (shLUC, lanes 1-3) or an shRNA against ULK1 (shULKl, lanes 4-6). Reduction of ULK1 protein levels by shULKl are shown in the corresponding blot (labelled ULK1). Reduction of levels of high-molecular weight (HMW) and monomeric (14 KDa) aSyn by shULKl are shown in the blot labelled WB: aSyn. HMW aSyn are meta-stable aggregates that resist sample treatment for Western blot sample preparation.

[0130] Example 2 and 3: Pharmacological inhibition of ULK1 function

[0131] Reduced activity of ULK1 can also be achieved by pharmacological inhibition. We have used two ULK1 inhibitors to inhibit accumulation of wt-aSyn and sp2-aSyn.

[0132] Mammalian cells were transfected with plasmids encoding GFP (control protein), wt-aSyn or the secreted sp2-aSyn. After transfection the cells were treated with the ULK1 inhibitors SBI- 0206965 (SBI) for 16 h (Example 2) or MRT-68921 (MRT) (Example 3). After treatment the cells were harvested and the corresponding cell lysates were analyzed by WB using the indicated antibodies. 0, vehicle-treated cells. HMW high molecular weight species such as meta-stable aSyn aggregates that remain as HMW even after the sample treatment for Western blot. Results are shown in Figures 2 and 3.

[0133] Example 4: RNA interference (siRNA) mediated inhibition of ULK1 gene expression reverses the reduced cell viability in wt- and sp2-«Syn expressing cells

[0134] A commercially-available siRNA which targets the sequence 5 ' TCATGGAGCAAGAGCACACGGA ' 3 (SEQ ID NO: 2) contained in the genes encoding human and Mus musculus ULK1 was purchased and transfected in cells expressing GFP (control) or wt- or sp2-aSyn. A control siRNA (siLUC) was transfected similarly. After transfection cell viability was determined using the MTT test.

[0135] Data is shown as the media ± SD. * p < 0.05 compared to GFP-expressing cells (one-way ANOVA followed by the post hoc Dunnett’s test).

[0136] Results show that in cells transfected with an unrelated siRNA called siLUC, both wt- and sp2- aSyn expressing cells display a statistically significant reduction of cell viability when compared to cells expressing the control protein GFP (Figure 4, bars 2 and 3 versus bar 1). In cells transfected with an siRNA against ULK1 (siULKl), this reduction in cell viability is not observed. Results are shown in Figure 4. Example 5: RNA interference (siRNA) mediated inhibition of ULK1 gene expression reduces the levels of BMW of wt- and sp2-aSyn

[0137] A commercially-available siRNA which targets the sequence 5 ' TCATGGAGCAAGAGCACACGGA ' 3 (SEQ ID NO: 2) contained in the genes encoding human and Mus musculus ULK1 was purchased and transfected in cells expressing GFP (control) or wt- or sp2-aSyn. A control siRNA (siLUC) was transfected similarly. After transfection the cells were harvested and whole cell lysates were analysed by Western blot using the indicated antibodies.

[0138] Results show that in cells transfected with an unrelated siRNA called siLUC, the levels of both wt- and sp2-aSyn are higher than in cells transfected with an siRNA against ULK1 (siULKl). In this experiment in particular, the effect of ULK1 silencing is observed in the high molecular weight species (BMW) of aSyn (WB: aSyn, HMW upper part, lane 5 versus lane 2, and lane 6 versus lane 3). It can be seen that a reduction of ULK1 protein levels by siULKl (WB: ULK1, lanes 4-6 versus 1-3) has been achieved. Results are shown in Figure 6.

[0139] Example 6: Efficacy of AP-26113 (Brigatinib) and Hesperadin

[0140] Cos7 cells were transiently transfected with an expression vector encoding sp2-aSyn. 24h post transfection the cells were treated with DMSO (Vehicle), or three different doses of AP-26113 (Brigatinib) or Hesperadin. (1000, 100 and 10 nanoMolar). 24h later the cells were harvested and whole cell lysates were analysed by Western blot using the indicated antibodies. The GAPDH blot is used as loading control. Dashed line indicates the upper part of the gel were high-molecular weight species (HMW) are retained.

[0141] It can be seen that both AP-26113 (Brigatinib) and Hesperadin reduce the formation of sp2- aSyn in the transfected cells. Results are shown in Figure 7.

