Lipid compound and lipid nanoparticle composition

Abstract

The present disclosure provides a lipid compound, which can be used in combination with other lipid components, such as neutral lipids, cholesterol, and polymer-lipid conjugates, to form lipid nanoparticles for delivery of therapeutic agents (e.g. nucleic acid molecules) for therapeutic or prophylactic purposes, comprising vaccination. Also provided herein is a lipid nanoparticle composition comprising the lipid compound.

Description

Composition of lipid compounds and lipid nanoparticles

[0001] Related applications

[0002] This application claims priority to Chinese patent application filed on November 15, 2024, with application number 202411647395.4 entitled "Lipid Compound and Lipid Nanoparticle Composition", the entire contents of which are incorporated herein by reference. Technical Field

[0003] This disclosure relates to the biomedical field, and particularly to lipid compounds that can be used in combination with other lipid components, such as neutral lipids, cholesterol, and polymer-bound lipids, to form lipid nanoparticles for the delivery of therapeutic agents (e.g., nucleic acid molecules, including nucleic acid mimics such as locked nucleic acids (LNA), peptide nucleic acids (PNA), and morpholino)) in vitro and in vivo for therapeutic or preventative purposes, including vaccination. Background Technology

[0004] RNA therapy can manipulate gene expression or produce functional proteins, making these drugs suitable for diseases with predetermined genetic targets, including infectious diseases, cancer, and immune diseases. Regardless of their therapeutic mechanisms, the large size of some functional RNAs (such as mRNA), their anionic charge, and their sensitivity to RNases present in the bloodstream and tissues make it difficult for mRNA to effectively enter cells and exert its effects.

[0005] Lipid nanoparticles (LNPs) are commonly used carriers for mRNA drugs. LNPs are multi-component systems, typically composed of ionizable lipids or cationic lipid compounds, cofactor lipids, cholesterol, and a protective agent, polyethylene glycol-lipid conjugates. LNPs can encapsulate mRNA within a hollow structure, which enhances mRNA stability in vivo and facilitates its function. However, LNP carriers in drug formulations are a major cause of adverse reactions such as pain and inflammation after drug injection. Furthermore, mRNA's function requires translation into corresponding proteins, necessitating escape from the particle, which is very difficult for intracellular LNP particles. Finally, mRNA tends to dissociate from LNPs at elevated temperatures, requiring cryopreservation and limiting the global use of this dosage form. In summary, while the benefits of this delivery technology are evident, there is still significant room for optimization.

[0006] Ionizable lipids or cationic lipid compounds are the core components of LNPs, and they are the main factors affecting the efficacy and toxicity of LNPs, as well as the main patent barriers in LNP development. Overcoming the cytotoxicity of ionizable lipids or cationic lipid compounds is one of the key points of LNP technology, requiring a balance between delivery efficiency and toxicity during development. The cytotoxicity of ionizable lipids or cationic lipids depends on the structure of their hydrophilic head group. Cationic lipids have a quaternary ammonium head group, while ionizable lipids have a tertiary ammonium head group. Generally, quaternary ammonium head group amphiphilic molecules are more toxic than tertiary ammonium head group amphiphilic molecules. Current domestic and international development mainly focuses on ionizable lipids. Ionizable lipids protonate at low pH, making them positively charged, but remain neutral at physiological pH. They can protonate and become positively charged under physiologically low pH conditions and are safely cleared after mRNA delivery. The pH sensitivity of ionizable lipids is beneficial for in vivo mRNA delivery because neutral lipids interact less with the anion exchange membranes of blood cells, thereby improving the biocompatibility of lipid nanoparticles.

[0007] Therefore, ionizable lipids are a key focus of patent protection. For example, the mRNA vaccines that shone brightly during the COVID-19 pandemic, whose delivery systems primarily consist of ionizable lipids, ALC-0315 (Acuitas / Pfizer) and SM-102 (Moderna), are hydrophilic ionizable lipids with tertiary amine head groups. In the LNP patent field, Arbutus is a leading company, possessing extensive and in-depth patents covering a wide range of ionizable / cationic lipids, encompassing numerous compound structure patents, LNP composition and formulation patents, and application patents.

[0008] Because foreign countries have been involved in the development of ionizable lipids for a longer period, domestic development of ionizable lipids has been restricted by foreign patents. Currently, the main direction for domestic companies to break through patents is to change the head structure and linking groups of ionizable lipids. The main development direction of this patent is to change the lipid chain of ionizable lipids by replacing the fatty chain of the compound with steroidal lipid molecules. Through patent research, a similar structure of cholesterol replacing fatty chain exists in US 9,365,610 B2 patent. However, the head structure of the compound in that patent is different from that of this patent. The head structure used in this patent is an alcoholamine structure similar to ALC-0315 and SM-102. The head structure in US 9,365,610 B2 patent does not contain hydroxyl groups and contains two tertiary amines.

[0009] Nucleic acid delivery has made great strides in recent years. However, gene delivery in the treatment process currently faces many challenges: there is a lack of compounds that can efficiently deliver mRNA in vivo; LNPs prepared from existing compounds have significant side effects when used for mRNA delivery; the synthesis process of ionizable lipids is complex; and there are serious patent barriers for ionizable lipids.

[0010] Therefore, it is necessary to discover novel ionized lipid compounds to address existing technical problems, improve LNP delivery efficiency, and reduce toxicity. Summary of the Invention

[0011] This disclosure provides lipid compounds, including pharmaceutically acceptable salts, prodrugs, or stereoisomers thereof, which can be used alone or in combination with other lipid components, such as neutral lipids, charged lipids, steroids (including, for example, all steroids), and / or their analogues and / or polymers, to form lipid nanoparticles for delivering therapeutic agents (e.g., nucleic acid molecules, including nucleic acid mimics such as locked nucleic acids (LNAs), peptide nucleic acids (PNAs), and morpholinonucleotides). In some cases, said lipid nanoparticles are used to deliver nucleic acids, such as antisense and / or messenger RNA. Methods for treating various diseases or disorders, such as those caused by infectious agents and / or protein deficiency, using such lipid nanoparticles are also provided.

[0012] In a first aspect, this disclosure provides compounds of formula (I):

[0013] Or a pharmaceutically acceptable salt, tautomer, prodrug, or stereoisomer thereof, wherein:

[0014] G 1 and G 2 Each is an independent key, C1-C 12 Alkylene or C2-C 12 alkenyl;

[0015] L 1 -OC(=O)R 1 -C(=O)OR 1 -OC(=O)OR 1 -C(=O)R 1 -OR 1 -S(O) x R 1 -S-SR 1 -C(=O)SR 1 -SC(=O)R 1 -NR a C(=O)R 1 -C(=O)NR b R c -NR a C(=O)NR b R c -OC(=O)NR b R c -NR a C(=O)OR 1-SC(=S)R 1 -C(=S)SR 1 -C(=S)R 1 -CH(OH)R 1 -P(=O)(OR) b (OR) c -(C6-C) 10 (Aspartic)-R 1 -(6 to 10-membered heteroaryl)-R 1 Or R 1 ;

[0016] R 1 For C6-C 24 Alkyl or C6-C 24 alkenyl or C6-C 24 alkynyl group;

[0017] R a and R b Each independently constitutes H, C1-C 12 Alkyl, C2-C 12 alkenyl or C2-C 12 alkynyl group;

[0018] R c For C1-C 32 Alkyl or C2-C 32 alkenyl;

[0019] L 2 -OC(=O)L 3 -C(=O)OL 3 -OC(=O)OL 3 -C(=O)L 3 -OL 3 -CH(OH)L 3 or L 3 ;

[0020] L 3 -R 2 =R 3 =R 4 -R 5 or -R 6 -R 7 or -R 8 -R 9 ;

[0021] R 2 C 3-8 Cycloalkylene, optionally C6 cycloalkylene or R 2 for R d C 3-8Cycloalkylene, optionally C6 cycloalkylene, R e and R f Each independently is H or C 1-12 Alkyl, R 3 For C1-C 12 Alkylene or C2-C 12 Ideonyl, R 4 It is a sub-bicyclic group, and can be selected as a sub-C group. 5-8 cycloalkyl-C 5-8 Cycloalkyl, and more preferably C6-neide-C5 cycloalkyl, R 5 For C2-C 24 Alkyl or C2-C 24 alkenyl or C2-C 24 alkynyl group;

[0022] R 6 It is a bicyclic group, and can be optionally a C6 aryl-C ... 5-8 Heterocyclic alkyl, more preferably C6-aryl-C6 heterocyclic alkyl, R 7 For C6-C 24 Alkyl or C6-C 24 alkenyl or C6-C 24 alkynyl group;

[0023] R 8 For C1-C 24 Alkylene or C2-C 24 alkenyl groups, optionally C6-C 18 Alkylene or C6-C 18 alkenyl group, or C group, can be selected. 10 Alkylene or C 10 Ideonyl, R 9 C 5-8 Cycloalkenyl, optionally C6 cycloalkenyl;

[0024] G 3 It is C1-C 12 Alkylene, optionally C2-C6 alkylene, and more preferably C2-C4 alkylene;

[0025] R 10 It is a hydroxyl group;

[0026] x is 0, 1, or 2; and

[0027] Each of the alkyl, alkenyl, alkynyl, cycloalkyl, heterocycloalkyl, cycloalkenyl, alkylene, alkenylene, arylene, heteroarylene, cycloalkylene, bicycloalkylene, and aryl groups is independently and optionally substituted.

[0028] In a second aspect, this disclosure provides a composition comprising the compound described in the first aspect above, as well as a therapeutic or preventative agent. In one embodiment, the composition further comprises one or more structured lipids. In one embodiment, the one or more structured lipids are selected from DSPCs, steroids, or combinations thereof. In one embodiment, the steroid is cholesterol. In a specific embodiment, the molar ratio of the compound to the DSPC is in the range of 2:1 to about 8:1, optionally about 3:1 to about 5:1, and more preferably about 47.5:10. In a specific embodiment, the molar ratio of the compound to the steroid is in the range of about 5:1 to about 1:1, optionally about 2:1 to about 1:1, and more preferably about 47.5:40.7. In one embodiment, the composition further comprises one or more polymer-bound lipids. In one embodiment, the polymer-bound lipid is DMG-PEG2000 or DMPE-PEG2000. In one specific embodiment, the molar ratio of the compound to the lipid bound to the polymer is in the range of about 100:1 to about 20:1, optionally about 50:1 to about 25:1, and more preferably about 47.5:1.8. In an optional embodiment, the composition comprises the compound described in the first aspect above, DSPC, cholesterol, DMG-PEG2000, and a therapeutic or preventative agent. In one specific embodiment, the ratio of the compound / DMG-PEG2000 / DSPC / cholesterol is 47.5 / 10 / 40.7 / 1.8 (mol%).

[0029] In one embodiment, the therapeutic or preventative agent comprises one or more of the following: small molecule drugs, nucleic acid molecules, and proteins. In one embodiment, the nucleic acid molecule comprises at least one mRNA, siRNA, or nclRNA encoding an antigen or a fragment or epitope thereof. In one embodiment, the mRNA is a monocistronic mRNA. In one embodiment, the mRNA is a polycistronic mRNA. In one embodiment, the antigen is a pathogenic antigen. In one embodiment, the antigen is a tumor-associated antigen. In one embodiment, the mRNA comprises one or more functional nucleotide analogs. In one embodiment, the functional nucleotide analog is one or more of the following: pseudouridine, 1-methyl-pseudouridine, and 5-methylcytosine.

[0030] In one embodiment, the composition is nanoparticles.

[0031] In a third aspect, this disclosure provides a lipid nanoparticle comprising the compound described in the first aspect or the composition described in the second aspect.

[0032] In a fourth aspect, this disclosure provides a pharmaceutical composition comprising the compound described in the first aspect, the composition described in the second aspect, or the lipid nanoparticles described in the third aspect, and a pharmaceutically acceptable excipient or diluent.

[0033] In a fifth aspect, this disclosure provides the use of the lipid nanoparticles described in the third aspect or the pharmaceutical composition described in the fourth aspect above in the preparation of a medicament. In one embodiment, the medicament is a vaccine, such as an oncology, influenza, or rabies vaccine. In one embodiment, the medicament is used to therapeutically or prophylactically enhance the immune response of a subject in need, wherein the subject is a vertebrate, optionally a mammal, such as a goat, cattle, pig, dog, cat, donkey, monkey, ape, rodent such as a mouse, hamster, rabbit, or human. In one embodiment, the medicament is for parenteral administration, and wherein parenteral administration includes injection, such as transmucosal injection, intradermal injection, intravenous injection, intramuscular injection, or subcutaneous injection. In one embodiment, the medicament is for nasal, oral spray, or infusion administration.

[0034] Additional features of this disclosure will become apparent to those skilled in the art upon consideration of the following detailed description of specific embodiments. Attached Figure Description

[0035] To more clearly illustrate the technical solutions in the embodiments of this application or the conventional technology, the drawings used in the description of the embodiments or the conventional technology will be briefly introduced below. Obviously, the drawings described below are only embodiments of this application. For those skilled in the art, other drawings can be obtained based on the disclosed drawings without creative effort.

[0036] Figure 1 is the proton NMR spectrum of compound 1.

[0037] Figure 2 is the 1H NMR spectrum of compound 2.

[0038] Figure 3 is the 1H NMR spectrum of compound 3.

[0039] Figure 4 is the proton NMR spectrum of compound 4.

[0040] Figure 5 is the proton NMR spectrum of compound 5.

[0041] Figure 6 is the 1H NMR spectrum of compound 6.

[0042] Figure 7 is the 1H NMR spectrum of compound 7.

[0043] Figure 8 is the proton NMR spectrum of compound 8.

[0044] Figure 9 shows the fluorescence imaging results of the small animal.

[0045] Figure 10 shows the rate of change in mouse body weight after injection of the LNP formulation.

[0046] Figure 11 is a schematic diagram of the Luciferase fluorescence signal detection principle. Detailed Implementation

[0047] The technical solutions of the embodiments of this application will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of this application, and not all embodiments. Based on the embodiments of this application, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of this application.

[0048] The techniques and procedures described or cited herein include those that are generally well understood and / or commonly used by those skilled in the art using conventional methods, such as the widely used methods described, for example, in Sambrook et al., MolecμLar Cloning: A Laboratory Manual (3rd edition, 2001); Current Protocols in MolecμLar Biology (Ausubel et al., eds., 2003).

[0049] the term

[0050] Unless otherwise described, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. For the purposes of interpreting this specification, the following terminology will be applied, and where appropriate, terms used in the singular will also include the plural form, and vice versa. All patents, applications, published applications, and other publications are incorporated herein by reference in their entirety. If any description of terminology set forth herein conflicts with any document incorporated herein by reference, the terminology set forth herein shall prevail.

[0051] As used herein and unless otherwise stated, the term “lipid” refers to a group of organic compounds, including but not limited to fatty acid esters, and is generally characterized by being poorly soluble in water but soluble in many nonpolar organic solvents. Although lipids are generally weakly water-soluble, certain classes of lipids (e.g., lipids modified with polar groups, such as DMG-PEG2000) have limited water solubility and are soluble in water under certain conditions. Known types of lipids include biomolecules such as fatty acids, waxes, sterols, fat-soluble vitamins, monoglycerides, diglycerides, triglycerides, and phospholipids. Lipids can be classified into at least three categories: (1) “simple lipids,” including fats and oils, as well as waxes; (2) “compound lipids,” including phospholipids and glycolipids (e.g., DMPE-PEG2000); and (3) “derived lipids,” such as steroids. In addition, as used herein, lipids also include lipid-like compounds. The term “lipid-like compounds,” also simply “lipids,” refers to lipid-like compounds (e.g., amphiphilic compounds with lipid-like physical properties).

[0052] The term "lipid nanoparticle" or "LNP" refers to a particle having at least one nanometer (nm) scale size (e.g., 1 to 1,000 nm) containing one or more types of lipid molecules. The LNPs provided herein may further contain at least one non-lipid payload molecule (e.g., one or more nucleic acid molecules). In some embodiments, the LNP comprises a non-lipid payload molecule partially or completely encapsulated within a lipid shell. Specifically, in some embodiments, the payload is a negatively charged molecule (e.g., mRNA encoding a viral protein), and the lipid component of the LNP comprises at least one cationic lipid. Without being bound by theory, it is anticipated that cationic lipids can interact with the negatively charged payload molecule and promote the incorporation and / or encapsulation of the payload into the LNP during LNP formation. Other lipids that can form part of an LNP as provided herein include, but are not limited to, neutral and charged lipids such as steroids, polymer-bound lipids, and various zwitterionic lipids. In some embodiments, the LNPs according to this disclosure comprise one or more lipids of formula (I) (and its sub-formulas) as described herein.

[0053] The term "cationic lipid" refers to a lipid that is positively charged at any pH or hydrogen ion activity in its environment, or is capable of becoming positively charged in response to the pH or hydrogen ion activity of its environment (e.g., the environment in which it is intended for use). Therefore, the term "cationic" encompasses both "permanent cation" and "cationizable." In some embodiments, the positive charge in the cationic lipid originates from the presence of a quaternary nitrogen atom. In some embodiments, the cationic lipid comprises a zwitterionic lipid that is positively charged in the environment in which it is intended for use (e.g., at physiological pH). In some embodiments, the cationic lipid is a lipid of one or more of formulas (I) (and their sub-formulas) as described herein.

[0054] The term "polymer-bound lipid" refers to a molecule that contains both a lipid moiety and a polymer moiety. An example of a polymer-bound lipid is a polyethylene glycol-modified lipid (PEG-lipid), in which the polymer moiety comprises polyethylene glycol.

[0055] The term "neutral lipid" encompasses any lipid molecule that exists in a neutral or zwitterionic form at or within a selected pH value or range. In some embodiments, the selected useful pH value or range corresponds to the pH conditions of the environment in which the lipid is intended to be used, such as physiological pH. As a non-limiting example, neutral lipids that may be used in conjunction with this disclosure include, but are not limited to, phosphatidylcholines such as 1,2-distearyl-sn-glycerol-3-phosphate choline (DSPC), 1,2-dipalmitoyl-sn-glycerol-3-phosphate choline (DPPC), 1,2-dimyristoyl-sn-glycerol-3-phosphate choline (DMPC), 1-palmitoyl-2-oleoyl-sn-glycerol-3-phosphate choline (POPC), and 1,2-dioleoyl-sn-glycerol-3-phosphate choline (DOPC); phosphatidylethanolamines such as 1,2-dioleoyl-sn-glycerol-3-phosphate ethanolamine (DOPE) and 2-((2,3-bis(oleoyloxy)propyl))dimethylammonium)ethyl hydrogen phosphate (DOCP); sphingomyelin (SM); ceramides; and steroids such as sterols and their derivatives. The neutral lipids described herein may be synthetic or derived from natural sources or compounds (from which they are isolated or modified).

[0056] The term "charged lipid" encompasses any lipid molecule present in a positively or negatively charged form at or within a selected pH value or range. In some embodiments, the selected pH value or range corresponds to the pH conditions of the environment in which the lipid is intended for use, such as physiological pH. As a non-limiting example, neutral lipids that may be used in conjunction with this disclosure include, but are not limited to, phosphatidylserine, phosphatidic acid, phosphatidylglycerol, phosphatidylinositol, sterol hemisuccinate, dialkyltrimethylammonium propane (e.g., DOTAP, DOTMA), dialkyldimethylaminopropane, ethylphosphocholine, dimethylaminoethane carbamoyl sterol (e.g., DC-Chol), sodium 1,2-dioleoyl-sn-glycerol-3-phosphate-L-serine (DOPS-Na), sodium 1,2-dioleoyl-sn-glycerol-3-phosphate-(1′-racemic-glycerol) (DOPG-Na), and sodium 1,2-dioleoyl-sn-glycerol-3-phosphate (DOPA-Na). The charged lipids described herein may be synthetic or derived from natural sources or compounds (from which they are isolated or modified).

[0057] As used herein and unless otherwise stated, the term "alkyl" refers to a saturated straight-chain or branched hydrocarbon chain group consisting only of carbon and hydrogen atoms. In one embodiment, the alkyl group has, for example, one to twenty-four carbon atoms (C1-C2). 24 Alkyl groups, with four to twenty carbon atoms (C4-C5). 20 Alkyl groups, with six to sixteen carbon atoms (C6-C6). 16 Alkyl groups, six to nine carbon atoms (C6-C9 alkyl groups), one to fifteen carbon atoms (C1-C9 alkyl groups) 15 Alkyl groups, with one to twelve carbon atoms (C1-C2). 12 Alkyl groups are composed of one to eight carbon atoms (C1-C8 alkyl) or one to six carbon atoms (C1-C6 alkyl) and are connected to the remainder of the molecule by a single bond. Examples of alkyl groups include, but are not limited to, methyl, ethyl, n-propyl, 1-methylethyl (isopropyl), n-butyl, n-pentyl, 1,1-dimethylethyl (tert-butyl), 3-methylhexyl, 2-methylhexyl, etc. Unless otherwise stated, alkyl groups are optionally substituted.

[0058] As used herein and unless otherwise stated, the term "alkenyl" refers to a straight-chain or branched hydrocarbon chain group consisting only of carbon and hydrogen atoms, containing one or more carbon-carbon double bonds. Those skilled in the art will understand that the term "alkenyl" also includes groups having "cis" and "trans" configurations, or having "E" and "Z" configurations. In one embodiment, the alkenyl group has, for example, two to twenty-four carbon atoms (C2-C4). 24 alkenyl), four to twenty carbon atoms (C4-C) 20 alkenyl), six to sixteen carbon atoms (C6-C) 16alkenyl), six to nine carbon atoms (C6-C9 alkenyl), two to fifteen carbon atoms (C2-C9 alkenyl) 15 alkenyl), two to twelve carbon atoms (C2-C) 12 The alkenyl group consists of two to eight carbon atoms (C2-C8 alkenyl) or two to six carbon atoms (C2-C6 alkenyl) and is connected to the rest of the molecule by a single bond. Examples of alkenyl groups include, but are not limited to, vinyl, propenyl, butenyl, pentenyl, pent-1,4-dienyl, etc. Unless otherwise stated, the alkenyl group is optionally substituted.

[0059] As used herein and unless otherwise stated, the term "alkynyl" refers to a straight-chain or branched hydrocarbon chain group consisting only of carbon and hydrogen atoms, containing one or more carbon-carbon triple bonds. In one embodiment, the alkynyl group has, for example, two to twenty-four carbon atoms (C2-C4). 24 Alkyne group), four to twenty carbon atoms (C4-C) 20 Alkyne group, six to sixteen carbon atoms (C6-C) 16 Alkyne group, six to nine carbon atoms (C6-C9 alkynyl), two to fifteen carbon atoms (C2-C9 alkynyl) 15 (Alkyne group), two to twelve carbon atoms (C2-C) 12 The alkynyl group consists of two to eight carbon atoms (C2-C8 alkynyl) or two to six carbon atoms (C2-C6 alkynyl) and is linked to the rest of the molecule by a single bond. Examples of alkynyl groups include, but are not limited to, ethynyl, propynyl, butynyl, and pentyynyl. Unless otherwise stated, the alkynyl group is optionally substituted.

[0060] As used herein and unless otherwise stated, the term "alkylene" or "alkylene chain" refers to a straight-chain or branched divalent hydrocarbon chain in which the remainder of a molecule is attached to a group and is saturated consisting only of carbon and hydrogen. In one embodiment, the alkylene chain has, for example, one to twenty-four carbon atoms (C1-C2). 24 Alkylenes, one to fifteen carbon atoms (C1-C5) 15 Alkylene), one to twelve carbon atoms (C1-C2) 12 Alkylenes (C1-C8 alkylenes), one to eight carbon atoms (C1-C6 alkylenes), one to six carbon atoms (C2-C4 alkylenes), two to four carbon atoms (C1-C2 alkylenes), and one to two carbon atoms (C1-C2 alkylenes). Examples of alkylenes include, but are not limited to, methylene, ethylene, propylene, and n-butylene. The alkylene chain is attached to the rest of the molecule via a single bond and to a group via a single bond. The connection between the alkylene chain and the rest of the molecule and to the group can be via one carbon or any two carbons within the chain. Unless otherwise stated, the alkylene chain is optionally substituted.

[0061] As used herein and unless otherwise stated, the term "alkenyl" refers to a straight-chain or branched divalent hydrocarbon chain that links the remainder of a molecule to a group, consisting only of carbon and hydrogen and containing one or more carbon-carbon double bonds. In one embodiment, the alkenyl group has, for example, two to twenty-four carbon atoms (C2-C4). 24 (alkenyl), two to fifteen carbon atoms (C2-C) 15 (alkenyl), two to twelve carbon atoms (C2-C) 12 The alkenyl group comprises two to eight carbon atoms (C2-C8 alkenyl), two to six carbon atoms (C2-C6 alkenyl), or two to four carbon atoms (C2-C4 alkenyl). Examples of alkenyl groups include, but are not limited to, vinylene, propenylene, and n-butenylene. The alkenyl group is attached to the rest of the molecule via a single or double bond and to a group via a single or double bond. The connection between the alkenyl group and the rest of the molecule and to the group can be via one or any two carbons within the chain. Unless otherwise stated, the alkenyl group is optionally substituted.

[0062] As used herein and unless otherwise stated, the term "ynynyl" refers to a straight-chain or branched divalent hydrocarbon chain in which the remainder of the molecule is attached to a group, consisting only of carbon and hydrogen and containing one or more carbon-carbon triple bonds. In one embodiment, the ynynyl group has, for example, two to twenty-four carbon atoms (C2-C4). 24 (hydantoinyl), two to fifteen carbon atoms (C2-C) 15 (hydantoinyl), two to twelve carbon atoms (C2-C) 12 The ynyl group consists of two to eight carbon atoms (C2-C8 ynyl), two to six carbon atoms (C2-C6 ynyl), or two to four carbon atoms (C2-C4 ynyl). Examples of ynyl groups include, but are not limited to, ethynylene, propynylene, and n-butynylene. The ynyl group is attached to the rest of the molecule via a single or double bond and to a group via a single or double bond. The attachment points of the ynyl group to the rest of the molecule and to the group can be via one or any two carbons within the chain. Unless otherwise stated, the ynyl group is optionally substituted.

[0063] As used herein and unless otherwise stated, the term "aryl" refers to a monocyclic aromatic group and / or a polycyclic monovalent aromatic group containing at least one aromatic hydrocarbon ring. In some embodiments, the aryl group has 6 to 18 ring carbon atoms (C6-C1). 18 aryl), 6 to 14 cyclic carbon atoms (C6-C) 14 (aryl) or 6 to 10 cyclic carbon atoms (C6-C) 10Aryl. Examples of aryl groups include, but are not limited to, phenyl, naphthyl, fluorenyl, azulel, anthraceneyl, phenanthryl, pyrene, biphenyl, and triphenyl. The term "aryl" also refers to a bicyclic, tricyclic, or other polycyclic hydrocarbon ring, wherein at least one ring is an aromatic ring, and the other rings may be saturated, partially unsaturated, or aromatic rings, such as dihydronaphthyl, indene, dihydroindene, or tetrahydronaphthyl (tetralinyl). Unless otherwise stated, aryl groups are optionally substituted.

[0064] As used herein and unless otherwise stated, the term "arylene" refers to a divalent aryl group. Unless otherwise stated, arylene groups are optionally substituted.

[0065] As used herein and unless otherwise stated, the term "heteroaryl" refers to a monocyclic aromatic group and / or a polycyclic aromatic group containing at least one aromatic ring, wherein the at least one aromatic ring contains one or more (e.g., one, two, three, or four) heteroatoms independently selected from O, S, and N. The heteroaryl group may be attached to the host structure at any heteroatom or carbon atom. In some embodiments, the heteroaryl group has 5 to 20, 5 to 15, or 5 to 10 ring atoms. The term "heteroaryl" also refers to bicyclic, tricyclic, or other polycyclic rings, wherein at least one ring is an aromatic ring, and the other rings may be saturated, partially unsaturated, or aromatic rings, wherein at least one aromatic ring contains one or more heteroatoms independently selected from O, S, and N. Examples of monocyclic heteroaryl groups include, but are not limited to, pyrroloyl, pyrazolyl, pyrazolinyl, imidazoyl, oxazolyl, isoxazolyl, thiazoyl, thiadiazoyl, isothiazolyl, furanyl, thiophene, oxadiazolyl, pyridyl, pyrazinyl, pyrimidinyl, pyridazinyl, and triazinyl. Examples of bicyclic heteroaryl groups include, but are not limited to, indolyl, benzothiazoyl, benzooxazolyl, benzothiaphene, quinolinyl, tetrahydroisoquinolinyl, isoquinolinyl, benzimidazolyl, benzopyranyl, indolazinyl, benzofuranyl, isobenzofuranyl, crononeyl, coumarinyl, cinolinyl, quinoxolinyl, indazoleyl, purinyl, pyrrolopyridyl, furanopyridyl, thiophenopyridyl, dihydroisoindolyl, and tetrahydroquinolinyl. Examples of tricyclic heteroaryl groups include, but are not limited to, carbazolyl, benzoindolyl, phenanthrolinel, acridinel, phenanthidyl, and xanthonyl. Unless otherwise stated, heteroaryl groups are optionally substituted.

[0066] As used herein and unless otherwise stated, the term "hybrid" refers to a divalent heteroaryl group. Unless otherwise stated, the heteroaryl group may optionally be substituted.

[0067] As used herein and unless otherwise stated, the term "hypobicyclic group" refers to a divalent, aromatic or non-aromatic, saturated or partially unsaturated bicyclic system sharing two adjacent ring atoms, including hypofenocytic carbocyclic groups and hypofenocytic heterocyclic groups, etc. For example, hypofenocytic carbocyclic groups can be listed...5-8 cycloalkyl-C6 aryl, C6-alkylene 5-8 cycloalkyl-C 3-5 heteroaryl, C 3-7 Heterocyclic alkyl ⇌ C6 aryl, C6-aryl 3-7 Heterocyclic alkyl and C 3-5 heteroaryl, C6-aryl-C6-aryl, C6-aryl 3-5 Heteroaryl-C6 aryl or C-16 aryl 3-5 heteroaryl-C 3-5 heteroaryl, C 5-8 cycloalkyl-C 5-8 Cycloalkyl, C6-neocycloalkyl and C5-cycloalkyl, C6-neoaryl and C 5-8 Heterocyclic alkyl groups, C6-aryl-C6 heterocyclic alkyl groups, etc.

[0068] When a group described herein is referred to as “substituted,” it may be substituted with one or more suitable substituents. Illustrative examples of substituents include, but are not limited to, those found in the exemplary compounds and embodiments provided herein, as well as: halogen atoms such as F, Cl, Br, or I; cyano; oxo (=O); hydroxyl (-OH); alkyl; alkenyl; alkynyl; cycloalkyl; aryl; -(C=O)OR'; -O(C=O)R'; -C(=O)R'; -OR'; -S(O) x R';-S-SR';-C(=O)SR';-SC(=O)R';-NR'R';-NR'C(=O)R';-C(=O)NR'R';-NR'C(=O)NR'R';-OC(=O)NR'R';-NR'C(=O)OR';-NR'S(O) x NR'R';-NR'S(O) x R′; and -S(O) x NR'R', where R' is independently H, C1-C each time it appears. 15 Alkyl or cycloalkyl, and x is 0, 1, or 2. In some embodiments, the substituent is C1-C. 12 Alkyl group. In other embodiments, the substituent is cycloalkyl. In other embodiments, the substituent is halogen, such as fluoro. In other embodiments, the substituent is oxo. In other embodiments, the substituent is hydroxyl. In other embodiments, the substituent is alkoxy (-OR'). In other embodiments, the substituent is carboxyl. In other embodiments, the substituent is amino (-NR'R').

[0069] As used herein and unless otherwise stated, the terms “optionally selected” or “optionally” (e.g., optionally substituted) mean that the event or condition described below may or may not occur, and the description includes both the possibility that the event or condition occurs and the possibility that it does not occur. For example, “optionally substituted alkyl” means that the alkyl group may or may not be substituted, and the description includes both substituted alkyl groups and unsubstituted alkyl groups.

[0070] As used herein and unless otherwise stated, the term "prodrug" for a bioactive compound refers to a compound that can be converted into a bioactive compound under physiological conditions or by solvent degradation. In one embodiment, the term "prodrug" refers to a pharmaceutically acceptable metabolic precursor of a bioactive compound. When a prodrug is administered to a subject in need, it may be inactive but is converted into a bioactive compound in vivo. Prodrugs typically undergo rapid conversion in vivo to produce the parent bioactive compound, for example, by hydrolysis in the blood. Prodrug compounds generally offer advantages of solubility, tissue compatibility, or delayed release in mammalian organisms (see Bundgard, H., Design of Prodrugs (1985), pp. 7–9, pp. 21–24 (Elsevier, Amsterdam)). Discussions on prodrugs are provided in Higuchi, T. et al., ACSSymposium Series, Volume 14; and Bioreversible Carriers in Drug Design, edited by Edward B. Roche, American Pharmaceutical Association and Pergamon Press, 1987.

[0071] In one embodiment, the term "prodrug" is also intended to include any covalently bonded carrier that, when administered to a mammalian subject, releases the active compound in vivo. Prodrugs of a compound can be prepared by modifying functional groups present in the compound in such a way that the modification can be cleaved in a conventional manner or in vivo to yield the parent compound. Prodrugs include compounds in which hydroxyl, amino, or thiol groups are bonded to any group that, when administered to a mammalian subject, cleaves to form a free hydroxyl, free amino, or free thiol group, respectively.

[0072] Examples of prodrugs include, but are not limited to, acetate, formate, and benzoate derivatives of alcohol functional groups or amide derivatives of amine functional groups in the compounds provided herein.

[0073] As used herein and unless otherwise stated, the term "pharmaceutically acceptable salt" includes both acid addition salts and base addition salts.

[0074] Examples of pharmaceutically acceptable acid addition salts include, but are not limited to, hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, and phosphoric acid; and organic acids, such as, but not limited to, acetic acid, 2,2-dichloroacetic acid, adipic acid, alginic acid, ascorbic acid, aspartic acid, benzenesulfonic acid, benzoic acid, 4-acetamidobenzoic acid, camphoric acid, camphor-10-sulfonic acid, decanoic acid, hexanoic acid, caprylic acid, carbonic acid, cinnamic acid, citric acid, and cyclamic acid. (acids), dodecyl sulfate, ethane-1,2-disulfonic acid, ethane sulfonic acid, 2-hydroxyethane sulfonic acid, formic acid, fumaric acid, galactosic acid, gentian acid, glucoheponic acid, gluconic acid, glucuronic acid, glutamic acid, glutamate, 2-oxoglutamate, glycerophosphate, glycolic acid, hippuric acid, isobutyric acid, lactic acid, lactobionic acid, lauric acid, maleic acid, malic acid, malonic acid, mandelic acid, methane sulfonic acid, mucoic acid, naphthalene-1,5-disulfonic acid, naphthalene-2-sulfonic acid, 1-hydroxy-2-naphthoic acid, nicotinic acid, oleic acid, orotic acid, oxalic acid, palmitic acid, papoic acid, propionic acid, pyroglutamic acid, pyruvic acid, salicylic acid, 4-aminosalicylic acid, sebacic acid, stearic acid, succinic acid, tartaric acid, thiocyanate, p-toluenesulfonic acid, trifluoroacetic acid, undecenoic acid, etc.

[0075] Examples of pharmaceutically acceptable base addition salts include, but are not limited to, salts prepared by adding an inorganic or organic base to a free acid compound. Salts derived from inorganic bases include, but are not limited to, sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, and aluminum salts. In one embodiment, the inorganic salt is an ammonium salt, sodium salt, potassium salt, calcium salt, or magnesium salt. Salts derived from organic bases include, but are not limited to, the following: primary, secondary, and tertiary amines; substituted amines, including naturally occurring substituted amines; cyclic amines; and basic ion exchange resins such as ammonia, isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, diethanolamine, ethanolamine, deanol, 2-dimethylaminoethanol, 2-diethylaminoethanol, dicyclohexylamine, lysine, arginine, histidine, caffeine, procaine, hydrabamine, choline, betaine, benzylamine, benzathine, ethylenediamine, glucosamine, methylglucosamine, theobromine, triethanolamine, aminobutanetriol, purine, piperazine, piperidine, N-ethylpiperidine, polyamine resins, etc. In one embodiment, the organic base is isopropylamine, diethylamine, ethanolamine, trimethylamine, dicyclohexylamine, choline, and caffeine.

[0076] The compounds described herein may contain one or more asymmetric centers, and thus may produce enantiomers, diastereomers, and other stereoisomers, which may be defined by absolute stereochemistry as (R)- or (S)-, or for amino acids as (D)- or (L)-. Unless otherwise stated, the compounds described herein are intended to include all such possible isomers, as well as their racemic and optically pure forms. Optically active (+) and (-), (R)- and (S)-, or (D)- and (L)- isomers may be prepared using chiral synthons or chiral reagents, or resolved using conventional techniques such as chromatography and fractional crystallization. Conventional techniques for the preparation / separation of individual enantiomers include chiral synthesis from suitable optically pure precursors or resolution of racemic mixtures (or racemic mixtures of salts or derivatives) using, for example, chiral high-performance liquid chromatography (HPLC). When the compounds described herein contain alkene double bonds or other geometrically asymmetric centers, the compounds are intended to include E and Z geometric isomers, unless otherwise stated. Similarly, it also intends to include all tautomer forms.

[0077] As used herein and unless otherwise stated, the term "isomer" refers to different compounds having the same molecular formula. "Stereoisomers" are isomers that differ only in the spatial arrangement of their atoms. "Restricted rotational isomers" are stereoisomers obtained by restricted rotation around a single bond. "Enantiomers" are a pair of stereoisomers that are non-overlapping mirror images of each other. A mixture of any proportion of a pair of enantiomers may be called a "racemic" mixture. "Diadiaomers" are stereoisomers that have at least two asymmetric atoms but are not mirror images of each other.

[0078] "Stereoisomers" may also include E and Z isomers or mixtures thereof, as well as cis and trans isomers or mixtures thereof. In some embodiments, the compounds described herein are isolated as either E or Z isomers. In other embodiments, the compounds described herein are mixtures of E and Z isomers.

[0079] "Tautomers" refer to the balanced isomers of a compound. The concentration of the isomers will depend on the environment in which the compound is found, and can vary depending on, for example, whether the compound is a solid or in an organic or aqueous solution.

[0080] It should also be noted that the compounds described herein may contain atomic isotopes in non-natural proportions at one or more atoms. For example, the compounds may be radiolabeled with radioactive isotopes, such as tritium ( 3 H), Iodine-125 ( 125 I), sulfur-35( 35 S) or carbon-14 ( 14 C), or it may be enriched by isotopes, such as deuterium (C). 2 H), carbon-13 ( 13C) or nitrogen-15 ( 15 As used herein, an "isotope" is an isotopically enriched compound. The term "isotopic enrichment" means that the isotopic composition of an atom differs from the natural isotopic composition of that atom. "Isotopic enrichment" can also mean that the isotopic composition of at least one atom contained in a compound differs from the natural isotopic composition of that atom. The term "isotopic composition" refers to the amount of each isotope present in a given atom. Radiolabeled and isotopically enriched compounds can be used as therapeutic agents, such as cancer therapeutic agents; research reagents, such as binding analytical reagents; and diagnostic agents, such as in vivo imaging agents. All isotopic variants of the compounds described herein, whether or not radioactive, are intended to be covered within the scope of the embodiments provided herein. In some embodiments, isotopes of the compounds described herein are provided, for example, isotopes enriched in deuterium, carbon-13, and / or nitrogen-15. As used herein, "deuterated" means that at least one hydrogen (H) in a compound has been deuterated (in the form of D or D). 2 H represents substitution, meaning that the compound is rich in deuterium at at least one position.

[0081] It should be noted that if there is a difference between the described structure and the name of the structure, the described structure shall prevail.

[0082] As used herein and unless otherwise stated, the term “pharmaceuticalally acceptable carrier, diluent, or excipient” includes, but is not limited to, any adjuvant, carrier, excipient, gliding agent, sweetener, diluent, preservative, dye / coloring agent, flavor enhancer, surfactant, wetting agent, dispersant, suspending agent, stabilizer, isotonic agent, solvent, or emulsifier approved by the U.S. Food and Drug Administration for acceptable use in humans or livestock.

[0083] The term "composition" is intended to cover products containing optionally specified amounts of a specified ingredient (such as the mRNA molecule provided herein).

[0084] As used interchangeably herein, the terms “polynucleotide” or “nucleic acid” refer to a polymer of nucleotides of any length and include, for example, DNA and RNA. Nucleotides can be deoxyribonucleotides, ribonucleotides, modified nucleotides or bases and / or their analogues, or any substrate that can be incorporated into the polymer by DNA or RNA polymerase or by a synthetic reaction. Polynucleotides may contain modified nucleotides, such as methylated nucleotides and their analogues. Nucleic acids can be single-stranded or double-stranded. As used herein and unless otherwise stated, “nucleic acid” also includes nucleic acid mimics such as locked nucleic acids (LNA), peptide nucleic acids (PNA), and morpholino nucleic acids. As used herein, “oligonucleotide” refers to a short synthetic polynucleotide whose length is generally, but not necessarily, less than about 200 nucleotides. The terms “oligonucleotide” and “polynucleotide” are not mutually exclusive. The above description of polynucleotides applies equally and fully to oligonucleotides. Unless otherwise stated, the left-hand end of any single-stranded polynucleotide sequence disclosed herein is the 5′ end; the left-hand direction of a double-stranded polynucleotide sequence is referred to as the 5′ direction. The direction of addition from 5′ to 3′ to the nascent RNA transcript is called the transcription direction; the region on the DNA strand that has the same sequence as the RNA transcript and is located at the 5′ end relative to the 5′ end of the RNA transcript is called the “upstream sequence”; the region on the DNA strand that has the same sequence as the RNA transcript and is located at the 3′ end relative to the 3′ end of the RNA transcript is called the “downstream sequence”.

[0085] "Isolated nucleic acid" refers to nucleic acid, such as RNA, DNA, or a mixture of nucleic acids, that is substantially isolated from other genomic DNA sequences naturally accompanying their natural sequences, as well as proteins or complexes (such as ribosomes and polymerases). An "isolated" nucleic acid molecule is a nucleic acid molecule isolated from other nucleic acid molecules present in the natural source of the nucleic acid molecule. Furthermore, when manufactured using recombinant technologies, "isolated" nucleic acid molecules, such as mRNA molecules, may be substantially free of other cellular material or culture media, or when chemically synthesized, they may be substantially free of chemical precursors or other chemicals. In certain embodiments, one or more nucleic acid molecules encoding antigens described herein are isolated or purified. The term includes nucleic acid sequences that have been removed from their natural environment and includes recombinant or cloned DNA or RNA isolates, as well as chemically synthesized analogs or analogs biosynthesized from heterologous systems. A substantially pure molecule may include an isolated form of the molecule.

[0086] The term “coding nucleic acid” or its grammatical equivalent, when used to refer to nucleic acid molecules, includes (a) nucleic acid molecules that, when in their natural state or manipulated by methods well known to those skilled in the art, can be transcribed to produce mRNA and subsequently translated into peptides and / or polypeptides; and (b) the mRNA molecule itself. An antisense sequence is a complementary sequence of such nucleic acid molecules from which the coding sequence can be inferred. The term “coding region” refers to the portion of a nucleic acid sequence that is translated into a peptide or polypeptide. The term “untranslated region” or “UTR” refers to the portion of a nucleic acid sequence that is not translated into a peptide or polypeptide. Depending on the orientation of the UTR relative to the coding region of the nucleic acid molecule, a UTR located at the 5′ end of the coding region is called a 5′-UTR, and a UTR located at the 3′ end of the coding region is called a 3′-UTR.

[0087] As used herein, the term "mRNA" refers to a messenger RNA molecule containing one or more open reading frames (ORFs) that can be translated by a cell or organism having said mRNA to produce one or more peptide or protein products. The region containing one or more ORFs is called the coding region of the mRNA molecule. In some embodiments, the mRNA molecule further includes one or more untranslated regions (UTRs).

[0088] In some embodiments, the mRNA is a monocistronic mRNA containing only one ORF. In some embodiments, the monocistronic mRNA encodes a peptide or protein containing at least one epitope of a selected antigen (e.g., a pathogenic antigen or a tumor-associated antigen). In other embodiments, the mRNA is a polycistronic mRNA containing two or more ORFs. In some embodiments, the polycistronic mRNA encodes two or more peptides or proteins that may be the same as or different from each other. In some embodiments, each peptide or protein encoded by the polycistronic mRNA contains at least one epitope of a selected antigen. In some embodiments, the different peptides or proteins encoded by the polycistronic mRNA each contain at least one epitope of a different antigen. In any of the embodiments described herein, the at least one epitope may be at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, or at least ten epitopes of an antigen.

[0089] The term "nucleobase" encompasses purines and pyrimidines, including the natural compounds adenine, thymine, guanine, cytosine, uracil, inosine, and their natural or synthetic analogues or derivatives.

[0090] As used herein, the term "functional nucleotide analog" refers to a modified form of a classical nucleotide A, G, C, U, or T, which (a) retains the base-pairing properties of the corresponding classical nucleotide and (b) contains at least one chemical modification of the corresponding native nucleotide's (i) nucleobase, (ii) glycosyl group, (iii) phosphate ester group, or (iv) any combination of (i) to (iii). As used herein, base pairing encompasses not only classical Watson-Crick adenine-thymine, adenine-uracil, or guanine-cytosine base pairs, but also base pairs formed between a classical nucleotide and a functional nucleotide analog or between a pair of functional nucleotide analogs, wherein the arrangement of the hydrogen bond donor and hydrogen bond acceptor allows for the formation of hydrogen bonds between the modified nucleobase and a classical nucleobase or between two complementary modified nucleobase structures. For example, functional analogs of guanosine (G) retain the ability to pair with functional analogs of cytosine (C) or cytosine. An example of this type of non-classical base pairing is the base pairing between the modified nucleotide inosine and adenine, cytosine, or uracil. As described herein, functional nucleotide analogs can be naturally occurring or non-natural. Therefore, nucleic acid molecules containing functional nucleotide analogs may have at least one modified nucleobase, glycosyl, and / or nucleoside linking. This document provides exemplary chemical modifications to nucleobase, glycosyl, or nucleoside linking in nucleic acid molecules.

[0091] As used herein, the terms “translation enhancer element,” “TEE,” and “translation enhancer” refer to regions in nucleic acid molecules that promote the translation of the coding sequence of the nucleic acid into a protein or peptide product, such as via cap-dependent or cap-independent translation. TEEs are typically located in the UTR region of nucleic acid molecules (e.g., mRNA) and enhance the translation of upstream or downstream coding sequences. For example, a TEE in the 5′-UTR of a nucleic acid molecule may be located between the promoter and start codon of the nucleic acid molecule. Various TEE sequences are known in this technique (Wellensiek et al., Genome-wide profiling of human cap-independent translation-enhancing elements, Nature Methods, Aug 2013; 10(8): 747-750; Chappell et al., PNAS, 29 June 2004, 101(26): 9590-9594). Some TEEs are known to be conserved across multiple species (Pánek et al., Nucleic Acids Research, Vol. 41, No. 16, September 1, 2013, pp. 7625-7634).

[0092] As used herein, the term "stem-loop sequence" refers to a single-stranded polynucleotide sequence having at least two regions that are complementary or substantially complementary to each other when read in opposite directions, and thus capable of base pairing with each other to form at least one double helix and an unpaired loop. The resulting structure is called a stem-loop structure, hairpin, or hairpin loop, and is a secondary structure found in many RNA molecules.

[0093] As used herein, the term "peptide" refers to a polymer containing two to fifty (2-50) amino acid residues linked by one or more covalent peptide bonds. The term applies to naturally occurring amino acid polymers as well as amino acid polymers in which one or more amino acid residues are non-naturally occurring amino acids (e.g., amino acid analogs or non-natural amino acids).

[0094] The terms “peptide” and “protein” are used interchangeably herein to refer to a polymer having more than fifty (50) amino acid residues linked by covalent peptide bonds. That is, the description of a peptide is equally applicable to the description of a protein, and vice versa. The term applies to naturally occurring amino acid polymers as well as amino acid polymers in which one or more amino acid residues are non-naturally occurring amino acids (e.g., amino acid analogs). As used herein, the term covers amino acid chains of any length, including full-length proteins (e.g., antigens).

[0095] The term "antigen" refers to a substance that can be recognized by a subject's immune system (including the adaptive immune system) and can trigger an immune response (including an antigen-specific immune response) upon the subject's exposure to the antigen. In some implementations, the antigen is a protein associated with diseased cells, such as cells infected with pathogens, or neoplastic cells (e.g., tumor-associated antigens (TAAs)).

[0096] In the case of peptides or polypeptides, as used herein, the term "fragment" refers to a peptide or polypeptide containing an amino acid sequence less than its full length. Such fragments may, for example, arise from truncation of the N-terminus, truncation of the C-terminus, and / or internal deletion of residues in the amino acid sequence. Fragments may, for example, be generated by alternative RNA splicing or by in vivo protease activity. In some embodiments, a fragment refers to a polypeptide-containing amino acid sequence comprising at least 5 consecutive amino acid residues, at least 10 consecutive amino acid residues, at least 15 consecutive amino acid residues, at least 20 consecutive amino acid residues, at least 25 consecutive amino acid residues, at least 30 consecutive amino acid residues, at least 40 consecutive amino acid residues, at least 50 consecutive amino acid residues, at least 60 consecutive amino acid residues, at least 70 consecutive amino acid residues, at least 80 consecutive amino acid residues, at least 90 consecutive amino acid residues, or at least 100 consecutive amino acid residues. A polypeptide having an amino acid sequence of at least 125, 150, 175, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, or 950 consecutive amino acid residues. In a particular embodiment, fragments of the polypeptide retain at least one, two, three, or more functions of the polypeptide.