[0142] References K. J. Petherick et aL, Pharmacological inhibition of ULK1 kinase blocks mammalian target of rapamycin (mTOR)-dependent autophagy. J Biol Chem 290, 11376-11383 (2015). A. lanniciello et cd., ULK1 inhibition promotes oxidative stress-induced differentiation and sensitizes leukemic stem cells to targeted therapy. Sci TranslMed 13, eabd5016 (2021). H. Ren et al., Design, Synthesis, and Characterization of an Orally Active DualSpecific ULK1 / 2 Autophagy Inhibitor that Synergizes with the PARP Inhibitor Olaparib for the Treatment of Triple-Negative Breast Cancer. J Med Chem 63, 14609- 14625 (2020). D. F. Egan et al., Small Molecule Inhibition of the Autophagy Kinase ULK1 and Identification of ULK1 Substrates. Mol Cell 59, 285-297 (2015). M. Zachari et al., The identification and characterisation of autophagy inhibitors from the published kinase inhibitor sets. Biochem J Ml , 801-814 (2020). K. R. Martin et al., A Potent and Selective ULK1 Inhibitor Suppresses Autophagy and Sensitizes Cancer Cells to Nutrient Stress. iScience 8, 74-84 (2018). M. B. Lazarus, C. J. Novotny, K. M. Shokat, Structure of the human autophagy initiating kinase ULK1 in complex with potent inhibitors. ACS Chem Biol 10, 257-261 (2015). M. B. Lazarus, K. M. Shokat, Discovery and structure of a new inhibitor scaffold of the autophagy initiating kinase ULK1. Bioorg Med Chem 23, 5483-5488 (2015). D. Sun et al., Discovery of 5-bromo-4-phenoxy-N-phenylpyrimidin-2-amine derivatives as novel ULK1 inhibitors that block autophagy and induce apoptosis in non-small cell lung cancer. Eur J Med Chem 208, 112782 (2020). S. He et al., In silico approaches using pharmacophore model combined with molecular docking for discovery of novel ULK1 inhibitors. Future Med Chem 13, 341-361 (2021). S. T. Xue et al, The role of the key autophagy kinase ULK1 in hepatocellular carcinoma and its validation as a treatment target. Autophagy 16, 1823-1837 (2020). D. Pharmaceuticals, Property of Deciphera Pharmaceuticals. A. Chaikuad et al., Conservation of structure, function and inhibitor binding in UNC- 51-like kinase 1 and 2 (ULK1 / 2). Biochem J 476, 875-887 (2019). A. Morozova et aL, Development of potent and selective ULK1 / 2 inhibitors based on 7-azaindole scaffold with favorable in vivo properties. Eur J Med Chem 266, 116101 (2024). S. D. Wood et al., In Silico HTS and Structure Based Optimization of Indazole- Derived ULK1 Inhibitors. ACS Med Chem Lett 8, 1258-1263 (2017). Prymaczok, N.C et al. Cell-to-cell transmitted alpha-synuclein recapitulates experimental Parkinson’s disease, npj Parkinsons Dis. 10, 10 (2024). Hamilton RL. Lewy bodies in Alzheimer's disease: a neuropathological review of 145 cases using alpha-synuclein immunohistochemistry. Brain Pathol. 2000 Jul;10(3):378- 8 Fyfe, I. a-Synuclein seeds in amyotrophic lateral sclerosis. Nat Rev Neurol 20, 203 (2024). Kohler, G. & Milstein, C. (1975): Continuous cultures of fused cells secreting antibody of predefined specificity. In: Nature. Bd. 256, S. 495-497. Huston et al., Cell Biophysics, 22: 189-224 (1993) Pliickthun and Skerra, Meth. Enzymol., 178:497-515 (1989) Gaston, J., et al. Intracellular delivery of therapeutic antibodies into specific cells using antibody -peptide fusions. Sci Rep 9, 18688 (2019) Zhao, Y., et al. Mechanisms and research advances in mRNA antibody drug-mediated passive immunotherapy. J Transl Med 21, 693 (2023). Kazemian P et al., Lipid-Nanoparticle-Based Delivery of CRISPR / Cas9 Genome- Editing Components, Molecular