[0097] An epitope is a site on the surface of an antigen molecule that binds to a single antibody molecule, such as a localized region on the surface of an antigen capable of binding to one or more antigen-binding regions of an antibody, and which, in an animal, such as a mammal (e.g., a human), possesses antigenic or immunogenic activity and can elicit an immune response. An immunogenic epitope is the portion of a polypeptide that elicits an antibody response in an animal. An antigenic epitope is the portion of a polypeptide that binds to an antibody by any method known in this art, including, for example, by immunoassay. An antigenic epitope is not necessarily immunogenic. Epitopes typically consist of chemically active surface groups of a molecule, such as amino acids or sugar side chains, and have specific three-dimensional structural features and specific charge features. Antibody epitopes can be linear epitopes or conformational epitopes. Linear epitopes are formed from a continuous amino acid sequence in a protein. Conformational epitopes are formed from amino acids that are discontinuous in the protein sequence but are bound together when the protein folds into its three-dimensional structure. Inducible epitopes are formed when the three-dimensional structure of a protein undergoes a conformational change, such as after activation or binding of another protein or ligand. In some embodiments, an epitope is a three-dimensional surface feature of a polypeptide. In other embodiments, epitopes are linear features of the polypeptide. Generally, antigens have several or many different epitopes and can react with many different antibodies.

[0098] As used herein, the term "genetic vaccine" refers to a therapeutic or prophylactic composition comprising at least one nucleic acid molecule encoding an antigen associated with a target disease (e.g., an infectious or neoplastic disease). Administration of a vaccine to a subject ("vaccination") allows the production of the encoded peptide or protein, thereby evoking an immune response against the target disease in the subject. In some embodiments, the immune response includes adaptive immune responses, such as the production of antibodies against the encoded antigen, and / or the activation and proliferation of immune cells capable of specifically eliminating diseased cells expressing said antigen. In some embodiments, the immune response further includes an innate immune response. According to this disclosure, the vaccine may be administered to a subject before or after the onset of clinical symptoms of the target disease. In some embodiments, vaccination of healthy or asymptomatic subjects renders the vaccinated subject immune or less susceptible to the development of the target disease. In some embodiments, vaccination of subjects exhibiting disease symptoms improves the disease status of the vaccinated subject or treats said disease.

[0099] The terms “innate immune response” and “innate immunity” are recognized in this technique and refer to the non-specific defense mechanisms initiated by the body’s immune system when it recognizes pathogen-associated molecular patterns. These mechanisms involve various forms of cellular activity, including cytokine production and cell death via various pathways. As used herein, the innate immune response includes, but is not limited to, increased production of inflammatory cytokines (e.g., type I interferon or IL-10 production); activation of the NF-κB pathway; increased proliferation, maturation, differentiation, and / or survival of immune cells; and, in some cases, induction of apoptosis. Activation of the innate immune system can be detected using methods known in this technique, such as measuring (NF)-κB activation.

[0100] The terms “adaptive immune response” and “adaptive immunity” are recognized in this art and refer to antigen-specific defense mechanisms initiated by the body’s immune system upon recognizing a specific antigen, including humoral and cell-mediated responses. As used herein, an adaptive immune response includes cellular responses triggered and / or enhanced by a vaccine composition, such as the genetic composition described herein. In some embodiments, the vaccine composition contains an antigen that serves as a target of an antigen-specific adaptive immune response. In other embodiments, the vaccine composition allows the production of an antigen in an immunized subject after administration, said antigen being a target of an antigen-specific adaptive immune response. Activation of an adaptive immune response can be detected using methods known in this art, such as measuring the production of antigen-specific antibodies or the level of antigen-specific cell-mediated cytotoxicity.

[0101] The term "antibody" is intended to include B cell polypeptide products within the immunoglobulin class of polypeptides, capable of binding to a specific molecular antigen, and consisting of two pairs of identical polypeptide chains, each pair having a heavy chain (approximately 50-70 kDa) and a light chain (approximately 25 kDa), each amino-terminal portion of each chain including a variable region containing approximately 100 to approximately 130 or more amino acids, and each carboxyl-terminal portion of each chain including a constant region. See, for example, Antibody Engineering (Borrebaeck, ed., 2nd edition, 1995); and Kuby, Immunology (3rd edition, 1997). In certain embodiments, the specific molecular antigen may be bound by the antibody provided herein, including polypeptides, fragments thereof, or epitopes. Antibodies also include, but are not limited to, synthetic antibodies, recombinant antibodies, camelified antibodies, internal antibodies, anti-idiotype (anti-Id) antibodies, and functional fragments of any of the above, where a functional fragment refers to the retention of the antibody heavy or light chain polypeptide as part of the binding activity of the antibody from which said fragment is derived. Non-limiting examples of functional fragments include single-chain Fv (scFv) (e.g., including monospecific, bispecific, etc.), Fab fragments, F(ab′) fragments, F(ab)2 fragments, F(ab′)2 fragments, disulfide-linked Fv (dsFv), Fd fragments, Fv fragments, bifunctional antibodies, trifunctional antibodies, tetrafunctional antibodies, and microantibodies. Specifically, the antibodies described herein include immunoglobulin molecules and immunoactive portions of immunoglobulin molecules, such as antigen-binding domains or molecules containing antigen-binding sites (e.g., one or more CDRs of an antibody). Such antibody fragments can be found in, for example, Harlow and Lane, Antibodies: A Laboratory Manual (1989); Mol. Biology and Biotechnology: A Comprehensive Desk Reference (Myers, ed., 1995); Huston et al., 1993, Cell Biophysics 22: 189-224; Plüickthun and Skerra, 1989, Meth. Enzymol. 178: 497-515; and Day, Advanced Immunochemistry (2nd edition, 1990). The antibodies presented herein can be any class of immunoglobulin molecules (e.g., IgG, IgE, IgM, IgD, and IgA) or any subclass (e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2).

[0102] The term "application" refers to the act of injecting or otherwise physically delivering a substance present outside the body (such as the lipid nanoparticle composition described herein) into the patient's body, such as via mucosal, intradermal, intravenous, intramuscular delivery, and / or any other physical delivery method described herein or known in this art. When treating a disease, condition, disorder, or symptom thereof, the substance is typically administered after the onset of said disease, condition, disorder, or symptom. When preventing a disease, condition, disorder, or symptom thereof, the substance is typically administered before the onset of said disease, condition, disorder, or symptom.

[0103] "Long-term" administration, as opposed to the acute mode, refers to the continuous administration of one or more agents (e.g., for a period of time, such as days, weeks, months, or years) to maintain the initial therapeutic effect (activity) over a longer period. "Intermittent" administration means that the treatment is not carried out continuously without interruption, but is essentially periodic.

[0104] As used herein, the term “targeted delivery” or the verb form “targeting” refers to a process that promotes the delivery of an agent (such as the therapeutic payload molecule in the lipid nanoparticle composition described herein) to a specific organ, tissue, cell, and / or intracellular compartment (referred to as a target site) relative to delivery to any other organ, tissue, cell, or intracellular compartment (referred to as a non-target site). Targeted delivery can be detected using methods known in the art, for example by comparing the concentration of the delivered agent in a target cell population with the concentration of the delivered agent in a non-target cell population after systemic administration. In some embodiments, targeted delivery results in a concentration at the target site that is at least twice as high as the concentration at the non-target site.

[0105] An "effective amount" is generally an amount sufficient to reduce the severity and / or frequency of symptoms; eliminate symptoms and / or underlying causes; prevent the occurrence of symptoms and / or their underlying causes; and / or improve or remedy damage caused by or associated with a disease, condition, or disorder, including, for example, infection and lesion formation. In some implementations, an effective amount is a therapeutic effective amount or a preventive effective amount.

[0106] As used herein, the term "therapeuticly effective amount" refers to an amount of agent (e.g., a vaccine composition) sufficient to reduce and / or improve the severity and / or duration of a given disease, condition, or ailment, and / or its associated symptoms (e.g., infectious diseases such as those caused by viral infections, or proliferative diseases such as cancer). The "therapeuticly effective amount" of the substances / molecules / agents of this disclosure (e.g., the lipid nanoparticle compositions described herein) can vary depending on a number of factors, such as an individual's disease state, age, sex, and weight, and the ability of the substance / molecule / agent to elicit a desired response in the individual. A therapeutically effective amount includes the amount in which the therapeutically beneficial effect of the substance / molecule / agent outweighs any of its toxic or harmful effects. In some embodiments, the term "therapeuticly effective amount" refers to the amount of the lipid nanoparticle composition described herein, or a therapeutic or preventative agent (e.g., therapeutic mRNA) contained therein, that effectively "treats" a disease, condition, or ailment of a subject or mammal.

[0107] "Prophylactic effective dose" is the amount of a pharmaceutical composition that, when administered to a subject, will have the expected preventive effect, such as preventing a disease, condition, disorder, or related symptoms (e.g., infectious diseases, such as those caused by viral infections, or proliferative disorders, such as cancer), delaying its onset (or recurrence), or reducing the likelihood of its onset (or recurrence). Typically, because the preventive dose is administered to the subject before or at an early stage of the disease, condition, or disorder, the preventive effective dose may be less than the therapeutic effective dose. A complete therapeutic or preventive effect may not occur with a single dose, but may only occur after a series of doses. Therefore, the therapeutic or preventive effective dose may be administered in one or more doses.

[0108] The term "prevention" refers to reducing the likelihood of the onset (or recurrence) of a disease, condition, illness, or related symptoms (such as infectious diseases, like those caused by viral infections, or proliferative diseases, like cancer).

[0109] The term "management" refers to a beneficial effect obtained by a subject from a therapy (e.g., a preventative or therapeutic agent) that does not lead to a cure of the disease. In some embodiments, administering one or more therapies (e.g., preventative or therapeutic agents, such as the lipid nanoparticle compositions described herein) to a subject to "manage" an infectious or neoplastic disease, one or more of its symptoms, thereby preventing the progression or worsening of the disease.

[0110] The term "preventive agent" refers to any agent that can completely or partially suppress the development, recurrence, onset, or spread of a subject's disease and / or related symptoms.

[0111] The term "therapeutic agent" means any agent that can be used to treat, prevent or alleviate a disease, condition or ailment, including any agent used to treat, prevent or alleviate one or more symptoms of a disease, condition or ailment and / or its associated symptoms.

[0112] The term "therapy" refers to any regimen, method, and / or agent that can be used to prevent, manage, treat, and / or improve a disease, condition, or disorder. In some implementations, the term "therapies" refers to biological, supportive, and / or other therapies known to those skilled in the art, such as medical personnel, for the prevention, management, treatment, and / or improvement of a disease, condition, or disorder.

[0113] The term "side effect" encompasses unwanted and / or adverse effects of a therapy (such as a preventative or therapeutic agent). Unwanted effects are not necessarily undesirable. Adverse effects of a therapy (such as a preventative or therapeutic agent) can be harmful, unpleasant, or risky. Examples of side effects include diarrhea, cough, gastroenteritis, wheezing, nausea, vomiting, anorexia, abdominal cramps, fever, pain, weight loss, dehydration, hair loss, difficulty breathing, insomnia, dizziness, mucositis, neuromuscular effects, fatigue, dry mouth, loss of appetite, rash or swelling at the application site, flu-like symptoms such as fever, chills, and fatigue, digestive problems, and allergic reactions. Numerous other undesirable effects experienced by patients are known in this technology. Many effects are described in the Physician's Desk Reference (68th edition, 2014).

[0114] The terms "subject" and "patient" are used interchangeably. As used herein, in some embodiments, the subject is a mammal, such as a non-primate (e.g., cow, pig, horse, cat, dog, rat, etc.) or a primate (e.g., monkey and human). In a particular embodiment, the subject is a human. In one embodiment, the subject is a mammal (e.g., a human) suffering from an infectious disease or a neoplastic disease. In another embodiment, the subject is a mammal (e.g., a human) at risk of developing an infectious disease or a neoplastic disease.

[0115] "Substantially all" means at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or about 100%.

[0116] As used herein and unless otherwise stated, the terms “about” or “approximately” mean an acceptable error in a particular value determined by a person skilled in the art, depending in part on the method by which the value is measured or determined. In some embodiments, the terms “about” or “approximately” mean within 1, 2, 3, or 4 standard deviations. In some embodiments, the terms “about” and “approximately” mean within 20%, 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.05%, or less of a given value or range.

[0117] Unless the context clearly indicates otherwise, the singular terms “a” and “described” as used herein include plural references.

[0118] All publications, patent applications, registration numbers, and other references cited in this specification are incorporated herein by reference in their entirety as if each individual publication or patent application were specifically and individually incorporated by reference. The publications discussed herein provide only those published prior to the filing date of this application. Nothing herein should be construed as an admission that the invention is not entitled to precedence over such publications. Furthermore, the publication dates provided may differ from the actual publication dates, which may require independent verification.

[0119] Several embodiments of the invention have been described. However, it should be understood that various modifications can be made without departing from the spirit and scope of the invention. Therefore, the descriptions in the experimental sections and examples are intended to illustrate, and not limit, the scope of the invention as described in the claims.

[0120] lipid compounds

[0121] In a first aspect, this disclosure provides compounds of formula (I):

[0122] Or a pharmaceutically acceptable salt, tautomer, prodrug, or stereoisomer thereof, wherein:

[0123] G 1 and G 2 Each is an independent key, C1-C 12 Alkylene or C2-C 12 alkenyl;

[0124] L 1 -OC(=O)R 1 -C(=O)OR 1 -OC(=O)OR 1 -C(=O)R 1-OR 1 -S(O) x R 1 -S-SR 1 -C(=O)SR 1 -SC(=O)R 1 -NR a C(=O)R 1 -C(=O)NR b R c -NR a C(=O)NR b R c -OC(=O)NR b R c -NR a C(=O)OR 1 -SC(=S)R 1 -C(=S)SR 1 -C(=S)R 1 -CH(OH)R 1 -P(=O)(OR) b (OR) c -(C6-C) 10 (Aspartic)-R 1 -(6 to 10-membered heteroaryl)-R 1 Or R 1 ;

[0125] R 1 For C6-C 24 Alkyl or C6-C 24 alkenyl or C6-C 24 alkynyl group;

[0126] R a and R b Each independently constitutes H, C1-C 12 Alkyl, C2-C 12 alkenyl or C2-C 12 alkynyl group;

[0127] R c For C1-C 32 Alkyl or C2-C 32 alkenyl;

[0128] L 2 -OC(=O)L 3 -C(=O)OL 3 -OC(=O)OL 3 -C(=O)L 3 -OL 3 -CH(OH)L 3 or L3 ;

[0129] L 3 -R 2 =R 3 =R 4 -R 5 or -R 6 -R 7 or -R 8 -R 9 ;

[0130] R 2 C 3-8 Cycloalkylene, optionally C6 cycloalkylene or R 2 for R d C 3-8 Cycloalkylene, optionally C6 cycloalkylene, R e and R f Each independently is H or C 1-12 Alkyl, R 3 For C1-C 12 Alkylene or C2-C 12 Ideonyl, R 4 It is a sub-bicyclic group, and can be selected as a sub-C group. 5-8 cycloalkyl-C 5-8 Cycloalkyl, and more preferably C6-neide-C5 cycloalkyl, R 5 For C2-C 24 Alkyl or C2-C 24 alkenyl or C2-C 24 alkynyl group;

[0131] R 6 It is a bicyclic group, and can be optionally a C6 aryl-C ... 5-8 Heterocyclic alkyl, more preferably C6-aryl-C6 heterocyclic alkyl, R 7 For C6-C 24 Alkyl or C6-C 24 alkenyl or C6-C 24 alkynyl group;

[0132] R 8 For C1-C 24 Alkylene or C2-C 24 alkenyl groups, optionally C6-C 18 Alkylene or C6-C 18 alkenyl group, or C group, can be selected. 10 Alkylene or C 10 Ideonyl, R 9 C 5-8 Cycloalkenyl, optionally C6 cycloalkenyl;

[0133] G 3It is C1-C 12 Alkylene, optionally C2-C6 alkylene, and more preferably C2-C4 alkylene;

[0134] R 10 It is a hydroxyl group;

[0135] x is 0, 1, or 2; and

[0136] Each of the alkyl, alkenyl, alkynyl, cycloalkyl, heterocycloalkyl, cycloalkenyl, alkylene, alkenylene, arylene, heteroarylene, cycloalkylene, bicycloalkylene, and aryl groups is independently and optionally substituted.

[0137] In one implementation, G 1 It is a key. In one implementation, G 2 It is a key. In one implementation, G 1 and G 2 All are keys.

[0138] In one implementation, G 1 and G 2 Each independently is C2-C 12 Alkylene or C2-C 12 alkenyl group. In one embodiment, G 1 and G 2 Each independently is C2-C 12 Alkylene. In one embodiment, G 1 and G 2 Each independently is C2-C 12 alkenyl group. In one embodiment, G 1 and G 2 Each is independently a C3-C8 alkylene group. In one embodiment, G 1 and G 2 Each is independently a C6-C8 alkylene group. In one embodiment, G 1 It is a C6 alkylene group and G 2 It is a C6 alkylene group. In one embodiment, G 1 It is a C6 alkylene group and G 2 It is a C7 alkylene group. In one embodiment, G 1 It is a C6 alkylene group and G 2 It is a C8 alkylene group. In one embodiment, G 1 It is a C7 alkylene and G 2 It is a C6 alkylene group. In one embodiment, G 1 It is a C7 alkylene and G 2 It is a C7 alkylene group. In one embodiment, G 1 It is a C7 alkylene and G 2 It is a C8 alkylene group. In one embodiment, G1 It is a C8 alkylene and G 2 It is a C6 alkylene group. In one embodiment, G 1 It is a C8 alkylene and G 2 It is a C7 alkylene group. In one embodiment, G 1 It is a C8 alkylene and G 2 It is a C8 alkylene group.

[0139] In one implementation, G 1 Unreplaced. In one implementation, G 1 Replaced. In one implementation, G 1 Substitution with -OH. In one embodiment, G 1 via (another) L 1 Replacement (i.e., G) 1 Connect to two L 1 ).

[0140] In one implementation, G 2 Unreplaced. In one implementation, G 2 Replaced. In one implementation, G 2 Substitution with -OH. In one embodiment, G 2 via (another) L 2 Replacement (i.e., G) 2 Connect to two L 2 ).

[0141] In one implementation, G 1 for In one implementation, G 1 for

[0142] In one implementation, G 2 for In one implementation, G 2 for

[0143] In one implementation, L 1 It is -OC(=O)R 1 -C(=O)OR 1 -OC(=O)OR 1 -C(=O)R 1 -OR 1 -S(O) x R 1 -S-SR 1 -C(=O)SR 1 -SC(=O)R 1 -NR aC(=O)R 1 -C(=O)NR b R c -NR a C(=O)NR b R c -OC(=O)NR b R c -NR a C(=O)OR 1 -SC(=S)R 1 -C(=S)SR 1 -C(=S)R 1 -CH(OH)R 1 or -P(=O)(OR) b (OR) c In one implementation, L 1 Yes - (C6-C 10 (Aspartic)-R 1 In one implementation, L 1 It is -(6 to 10-membered heteroaryl)-R 1 In one implementation, L 1 It is R 1 .

[0144] In one implementation, L 1 It is -OC(=O)R 1 -C(=O)OR 1 -C(=O)SR 1 -SC(=O)R 1 -NR a C(=O)R 1 or -C(=O)NR b R c In one implementation, L 1 It is -OC(=O)R 1 -C(=O)OR 1 -NR a C(=O)R 1 or -C(=O)NR b R c In one implementation, L 1 It is -OC(=O)R 1 In one implementation, L 1 It is -C(=O)OR 1 In one implementation, L 1 Yes -NR a C(=O)R 1 In one implementation, L 1 It is -C(=O)NRb R c In one implementation, L 1 Yes -NR a C(=O)NR b R c In one implementation, L 1 It is -OC(=O)NR b R c In one implementation, L 1 Yes -NR a C(=O)OR 1 In one implementation, L 1 It is -OC(=O)OR 1 .

[0145] In one implementation, R 1 For straight chain C6-C 24 Alkyl group. In one embodiment, R 1 It is a straight chain C 10 -C 20 Alkyl group. In one embodiment, R 1 It is a straight chain C 15 -C 17 Alkyl group. In one embodiment, R 1 It is a straight-chain C7 alkyl group. In one embodiment, R 1 It is a straight-chain C8 alkyl group. In one embodiment, R 1 It is a straight-chain C9 alkyl group. In one embodiment, R 1 It is a straight chain C 10 Alkyl group. In one embodiment, R 1 It is a straight chain C 11 Alkyl group. In one embodiment, R 1 It is a straight chain C 12 Alkyl group. In one embodiment, R 1 It is a straight chain C 13 Alkyl group. In one embodiment, R 1 It is a straight chain C 14 Alkyl group. In one embodiment, R 1 It is a straight chain C 15 Alkyl group. In one embodiment, R 1 It is a straight chain C 16 Alkyl group. In one embodiment, R 1 It is a straight chain C 17 Alkyl group. In one embodiment, R 1 It is a straight chain C 18 Alkyl group. In one embodiment, R 1 It is a straight chain C 19 Alkyl group. In one embodiment, R1 It is a straight chain C 20 alkyl.

[0146] In one implementation, R 1 For straight chain C6-C 24 Alkenyl. In one embodiment, R 1 It is a straight chain C 10 -C 20 Alkenyl. In one embodiment, R 1 It is a straight chain C 15 -C 17 Alkenyl. In one embodiment, R 1 It is a straight-chain C7 alkenyl group. In one embodiment, R 1 It is a straight-chain C8 alkenyl group. In one embodiment, R 1 It is a straight-chain C9 alkenyl group. In one embodiment, R 1 It is a straight chain C 10 Alkenyl. In one embodiment, R 1 It is a straight chain C 11 Alkenyl. In one embodiment, R 1 It is a straight chain C 12 Alkenyl. In one embodiment, R 1 It is a straight chain C 13 Alkenyl. In one embodiment, R 1 It is a straight chain C 14 Alkenyl. In one embodiment, R 1 It is a straight chain C 15 Alkenyl. In one embodiment, R 1 It is a straight chain C 16 Alkenyl. In one embodiment, R 1 It is a straight chain C 17 Alkenyl. In one embodiment, R 1 It is a straight chain C 18 Alkenyl. In one embodiment, R 1 It is a straight chain C 19 Alkenyl. In one embodiment, R 1 It is a straight chain C 20 Alkenyl group.

[0147] In one implementation, R 1 For branch C6-C 24 Alkyl group. In one embodiment, R 1 It is a branch C 10 -C 20 Alkyl group. In one embodiment, R 1 It is a branch C 15 -C 17 Alkyl group. In one embodiment, R 1 Yes -Rg -CH(R h (R) i ), where R g It is a C0-C5 alkylene group, and R h and R i Independently for C2-C 10 Alkyl group. In one embodiment, R 1 Yes -R g -CH(R h (R) i ), where R g It is a C0-C1 alkylene group, and R h and R i Independently, it is a C4-C8 alkyl group. In one embodiment, R 1 Yes -R g -CH(R h (R) i ), where R g It is a C0 alkylene group, and R h and R i They are C8 alkyl and C6 alkyl, respectively. In one embodiment, R... 1 Yes -R g -CH(R h (R) i ), where R g It is a C0 alkylene group, and R h and R i All are C8 alkyl groups.

[0148] In one implementation, R 1 It is a branched chain C6-C 24 Alkenyl. In one embodiment, R 1 Yes -R g -CH(R h (R) i ), where R g It is a C0-C5 alkylene group, and R h and R i Independently for C2-C 10 Alkenyl. In one embodiment, R 1 Yes -R g -CH(R h (R) i ), where R g It is a C0-C1 alkylene group, and R h and R i Independently for C6-C 10 Alkenyl group.

[0149] In one implementation, L 1 for

[0150] In one implementation, L 1 for

[0151] In one implementation, L 1 for

[0152] In one implementation, L 1 for

[0153] In one implementation, L 1 for

[0154] In one implementation, L 1 for

[0155] In one implementation, L 1 for

[0156] In one implementation, L 1 for

[0157] In one implementation, L 2 -OC(=O)L 3 In one implementation, L 2 -C(=O)OL 3 In one implementation, L 2 -OC(=O)OL 3 In one implementation, L 2 -C(=O)L 3 In one implementation, L 2 For -OL 3 In one implementation, L 2 -CH(OH)L 3 In one implementation, L 2 For L 3 .

[0158] In one implementation, L 3 -R 2 =R 3 =R 4 -R 5 .

[0159] In one implementation, L 2 -C(=O)OL 3 And L 3 -R 2 =R3 =R 4 -R 5 .

[0160] In one implementation, R 2 C 3-8 Cycloalkylene. In one embodiment, R 2 It is a C3 cycloalkylene group. In one embodiment, R 2 It is a C4 cycloalkylene group. In one embodiment, R 2 It is a C5 cycloalkylene group. In one embodiment, R 2 It is a C6 cycloalkylene group. In one embodiment, R 2 It is a C7 cycloalkylene group. In one embodiment, R 2 It is a C8 cycloalkylene group.

[0161] In one implementation, R 2 for Where R d C 3-8 Cycloalkylene, R e and R f Each independently is H or C 1-12 Alkyl group. In one embodiment, R d It is a C3 cycloalkylene group. In one embodiment, R d It is a C4 cycloalkylene group. In one embodiment, R d It is a C5 cycloalkylene group. In one embodiment, R d It is a C6 cycloalkylene group. In one embodiment, R d It is a C7 cycloalkylene group. In one embodiment, R d It is a C8 cycloalkylene group. In one embodiment, R e For H. In one implementation, R e For C1-C 10 Alkyl group. In one embodiment, R e It is a C1-C8 alkyl group. In one embodiment, R e It is a C1-C6 alkyl group. In one embodiment, R e It is a C1-C4 alkyl group. In one embodiment, R e It is a C1-C2 alkyl group. In one embodiment, R e It is methyl. In one embodiment, R e It is ethyl. In one embodiment, R e It is propyl. In one implementation, R e It is n-butyl. In one implementation, R e It is an autogenous base. In one implementation, R eIt is octylene. In one implementation, R e It is a non-non-based compound. In one implementation, R f For H. In one implementation, R e For C1-C 10 Alkyl group. In one embodiment, R f It is a C1-C8 alkyl group. In one embodiment, R f It is a C1-C6 alkyl group. In one embodiment, R f It is a C1-C4 alkyl group. In one embodiment, R f It is a C1-C2 alkyl group. In one embodiment, R f It is methyl. In one embodiment, R f It is ethyl. In one embodiment, R f It is propyl. In one implementation, R f It is n-butyl. In one implementation, R f It is an autogenous base. In one implementation, R f It is octylene. In one implementation, R f It is a non-nonyl basis. In one implementation, R 2 for Where R d It is a C6 cycloalkylene group, R e and R f Both are H. In one implementation, R 2 for R a’ R b’ R c’ R d’ R e’ Independently selected from H, C1-C6 alkyl. In one embodiment, R 2 for

[0162] In one implementation, R 3 For C1-C 12 Alkylene. In one embodiment, R 3 It is a C1 alkylene group. In one embodiment, R 3 It is a C2 alkylene group. In one embodiment, R 3 It is a C3 alkylene group. In one embodiment, R 3 It is a C4 alkylene group. In one embodiment, R 3 It is a C5 alkylene group. In one embodiment, R 3 It is a C6 alkylene group. In one embodiment, R 3 It is a C7 alkylene group. In one embodiment, R 3It is a C8 alkylene group. In one embodiment, R 3 It is a C9 alkylene group. In one embodiment, R 3 C 10 Alkylene. In one embodiment, R 3 C 11 Alkylene. In one embodiment, R 3 C 12 Alkylene.

[0163] In one implementation, R 3 For C1-C 12 alkenyl group. In one embodiment, R 3 It is a C1-olefinic group. In one embodiment, R 3 It is C2-olefinic. In one embodiment, R 3 It is a C3-olefinic group. In one embodiment, R 3 It is a C4 alkenyl group. In one embodiment, R 3 It is C5-olefinic. In one embodiment, R 3 It is C6-olefinic. In one embodiment, R 3 It is C7-olefinic. In one embodiment, R 3 It is C8-olefinic. In one embodiment, R 3 It is C9-olefinic. In one embodiment, R 3 C 10 alkenyl group. In one embodiment, R 3 C 11 alkenyl group. In one embodiment, R 3 C 12 Alkenyl group.

[0164] In one implementation, R 3 for

[0165] In one implementation, R 4 It is a subbicyclic group. In one embodiment, R 4 For Asia C 5-8 cycloalkyl-C 5-8 Cycloalkyl. In one embodiment, R 4 It is a C6-neide cycloalkylene and a C5-cycloalkylene oxide. In one embodiment, R 4 for R f’ R g’ R h’ R i’ R j’ R k’ R l’ Rm’ Independently selected from H, C1-C6 alkyl. In one embodiment, R 4 for R f’ R g’ R h’ R i’ R j’ R k’ R l’ R m’ Independently selected from H, methyl. In one embodiment, R 4 for

[0166] In one implementation, R 5 For straight chain C2-C 24 Alkyl group. In one embodiment, R 5 It is a straight-chain C6-C 16 Alkyl group. In one embodiment, R 5 It is a straight-chain C8-C9 alkyl group. In one embodiment, R 5 It is a straight-chain C2 alkyl group. In one embodiment, R 5 It is a straight-chain C3 alkyl group. In one embodiment, R 5 It is a straight-chain C4 alkyl group. In one embodiment, R 5 It is a straight-chain C5 alkyl group. In one embodiment, R 5 It is a straight-chain C6 alkyl group. In one embodiment, R 5 It is a straight-chain C7 alkyl group. In one embodiment, R 5 It is a straight-chain C8 alkyl group. In one embodiment, R 5 It is a straight-chain C9 alkyl group. In one embodiment, R 5 It is a straight chain C 10 Alkyl group. In one embodiment, R 5 It is a straight chain C 11 Alkyl group. In one embodiment, R 5 It is a straight chain C 12 Alkyl group. In one embodiment, R 5 It is a straight chain C 13 Alkyl group. In one embodiment, R 5 It is a straight chain C 14 Alkyl group. In one embodiment, R 5 It is a straight chain C 15 Alkyl group. In one embodiment, R 5 It is a straight chain C 16 Alkyl group. In one embodiment, R 5 It is a straight chain C 17 Alkyl group. In one embodiment, R 5It is a straight chain C 18 Alkyl group. In one embodiment, R 5 It is a straight chain C 19 Alkyl group. In one embodiment, R 5 It is a straight chain C 20 Alkyl group. In one embodiment, R 5 It is a straight chain C 21 Alkyl group. In one embodiment, R 5 It is a straight chain C 22 Alkyl group. In one embodiment, R 5 It is a straight chain C 23 Alkyl group. In one embodiment, R 5 It is a straight chain C 24 alkyl.

[0167] In one implementation, R 5 For straight chain C2-C 24 Alkenyl. In one embodiment, R 5 It is a straight-chain C6-C 16 Alkenyl. In one embodiment, R 5 It is a straight-chain C8-C9 alkenyl group. In one embodiment, R 5 It is a straight-chain C2-olefin. In one embodiment, R 5 It is a straight-chain C3 alkenyl group. In one embodiment, R 5 It is a straight-chain C4 alkenyl group. In one embodiment, R 5 It is a straight-chain C5 alkenyl group. In one embodiment, R 5 It is a straight-chain C6 alkenyl group. In one embodiment, R 5 It is a straight-chain C7 alkenyl group. In one embodiment, R 5 It is a straight-chain C8 alkenyl group. In one embodiment, R 5 It is a straight-chain C9 alkenyl group. In one embodiment, R 5 It is a straight chain C 10 Alkenyl. In one embodiment, R 5 It is a straight chain C 11 Alkenyl. In one embodiment, R 5 It is a straight chain C 12 Alkenyl. In one embodiment, R 5 It is a straight chain C 13 Alkenyl. In one embodiment, R 5 It is a straight chain C 14 Alkenyl. In one embodiment, R 5 It is a straight chain C 15 Alkenyl. In one embodiment, R 5 It is a straight chain C 16 Alkenyl. In one embodiment, R 5It is a straight chain C 17 Alkenyl. In one embodiment, R 5 It is a straight chain C 18 Alkenyl. In one embodiment, R 5 It is a straight chain C 19 Alkenyl. In one embodiment, R 5 It is a straight chain C 20 Alkenyl. In one embodiment, R 5 It is a straight chain C 21 Alkenyl. In one embodiment, R 5 It is a straight chain C 22 Alkenyl. In one embodiment, R 5 It is a straight chain C 23 Alkenyl. In one embodiment, R 5 It is a straight chain C 24 Alkenyl group.

[0168] In one implementation, R 5 For branch C2-C 24 Alkyl group. In one embodiment, R 5 It is a branched chain C6-C 16 Alkyl group. In one embodiment, R 5 It is a branched C8-C9 alkyl group. In one embodiment, R 5 It is a branched C2 alkyl group. In one embodiment, R 5 It is a branched C3 alkyl group. In one embodiment, R 5 It is a branched C4 alkyl group. In one embodiment, R 5 It is a branched C5 alkyl group. In one embodiment, R 5 It is a branched C6 alkyl group. In one embodiment, R 5 It is a branched C7 alkyl group. In one embodiment, R 5 It is a branched C8 alkyl group. In one embodiment, R 5 It is a branched C9 alkyl group. In one embodiment, R 5 It is a branch C 10 Alkyl group. In one embodiment, R 5 It is a branch C 11 Alkyl group. In one embodiment, R 5 It is a branch C 12 Alkyl group. In one embodiment, R 5 It is a branch C 13 Alkyl group. In one embodiment, R 5 It is a branch C 14 Alkyl group. In one embodiment, R 5 It is a branch C 15 Alkyl group. In one embodiment, R 5It is a branch C 16 Alkyl group. In one embodiment, R 5 It is a branch C 17 Alkyl group. In one embodiment, R 5 It is a branch C 18 Alkyl group. In one embodiment, R 5 It is a branch C 19 Alkyl group. In one embodiment, R 5 It is a branch C 20 Alkyl group. In one embodiment, R 5 It is a branch C 21 Alkyl group. In one embodiment, R 5 It is a branch C 22 Alkyl group. In one embodiment, R 5 It is a branch C 23 Alkyl group. In one embodiment, R 5 It is a branch C 24 Alkyl group. In one embodiment, R 5 for

[0169] In one implementation, R 5 For branch C2-C 24 Alkenyl. In one embodiment, R 5 It is a branched chain C6-C 16 Alkenyl. In one embodiment, R 5 It is a branched C8-C9 alkenyl group. In one embodiment, R 5 It is a branched C2-olefin. In one embodiment, R 5 It is a branched C3 alkenyl group. In one embodiment, R 5 It is a branched C4 alkenyl group. In one embodiment, R 5 It is a branched C5 alkenyl group. In one embodiment, R 5 It is a branched C6 alkenyl group. In one embodiment, R 5 It is a branched C7 alkenyl group. In one embodiment, R 5 It is a branched C8 alkenyl group. In one embodiment, R 5 It is a branched C9 alkenyl group. In one embodiment, R 5 It is a branch C 10 Alkenyl. In one embodiment, R 5 It is a branch C 11 Alkenyl. In one embodiment, R 5 It is a branch C 12 Alkenyl. In one embodiment, R 5 It is a branch C 13 Alkenyl. In one embodiment, R 5 It is a branch C14 Alkenyl. In one embodiment, R 5 It is a branch C 15 Alkenyl. In one embodiment, R 5 It is a branch C 16 Alkenyl. In one embodiment, R 5 It is a branch C 17 Alkenyl. In one embodiment, R 5 It is a branch C 18 Alkenyl. In one embodiment, R 5 It is a branch C 19 Alkenyl. In one embodiment, R 5 It is a branch C 20 Alkenyl. In one embodiment, R 5 It is a branch C 21 Alkenyl. In one embodiment, R 5 It is a branch C 22 Alkenyl. In one embodiment, R 5 It is a branch C 23 Alkenyl. In one embodiment, R 5 It is a branch C 24 Alkenyl. In one embodiment, R 5 yes

[0170] In one implementation, L 3 for:

[0171] R a’ R b’ R c’ R d’ R e’ Independently selected from H, C1-C6 alkyl, and

[0172] R f’ R g’ R h’ R i’ R j’ R k’ R l’ R m’ Independently selected from H, C1-C6 alkyl groups.

[0173] In one implementation, L 3 for:

[0174] In one implementation, L 3 for:

[0175] In one implementation, L 3-R 6 -R 7 .

[0176] In one implementation, L 2 -C(=O)OL 3 L 3 -R 6 -R 7 .

[0177] In one implementation, R 6 It is a subbicyclic group. In one embodiment, R 6 For C6 aryl and C 5-8 Heterocyclic alkyl. In one embodiment, R 6 It is a C6-aryl-C6 heterocyclic alkyl group. In one embodiment, R 6 for R n’ R o’ R p’ R q’ R r’ R s’ Independently selected from H, C1-C6 alkyl groups. In one embodiment, R 6 for R n’ R o’ R p’ R q’ R r’ R s’ Independently selected from H, methyl. In one embodiment, R 6 for

[0178] In one implementation, R 7 For straight chain C6-C 24 Alkyl group. In one embodiment, R 7 For straight chain C 12 -C 18 Alkyl group. In one embodiment, R 7 It is a straight-chain C6 alkyl group. In one embodiment, R 7 It is a straight-chain C7 alkyl group. In one embodiment, R 7 It is a straight-chain C8 alkyl group. In one embodiment, R 7 It is a straight-chain C9 alkyl group. In one embodiment, R 7 It is a straight chain C 10 Alkyl group. In one embodiment, R 7 It is a straight chain C 11 Alkyl group. In one embodiment, R 7 It is a straight chain C 12Alkyl group. In one embodiment, R 7 It is a straight chain C 13 Alkyl group. In one embodiment, R 7 It is a straight chain C 14 Alkyl group. In one embodiment, R 7 It is a straight chain C 15 Alkyl group. In one embodiment, R 7 It is a straight chain C 16 Alkyl group. In one embodiment, R 7 It is a straight chain C 17 Alkyl group. In one embodiment, R 7 It is a straight chain C 18 Alkyl group. In one embodiment, R 7 It is a straight chain C 19 Alkyl group. In one embodiment, R 7 It is a straight chain C 20 Alkyl group. In one embodiment, R 7 It is a straight chain C 21 Alkyl group. In one embodiment, R 7 It is a straight chain C 22 Alkyl group. In one embodiment, R 7 It is a straight chain C 23 Alkyl group. In one embodiment, R 7 It is a straight chain C 24 alkyl.

[0179] In one implementation, R 7 For straight chain C6-C 24 Alkenyl. In one embodiment, R 7 For straight chain C 12 -C 18 Alkenyl. In one embodiment, R 7 It is a straight-chain C6 alkenyl group. In one embodiment, R 7 It is a straight-chain C7 alkenyl group. In one embodiment, R 7 It is a straight-chain C8 alkenyl group. In one embodiment, R 7 It is a straight-chain C9 alkenyl group. In one embodiment, R 7 It is a straight chain C 10 Alkenyl. In one embodiment, R 7 It is a straight chain C 11 Alkenyl. In one embodiment, R 7 It is a straight chain C 12 Alkenyl. In one embodiment, R 7 It is a straight chain C 13 Alkenyl. In one embodiment, R 7 It is a straight chain C 14 Alkenyl. In one embodiment, R7 It is a straight chain C 15 Alkenyl. In one embodiment, R 7 It is a straight chain C 16 Alkenyl. In one embodiment, R 7 It is a straight chain C 17 Alkenyl. In one embodiment, R 7 It is a straight chain C 18 Alkenyl. In one embodiment, R 7 It is a straight chain C 19 Alkenyl. In one embodiment, R 7 It is a straight chain C 20 Alkenyl. In one embodiment, R 7 It is a straight chain C 21 Alkenyl. In one embodiment, R 7 It is a straight chain C 22 Alkenyl. In one embodiment, R 7 It is a straight chain C 23 Alkenyl. In one embodiment, R 7 It is a straight chain C 24 Alkenyl group.

[0180] In one implementation, R 7 For branch C6-C 24 Alkyl group. In one embodiment, R 7 For branch C 12 -C 18 Alkyl group. In one embodiment, R 7 It is a branched C6 alkyl group. In one embodiment, R 7 It is a branched C7 alkyl group. In one embodiment, R 7 It is a branched C8 alkyl group. In one embodiment, R 7 It is a branched C9 alkyl group. In one embodiment, R 7 It is a branch C 10 Alkyl group. In one embodiment, R 7 It is a branch C 11 Alkyl group. In one embodiment, R 7 It is a branch C 12 Alkyl group. In one embodiment, R 7 It is a branch C 13 Alkyl group. In one embodiment, R 7 It is a branch C 14 Alkyl group. In one embodiment, R 7 It is a branch C 15 Alkyl group. In one embodiment, R 7 It is a branch C 16 Alkyl group. In one embodiment, R 7 It is a branch C17 Alkyl group. In one embodiment, R 7 It is a branch C 18 Alkyl group. In one embodiment, R 7 It is a branch C 19 Alkyl group. In one embodiment, R 7 It is a branch C 20 Alkyl group. In one embodiment, R 7 It is a branch C 21 Alkyl group. In one embodiment, R 7 It is a branch C 22 Alkyl group. In one embodiment, R 7 It is a branch C 23 Alkyl group. In one embodiment, R 7 It is a branch C 24 Alkyl group. In one embodiment, R 7 for

[0181] In one implementation, L 3 for:

[0182] In one implementation, L 3 -R 8 -R 9 .

[0183] In one implementation, L 2 -OC(=O)L 3 And L 3 -R 8 -R 9 .

[0184] In one implementation, R 8 For straight chain C1-C 24 Alkylene. In one embodiment, R 8 For straight chain C6-C 18 Alkylene. In one embodiment, R 8 It is a straight-chain C6 alkylene group. In one embodiment, R 8 It is a straight-chain C7 alkylene group. In one embodiment, R 8 It is a straight-chain C8 alkylene group. In one embodiment, R 8 It is a straight-chain C9 alkylene group. In one embodiment, R 8 For straight chain C 10 Alkylene. In one embodiment, R 8 For straight chain C 11 Alkylene. In one embodiment, R 8 For straight chain C12 Alkylene. In one embodiment, R 8 For straight chain C 13 Alkylene. In one embodiment, R 8 For straight chain C 14 Alkylene. In one embodiment, R 8 For straight chain C 15 Alkylene. In one embodiment, R 8 For straight chain C 16 Alkylene. In one embodiment, R 8 For straight chain C 17 Alkylene. In one embodiment, R 8 For straight chain C 18 Alkylene.

[0185] In one implementation, R 8 For straight chain C1-C 24 alkenyl group. In one embodiment, R 8 For straight chain C6-C 18 alkenyl group. In one embodiment, R 8 It is a straight-chain C6-olefinic group. In one embodiment, R 8 It is a straight-chain C7 alkenyl group. In one embodiment, R 8 It is a straight-chain C8-olefinic group. In one embodiment, R 8 It is a straight-chain C9-olefinic group. In one embodiment, R 8 For straight chain C 10 alkenyl group. In one embodiment, R 8 For straight chain C 11 alkenyl group. In one embodiment, R 8 For straight chain C 12 alkenyl group. In one embodiment, R 8 For straight chain C 13 alkenyl group. In one embodiment, R 8 For straight chain C 14 alkenyl group. In one embodiment, R 8 For straight chain C 15 alkenyl group. In one embodiment, R 8 For straight chain C 16 alkenyl group. In one embodiment, R 8 For straight chain C 17 alkenyl group. In one embodiment, R 8 For straight chain C 18 Alkenyl group.

[0186] In one implementation, R 8 For branch C1-C 24Alkylene. In one embodiment, R 8 For branch C6-C 18 Alkylene. In one embodiment, R 8 It is a branched C6 alkylene group. In one embodiment, R 8 It is a branched C7 alkylene group. In one embodiment, R 8 It is a branched C8 alkylene group. In one embodiment, R 8 It is a branched C9 alkylene group. In one embodiment, R 8 For branch C 10 Alkylene. In one embodiment, R 8 For branch C 11 Alkylene. In one embodiment, R 8 For branch C 12 Alkylene. In one embodiment, R 8 For branch C 13 Alkylene. In one embodiment, R 8 For branch C 14 Alkylene. In one embodiment, R 8 For branch C 15 Alkylene. In one embodiment, R 8 For branch C 16 Alkylene. In one embodiment, R 8 For branch C 17 Alkylene. In one embodiment, R 8 For branch C 18 Alkylene.

[0187] In one implementation, R 8 For branch C1-C 24 alkenyl group. In one embodiment, R 8 For branch C6-C 18 alkenyl group. In one embodiment, R 8 It is a branched C6-olefinic group. In one embodiment, R 8 It is a branched C7 alkenyl group. In one embodiment, R 8 It is a branched C8-olefinic group. In one embodiment, R 8 It is a branched C9-olefinic group. In one embodiment, R 8 For branch C 10 alkenyl group. In one embodiment, R 8 For branch C 11 alkenyl group. In one embodiment, R 8 For branch C 12 alkenyl group. In one embodiment, R 8 For branch C 13alkenyl group. In one embodiment, R 8 For branch C 14 alkenyl group. In one embodiment, R 8 For branch C 15 alkenyl group. In one embodiment, R 8 For branch C 16 alkenyl group. In one embodiment, R 8 For branch C 17 alkenyl group. In one embodiment, R 8 For branch C 18 alkenyl group. In one embodiment, R 8 for

[0188] In one implementation, R 9 C 5-8 Cycloalkenyl. In one embodiment, R 9 It is a C5 cycloalkenyl group. In one embodiment, R 9 It is a C6 cycloalkenyl group. In one embodiment, R 9 It is C7 cycloalkenyl. In one embodiment, R 9 It is C8 cycloalkenyl. In one embodiment, R 9 for R t’ R u’ R v’ R w’ R x’ R y’ Independently selected from H, C1-C6 alkyl. In one embodiment, R 9 for R t’ R u’ R v’ R w’ R x’ R y’ Independently selected from H, methyl. In one embodiment, R 9 for

[0189] In one implementation, L 3 for:

[0190] In one implementation, G 3 For C2-C 12 Alkylene. In one embodiment, G 3 It is a C2-C6 alkylene group. In one embodiment, G 3 It is a C2-C4 alkylene group. In one embodiment, G 3It is a C2 alkylene group. In one embodiment, G 3 It is a C3 alkylene group. In one embodiment, G 3 It is a C4 alkylene group. In one embodiment, G 3 It is a C5 alkylene group. In one embodiment, G 3 It is a C6 alkylene group. In one embodiment, G 3 It is a C7 alkylene group. In one embodiment, G 3 It is a C8 alkylene group. In one embodiment, G 3 It is a C9 alkylene group. In one embodiment, G 3 C 10 Alkylene. In one embodiment, G 3 C 11 Alkylene. In one embodiment, G 3 C 12 Alkylene. In one embodiment, G 3 for In one implementation, G 3 for

[0191] In one embodiment, the compound is a compound listed in the table below or a pharmaceutically acceptable salt, tautomer, prodrug, or stereoisomer thereof.

[0192] It should be understood that any embodiment of the compounds provided herein as shown above, and any specific substituents and / or variables of the compounds provided herein as shown above, may be independently combined with other embodiments and / or substituents and / or variables of the compounds to form embodiments not specifically described above. Furthermore, in the case of listing any specific group or variable of substituents and / or variables, it should be understood that each individual substituent and / or variable may be deleted from a particular embodiment and / or claim, and the remaining list of substituents and / or variables will be considered within the scope of the embodiments provided herein.

[0193] It should be understood that the combination of substituents and / or variables described in this specification is only permissible if such contributions result in a stable compound.

[0194] Nanoparticle Composition

[0195] In one aspect, this document describes nanoparticle compositions comprising the lipid compounds described herein. In a particular embodiment, the nanoparticle composition comprises a compound according to formula (I) (and its sub-formulas) as described herein.

[0196] In some embodiments, the maximum size of the nanoparticle compositions provided herein is 1 μm or shorter when measured, for example, by dynamic light scattering (DLS), transmission electron microscopy, scanning electron microscopy, or another method (e.g., ≤1 μm, <900 nm, ≤800 nm, <700 nm, ≤600 nm, <500 nm, <400 nm, ≤300 nm, ≤200 nm, ≤175 nm, ≤150 nm, ≤125 nm, ≤100 nm, ≤75 nm, ≤50 nm, or shorter). In one embodiment, the lipid nanoparticles provided herein have at least one size in the range of about 40 nm to about 200 nm. In one embodiment, said at least one size is in the range of about 40 nm to about 100 nm.

[0197] Nanoparticle compositions that can be used in conjunction with this disclosure include, for example, lipid nanoparticles (LNPs), lipoprotein nanoparticles, liposomes, lipid vesicles, and lipid complexes. In some embodiments, the nanoparticle composition is a vesicle comprising one or more lipid bilayers. In some embodiments, the nanoparticle composition comprises two or more concentric bilayers separated by aqueous compartments. The lipid bilayers may be functionalized and / or cross-linked with each other. The lipid bilayers may include one or more ligands, proteins, or channels.

[0198] The characteristics of nanoparticle compositions can depend on their components. For example, a nanoparticle composition containing cholesterol as a structural lipid may have different characteristics than a nanoparticle composition containing different structural lipids. Similarly, the characteristics of a nanoparticle composition may depend on the absolute or relative amounts of its components. For example, a nanoparticle composition containing a higher molar fraction of phospholipids may have different characteristics than a nanoparticle composition containing a lower molar fraction of phospholipids. The characteristics may also vary depending on the preparation method and conditions of the nanoparticle composition.