Pharmaceutics 2022,19 (6), 1669-1686 Wang L et al., In Vivo Delivery Systems for Therapeutic Genome Editing. Int J Mol Sci. 2016 Apr 27;17(5):626. Dong, H., and Yang, Y.H. (2024). GSK621 ameliorates high glucose-induced renal injury by inducing autophagy via AMPK / ULK1 signaling pathway: an in vitro and in vivo study. Mol Cell Toxicol 20, 601-610. Gao, J., Perera, G., Bhadbhade, M., Halliday, G.M., and Dzamko, N. (2019). Autophagy activation promotes clearance of alpha-synuclein inclusions in fibril- seeded human neural cells. J Biol Chem 294, 14241-14256. Lim, J., Lachenmayer, M.L., Wu, S., Liu, W.C., Kundu, M., Wang, R., Komatsu, M., Oh, Y.J., Zhao, Y.X., and Yue, Z.Y. (2015). Proteotoxic Stress Induces Phosphorylation of p62 / SQSTMl by ULK1 to Regulate Selective Autophagic Clearance of Protein Aggregates. Pios Genet 11. 1 Liu, W., Zhu, S.O., Guo, Y.L., Tu, L.F., Zhen, Y.Q., Zhao, R.Y., Ou- Yang, L., Kurihara, H., He, R.R., and Liu, B. (2023). BL-918, a small-molecule activator of ULK1, induces cytoprotective autophagy for amyotrophic lateral sclerosis therapy. Acta Pharmacol Sin 44, 524-537. Lu, J.H., Tan, J.Q., Durairajan, S.S., Liu, L.F., Zhang, Z.H., Ma, L., Shen, H.M., Chan, H.Y., and Li, M. (2012). Isorhynchophylline, a natural alkaloid, promotes the degradation of alpha-synuclein in neuronal cells via inducing autophagy. Autophagy 8, 98-108. Lv, Q.K., Zhong, Z., Hu, B.B., Yan, S., Yan, Y.F., Zhang, J. J., Shi, T., Jiang, L.J., Li, W., and Huang, W. (2021). MicroRNA-3473b regulates the expression of TREM2 / ULK1 and inhibits autophagy in inflammatory pathogenesis of Parkinson disease. J Neurochem 157, 599-610. Ouyang, L., Zhang, L., Zhang, S., Yao, D., Zhao, Y., Wang, G., Fu, L., Lei, P., and Liu, B. (2018). Small-Molecule Activator of UNC-51-Like Kinase 1 (ULK1) That Induces Cytoprotective Autophagy for Parkinson's Disease Treatment. J Med Chem 61, 2776-2792. Sarkar, S., Davies, J.E., Huang, Z., Tunnacliffe, A., and Rubinsztein, D.C. (2007). Trehalose, a novel mTOR-independent autophagy enhancer, accelerates the clearance of mutant huntingtin and alpha-synuclein. J Biol Chem 282, 5641-5652. Sn, S., Pandurangi, J., Murumalla, R., Dj, V., Garimella, L., Acharya, A., Rai, S., Paul, A., Yarreiphang, H., Pillai, M.S., et al. (2019). Small molecule modulator of aggrephagy regulates neuroinflammation to curb pathogenesis of neurodegeneration. EBioMedicine 50, 260-273. Steele, J.W., Ju, S., Lachenmayer, M.L., Liken, J., Stock, A., Kim, S.H., Delgado, L.M., Alfaro, I.E., Bernales, S., Verdile, G., et al. (2013). Latrepirdine stimulates autophagy and reduces accumulation of alpha-synuclein in cells and in mouse brain. Mol Psychiatry 18, 882-888. Zhang, H., Duan, C., and Yang, H. (2015). Defective autophagy in Parkinson's disease: lessons from genetics. Mol Neurobiol 51, 89-104. Phadke M, Remsing Rix LL, Smalley I, Bryant AT, Luo Y, Lawrence HR, Schaible BJ, Chen YA, Rix U, Smalley KSM. Dabrafenib inhibits the growth of BRAF-WT cancers through CDK16 and NEK9 inhibition. Mol Oncol. 2018 Jan;12(l):74-88. doi: 10.1002 / 1878-0261.12152. Epub 2017 Nov 23. PMID: 29112787; PMCID: PMC5748485. 38. Camidge DR, Kim HR, Ahn MJ, Yang JCH, Han JY, Hochmair MJ, Lee KH, Delmonte A, Garcia Campelo MR, Kim DW, Griesinger F, Felip E, Califano R, Spira Al, Gettinger SN, Tiseo M, Lin HM, Liu Y, Vranceanu F, Niu H, Zhang P, Popat S. Brigatinib Versus Crizotinib in ALK Inhibitor-Naive Advanced ALK -Positive NSCLC: Final Results of Phase 3 ALTA-IL Trial. J Thorac Oncol. 2021 Dec;16(12):2091-2108.