[0199] Nanoparticle compositions can be characterized using a variety of methods. For example, microscopic examination (e.g., transmission electron microscopy or scanning electron microscopy) can be used to examine the morphology and size distribution of the nanoparticle composition. Dynamic light scattering or potentiometry (e.g., potentiometric titration) can be used to measure the zeta potential. Dynamic light scattering can also be used to determine particle size. Instruments such as the Zetasizer Nano ZS (Malvem Instruments Ltd, Malvem, Worcestershire, UK) can also be used to measure multiple characteristics of the nanoparticle composition, such as particle size, polydispersity index, and zeta potential.

[0200] Dh (size): The average size of the nanoparticle composition can range from tens of nanometers to hundreds of nanometers. For example, the average size can be from about 40 nm to about 150 nm, such as about 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm or 150 nm. In some embodiments, the average size of the nanoparticle composition may be about 50 nm to about 100 nm, about 50 nm to about 90 nm, about 50 nm to about 80 nm, about 50 nm to about 70 nm, about 50 nm to about 60 nm, about 60 nm to about 100 nm, about 60 nm to about 90 nm, about 60 nm to about 80 nm, about 60 nm to about 70 nm, about 70 nm to about 100 nm, about 70 nm to about 90 nm, about 70 nm to about 80 nm, about 80 nm to about 100 nm, about 80 nm to about 90 nm, or about 90 nm to about 100 nm. In some embodiments, the average size of the nanoparticle composition may be about 70 nm to about 100 nm. In some embodiments, the average size may be about 80 nm. In other embodiments, the average size may be about 100 nm.

[0201] PDI: The nanoparticle composition may be relatively homogeneous. The polydispersity index (PDI) can be used to indicate the homogeneity of the nanoparticle composition, such as its particle size distribution. A smaller PDI (e.g., less than 0.3) generally indicates a narrower particle size distribution. The PDI of the nanoparticle composition can be from about 0 to about 0.25, for example, 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25. In some embodiments, the PDI of the nanoparticle composition can be from about 0.10 to about 0.20.

[0202] Encapsulation efficiency: The encapsulation efficiency of the therapeutic and / or preventative agent describes the amount of the therapeutic and / or preventative agent encapsulated in or otherwise associated with the nanoparticle composition after preparation, relative to the initial amount provided. An encapsulation efficiency is desirablely high (e.g., close to 100%). Encapsulation efficiency can be measured, for example, by comparing the amount of the therapeutic and / or preventative agent in a solution containing the nanoparticle composition before and after the nanoparticle composition has been disrupted with one or more organic solvents or detergents. Fluorescence can be used to measure the amount of free therapeutic and / or preventative agent (e.g., RNA) in solution. For the nanoparticle compositions described herein, the encapsulation efficiency of the therapeutic and / or preventative agent may be at least 50%, such as 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the encapsulation efficiency may be at least 80%. In some implementations, the encapsulation efficiency can be at least 90%.

[0203] Zeta potential: The zeta potential of a nanoparticle composition can be used to indicate the potential kinetics of the composition. For example, the zeta potential can describe the surface charge of the nanoparticle composition. Nanoparticle compositions with relatively low positive or negative charges are generally desirable because substances with higher charges can interact undesirably with cells, tissues, and other components in the body. In some embodiments, the zeta potential of the nanoparticle composition may be about -10mV to about +20mV, about -10mV to about +15mV, about -10mV to about +10mV, about -10mV to about +5mV, about -10mV to about 0mV, about -10mV to about -5mV, about -5mV to about +20mV, about -5mV to about +15mV, about -5mV to about +10mV, about -5mV to about +5mV, about -5mV to about 0mV, about 0mV to about +20mV, about 0mV to about +15mV, about 0mV to about +10mV, about 0mV to about +5mV, about +5mV to about +20mV, about +5mV to about +15mV, or about +5mV to about +10mV.

[0204] In another embodiment, the self-replicating RNA may be formulated in liposomes. As a non-limiting example, the self-replicating RNA may be formulated in liposomes as described in International Publication No. WO20120067378, which is incorporated herein by reference in its entirety. In one aspect, the liposomes may contain lipids with pKa values ​​favorable for mRNA delivery. In another aspect, the liposomes may have a substantially neutral surface charge at physiological pH and thus be effective for immunization (see, for example, liposomes described in International Publication No. WO20120067378, which is incorporated herein by reference in its entirety).

[0205] In some embodiments, the nanoparticle composition comprises a lipid component, which includes at least one lipid, such as a compound according to one of formulas (I) (and its sub-formulas) described herein. For example, in some embodiments, the nanoparticle composition may comprise a lipid component, which includes compounds provided herein. The nanoparticle composition may also comprise one or more other lipid or non-lipid components as described below.

[0206] Cationic / ionizable lipids

[0207] As described herein, in some embodiments, the nanoparticle compositions provided herein, in addition to comprising lipids according to formula (I) (and its sub-formulas), comprise one or more charged or ionizable lipids. Without being bound by theory, it is anticipated that certain charged or zwitterionic lipid components of the nanoparticle compositions will resemble lipid components in cell membranes, thereby improving cellular uptake of the nanoparticles. Exemplary charged or ionizable lipids that may form part of the nanoparticle compositions of the present invention include, but are not limited to, 3-(bisdodecylamino)-N1,N1,4-tris(dodecyl)-1-piperazineethylamine (KL10), N1-[2-(bisdodecylamino)ethyl]-N1,N4,N4-tris(dodecyl)-1,4-piperazinediethylamine (KL22), 14,25-bis(tridecyl)-15,18,21,24-tetraaza-octacosane (KL25), and 1,2-dilinyloxy-N,N -Dimethylaminopropane (DLinDMA), 2,2-dilinole-4-dimethylaminomethyl-[1,3]-dioxacyclopentane (DLin-K-DMA), 4-(dimethylamino)butyric acid 37-carbon-6,9,28,31-tetraen-19-yl ester (DLin-MC3-DMA), 2,2-dilinole-4-(2-dimethylaminoethyl)-[1,3]-dioxacyclopentane (DLin-KC2-DMA), 1,2-dioleoyloxy-N,N-dimethylaminopropane ( DODMA), 2-({8-[(3β)-cholesterol-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadec-9,12-dien-1-yloxy]prop-1-amine (octyl-CLinDMA), (2R)-2-({8-[(3β)-cholesterol-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadec-9,12-dien-1-yloxy]prop-1-amine (octyl-CLi) nDMA(2R)), (2S)-2-({8-[(3β)-cholesterol-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z-,12Z)-octadec-9,12-dien-1-yloxy]prop-1-amine (octyl-CLinDMA(2S)), (12Z,15Z)-N,N-dimethyl-2-nonyltetradec-12,15-dien-1-amine, N,N-dimethyl-1-{(1S,2R)-2-octylcyclopropyl}heptadecane-8-amine.Additional exemplary charged or ionizable lipids that may form part of the nanoparticle compositions of the present invention include lipids (e.g., lipid 5) described in Sabnis et al., “A Novel Amino Lipid Series for mRNA Delivery: Improved Endosomal Escape and Sustained Pharmacology and Safety in Non-human Primates”, Molecule Lar Therapy, Vol. 26, No. 6, 2018, all of which are incorporated herein by reference.

[0208] In some embodiments, suitable cationic lipids include N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA); N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTAP); 1,2-dioleoyl-sn-glycerol-3-ethylphosphocholine (DOEPC); 1,2-dilauroyl-sn-glycerol-3-ethylphosphocholine (DLEPC); 1,2-dimyristoyl-sn-glycerol-3-ethylphosphocholine Base (DMEPC); 1,2-Dimyristoleoyl-sn-glycerol-3-ethylphosphocholine (14:1); N1-[2-((1S)-1-[(3-aminopropyl)amino]-4-[di(3-aminopropyl)amino]butylcarbamoyl)ethyl]-3,4-di[oleoyloxy]-benzamide (MVL5); bis(octadecylamido)glycyltetramine (DOGS); 3b-[N-(N′,N′-dimethylaminoethyl)carbamoyl]cholesterol (DC-Chol); bis(octadecyl)bromoacetate Dimethylammonium chloride (DDAB); SAINT-2,N-methyl-4-(dioleoyl)methylpyridinium; 1,2-dimyristyloxypropyl-3-dimethylhydroxyethylammonium bromide (DMRIE); 1,2-dioleoyl-3-dimethylhydroxyethylammonium bromide (DORIE); 1,2-dioleoyloxypropyl-3-dimethylhydroxyethylammonium chloride (DORI); dialkylated amino acids (DILA2) (e.g., C18: 1-norArg-C16); dioleoyldimethylammonium chloride (DODAC); 1-palmitoyldimethylammonium chloride (DORIE); 1-palmit ... Acyl-2-oleoyl-sn-glycerol-3-ethylphosphocholine (POEPC); 1,2-dimyristoleoyl-sn-glycerol-3-ethylphosphocholine (MOEPC); dioleoic acid(R)-5-(dimethylamino)pentane-1,2-diyl ester hydrochloride (DODAPen-Cl); dioleoic acid(R)-5-guanidinopentane-1,2-diyl ester hydrochloride (DOPen-G); and chloride(R)-N,N,N-trimethyl-4,5-bis(oleoyloxy)pentane-1-amineonium salt (DOTAPen). Cationic lipids with head groups that are charged at physiological pH are also suitable, such as primary amines (e.g., DODAG N′,N′-bis(octadecyl-N-4,8-diaza-10-aminodecanoylglycineamide) and guanidinium head groups (e.g., bis-guanidinium-spermethylenetriamine-cholesterol (BGSC), bis-guanidinium-tren-cholesterol (BGTC), PONA, and dioleoic acid(R)-5-guanidinium-pentane-1,2-diyl ester hydrochloride (DOPen-G)). Another suitable cationic lipid is dioleoic acid(R)-5-(dimethylamino)pentane-1,2-diyl ester hydrochloride (DODAPen-Cl).In some embodiments, the cationic lipid is a specific enantiomer or racemic form, and includes various salt forms of the aforementioned cationic lipid (e.g., chlorides or sulfates). For example, in some embodiments, the cationic lipid is N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTAP-Cl) or N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium sulfate (DOTAP-sulfate). In some embodiments, the cationic lipids are ionizable cationic lipids, such as bis(octadecyl)dimethylammonium bromide (DDAB); 1,2-dilinoleyloxy-3-dimethylaminopropane (DLinDMA); 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxacyclopentane (DLin-KC2-DMA); 4-(dimethylamino)butyrate trihexadecano-6,9,28,31-tetraen-19-yl ester (DLin-MC3-DMA); 1,2-dioleoyloxy-3-dimethylaminopropane (DODAP); 1,2-dioleyloxy-3-dimethylaminopropane (DODMA); and N-morpholinocholesterol (Mo-CHOL). In some embodiments, the lipid nanoparticles comprise a combination of two or more cationic lipids (e.g., two or more of the above-described cationic lipids).

[0209] Additionally, in some embodiments, the charged or ionizable lipids that may form part of the nanoparticle compositions of the present invention are lipids comprising cyclic amine groups. Additional cationic lipids suitable for the formulations and methods disclosed herein include those described in WO2015199952, WO2016176330, and WO2015011633, the entire contents of which are incorporated herein by reference.

[0210] Polymer-bound lipids

[0211] In some embodiments, the lipid component of the nanoparticle composition may include one or more polymer-bound lipids, such as polyethylene glycol-modified lipids (PEG lipids). Without being bound by theory, it is anticipated that the polymer-bound lipid component in the nanoparticle composition may improve colloidal stability and / or reduce protein uptake by the nanoparticles. Exemplary polymer-bound lipids that may be combined with the present disclosure include, but are not limited to, PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol, and mixtures thereof. For example, PEG lipids may be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, PEG-DSPE, ceramide-PEG2000, or Chol-PEG2000.

[0212] In one embodiment, the polymer-bound lipid is a polyethylene glycol-modified lipid. For example, some embodiments include polyethylene glycol-modified diacylglycerols (PEG-DAG), such as 1-(monomethoxy-polyethylene glycol)-2,3-dimyristoylglycerol (PEG-DMG); polyethylene glycol-modified phosphatidylethanolamine (PEG-PE); PEG succinate diacylglycerols (PEG-S-DAG), such as 4-O-(2',3'-di(tetradecanoyloxy)propyl-1-O-(ω-methoxy(polyethoxy)ethyl)succinate (PEG-S-DMG); polyethylene glycol-modified ceramides (PEG-cer); or PEG dialkoxypropyl carbamates, such as ω-methoxy(polyethoxy)ethyl-N-(2,3-di(tetradecanoyloxy)propyl)carbamate or 2,3-di(tetradecanoyloxy)propyl-N-(ω-methoxy)(polyethoxy)ethyl)carbamate.

[0213] In one embodiment, the polymer-bound lipid is present at a concentration ranging from 1.0 mol% to 1.5 mol%. In another embodiment, the polymer-bound lipid is present at a concentration of about 1.5 mol%.

[0214] In one embodiment, the molar ratio of the ionizable lipid to the polymer-bound lipid is in the range of about 100:1 to about 20:1, about 35:1 to about 25:1, and optionally about 47.5:1.8.

[0215] In one embodiment, the polyethylene glycol-modified lipid has the following formula:

[0216] Or its pharmaceutically acceptable salts, tautomers or stereoisomers, wherein:

[0217] R 12 and R 13 Each is independently a straight-chain or branched saturated or unsaturated alkyl chain containing 10 to 30 carbon atoms, wherein the alkyl chain is optionally interspersed with one or more ester bonds; and

[0218] w has an average value in the range of 30 to 60.

[0219] In one implementation, R 12 and R 13 Each is independently a straight-chain saturated alkyl chain containing 12 to 16 carbon atoms. In other embodiments, the average w is in the range of 42 to 55, for example, the average w is 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54 or 55. In some specific embodiments, the average w is about 49.

[0220] In one embodiment, the polyethylene glycol-modified lipid has the following formula:

[0221] The average value of w is approximately 49.

[0222] In one embodiment, the polyethylene glycol-modified lipoprotein is DMG-PEG2000, which has the following formula:

[0223] Structural lipids

[0224] In some embodiments, the lipid component of the nanoparticle composition may include one or more structural lipids. Without being bound by theory, it is contemplated that structural lipids can stabilize the amphiphilic structure of the nanoparticles, such as, but not limited to, the lipid bilayer structure of the nanoparticles. Exemplary structural lipids that may be used in conjunction with this disclosure include, but are not limited to, cholesterol, codosterone, sitosterol, ergosterol, campesterol, stigmasterol, brassic acid, lycopene, lycopene, ursolic acid, α-tocopherol, and mixtures thereof. In some embodiments, the structural lipid is cholesterol. In some embodiments, the structural lipid includes cholesterol and corticosteroids (e.g., prednisolone, dexamethasone, prednisone, and hydrocortisone) or combinations thereof.

[0225] In one embodiment, the lipid nanoparticles provided herein comprise a steroid or a steroid analogue. In one embodiment, the steroid or steroid analogue is cholesterol. In one embodiment, the steroid is present at a concentration in the range of 39 mol% to 49 mol%, 40 mol% to 46 mol%, 40 mol% to 44 mol%, 40 mol% to 42 mol%, 42 mol% to 44 mol%, or 44 mol% to 46 mol%. In one embodiment, the steroid is present at a concentration of 40 mol%, 41 mol%, 42 mol%, 43 mol%, 44 mol%, 45 mol%, or 46 mol%.

[0226] In one embodiment, the steroid is present at a concentration ranging from 32 mol% to 50 mol% steroid. In one embodiment, the molar ratio of ionizable lipid to cholesterol is in the range of about 5:1 to about 1:1, optionally about 2:1 to about 1:1, and more preferably about 49:39.5.

[0227] Phospholipids

[0228] In some embodiments, the lipid component of the nanoparticle composition may include one or more phospholipids, such as one or more (poly)unsaturated lipids. Phospholipids are also commonly used as structural lipids in LNP formulations because they can spontaneously organize into lipid bilayers, and their higher phase transition temperatures enhance the membrane stability of LNPs. Without being bound by theory, it is anticipated that phospholipids can assemble into one or more lipid bilayer structures. Exemplary phospholipids that can form part of the nanoparticle compositions of the present invention include, but are not limited to, 1,2-distearyl-sn-glycerol-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycerol-3-phosphoethanolamine (DOPE), 1,2-dilinoleoyl-sn-glycerol-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycerol-3-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycerol-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycerol-3-phosphocholine (DPPC), 1,2-di(undecanoyl)-sn-glycerol-3-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycerol-3-phosphocholine (POPC), and 1,2-di-O-octadecenyl-sn-glycerol-3-phosphocholine (18:0 Diether). 1,2-Oleoyl-2-cholesterolylhemisuccinoyl-sn-glycerol-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycerol-3-phosphocholine (C16 Lyso PC), 1,2-dilinoleoyl-sn-glycerol-3-phosphocholine, 1,2-disarachidonicoyl-sn-glycerol-3-phosphocholine, 1,2-docosahexaenooyl-sn-glycerol-3-phosphocholine, 1,2-diphydanoyl-sn-glycerol-3-phosphoethanolamine (ME) The nanoparticle composition comprises 1,2-distearyl-sn-glycerol-3-phosphate ethanolamine, 1,2-dilinoleoyl-sn-glycerol-3-phosphate ethanolamine, 1,2-dilinoleoyl-sn-glycerol-3-phosphate ethanolamine, 1,2-disarachidanoyl-sn-glycerol-3-phosphate ethanolamine, 1,2-docosahexaenoyl-sn-glycerol-3-phosphate ethanolamine, 1,2-dioleoyl-sn-glycerol-3-phosphate racemic-(1-glycerol) sodium salt (DOPG), and sphingomyelin. In some embodiments, the nanoparticle composition comprises DSPC. In some embodiments, the nanoparticle composition comprises DOPE. In some embodiments, the nanoparticle composition comprises both DSPC and DOPE.

[0229] Other exemplary neutral lipids include, for example, dipalmitoylphosphatidylglycerol (DPPG), palmitoyloleoylphosphatidylethanolamine (POPE), and dioleoylphosphatidylethanolamine 4-(N-maleimidemethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphatidylethanolamine (DMPE), distearate-phosphatidylethanolamine (DSPE), 16-O-monomethylPE, 16-O-dimethylPE, 18-1-transPE, 1-stearoyl-2-oleoylphosphatidylethanolamine (SOPE), and 1,2-ditransoleoyl-sn-glycerol-3-phosphate ethanolamine (transDOPE). In one embodiment, the neutral lipid is 1,2-distearate-sn-glycerol-3-phosphate choline (DSPC). In one embodiment, the neutral lipids are selected from DSPC, DPPC, DMPC, DOPC, POPC, DOPE, and SM.

[0230] In one embodiment, the neutral lipid is phosphatidylcholine (PC), phosphatidylethanolamine (PE), phosphatidylserine (PS), phosphatidic acid (PA), or phosphatidylglycerol (PG).

[0231] Additional phospholipids that may form part of the nanoparticle composition of the present invention include those phospholipids described in WO2017 / 112865, the entire contents of which are incorporated herein by reference in their entirety.

[0232] Therapeutic payload

[0233] According to this disclosure, the nanoparticle compositions described herein may further comprise one or more therapeutic and / or preventative agents. These therapeutic and / or preventative agents are sometimes referred to herein as “therapeutic payload” or “payload.” In some embodiments, the therapeutic payload may be administered in vivo or in vitro, using nanoparticles as a delivery medium.

[0234] In some embodiments, the nanoparticle composition comprises the following as a therapeutic active load: small molecule compounds (e.g., small molecule drugs), such as anticancer agents (e.g., vincristine, doxorubicin, mitoxantrone, camptothecin, cisplatin, bleomycin, cyclophosphamide, methotrexate, and streptozotocin), and antitumor agents (e.g., actinomycin D, vincristine, vinblastine, cytosine arabinoside). Arabinoside, anthracyclines, alkylating agents, platinum compounds, antimetabolites and nucleoside analogs, such as methotrexate and purine and pyrimidine analogs, anti-infectives, local anesthetics (such as dibucaine and chlorpromazine), beta-adrenergic blockers (such as propranolol, timolol and labetalol), antihypertensives (such as clonidine and hydralazine), antidepressants (such as imipramine, amitriptyline and doxepin), anticonvulsants (such as phenytoin), and antihistamines. Antibiotics (e.g., diphenhydramine, chlorpheniramine, and promethazine), antibiotics / antibacterial agents (e.g., gentamicin, ciprofloxacin, and cefoxitin), antifungal agents (e.g., miconazole, terconazole, econazole, isoconazole, butaconazole, clotrimazole, itraconazole, nystatin, naftifine, and amphotericin B), antiparasitic agents, hormones, hormone antagonists, immunomodulators, neurotransmitter antagonists, antiglaucoma agents, vitamins, anesthetics, and imaging agents.

[0235] In some embodiments, the therapeutic payload comprises a cytotoxin, a radioactive ion, a chemotherapeutic agent, a vaccine, a compound that induces an immune response, and / or another therapeutic and / or prophylactic agent. Cytotoxins or cytotoxic agents include any agents that may be harmful to cells. Examples include, but are not limited to, taxol, cytochalasin B, gramicidin D, and ethidium bromide. bromide, emetine, mitomycin, etoposide, teniposide, vincristine, vinblastine, colchicine, doxorubicin, daunorubicin, dihydroxyanthracinedione, mithramycin, actinomycin D, 1-dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, puromycin, maytansinoids, such as maytansinol, rachelmycin (CC-1065), and their analogues or homologues. Radioactive ions include, but are not limited to, iodine (e.g., iodine-125 or iodine-131), strontium-89, phosphorus, palladium, cesium, iridium, phosphate, cobalt, yttrium-90, samarium-153, and praseodymium.

[0236] In other embodiments, the therapeutic effective loading of the nanoparticle composition of the present invention may include, but is not limited to, therapeutic agents and / or prophylactic agents, such as antimetabolites (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-fluorouracil, dacarbazine), alkylating agents (e.g., nitrogen mustard, thiotepa, chlorambucil, lactamase (CC-1065), melphalan, carmustine (BSNU), lomustine (… lomustine (CCNU), cyclophosphamide, busulfan, dibromomannitol, streptozotocin, mitomycin C and cis-dichlorodiamineplatin(II) (DDP), anthracyclines (e.g., daunomycin and doxorubicin), antibiotics (e.g., dactinomycin D (formerly known as actinomycin)), bleomycin, miracin and antramycin (AMC)), and antimitotics (e.g., vincristine, vinblastine, paclitaxel and maytansine compounds).

[0237] In some embodiments, the nanoparticle composition comprises biomolecules such as peptides and polypeptides as a therapeutic payload. The biomolecules forming part of the nanoparticle composition of the present invention may be of natural origin or synthetically produced. For example, in some embodiments, the therapeutic payload of the nanoparticle composition of the present invention may include, but is not limited to, gentamicin, amikacin, insulin, erythropoietin (EPO), granulocyte colony-stimulating factor (G-CSF), granulocyte-macrophage colony-stimulating factor (GM-CSF), factor VIR, luteinizing hormone-releasing hormone (LHRH) analogs, interferon, heparin, hepatitis B surface antigen, typhoid vaccine, cholera vaccine, and peptides and polypeptides.

[0238] Nucleic acid

[0239] In some embodiments, the nanoparticle compositions of the present invention comprise one or more nucleic acid molecules (e.g., DNA or RNA molecules) as a therapeutic payload. Exemplary forms of nucleic acid molecules that may be included as a therapeutic payload in the nanoparticle compositions of the present invention include, but are not limited to, one or more of the following: deoxyribonucleic acid (DNA), ribonucleic acid (RNA), including messenger mRNA (mRNA), its hybrids, RNAi inducers, RNAi agents, siRNA, shRNA, miRNA, antisense RNA, ribonuclease, catalytic DNA, RNA that induces triple helix formation, aptamers, vectors, etc. In some embodiments, the therapeutic payload comprises RNA. RNA molecules that may be included as a therapeutic payload in the nanoparticle compositions of the present invention include, but are not limited to, shortmers, agomir, antagomir, antisense, ribonuclease, small interfering RNA (siRNA), asymmetric interfering RNA (aiRNA), microRNA (miRNA), Dicer-substrate RNA (dsRNA), small hairpin RNA (shRNA), transfer RNA (tRNA), messenger RNA (mRNA), and other forms of RNA molecules known in the art. In a particular implementation, RNA is mRNA.

[0240] In other embodiments, the nanoparticle composition comprises siRNA molecules as a therapeutic payload. Specifically, in some embodiments, the siRNA molecules are capable of selectively interfering with and downregulating the expression of genes of interest. For example, in some embodiments, after administration of the siRNA-containing nanoparticle composition to a subject in need, the siRNA payload selectively silences genes associated with a specific disease, condition, or disorder. In some embodiments, the siRNA molecule comprises a sequence complementary to the mRNA sequence encoding a protein product of interest. In some embodiments, the siRNA molecule is an immunomodulatory siRNA.

[0241] In some embodiments, the nanoparticle composition comprises an shRNA molecule or a carrier encoding an shRNA molecule as a therapeutic payload. Specifically, in some embodiments, the therapeutic payload generates shRNA within the target cells after application. Constructs and mechanisms associated with shRNA are well known in the art.

[0242] In some embodiments, the nanoparticle composition comprises an mRNA molecule as a therapeutic payload. Specifically, in some embodiments, the mRNA molecule encodes a polypeptide of interest, including any naturally occurring or non-naturally occurring or otherwise modified polypeptide. The polypeptide encoded by the mRNA can have any size and can have any secondary structure or activity. In some embodiments, the polypeptide encoded by the mRNA payload can have a therapeutic effect when expressed in cells.

[0243] In some embodiments, the nucleic acid molecule of this disclosure comprises an mRNA molecule. In a particular embodiment, the nucleic acid molecule comprises at least one coding region (e.g., an open reading frame (ORF)) encoding a peptide or polypeptide of interest. In some embodiments, the nucleic acid molecule also comprises at least one untranslated region (UTR). In a particular embodiment, the untranslated region (UTR) is located upstream (5′ end) of the coding region and is referred to herein as the 5′-UTR. In a particular embodiment, the untranslated region (UTR) is located downstream (3′ end) of the coding region and is referred to herein as the 3′-UTR. In a particular embodiment, the nucleic acid molecule comprises both a 5′-UTR and a 3′-UTR. In some embodiments, the 5′-UTR comprises a 5′-cap structure. In some embodiments, the nucleic acid molecule comprises a Kozak sequence (e.g., in the 5′-UTR). In some embodiments, the nucleic acid molecule comprises a poly-A region (e.g., in the 3′-UTR). In some embodiments, the nucleic acid molecule comprises a polyadenylation signal (e.g., in the 3′-UTR). In some embodiments, the nucleic acid molecule comprises a stable region (e.g., in the 3′-UTR). In some embodiments, the nucleic acid molecule includes a secondary structure. In some embodiments, the secondary structure is a stem-loop. In some embodiments, the nucleic acid molecule includes a stem-loop sequence (e.g., in the 5′-UTR and / or 3′-UTR). In some embodiments, the nucleic acid molecule includes one or more intron regions capable of being excised during splicing. In a particular embodiment, the nucleic acid molecule includes one or more regions selected from the 5′-UTR and coding region. In a particular embodiment, the nucleic acid molecule includes one or more regions selected from the coding region and 3′-UTR. In a particular embodiment, the nucleic acid molecule includes one or more regions selected from the 5′-UTR, coding region, and 3′-UTR.

[0244] Encoding area

[0245] In some embodiments, the nucleic acid molecule of this disclosure comprises at least one coding region. In some embodiments, the coding region is an open reading frame (ORF) encoding a single peptide or protein. In some embodiments, the coding region comprises at least two ORFs, each encoding a peptide or protein. In embodiments where the coding region comprises more than one ORF, the encoded peptides and / or proteins may be the same as or different from each other. In some embodiments, multiple ORFs in the coding region are separated by non-coding sequences. In a particular embodiment, the non-coding sequence separating two ORFs comprises an internal ribosome entry site (IRES).

[0246] Not bound by theory, it is anticipated that the internal ribosome entry site (IRES) can serve as a single ribosome binding site or as one of multiple ribosome binding sites for mRNA. An mRNA molecule containing more than one functional ribosome binding site may encode several peptides or polypeptides that are independently translated by ribosomes (e.g., polycistronic mRNA). Therefore, in some embodiments, the nucleic acid molecule (e.g., mRNA) of this disclosure contains one or more internal ribosome entry sites (IRES). Examples of IRES sequences that can be used in conjunction with this disclosure include, but are not limited to, those from small RNA viruses (e.g., FMDV), insect pest virus (CFFV), poliovirus (PV), encephalomyocytovirus (ECMV), foot-and-mouth disease virus (FMDV), hepatitis C virus (HCV), classical swine fever virus (CSFV), murine leukemia virus (MLV), simian immunodeficiency virus (sIV), or cricket paralysis virus (CrPV).

[0247] In various embodiments, the nucleic acid molecules of this disclosure encode at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more peptides or proteins. The peptides and proteins encoded by the nucleic acid molecules may be the same or different. In some embodiments, the nucleic acid molecules of this disclosure encode dipeptides (e.g., carnosine and anserine). In some embodiments, the nucleic acid molecules encode tripeptides. In some embodiments, the nucleic acid molecules encode tetrapeptides. In some embodiments, the nucleic acid molecules encode pentapeptides. In some embodiments, the nucleic acid molecules encode hexapeptides. In some embodiments, the nucleic acid molecules encode heptapeptides. In some embodiments, the nucleic acid molecules encode octapeptides. In some embodiments, the nucleic acid molecules encode nonapeptides. In some embodiments, the nucleic acid molecules encode decapeptides. In some embodiments, the nucleic acid molecules encode peptides or polypeptides having at least about 15 amino acids. In some embodiments, the nucleic acid molecules encode peptides or polypeptides having at least about 50 amino acids. In some embodiments, the nucleic acid molecules encode peptides or polypeptides having at least about 100 amino acids. In some embodiments, the nucleic acid molecules encode peptides or polypeptides having at least about 150 amino acids. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide having at least about 300 amino acids. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide having at least about 500 amino acids. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide having at least about 1000 amino acids.

[0248] In some embodiments, the nucleic acid molecule of this disclosure is at least about 30 nucleotides (nt) long. In some embodiments, the nucleic acid molecule is at least about 35 nt long. In some embodiments, the nucleic acid molecule is at least about 40 nt long. In some embodiments, the nucleic acid molecule is at least about 45 nt long. In some embodiments, the nucleic acid molecule is at least about 50 nt long. In some embodiments, the nucleic acid molecule is at least about 55 nt long. In some embodiments, the nucleic acid molecule is at least about 60 nt long. In some embodiments, the nucleic acid molecule is at least about 65 nt long. In some embodiments, the nucleic acid molecule is at least about 70 nt long. In some embodiments, the nucleic acid molecule is at least about 75 nt long. In some embodiments, the nucleic acid molecule is at least about 80 nt long. In some embodiments, the nucleic acid molecule is at least about 85 nt long. In some embodiments, the nucleic acid molecule is at least about 90 nt long. In some embodiments, the nucleic acid molecule is at least about 95 nt long. In some embodiments, the nucleic acid molecule is at least about 100 nt long. In some embodiments, the nucleic acid molecule is at least about 120 nt long. In some embodiments, the length of the nucleic acid molecule is at least about 140 nt. In some embodiments, the length of the nucleic acid molecule is at least about 160 nt. In some embodiments, the length of the nucleic acid molecule is at least about 180 nt. In some embodiments, the length of the nucleic acid molecule is at least about 200 nt. In some embodiments, the length of the nucleic acid molecule is at least about 250 nt. In some embodiments, the length of the nucleic acid molecule is at least about 300 nt. In some embodiments, the length of the nucleic acid molecule is at least about 400 nt. In some embodiments, the length of the nucleic acid molecule is at least about 500 nt. In some embodiments, the length of the nucleic acid molecule is at least about 600 nt. In some embodiments, the length of the nucleic acid molecule is at least about 700 nt. In some embodiments, the length of the nucleic acid molecule is at least about 800 nt. In some embodiments, the length of the nucleic acid molecule is at least about 900 nt. In some embodiments, the length of the nucleic acid molecule is at least about 1000 nt. In some embodiments, the length of the nucleic acid molecule is at least about 1100 nt. In some embodiments, the length of the nucleic acid molecule is at least about 1200 nt. In some embodiments, the length of the nucleic acid molecule is at least about 1300 nt. In some embodiments, the length of the nucleic acid molecule is at least about 1400 nt. In some embodiments, the length of the nucleic acid molecule is at least about 1500 nt. In some embodiments, the length of the nucleic acid molecule is at least about 1600 nt. In some embodiments, the length of the nucleic acid molecule is at least about 1700 nt. In some embodiments, the length of the nucleic acid molecule is at least about 1800 nt. In some embodiments, the length of the nucleic acid molecule is at least about 1900 nt.In some embodiments, the nucleic acid molecule is at least about 2000 nt in length. In some embodiments, the nucleic acid molecule is at least about 2500 nt in length. In some embodiments, the nucleic acid molecule is at least about 3000 nt in length. In some embodiments, the nucleic acid molecule is at least about 3500 nt in length. In some embodiments, the nucleic acid molecule is at least about 4000 nt in length. In some embodiments, the nucleic acid molecule is at least about 4500 nt in length. In some embodiments, the nucleic acid molecule is at least about 5000 nt in length.

[0249] In certain embodiments, the therapeutic payload comprises a vaccine composition (e.g., a gene vaccine) as described herein. In some embodiments, the therapeutic payload comprises a compound capable of inducing immunity against one or more target diseases or illnesses. In some embodiments, the target disease is associated with or caused by a pathogen infection, such as coronaviruses (e.g., 2019-nCoV), influenza viruses, measles viruses, human papillomaviruses (HPV), rabies viruses, meningitis viruses, pertussis viruses, tetanus viruses, plague viruses, hepatitis viruses, and tuberculosis viruses. In some embodiments, the therapeutic payload comprises a nucleic acid sequence (e.g., mRNA) encoding a pathogen-specific pathogenic protein or an antigenic fragment or epitope thereof. Upon administration to a vaccinated subject, the vaccine allows expression of the encoded pathogenic protein (or an antigenic fragment or epitope thereof), thereby inducing immunity against the pathogen in the subject.

[0250] In some implementations, the target disease is associated with or caused by the proliferation of cells (e.g., cancer). In some implementations, the therapeutic payload comprises a nucleic acid sequence (e.g., mRNA) encoding a cancer-specific tumor-associated antigen (TAA) or an antigenic fragment or epitope thereof. Upon administration to a vaccinated subject, the vaccine allows expression of the encoded TAA (or an antigenic fragment or epitope thereof), thereby inducing immunity against TAA-expressing proliferation cells in the subject.

[0251] 5'-cap structure

[0252] Unbound by theory, it is anticipated that the 5′-cap structure of polynucleotides participates in nuclear export and increases polynucleotide stability, and binds to mRNA cap-binding protein (CBP), which is responsible for polynucleotide stability in the cell and induces translational ability through association with poly-A binding protein to form mature circular mRNA. The 5′-cap structure further facilitates the removal of 5′-proximal introns during mRNA splicing. Therefore, in some embodiments, the nucleic acid molecules of this disclosure include a 5′-cap structure.

[0253] Nucleic acid molecules can be capped at the 5′ end via the cellular endogenous transcriptional apparatus, thereby creating a 5′-ppp-5′-triphosphate bond between the terminal guanosine cap residue of the polynucleotide and the sense nucleotide transcribed at the 5′ end. This 5′-guanosine cap can then be methylated to produce an N7-methyl-guanosine residue. The ribose of the nucleotide transcribed at the 5′ end and / or anteterminal of the polynucleotide can also optionally be 2′-O-methylated. 5′-uncapping via hydrolysis and cleavage of the guanosine cap structure can target nucleic acid molecules, such as mRNA molecules, for degradation.

[0254] In some embodiments, the nucleic acid molecules of this disclosure include one or more modifications to the native 5′-cap structure produced by endogenous processes. Without being bound by theory, modification of the 5′-cap can increase the stability of the polynucleotide, increase its half-life, and increase its translation efficiency.

[0255] Exemplary modifications to the native 5′-cap structure include creating a non-hydrolyzable cap structure to prevent decapping and thereby increase the half-life of the polynucleotide. In some embodiments, because cap structure hydrolysis requires cleavage of the 5′-ppp-5′ phosphodiester bond, modified nucleotides may be used during the capping reaction. For example, in some embodiments, a vaccinia virus capping enzyme from New England Biolabs (Ipswich, Mass.) may be used with α-thioguanosine nucleotides to generate thiophosphate bonds in the 5′-ppp-5′ cap, according to the manufacturer's instructions. Additional modified guanosine nucleotides, such as α-methylphosphonic acid and selenophosphate nucleotides, may be used.

[0256] Additional exemplary modifications to the natural 5′-cap structure include modifications at the 2′ and / or 3′ positions of the capped guanosine triphosphate (GTP), substitution of the sugar epoxide (oxygen that produces the carbide ring) for the methylene moiety (CH2), modifications at the triphosphate bridge portion of the cap structure, or modifications at the nucleobase (G) portion.

[0257] Additional exemplary modifications to the natural 5′-cap structure include, but are not limited to, 2′-O-methylation of the ribose at the 2′-hydroxyl group of the 5′-terminus and / or the 5′-terminal prenucleotide of the polynucleotide (as described above). Several different 5′-cap structures can be used to generate 5′-caps for polynucleotides (e.g., mRNA molecules). Further exemplary 5′-cap structures that may be used in conjunction with this disclosure include those described in International Patent Publications Nos. WO2008127688, WO 2008016473, and WO 2011015347, the entire contents of which are incorporated herein by reference.

[0258] In various embodiments, the 5′-terminal cap may include a cap analogue. Cap analogues, also referred to herein as synthetic cap analogues, chemical caps, chemical cap analogues, or structural or functional cap analogues, have a chemical structure different from that of a natural (i.e., endogenous, wild-type, or physiological) 5′-cap while retaining cap function. Cap analogues may be synthesized and / or linked to polynucleotides chemically (i.e., non-enzymatically) or enzymatically.

[0259] For example, the anti-reverse cap analog (ARCA) cap contains two guanosines linked by 5′-5′-triphosphate groups, one of which contains an N7-methyl group and a 3′-O-methyl group (i.e., N7,3′-O-dimethyl-guanosine-5′-triphosphate-5′-guanosine, or m7G-3′mppp-G, which can be equivalently referred to as 3′O-Me-m7G(5′)ppp(5′)G). The 3′-O atom of the other unchanged guanosine is linked to the 5′-terminal nucleotide of the capped polynucleotide (e.g., mRNA). The N7- and 3′-O-methylated guanosine provides the terminal portion of the capped polynucleotide (e.g., mRNA). Another exemplary cap structure is mCAP, which is similar to ARCA but has a 2′-O-methyl group on the guanosine (i.e., N7,2′-O-dimethyl-guanosine-5′-triphosphate-5′-guanosine, or m7Gm-ppp-G).

[0260] In some embodiments, the cap analog may be a dinucleotide cap analog. As a non-limiting example, the dinucleotide cap analog may be modified at different phosphate ester positions with a boranophosphate group or a phophoroselenoate group, such as the dinucleotide cap analog described in U.S. Patent No. 8,519,110, the entire contents of which are incorporated herein by reference.

[0261] In some embodiments, the cap analog may be an N7-(4-chlorophenoxyethyl)-substituted dinucleotide cap analog known in the art and / or described herein. Non-limiting examples of N7-(4-chlorophenoxyethyl)-substituted dinucleotide cap analogs include N7-(4-chlorophenoxyethyl)-G(5′)ppp(5′)G and N7-(4-chlorophenoxyethyl)-m3′-OG(5′)ppp(5′)G cap analogs (see, for example, the various cap analogs and methods for synthesizing cap analogs described in Kore et al., Bioorganic & Medicinal Chemistry 2013 21:4570-4574; the entire contents of which are incorporated herein by reference). In other embodiments, the cap analog that may be used in conjunction with the nucleic acid molecules of this disclosure is a 4-chloro / bromophenoxyethyl analog.

[0262] In various embodiments, the cap analogue may include guanosine analogues. Useful guanosine analogues include, but are not limited to, inosine, N1-methyl-guanosine, 2′-fluoro-guanosine, 7-denitro-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, and 2-azido-guanosine.

[0263] Unbound by theory, it is anticipated that although cap analogs allow for simultaneous capping of polynucleotides in in vitro transcription reactions, up to 20% of transcripts will remain uncapped. This situation, along with the structural differences between cap analogs and the native 5′-cap structure of polynucleotides produced by endogenous cellular transcription mechanisms, may lead to reduced translational capacity and decreased cell stability.

[0264] Therefore, in some embodiments, the nucleic acid molecules of this disclosure may also be capped post-transcriptionally using enzymes to produce a more authentic 5′-cap structure. As used herein, the phrase “more authentic” means a feature that structurally or functionally closely reflects or mimics an endogenous or wild-type feature. That is, a “more authentic” feature better represents an endogenous, wild-type, natural, or physiological cellular function and / or structure compared to existing synthetic features or analogs, or that surpasses the corresponding endogenous, wild-type, natural, or physiological feature in one or more respects. Non-limiting examples of more authentic 5′-cap structures that may be used in conjunction with the nucleic acid molecules of this disclosure are structures that, compared to synthetic 5′-cap structures known in the art (or compared to wild-type, natural, or physiological 5′-cap structures), particularly have enhanced binding to cap-binding proteins, increased half-life, reduced sensitivity to 5′-endonucleases, and / or reduced 5′-uncapping. For example, in some embodiments, recombinant vaccinia virus capping enzyme and recombinant 2′-O-methyltransferase can create a classic 5′-5′-triphosphate bond between the 5′-terminal nucleotide of the polynucleotide and the guanosine cap nucleotide, wherein the cap guanosine contains N7-methylation and the 5′-terminal nucleotide of the polynucleotide contains 2′-O-methyl. This structure is called the cap 1 structure. Compared with other 5′ cap analog structures known, such as those in this art, this cap results in higher translational efficiency, cell stability, and reduced activation of pro-inflammatory cytokines. Other exemplary cap structures include 7mG(5')ppp(5')N,pN2p (cap 0), 7mG(5')ppp(5')NlmpNp (cap 1), 7mG(5')-ppp(5')NlmpN2mp (cap 2), and m(7)Gpppm(3)(6,6,2')Apm(2')Apm(2')Cpm(2))(3,2')Up (cap 4).

[0265] Unbound by theory, it is expected that the nucleic acid molecules disclosed herein can be capped post-transcriptionally, and because this method is relatively efficient, almost 100% of nucleic acid molecules can be capped.

[0266] Untranslated Region (UTR)

[0267] In some embodiments, the nucleic acid molecule of this disclosure comprises one or more untranslated regions (UTRs). In some embodiments, the UTR is located upstream of the coding region in the nucleic acid molecule and is referred to as a 5′-UTR. In some embodiments, the UTR is located downstream of the coding region in the nucleic acid molecule and is referred to as a 3′-UTR. The sequence of the UTR may be homologous or heterologous to the sequence of the coding region found in the nucleic acid molecule. Multiple UTRs may be included in the nucleic acid molecule and may have the same or different sequences and / or genetic origins. According to this disclosure, any portion of the UTR in the nucleic acid molecule (including any portion) may be codon-optimized, and any portion may independently contain one or more different structural or chemical modifications before and / or after codon optimization.

[0268] In some embodiments, the nucleic acid molecule (e.g., mRNA) of this disclosure comprises a UTR and a coding region that are homologous to each other. In other embodiments, the nucleic acid molecule (e.g., mRNA) of this disclosure comprises a UTR and a coding region that are heterologous to each other. In some embodiments, to monitor the activity of the UTR sequence, a nucleic acid molecule comprising a coding sequence of a UTR and a detectable probe may be administered in vitro (e.g., in cell or tissue cultures) or in vivo (e.g., to a subject), and the effect of the UTR sequence (e.g., regulation of expression levels, cellular localization of the coding product, or half-life of the coding product) may be measured using methods known in this art.

[0269] In some embodiments, the UTR of the nucleic acid molecule (e.g., mRNA) of this disclosure includes at least one translational enhancer element (TEE), which serves to increase the amount of polypeptide or protein produced by the nucleic acid molecule. In some embodiments, the TEE is located in the 5′-UTR of the nucleic acid molecule. In other embodiments, the TEE is located at the 3′-UTR of the nucleic acid molecule. In other embodiments, at least two TEEs are located at the 5′-UTR and 3′-UTR of the nucleic acid molecule, respectively. In some embodiments, the nucleic acid molecule (e.g., mRNA) of this disclosure may contain one or more copies of a TEE sequence or more than one different TEE sequence. In some embodiments, the different TEE sequences present in the nucleic acid molecule of this disclosure may be homologous or heterologous relative to each other.

[0270] Various TEE sequences are known in this art and can be used in conjunction with this disclosure. For example, in some embodiments, the TEE may be an internal ribosome entry site (IRES), an HCV-IRES, or an IRES element. (See Chappell et al., Proc. Natl. Acad. Sci. USA 101:9590-9594, 2004; Zhou et al., Proc. Natl. Acad. Sci. 102:6273-6278, 2005.) Additional internal ribosome entry sites (IRES) that can be used in conjunction with this disclosure include, but are not limited to, the IRES described in U.S. Patent No. 7,468,275, U.S. Patent Publication No. 2007 / 0048776, and U.S. Patent Publication No. 2011 / 0124100, and International Patent Publication Nos. WO2007 / 025008 and WO2001 / 055369, the contents of which are incorporated herein by reference in their entirety. In some implementations, the TEE may be the TEE described in Supplement Table 1 and Supplement Table 2 of Wellensiek et al., Genome-wide profiling of human cap-independent translation-enhancing elements, Nature Methods, August 2013; 10(8): 747-750; the contents of each reference are incorporated herein by reference in full.

[0271] Additional exemplary TEEs that may be used in conjunction with this disclosure include, but are not limited to, U.S. Patent Nos. 6,310,197, 6,849,405, 7,456,273, 7,183,395, 2009 / 0226470, 2013 / 0177581, 2007 / 0048776, 2011 / 0124100, and others. The TEE sequences described in Patent No. 2009 / 0093049, International Patent Publication No. WO2009 / 075886, International Patent Publication No. WO2012 / 009644, International Patent Publication No. WO1999 / 024595, International Patent Publication No. WO2007 / 025008, International Patent Publication No. WO2001 / 055371, European Patent No. 2610341, and European Patent No. 2610340 are incorporated herein by reference in their entirety.

[0272] In various embodiments, the nucleic acid molecule (e.g., mRNA) of this disclosure comprises at least one UTR containing at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, or more than 60 TEE sequences. In some embodiments, the TEE sequences in the UTR of the nucleic acid molecule are copies of the same TEE sequence. In other embodiments, at least two TEE sequences in the UTR of the nucleic acid molecule have different TEE sequences. In some embodiments, multiple different TEE sequences are arranged in one or more repeat patterns in the UTR region of the nucleic acid molecule. For illustrative purposes only, the repeat pattern may be, for example, ABABAB, AABBBAABBAABB, ABCABCABC, etc., where each uppercase letter (A, B, or C) represents a different TEE sequence in these exemplary patterns. In some embodiments, at least two TEE sequences are consecutive to each other in the UTR of the nucleic acid molecule (i.e., there is no spacer subsequence between them). In other embodiments, at least two TEE sequences are separated by spacer subsequences. In some embodiments, the UTR may contain a TEE sequence-spacer subsequence module that is repeated at least once, at least twice, at least three times, at least four times, at least five times, at least six times, at least seven times, at least eight times, at least nine times, or more in the UTR. In any embodiment described in this paragraph, the UTR may be a 5′-UTR, a 3′-UTR, or both a 5′-UTR and a 3′-UTR of the nucleic acid molecule.

[0273] In some embodiments, the UTR of the nucleic acid molecule (e.g., mRNA) disclosed herein includes at least one translation repressive element that reduces the amount of polypeptide or protein produced by the nucleic acid molecule. In some embodiments, the UTR of the nucleic acid molecule includes one or more miR sequences or fragments thereof (e.g., miR seed sequences) recognized by one or more microRNAs. In some embodiments, the UTR of the nucleic acid molecule includes one or more stem-loop structures that downregulate the translational activity of the nucleic acid molecule. Other mechanisms for inhibiting translational activity associated with nucleic acid molecules are known in the art. In any embodiment described in this paragraph, the UTR may be a 5′-UTR, a 3′-UTR, or both a 5′-UTR and a 3′-UTR of the nucleic acid molecule.

[0274] Poly-A region

[0275] In natural RNA processing, long-chain adenosine nucleotides (poly-A regions) are typically added to messenger RNA (mRNA) molecules to increase molecular stability. Immediately after transcription, the 3′ end of the transcript is cleaved to release the 3′-hydroxyl group. Then, a poly-A polymerase adds a cascade of adenosine nucleotides to the RNA. This process, called polyadenylation, adds a poly-A region of 100 to 250 residues in length. Without being bound by theory, the poly-A region is expected to confer several advantages to the nucleic acid molecules of this disclosure.

[0276] Therefore, in some embodiments, the nucleic acid molecule (e.g., mRNA) of this disclosure contains a polyadenylation signal. In some embodiments, the nucleic acid molecule (e.g., mRNA) of this disclosure contains one or more polyadenylated (poly-A) regions. In some embodiments, the poly-A region is composed entirely of adenine nucleotides or their functional analogues. In some embodiments, the nucleic acid molecule contains at least one poly-A region at its 3′ end. In some embodiments, the nucleic acid molecule contains at least one poly-A region at its 5′ end. In some embodiments, the nucleic acid molecule contains at least one poly-A region at its 5′ end and at least one poly-A region at its 3′ end.