[0143] 39. Hauf S, Cole RW, LaTerra S, Zimmer C, Schnapp G, Walter R, Heckel A, van Meel J, Rieder CL, Peters JM. The small molecule Hesperadin reveals a role for Aurora B in correcting kinetochore-microtubule attachment and in maintaining the spindle assembly checkpoint. J Cell Biol. 2003 Apr 28;161(2):281-94.

[0144] Sequences

[0145] The following sequences form part of the disclosure of the present application. A WIPO ST 26 compatible electronic sequence listing is provided with this application, too. For the avoidance of doubt, if discrepancies exist between the sequences in the following table and the electronic sequence listing, the sequences in this table shall be deemed to be the correct ones. Unless otherwise specified sequences are shown in 5 ’->3’ orN->C orientation.

[0146] In some cases, signal peptides may be encompassed in the reproduced sequences. In such case, the sequences shall be deemed disclosed with and without signal peptides. A readily available tool to identify signal peptides in a given protein sequence is SignalP - 6.0 provided by Dansk Technical University under https: / / services.healthtech.dtu.dk / service.php7SignalP. The same applies to His tags, C-Myc tags, FLAG tags, HA tags, Strep tags, TC tags, Poly A tags, or Nuclear Localization Sequences, if existing - all of which are well known to the skilled artisan. Note further that in RNA sequences, “T” is to be read for Uracil.

[0147] Table 2: Sequence listing

Claims

What is claimed is:

1. A ULK1 inhibitor for (the manufacture of a medicament for) use in the treatment of a human or mammalian patient(i) being diagnosed for,(ii) suffering from, or(iii) being at risk of developing a neurodegenerative disease, or in the prevention of such condition.

2. A method for treating a human or mammalian patient, which method comprises administration of one or more ULK1 inhibitors, wherein the human or mammalian patient(i) is diagnosed for,(ii) suffers from or(iii) is at risk of developing a neurodegenerative disease.

3. The ULK1 inhibitor for use according to claim 1, or the method according to claim 2, wherein the ULK1 inhibitor is a small molecular inhibitor selected from the group consisting of AP26113 (Brigatinib), and Hesperadin.

4. The ULK1 inhibitor for use according to claim 1, or the method according to claim 2, wherein the ULK1 inhibitor is a small molecular inhibitor selected from the group consisting of SBI- 0206965 (SBI) and MRT-68921 (MRT).

5. The ULK1 inhibitor for use according to claim 1, or the method according to claim 2, wherein the ULK1 inhibitor is a small molecular inhibitor selected from the list shown in table 1.

6. The ULK1 inhibitor for use or the method according to any one of the aforemenetioned claims, wherein the neurodegenerative disease is caused by accumulation of alpha-Synuclein.

7. The ULK1 inhibitor for use or the method according to any one of the aforemenetioned claims, wherein the neurodegenerative disease is at least one selected from the group consisting of• Alzheimer’s Disease (AD)• dementia with Lewy bodies (DLB)• multiple system atrophy (MSA)• Parkinson’s Disease (PD), and / or• Amyotrophic Lateral Sclerosis (ALS)8. The ULK1 inhibitor for use according to claim 1, 6 or 7 or the method according to claim 2, 6 or 7, wherein the ULK1 inhibitor is• a DNA or RNA oligonucleotide targeting the ULK1 capable of activating the RNA interference pathway, like e.g. an shRNA or an siRNA,• a moiety that is capable to directly or indirectly reduce the expression of the ULK1 gene, like e.g. a moiety encompassing or encoding inter alia a programmable endonuclease, and / or• a monoclonal antibody, or a target binding fragment thereof.

9. A kit or dosage form comprising the ULK1 inhibitor for use according to any one of claims 1, and 3 - 8.

10. The method according to any one of claims 2 - 8, wherein the ULK-1 inhibitor is provided in a kit or dosage form.

11. The ULK1 inhibitor for use, the method, or the kit or dosage form according to any one of the aforementioned claims, wherein,• the ULK1 inhibitor is for systemic or topical administration, or is systemically or topically administered• the ULK1 inhibitor is for at least one of oral, nasal, inhalation, transcutaneous, iv, im, sc or intrathecal administration, or is administered orally, nasally, by inhalation, transcutaneous, iv, im, sc or intrathecally,• or the dosage form comprises at least one of a tablet, lozenge capsule, powder, syrup, syringe, infusion bag, and / or injection pen

Images