[0277] According to this disclosure, the poly-A region may have different lengths in different embodiments. Specifically, in some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 30 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 35 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 40 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 45 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 50 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 55 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 60 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 65 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 70 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 75 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 80 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 85 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 90 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 95 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 100 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 110 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 120 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 130 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 140 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 150 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 160 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 170 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 180 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 190 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 200 nucleotides long.In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 225 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 250 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 275 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 300 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 350 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 400 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 450 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 500 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 600 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 700 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 800 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 900 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 1000 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 1100 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 1200 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 1300 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 1400 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 1500 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 1600 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 1700 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 1800 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 1900 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 2000 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 2250 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 2500 nucleotides long.In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 2750 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 3000 nucleotides long.

[0278] In some embodiments, the length of the poly-A region in a nucleic acid molecule may be selected based on the total length of the nucleic acid molecule or a portion thereof (e.g., the length of the coding region or the length of the open reading frame). For example, in some embodiments, the poly-A region accounts for approximately 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or higher percentages of the total length of the nucleic acid molecule containing the poly-A region.

[0279] Unbound by theory, it is anticipated that certain RNA-binding proteins can bind to the poly-A region located at the 3′ end of mRNA molecules. These poly-A binding proteins (PABPs) can regulate mRNA expression, for example, by interacting with translation initiation mechanisms in cells and / or protecting the 3′-poly-A tail from degradation. Therefore, in some embodiments, the nucleic acid molecules (e.g., mRNA) of this disclosure contain at least one binding site of a poly-A binding protein (PABP). In other embodiments, the nucleic acid molecules are conjugated or complexed with PABPs before being loaded into a delivery medium (e.g., lipid nanoparticles).

[0280] In some embodiments, the nucleic acid molecules (e.g., mRNA) disclosed herein comprise a poly-AG tetrad. A G tetrad is a circular array of four hydrogen-bonded guanosine nucleotides that can be formed from G-rich sequences in DNA and RNA. In this embodiment, the G tetrad is incorporated into one end of the poly-A region. The stability, protein yield, and other parameters of the resulting polynucleotide (e.g., mRNA) can be analyzed, including half-life at different time points. It has been found that the protein yield of the poly-AG tetrad structure is at least 75% of the protein yield observed using only the poly-A region containing 120 nucleotides.

[0281] In some embodiments, the nucleic acid molecule (e.g., mRNA) disclosed herein may include a poly-A region and may be stabilized by adding a 3′-stabilizing region. In some embodiments, the 3′-stabilizing region that can be used to stabilize the nucleic acid molecule (e.g., mRNA) includes a poly-A or poly-AG quadruple structure as described in International Patent Publication No. WO2013 / 103659, the contents of which are incorporated herein by reference in their entirety.

[0282] In other embodiments, the 3′-stable region that can be used in conjunction with the nucleic acid molecules of this disclosure includes chain-terminating nucleosides, such as, but not limited to, 3′-deoxyadenosine (cordycepin); 3′-deoxyuridine; 3′-deoxycytosine; 3′-deoxyguanosine; 3′-deoxythymidine; 2',3'-dideoxynucleosides, such as 2',3'-dideoxyadenosine, 2',3'-dideoxyuridine, 2',3'-dideoxycytosine, 2',3'-dideoxyguanosine, 2',3'-dideoxythymidine; 2′-deoxynucleosides; or O-methylnucleosides: 3′-deoxynucleosides; 2',3'-dideoxynucleosides; 3′-O-methylnucleosides; 3′-O-ethylnucleosides; 3′-arabinoside; and other alternative nucleosides known in this art and / or described herein.

[0283] Secondary structure

[0284] Unbound by theory, stem-loop structures are expected to guide RNA folding, protect the structural stability of nucleic acid molecules (e.g., mRNA), provide recognition sites for RNA-binding proteins, and serve as substrates for enzymatic reactions. For example, the incorporation of miR and / or TEE sequences will alter the shape of the stem-loop region, thereby increasing and / or decreasing translation (Kedde et al., A Pumilio-induced RNA structure switch in p27-3'UTR controls miR-221 and miR-222 accessibility. N at Cell Biol., Oct 2010; 12(10): 1014-20, the contents of which are incorporated herein by reference in their entirety).

[0285] Therefore, in some embodiments, the nucleic acid molecule (e.g., mRNA) or a portion thereof described herein may have a stem-loop structure, such as, but not limited to, histone stem-loops. In some embodiments, the stem-loop structure is formed by a stem-loop sequence of about 25 or about 26 nucleotides in length, such as, but not limited to, the structure described in International Patent Publication No. WO2013 / 103659, the contents of which are incorporated herein by reference in their entirety. Additional examples of stem-loop sequences include those described in International Patent Publications No. WO2012 / 019780 and No. WO201502667, the contents of which are incorporated herein by reference. In some embodiments, the stem-loop sequence comprises a TEE as described herein. In some embodiments, the stem-loop sequence comprises a miR sequence as described herein. In a particular embodiment, the stem-loop sequence may comprise a miR-122 seed sequence. In a particular embodiment, the nucleic acid molecule comprises the stem-loop sequence CAAAGGCTCTTTTCAGAGCCACCA (SEQ ID NO: 1). In other embodiments, the nucleic acid molecule contains the stem-loop sequence CAAAGGCUCUUUUCAGAGCCACCA (SEQ ID NO: 2).

[0286] In some embodiments, the nucleic acid molecule (e.g., mRNA) of this disclosure includes a stem-loop sequence located upstream (at the 5′ end) of the coding region in the nucleic acid molecule. In some embodiments, the stem-loop sequence is located within the 5′-UTR of the nucleic acid molecule. In some embodiments, the nucleic acid molecule (e.g., mRNA) of this disclosure includes a stem-loop sequence located downstream (at the 3′ end) of the coding region in the nucleic acid molecule. In some embodiments, the stem-loop sequence is located within the 3′-UTR of the nucleic acid molecule. In some cases, the nucleic acid molecule may contain more than one stem-loop sequence. In some embodiments, the nucleic acid molecule contains at least one stem-loop sequence in the 5′-UTR and at least one stem-loop sequence in the 3′-UTR.

[0287] In some embodiments, the nucleic acid molecule containing the stem-loop structure further includes a stable region. In some embodiments, the stable region contains at least one chain-terminating nucleoside, which serves to slow down degradation and thereby increase the half-life of the nucleic acid molecule. Exemplary chain-terminating nucleosides that can be used in conjunction with the nucleic acid molecules of this disclosure include, but are not limited to, 3′-deoxyadenosine (cordycepin); 3′-deoxyuridine; 3′-deoxycytosine; 3′-deoxyguanosine; 3′-deoxythymidine; 2',3'-dideoxynucleosides, such as 2',3'-dideoxyadenosine, 2',3'-dideoxyuridine, 2',3'-dideoxycytosine, 2',3'-dideoxyguanosine, 2',3'-dideoxythymidine; 2′-deoxynucleosides; or O-methylnucleosides; 3′-deoxynucleosides; 2',3'-dideoxynucleosides; 3′-O-methylnucleosides; 3′-O-ethylnucleosides; 3′-arabinoside; and other alternative nucleosides known in this art and / or described herein. In other embodiments, the stem-loop structure can be stabilized by altering the 3′-region of the polynucleotide, which can prevent and / or inhibit the addition of oligomers (U) (International Patent Publication No. WO2013 / 103659, which is incorporated herein by reference in its entirety).

[0288] In some embodiments, the nucleic acid molecules of this disclosure comprise at least one stem-loop sequence and a poly-A region or polyadenylation signal. Non-limiting examples of polynucleotide sequences comprising at least one stem-loop sequence and a poly-A region or polyadenylation signal include sequences described in International Patent Publications WO2013 / 120497, WO2013 / 120629, WO2013 / 120500, WO2013 / 120627, WO2013 / 120498, WO2013 / 120626, WO2013 / 120499, and WO2013 / 120628, the contents of which are incorporated herein by reference in their entirety.

[0289] In some embodiments, nucleic acid molecules containing stem-loop sequences and poly-A regions or polyadenylation signals may encode pathogen antigens or fragments thereof, such as the polynucleotide sequences described in International Patent Publications WO2013 / 120499 and WO2013 / 120628, the contents of which are incorporated herein by reference in their entirety.

[0290] In some embodiments, nucleic acid molecules containing stem-loop sequences and poly-A regions or polyadenylation signals may encode therapeutic proteins, such as the polynucleotide sequences described in International Patent Publications WO2013 / 120497 and WO2013 / 120629, the contents of which are incorporated herein by reference in their entirety.

[0291] In some embodiments, nucleic acid molecules containing stem-loop sequences and poly-A regions or polyadenylation signals may encode tumor antigens or fragments thereof, such as the polynucleotide sequences described in International Patent Publications WO2013 / 120500 and WO2013 / 120627, the contents of which are incorporated herein by reference in their entirety.

[0292] In some embodiments, nucleic acid molecules containing stem-loop sequences and poly-A regions or polyadenylation signals may encode sensitizing antigens or autoimmune autoantigens, such as the polynucleotide sequences described in International Patent Publications WO2013 / 120498 and WO2013 / 120626, the contents of which are incorporated herein by reference in their entirety.

[0293] Functional nucleotide analogs

[0294] In some embodiments, the payload nucleic acid molecules described herein contain only classical nucleotides selected from A (adenosine), G (guanosine), C (cytosine), U (uridine), and T (thymidine). Without being bound by theory, it is anticipated that certain functional nucleotide analogs may confer useful properties to nucleic acid molecules. In the context of this disclosure, examples of such useful properties include, but are not limited to, increased stability of the nucleic acid molecule, decreased immunogenicity of the nucleic acid molecule in inducing an innate immune response, increased yield of proteins encoded by the nucleic acid molecule, increased intracellular delivery and / or retention of the nucleic acid molecule, and / or decreased cytotoxicity of the nucleic acid molecule.

[0295] Therefore, in some embodiments, the nucleic acid-loaded molecule comprises at least one functional nucleotide analog as described herein. In some embodiments, the functional nucleotide analog contains at least one chemical modification targeting a nucleotide base, glycosyl group, and / or phosphate ester group. Thus, a nucleic acid-loaded molecule containing at least one functional nucleotide analog contains at least one chemical modification targeting a nucleotide base, glycosyl group, and / or nucleoside linking. Exemplary chemical modifications for nucleotide base, glycosyl group, or nucleoside linking of nucleic acid molecules are provided herein.

[0296] As described herein, nucleotides comprising 0% to 100% of all nucleotides in an effective nucleic acid molecule may be functional nucleotide analogs as described herein. For example, in various embodiments, approximately 1% to 20%, approximately 1% to 25%, approximately 1% to 50%, approximately 1% to 60%, approximately 1% to 70%, approximately 1% to 80%, approximately 1% to 90%, approximately 1% to 95%, approximately 10% to 20%, approximately 10% to 25%, approximately 10% to 50%, approximately 10% to 60%, approximately 10% to 70%, approximately 10% to 80%, approximately 10% to 90%, approximately 10% to 95%, approximately 10% to 100%, approximately 20% to 25%, approximately 20% to 50%, approximately 20% to 60%, approximately 20% to 70% % of, about 20% to about 80%, about 20% to about 90%, about 20% to about 95%, about 20% to about 100%, about 50% to about 60%, about 50% to about 70%, about 50% to about 80%, about 50% to about 90%, about 50% to about 95%, about 50% to about 100%, about 70% to about 80%, about 70% to about 90%, about 70% to about 95%, about 70% to about 100%, about 80% to about 90%, about 80% to about 95%, about 80% to about 100%, about 90% to about 95%, about 90% to about 100%, or about 95% to about 100% of the nucleotides are the functional nucleotide analogs described herein. In any of these embodiments, the functional nucleotide analog may be present at any position in the nucleic acid molecule, including the 5′-terminus, 3′-terminus, and / or one or more internal positions. In some implementations, a single nucleic acid molecule may contain different sugar modifications, different nucleobase modifications, and / or different types of internucleotide bonds (e.g., main chain structure).

[0297] As described herein, the functional nucleotide analogues described herein may be 0% to 100% of all nucleotides of one type in a nucleic acid molecule (e.g., all purine nucleotides of one type, or all pyrimidine nucleotides of one type, or all A, G, C, T, or U of one type). For example, in various embodiments, the nucleic acid molecule contains approximately 1% to approximately 20%, approximately 1% to approximately 25%, approximately 1% to approximately 50%, approximately 1% to approximately 60%, approximately 1% to approximately 70%, approximately 1% to approximately 80%, approximately 1% to approximately 90%, approximately 1% to approximately 95%, approximately 10% to approximately 20%, approximately 10% to approximately 25%, approximately 10% to approximately 50%, approximately 10% to approximately 60%, approximately 10% to approximately 70%, approximately 10% to approximately 80%, approximately 10% to approximately 90%, approximately 10% to approximately 95%, approximately 10% to approximately 100%, approximately 20% to approximately 25%, approximately 20% to approximately 50%, approximately 20% to approximately 60%, approximately 20% to approximately 70%, approximately 20% to approximately 70%, approximately 1 ... 0%, about 20% to about 80%, about 20% to about 90%, about 20% to about 95%, about 20% to about 100%, about 50% to about 60%, about 50% to about 70%, about 50% to about 80%, about 50% to about 90%, about 50% to about 95%, about 50% to about 100%, about 70% to about 80%, about 70% to about 90%, about 70% to about 95%, about 70% to about 100%, about 80% to about 90%, about 80% to about 95%, about 80% to about 100%, about 90% to about 95%, about 90% to about 100%, or about 95% to about 100% of the nucleotides are the functional nucleotide analogs described herein. In any of these embodiments, the functional nucleotide analog may be present at any position in the nucleic acid molecule, including the 5′-terminus, 3′-terminus, and / or one or more internal positions. In some implementations, a single nucleic acid molecule may contain different sugar modifications, different nucleobase modifications, and / or different types of internucleotide bonds (e.g., main chain structure).

[0298] Modification of nucleobases

[0299] In some embodiments, the functional nucleotide analog contains non-classical nucleobases. In some embodiments, classical nucleobases in the nucleotide (e.g., adenine, guanine, uracil, thymine, and cytosine) may be modified or substituted to provide one or more functional analogs of the nucleotide. Exemplary modifications of nucleobases include, but are not limited to, one or more substitutions or modifications, including, but not limited to, alkyl, aryl, halogen, oxo, hydroxyl, alkoxy, and / or thio substitutions; one or more fused or ring-opening, oxidation, and / or reduction.

[0300] In some embodiments, the non-classical nucleobase is a modified uracil. Exemplary nucleobases and nucleosides having modified uracil include pseudouridine (ψ), pyridine-4-ketoribonucleotide, 5-azauracil, 6-azauracil, 2-thio-5-azauracil, 2-thiouracil (s2U), 4-thiouracil (s4U), 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxyuracil (ho5U), 5-aminoallyluracil, 5-halouracil (e.g., 5-iodouracil or 5-bromouracil), 3-methyluracil (m3U), 5-methoxyuracil (mo5U), and uracil 5- Oxyacetic acid (cmo5U), methyl 5-oxyacetic acid ester (mcmo5U), 5-carboxymethyl-uracil (cm5U), 1-carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uracil (chm5U), methyl 5-carboxyhydroxymethyl-uracil ester (mchm5U), 5-methoxycarbonylmethyl-uracil (mcm5U), 5-methoxycarbonylmethyl-2-thiouracil (mcm5s2U), 5-aminomethyl-2-thiouracil (nm5s2U), 5-methylaminomethyluracil (mnm5U), 5-methylaminomethyl-2- Thiouracil (mnm5s2U), 5-methylaminomethyl-2-selenouracil (mnm5se2U), 5-carbamoylmethyluracil (ncm5U), 5-carboxymethylaminomethyl-uracil (cmnm5U), 5-carboxymethylaminomethyl-2-thiouracil (cmnm5s2U), 5-propynyl-uracil, 1-propynyl-pseudouracil, 5-tauronic acid methyl-uracil (τm5U), 1-tauronic acid methyl-pseudouridine, 5-tauronic acid methyl-2-thio-uracil (τm55s2U), 1-tauronic acid methyl-4- Thio-pseudouridine, 5-methyl-uridine (m5U, i.e., deoxythymidine with nucleobase), 1-methyl-pseudouridine (m1ψ), 1-ethyl-pseudouridine (Et1ψ), 5-methyl-2-thio-uridine (m5s2U), 1-methyl-4-thio-pseudouridine (m1s4ψ), 4-thio-1-methyl-pseudouridine, 3-methyl-pseudouridine (m3ψ), 2-thio-1-methyl-pseudouridine, 1-methyl-1-deazo-pseudouridine, 2-thio-1-methyl-1-deazo-pseudouridine, dihydrouridine (D), dihydropseudouridine, 5,6-Dihydrouracil, 5-Methyl-Dihydrouracil (m5D), 2-Thio-Dihydrouracil, 2-Thio-Dihydropseudouridine, 2-Methoxy-uracil, 2-Methoxy-4-Thio-uracil, 4-Methoxy-pseudouridine, 4-Methoxy-2-Thio-pseudouridine, N1-Methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uracil (acp3U), 1-Methyl-3-(3-amino-3-carboxypropyl)pseudouridine (acp3ψ), 5-(isopentenylaminomethyl)uracil (m5U), 5-(isopentenylaminomethyl)-2-Thio-uracil (m5s2U), 5,2'-O-Dimethyluridine (m5Um), 2-Thio-2'-O-Methyluridine (s2Um), 5-Methoxycarbonyl 5-Carbamoylmethyl-2'-O-methyluridine (mcm5Um), 5-carbamoylmethyl-2'-O-methyluridine (ncm5Um), 5-carboxymethylaminomethyl-2'-O-methyluridine (cmnm5Um), 3,2'-O-dimethyluridine (m3Um), and 5-(isopentenylaminomethyl)-2'-O-methyluridine (inm5Um), 1-thiouracil, deoxythymidine, 5-(2-methoxycarbonylvinyl)uracil, 5-(carbamoylhydroxymethyl)uracil, 5-carbamoylmethyl-2-thiouracil, 5-carboxymethyl-2-thiouracil, 5-cyanomethyluracil, 5-methoxy-2-thiouracil, and 5-[3-(1-E-propenylamino)]uracil.

[0301] In some embodiments, the non-classical nucleobase is a modified cytosine. Exemplary nucleobases and nucleosides having modified cytosine include 5-azacytosine, 6-azacytosine, pseudoisocytosine, 3-methylcytosine (m3C), N4-acetylcytosine (ac4C), 5-formylcytosine (f5C), N4-methylcytosine (m4C), 5-methylcytosine (m5C), 5-halocytosine (e.g., 5-iodocytosine), and 5-hydroxymethylcytosine. 1-Cytosine (hm5C), 1-Methyl-Pseudo-Cytosine, Pyrrolocytosine, Pyrrolocytosine, 2-Thiocytosine (s2C), 2-Thio-5-Methylcytosine, 4-Thio-Pseudo-Cytosine, 4-Thio-1-Methyl-Pseudo-Cytosine, 4-Thio-1-Methyl-1-Denitro-Pseudo-Cytosine, 1-Methyl-1-Denitro-Pseudo-Cytosine, Zeburaline, 5-aza-Zebrolin, 5-Methyl-Zebrolin, 5-aza-2-Thio-Zebrolin, 2-Thio-Zebrolin, 2-Methoxy-Cytosine, 2-Methoxy-5-Methylcytosine, 4-Methoxy-Pseudo-Cytosine, 4-Methoxy-1-Methyl-Pseudo-Cytosine, Lysidine (k2C), 5,2'-O-Dimethyl-Cytosine (m5Cm), N4-ethyl Acyl-2'-O-methyl-cytidine (ac4Cm), N4,2'-O-dimethyl-cytidine (m4Cm), 5-formyl-2'-O-methyl-cytidine (fSCm), N4,N4,2'-O-trimethyl-cytidine (m42Cm), 1-thio-cytosine, 5-hydroxy-cytosine, 5-(3-azidopropyl)-cytosine, and 5-(2-azidoethyl)-cytosine.

[0302] In some embodiments, the non-classical nucleobase is a modified adenine. Exemplary nucleobases and nucleosides having alternative adenine include 2-amino-purine, 2,6-diamino-purine, 2-amino-6-halo-purine (e.g., 2-amino-6-chloro-purine), 6-halo-purine (e.g., 6-chloro-purine), 2-amino-6-methyl-purine, 8-azido-adenine, 7-deadenine, 7-deadenine-8-aza-adenine, 7-deadenine-2-amino-purine, 7-deadenine-2,6-diamino-purine, 7-deadenine-8-aza-adenine, etc. -2,6-Diaminopurine, 1-methyl-adenine (m1A), 2-methyl-adenine (m2A), N6-methyl-adenine (m6A), 2-methylthio-N6-methyl-adenine (ms2m6A), N6-isopentenyl-adenine (i6A), 2-methylthio-N6-isopentenyl-adenine (ms2i6A), N6-(cis-hydroxyisopentenyl)adenine (io6A), 2-methylthio-N6-(cis-hydroxyisopentenyl)adenine (ms2io6A), N6-glycylcarbamate N6-Adenine (g6A), N6-Threonylcarbamoyl-Adenine (t6A), N6-Methyl-N6-Threonylcarbamoyl-Adenine (m6t6A), 2-Methylthio-N6-Threonylcarbamoyl-Adenine (ms2g6A), N6,N6-Dimethyl-Adenine (m62A), N6-Hydroxyn-Valylcarbamoyl-Adenine (hn6A), 2-Methylthio-N6-Hydroxyn-Valylcarbamoyl-Adenine (ms2hn6A), N6-Acetyl-Adenine (ac6A) 7-Methyl-adenine, 2-methylthio-adenine, 2-methoxy-adenine, N6,2'-O-dimethyl-adenine (m6Am), N6,N6,2'-O-trimethyl-adenine (m62Am), 1,2'-O-dimethyl-adenine (m1Am), 2-amino-N6-methyl-purine, 1-thio-adenine, 8-azido-adenine, N6-(19-amino-pentaenodecyl)-adenine, 2,8-dimethyl-adenine, N6-formyl-adenine, and N6-hydroxymethyl-adenine.

[0303] In some embodiments, the non-classical nucleobase is modified guanine. Exemplary nucleobases and nucleosides having modified guanine include inosine (I), 1-methyl-inosine (m1I), wyosine (imG), methyl-wyosine (mimG), 4-demethyl-wyosine (imG-14), isowyosine (imG2), wybutosine (yW), peroxy-wyosine (o2yW), hydroxy-wyosine (OHyW), undermodified hydroxy-wyosine (OHyW*), 7-denitro- Guanine, queuosine (Q), epoxyqueuosine (oQ), galactosyl-queuosine (galQ), mannosyl-queuosine (manQ), 7-cyano-7-deazo-guanine (preQO), 7-aminomethyl-7-deazo-guanine (preQ1), archaeosine (G+), 7-deazo-8-aza-guanine, 6-thio-guanine, 6-thio-7-deazo-guanine, 6-thio-7-deazo-8-aza-guanine, 7-methyl 6-methyl-guanine (m7G), 6-thio-7-methyl-guanine, 7-methyl-inosine, 6-methoxy-guanine, 1-methyl-guanine (m1G), N2-methyl-guanine (m2G), N2,N2-dimethyl-guanine (m22G), N2,7-dimethyl-guanine (m2,7G), N2,N2,7-dimethyl-guanine (m2,2,7G), 8-oxo-guanine, 7-methyl-8-oxo-guanine, 1-methyl-6-thio-guanine, N2-methyl-6- Thio-guanine, N2,N2-dimethyl-6-thio-guanine, N2-methyl-2'-O-methyl-guanosine (m2Gm), N2,N2-dimethyl-2'-O-methyl-guanosine (m22Gm), 1-methyl-2'-O-methyl-guanosine (m1Gm), N2,7-dimethyl-2'-O-methyl-guanosine (m2,7Gm), 2'-O-methyl-inosine (Im), 1,2'-O-dimethyl-inosine (m1Im), 1-thio-guanine, and O-6-methyl-guanine.

[0304] In some embodiments, the noncanonical nucleobase of the functional nucleotide analog may independently be a purine, pyrimidine, a purine analog, or a pyrimidine analog. For example, in some embodiments, the noncanonical nucleobase may be a modified adenine, cytosine, guanine, uracil, or hypoxanthine. In other embodiments, non-classical nucleobases may also include, for example, naturally occurring and synthetic derivatives of the base, including pyrazolo[3,4-d]pyrimidine; 5-methylcytosine (5-me-C); 5-hydroxymethylcytosine; xanthine; hypoxanthine; 2-aminoadenine; 6-methyl and other alkyl derivatives of adenine and guanine; 2-propyl and other alkyl derivatives of adenine and guanine; 2-thiouracil, 2-thiothymine, and 2-thiocytosine; 5-propynyluracil and cytosine; 6-azouracil, cytosine, and thymine; 5-uracil (pseudouracil); 4-thiouracil; 8-halogenated (e.g., 8-bromo), 8-amino, 8-thiol 8-Thioalkyl, 8-hydroxy and other 8-substituted adenine and guanine; 5-halogenated, especially 5-bromo, 5-trifluoromethyl and other 5-substituted uracil and cytosine; 7-methylguanine and 7-methyladenine; 8-azaguanine and 8-azaaadenine; deadenine, 7-deadenine, 3-deadenine; deadenine, 7-deadenine, 3-deadenine; pyrazolo[3,4-d]pyrimidine; imidazo[1,5-a]1,3,5-triazinone; 9-deadenine; imidazo[4,5-d]pyrazine; thiazo[4,5-d]pyrimidine; pyrazin-2-one; 1,2,4-triazine; pyridazine; or 1,3,5-triazine.

[0305] Sugar modification

[0306] In some embodiments, the functional nucleotide analog contains a non-classical glycosyl group. In various embodiments, the non-classical glycosyl group may be a 5- or 6-carbon sugar with one or more substitutions (e.g., pentose, ribose, arabinose, xylose, glucose, galactose, or deoxygenated derivatives thereof), wherein the one or more substitutions are, for example, halogen, hydroxyl, thiol, alkyl, alkoxy, alkenyloxy, alkynyloxy, cycloalkyl, aminoalkoxy, alkoxyalkoxy, hydroxyalkoxy, amino, azide, aryl, aminoalkyl, aminoalkenyl, aminoalkynyl, etc.

[0307] Generally, RNA molecules contain a ribose, which is an oxygen-containing 5-membered ring. Exemplary non-restrictive alternative nucleotides include oxygen substitution in the ribose (e.g., substitution with S, Se, or alkylene groups such as methylene or ethylene); addition of a double bond (e.g., substitution of the ribose with a cyclopentenyl or cyclohexenyl group); ring contraction of the ribose (e.g., for forming a 4-membered ring of cyclobutane or oxetane); ring expansion of the ribose (e.g., for forming a 6- or 7-membered ring with an additional carbon or heteroatom, such as for dehydrated hexitol, altritol, mannitol, cyclohexyl, ... Cyclohexenyl and N-morpholinyl (which also have an aminophosphate backbone)); polycyclic forms (e.g., tricyclic and “unlocked” forms, such as diol nucleic acids (GNA) (e.g., R-GNA or S-GNA, in which the ribose is replaced by a diol unit linked to a phosphodiester bond), threononucleotides (TNA, in which the ribose is replaced by α-L-furanthreosyl-(3'→2')) and peptide nucleic acids (PNA, in which 2-amino-ethyl-glycine is used to replace the ribose and phosphodiester backbone)).

[0308] In some embodiments, the glycosyl group contains one or more carbons having a stereochemical configuration opposite to that of the corresponding carbon in ribose. Therefore, nucleic acid molecules may include nucleotides containing, for example, arabinose or L-ribose as sugars. In some embodiments, nucleic acid molecules include at least one nucleoside wherein the sugar is L-ribose, 2′-O-methylribose, 2′-fluororibose, arabinose, hexitol, LNA, or PNA.

[0309] Modification of internucleotide bonds

[0310] In some embodiments, the payload nucleic acid molecule of this disclosure may contain one or more modified nucleoside-to-nucleotide bonds (e.g., a phosphate backbone). The phosphate backbone groups can be modified by replacing one or more oxygen atoms with different substituents.

[0311] In some embodiments, the functional nucleotide analog may include an unaltered phosphate moiety replaced by another nucleoside linker as described herein. Examples of alternative phosphate groups include, but are not limited to, thiophosphates, selenophosphates, borane phosphates, borane phosphates, phosphonates, aminophosphates, diaminophosphates, alkyl or aryl phosphonates, and phosphate triesters. Both non-linked oxygen atoms in dithiophosphates are sulfur-substituted. The phosphate linker can also be modified by replacing the linking oxygen atoms with nitrogen (bridged aminophosphate), sulfur (bridged thiophosphate), and carbon (bridged methylene phosphonate).

[0312] Alternative nucleosides and nucleotides may include one or more non-bridging oxygen atoms replaced by a borane moiety (BH3), sulfur (thio), methyl, ethyl, and / or methoxy group. As a non-limiting example, two non-bridging oxygen atoms at the same position (e.g., alpha (α), beta (β), or gamma (γ) position) may be replaced by sulfur (thio) and methoxy groups. The substitution of one or more oxygen atoms at the phosphate moiety position (e.g., α-thiophosphate) may confer RNA and DNA stability (e.g., stability against exonucleases and endonucleases) via a non-natural thiophosphate backbone. Thiophosphate DNA and RNA exhibit increased nuclease resistance and therefore a longer half-life in the cellular environment.

[0313] This document describes other nucleoside interlinkings that may be used according to this disclosure, including nucleoside interlinkings that do not contain phosphorus atoms.

[0314] Additional examples of nucleic acid molecules (e.g., mRNA), related compositions, formulations, and / or methods that may be used in conjunction with this disclosure further include WO2002 / 098443, WO2003 / 051401, WO2008 / 052770, WO2009127230, WO2006122828, WO2008 / 083949, WO2010088927, WO2010 / 037539, WO2004 / 004743, and WO2005 / 01. 6376、WO2006 / 024518、WO2007 / 095976、WO2008 / 014979、WO2008 / 077592、WO2009 / 030481、WO2009 / 095226 , WO2011069586, WO2011026641, WO2011 / 144358, WO2012019780, WO2012013326, WO2012089338, WO2012113 513. WO2012116811, WO2012116810, WO2013113502, WO2013113501, WO2013113736, WO2013143698, WO2013 143699, WO2013143700, WO2013 / 120626, WO2013120627, WO2013120628, WO2013120629, WO2013174409, WO2 The contents of the cases described in 014127917, WO2015 / 024669, WO2015 / 024668, WO2015 / 024667, WO2015 / 024665, WO2015 / 024666, WO2015 / 024664, WO2015101415, WO2015101414, WO2015024667, WO2015062738, and WO2015101416 are incorporated herein by reference in their entirety.

[0315] preparation

[0316] According to this disclosure, the nanoparticle compositions described herein may comprise at least one lipid component and one or more additional components, such as therapeutic and / or preventative agents. The nanoparticle compositions may be designed for one or more specific applications or targets. The components of the nanoparticle compositions may be selected based on a specific application or target, and / or based on the efficacy, toxicity, cost, ease of use, availability, or other characteristics of one or more components. Similarly, specific formulations of the nanoparticle compositions may be selected for a specific application or target based on, for example, the efficacy and toxicity of a specific combination of each component.

[0317] The lipid component of the nanoparticle composition may include, for example, lipids according to one of formulas (I) (and its sub-formulas) as described herein, phospholipids (e.g., unsaturated lipids, such as DOPE or DSPC), PEG lipids, and structural lipids. Each component of the lipid component may be provided in a specific fraction.

[0318] In one embodiment, this document provides a nanoparticle composition comprising an ionizable lipid compound, a therapeutic agent, and one or more excipients provided herein. In one embodiment, the ionizable lipid compound comprises a compound according to one of formulas (I) (and its sub-formulas) as described herein, and optionally one or more additional ionizable lipid compounds. In one embodiment, the one or more excipients are selected from neutral lipids, steroids, and polymer-bound lipids. In one embodiment, the therapeutic agent is encapsulated within or associated with the lipid nanoparticles.

[0319] In one embodiment, this document provides a nanoparticle composition (lipid nanoparticles) comprising:

[0320] i) Ionizable lipids;

[0321] ii) Neutral lipids;

[0322] iii) Steroids;

[0323] iv) Polymer-bound lipids; and

[0324] v) Therapeutic agents.

[0325] As used herein, “molar percentage” refers to the molar percentage of a component relative to the total number of moles of all lipid components in the LNP (i.e., the total number of moles of ionizable lipids, neutral lipids, steroids and polymer-bound lipids).

[0326] In one embodiment, the lipid nanoparticles comprise 41 mol% to 49 mol%, 41 mol% to 48 mol%, 42 mol% to 48 mol%, 43 mol% to 48 mol%, 44 mol% to 48 mol%, 45 mol% to 48 mol%, 46 mol% to 48 mol%, or 47.2 mol% to 47.8 mol% of ionizable lipids. In another embodiment, the lipid nanoparticles comprise about 47.0 mol%, 47.1 mol%, 47.2 mol%, 47.3 mol%, 47.4 mol%, 47.5 mol%, 47.6 mol%, 47.7 mol%, 47.8 mol%, 47.9 mol%, or 48.0 mol% of ionizable lipids.

[0327] In one embodiment, the neutral lipids are present at a concentration ranging from 5 mol% to 15 mol%, 7 mol% to 13 mol%, or 9 mol% to 11 mol%. In one embodiment, the neutral lipids are present at a concentration of about 9.5 mol%, 10 mol%, or 10.5 mol%. In one embodiment, the molar ratio of ionizable lipids to neutral lipids is in the range of about 2:1 to about 8:1, preferably about 3:1 to about 5:1, and more preferably about 47.5:10.

[0328] In one embodiment, the steroid is present at a concentration ranging from 39 mol% to 49 mol%, 40 mol% to 46 mol%, 40 mol% to 44 mol%, 40 mol% to 42 mol%, 42 mol% to 44 mol%, or 44 mol% to 46 mol%. In one embodiment, the steroid is present at a concentration of 40 mol%, 41 mol%, 42 mol%, 43 mol%, 44 mol%, 45 mol%, or 46 mol%. In one embodiment, the molar ratio of ionizable lipid to steroid is in the range of 5:1 to about 1:1, preferably about 2:1 to about 1:1, and more preferably about 47.5:40.7. In one embodiment, the steroid is cholesterol.

[0329] In one embodiment, the lipid nanoparticles comprise 1.0 mol% to 2.5 mol% of polymer-bound lipids. In one embodiment, the polymer-bound lipids are present at a concentration of about 1.5 mol%. In one embodiment, the molar ratio of ionizable lipids to polymer-bound lipids is in the range of about 100:1 to about 20:1, optionally about 50:1 to about 25:1, and more preferably 47.5:1.8.

[0330] In one embodiment, the average diameter of the lipid nanoparticles is in the range of 50 nm to 100 nm or 60 nm to 85 nm.

[0331] In one embodiment, the composition comprises the ionizable lipids, DSPC, cholesterol, and PEG-lipids provided herein, as well as mRNA. In one embodiment, the molar ratio of the ionizable lipids, DSPC, cholesterol, and PEG-lipids provided herein is about 49:10:39.5:1.5 or 47.5:10:40.7:1.8.

[0332] In one embodiment, the ratio of therapeutic agent to lipid in the LNP (i.e., N / P, where N represents the molar number of ionizable lipids and P represents the molar number of phosphate esters present as part of the nucleic acid backbone) is in the range of 2:1 to 30:1, for example, in the range of 3:1 to 22:1. In one embodiment, the N / P is in the range of 6:1 to 20:1 or 2:1 to 12:1. Exemplary N / P ranges include about 3:1, about 6:1, about 12:1, and about 22:1.

[0333] Nanoparticle compositions can be designed for one or more specific applications or targets. For example, nanoparticle compositions can be designed for delivering therapeutic and / or preventative agents, such as RNA, to specific cells, tissues, organs, or systems or groups thereof in a mammal. The physicochemical properties of the nanoparticle composition can be modified to increase selectivity for specific bodily targets. For example, particle size can be tailored based on the fenestration size of different organs. The therapeutic and / or preventative agents contained in the nanoparticle composition can also be selected based on one or more desired delivery targets. For example, the therapeutic and / or preventative agents can be selected for a specific indication, disease, ailment, or condition and / or for delivery to specific cells, tissues, organs, or systems or groups thereof (e.g., local or specific delivery). In some embodiments, the nanoparticle composition may contain mRNA encoding a polypeptide of interest, which can be translated intracellularly to produce the polypeptide of interest. Such compositions can be designed for specific delivery to specific organs. In some embodiments, the composition can be designed for specific delivery to the mammalian liver.

[0334] The amount of therapeutic and / or preventative agents in the nanoparticle composition may depend on the size, composition, desired target and / or application, or other characteristics of the nanoparticle composition, as well as the properties of the therapeutic and / or preventative agents. For example, the amount of RNA that can be used in the nanoparticle composition may depend on the size, sequence, and other characteristics of the RNA. The relative amounts of therapeutic and / or preventative agents and other components (e.g., lipids) in the nanoparticle composition may also vary. In some embodiments, the wt / wt ratio of the lipid component to the therapeutic and / or preventative agent in the nanoparticle composition may be from about 5:1 to about 60:1, for example, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, 25:1, 30:1, 35:1, 40:1, 45:1, 50:1, and 60:1. For example, the wt / wt ratio of the lipid component to the therapeutic and / or preventative agent can be from about 10:1 to about 40:1. In some embodiments, the wt / wt ratio is about 20:1. The amount of the therapeutic and / or preventative agent in the nanoparticle composition can be measured, for example, using absorption spectroscopy (e.g., UV-Vis spectroscopy).

[0335] In some embodiments, the nanoparticle composition comprises one or more RNAs, and the amounts of one or more RNAs, lipids, and the like may be selected to provide a specific N:P ratio. The N:P ratio of the composition refers to the molar ratio of nitrogen atoms in one or more lipids to the number of phosphate groups in the RNA. In some embodiments, a lower N:P ratio is selected. The amounts of one or more RNAs, lipids, and the like may be selected to provide an N:P ratio of about 2:1 to about 30:1, such as 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 12:1, 14:1, 16:1, 18:1, 20:1, 22:1, 24:1, 26:1, 28:1, or 30:1. In some embodiments, the N:P ratio may be about 2:1 to about 8:1. In other embodiments, the N:P ratio is about 5:1 to about 8:1. For example, the N:P ratio can be approximately 5.0:1, approximately 5.5:1, approximately 5.67:1, approximately 6.0:1, approximately 6.5:1, or approximately 7.0:1. For example, the N:P ratio can be approximately 5.67:1.

[0336] The physical properties of nanoparticle compositions can depend on their components. For example, a nanoparticle composition containing cholesterol as a structural lipid may have different characteristics than a nanoparticle composition containing different structural lipids. Similarly, the characteristics of a nanoparticle composition may depend on the absolute or relative amounts of its components. For example, a nanoparticle composition containing a higher molar fraction of phospholipids may have different characteristics than a nanoparticle composition containing a lower molar fraction of phospholipids. Characteristics can also vary depending on the preparation method and conditions of the nanoparticle composition.

[0337] Nanoparticle compositions can be characterized using a variety of methods. For example, microscopic examination (e.g., transmission electron microscopy or scanning electron microscopy) can be used to examine the morphology and size distribution of the nanoparticle composition. Dynamic light scattering or potentiometry (e.g., potentiometric titration) can be used to measure the zeta potential. Dynamic light scattering can also be used to determine particle size. Instruments such as the Zetasizer Nano ZS (Malvem Instruments Ltd, Malvem, Worcestershire, UK) can also be used to measure multiple characteristics of the nanoparticle composition, such as particle size, polydispersity index, and zeta potential.

[0338] In various embodiments, the average size of the nanoparticle composition can range from tens of nanometers to hundreds of nanometers. For example, the average size can be from about 40 nm to about 150 nm, such as about 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm or 150 nm. In some embodiments, the average size of the nanoparticle composition may be about 50 nm to about 100 nm, about 50 nm to about 90 nm, about 50 nm to about 80 nm, about 50 nm to about 70 nm, about 50 nm to about 60 nm, about 60 nm to about 100 nm, about 60 nm to about 90 nm, about 60 nm to about 80 nm, about 60 nm to about 70 nm, about 70 nm to about 100 nm, about 70 nm to about 90 nm, about 70 nm to about 80 nm, about 80 nm to about 100 nm, about 80 nm to about 90 nm, or about 90 nm to about 100 nm. In some embodiments, the average size of the nanoparticle composition may be about 70 nm to about 100 nm. In some embodiments, the average size may be about 80 nm. In other embodiments, the average size may be about 100 nm.

[0339] The nanoparticle composition can be relatively homogeneous. The polydispersity index can be used to indicate the uniformity of the nanoparticle composition, such as its particle size distribution. A smaller polydispersity index (e.g., less than 0.3) generally indicates a narrower particle size distribution. The polydispersity index of the nanoparticle composition can be from about 0 to about 0.25, for example, 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25. In some embodiments, the polydispersity index of the nanoparticle composition can be from about 0.10 to about 0.20.

[0340] The zeta potential of a nanoparticle composition can be used to indicate the potential kinetics of the composition. For example, the zeta potential can describe the surface charge of the nanoparticle composition. Nanoparticle compositions with relatively low positive or negative charges are generally desirable because substances with higher charges can interact undesirably with cells, tissues, and other components in the body. In some embodiments, the zeta potential of the nanoparticle composition may be about -10mV to about +20mV, about -10mV to about +15mV, about -10mV to about +10mV, about -10mV to about +5mV, about -10mV to about 0mV, about -10mV to about -5mV, about -5mV to about +20mV, about -5mV to about +15mV, about -5mV to about +10mV, about -5mV to about +5mV, about -5mV to about 0mV, about 0mV to about +20mV, about 0mV to about +15mV, about 0mV to about +10mV, about 0mV to about +5mV, about +5mV to about +20mV, about +5mV to about +15mV, or about +5mV to about +10mV.

[0341] The encapsulation efficiency of the therapeutic and / or preventative agents describes the amount of therapeutic and / or preventative agents encapsulated in or otherwise associated with the nanoparticle composition after preparation, relative to the initial amount provided. Encapsulation efficiency is desirablely high (e.g., close to 100%). Encapsulation efficiency can be measured, for example, by comparing the amount of therapeutic and / or preventative agents in a solution containing the nanoparticle composition before and after the nanoparticle composition has been disrupted with one or more organic solvents or detergents. Fluorescence can be used to measure the amount of free therapeutic and / or preventative agents (e.g., RNA) in solution. For the nanoparticle compositions described herein, the encapsulation efficiency of the therapeutic and / or preventative agents may be at least 50%, such as 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the encapsulation efficiency may be at least 80%. In some implementations, the encapsulation efficiency can be at least 90%.

[0342] Nanoparticle compositions may optionally include one or more coatings. For example, nanoparticle compositions may be formulated into coated capsules, films, or tablets. Capsules, films, or tablets containing the compositions described herein may have any useful size, tensile strength, hardness, or density.

[0343] Pharmaceutical Composition

[0344] According to this disclosure, nanoparticle compositions can be formulated, either wholly or partially, into pharmaceutical compositions. A pharmaceutical composition may comprise one or more nanoparticle compositions. For example, a pharmaceutical composition may comprise one or more nanoparticle compositions that contain one or more different therapeutic and / or preventative agents. A pharmaceutical composition may further comprise one or more pharmaceutically acceptable excipients or adjuvants, such as those described herein. General guidelines for the formulation and manufacture of pharmaceutical compositions and agents can be found, for example, in Remington's *The Science and Practice of Pharmacy*, 21st edition, ARGennaro; Lippincott, Williams & Wilkins, Baltimore, Md., 2006. Conventional excipients and adjuvants can be used in any pharmaceutical composition unless any conventional excipient or adjuvant is incompatible with one or more components of the nanoparticle composition. An excipient or adjuvant is incompatible with a component of the nanoparticle composition if a combination of the excipient or adjuvant with a component of the nanoparticle composition would result in any undesirable biological or other harmful effects.

[0345] In some embodiments, the one or more excipients or adjuvants may constitute more than 50% of the total mass or volume of the pharmaceutical composition comprising the nanoparticle composition. For example, the one or more excipients or adjuvants may constitute 50%, 60%, 70%, 80%, 90%, or higher percentages according to pharmaceutical convention. In some embodiments, the pharmaceutically acceptable excipients are at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% pure. In some embodiments, the excipients are approved for human and veterinary use. In some embodiments, the excipients are approved by the U.S. Food and Drug Administration. In some embodiments, the excipients are pharmaceutical grade. In some embodiments, the excipients comply with the standards of the United States Pharmacopeia (USP), the European Pharmacopoeia (EP), the British Pharmacopoeia, and / or the International Pharmacopoeia.

[0346] The relative amounts of one or more nanoparticle compositions, one or more pharmaceutically acceptable excipients, and / or any additional ingredients in the pharmaceutical compositions according to this disclosure will vary depending on the identity, physical condition, and / or status of the treated subject and further depending on the route of administration of the composition. For example, the pharmaceutical composition may contain one or more nanoparticle compositions in amounts between 0.1% and 100% (wt / wt).

[0347] In some embodiments, the nanoparticle compositions and / or pharmaceutical compositions of this disclosure are stored and / or transported under refrigerated or frozen conditions (e.g., at 4°C or lower, such as between about -150°C and about 0°C, or between about -80°C and about -20°C (e.g., about -5°C, -10°C, -15°C, -20°C, -25°C, -30°C, -40°C, -50°C, -60°C, -70°C, -80°C, -90°C, -130°C, or -150°C)). For example, pharmaceutical compositions comprising any one of the compounds of formula (I) (and its sub-formulas) are solutions refrigerated and / or transported at, for example, about -20°C, 30°C, -40°C, -50°C, -60°C, -70°C, or -80°C. In some embodiments, this disclosure also relates to a method for increasing the stability of a nanoparticle composition and / or pharmaceutical composition by storing a compound comprising any one of formula (I) (and its sub-formulas) at a temperature of 4°C or lower, for example, between about -150°C and about 0°C or between about -80°C and about -20°C, for example, at about -5°C, -10°C, -15°C, -20°C, -25°C, -30°C, -40°C, -50°C, -60°C, -70°C, -80°C, -90°C, -130°C, or -150°C. For example, the nanoparticle compositions and / or pharmaceutical compositions disclosed herein are stable at temperatures, for example, 4°C or lower (e.g., between about 4°C and -20°C), for at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 5 weeks, at least 6 weeks, at least 1 month, at least 2 months, at least 4 months, at least 6 months, at least 8 months, at least 10 months, at least 12 months, at least 14 months, at least 16 months, at least 18 months, at least 20 months, at least 22 months, or at least 24 months. In one embodiment, the formulation is stable at about 4°C for at least 4 weeks. In some embodiments, the pharmaceutical compositions disclosed herein comprise the nanoparticle compositions disclosed herein and a pharmaceutically acceptable carrier selected from one or more of the following: Tris, acetates (e.g., sodium acetate), citrates (e.g., sodium citrate), saline, PBS, and sucrose. In some embodiments, the pharmaceutical compositions of this disclosure have a pH value between about 7 and 8 (e.g., 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, or 8.0, or between 7.5 and 8, or between 7 and 7.8). For example, the pharmaceutical compositions of this disclosure comprise the nanoparticle composition disclosed herein, Tris, saline, and sucrose, and have a pH value of about 7.5-8, which is suitable for storage and / or transport, for example, at about -20°C.For example, the pharmaceutical compositions disclosed herein comprise the nanoparticle compositions disclosed herein and PBS, and have a pH of about 7-7.8, making them suitable for storage and / or transport at, for example, a temperature of about 4°C or lower. In the context of this disclosure, “stability,” “stabilization,” and “stable” mean that the nanoparticle compositions and / or pharmaceutical compositions disclosed herein are resistant to chemical or physical changes (e.g., degradation, particle size changes, aggregation, encapsulation changes, etc.) under given conditions of manufacture, preparation, transport, storage, and / or use, such as when pressure is applied, such as shear force, freezing / thawing pressure, etc.

[0348] Nanoparticle compositions and / or pharmaceutical compositions comprising one or more nanoparticle compositions may be administered to any patient or subject, including those who may benefit from the therapeutic effects provided by delivery of therapeutic and / or prophylactic agents to one or more specific cells, tissues, organs, or systems or groups thereof, such as the renal system. While the descriptions of nanoparticle compositions and pharmaceutical compositions comprising nanoparticle compositions provided herein are primarily directed toward compositions suitable for human administration, those skilled in the art will understand that such compositions are generally suitable for administration to any other mammal. Modifications to compositions suitable for human administration are well known to make them suitable for administration to a variety of animals, and such modifications can be designed and / or performed by veterinary pharmacologists of ordinary skill through routine experiments (if any). Subjects to whom the compositions are administered are considered to include, but are not limited to, humans, other primates, and other mammals, including commercially relevant mammals such as cattle, pigs, horses, sheep, cats, dogs, mice, and / or rats.

[0349] Pharmaceutical compositions comprising one or more nanoparticles can be prepared by any method known in or to be developed in the field of pharmacology. Generally, such preparation methods involve combining the active ingredient with an excipient and / or one or more other auxiliary ingredients, and then, if desired or necessary, aliquoting, shaping and / or packaging the product into desired single- or multi-dose units.

[0350] The pharmaceutical compositions according to this disclosure may be prepared, packaged, and / or sold in bulk, as a single unit dose, and / or as multiple single unit doses. As used herein, a “unit dose” is a discrete amount of a pharmaceutical composition containing a predetermined amount of an active ingredient (e.g., a nanoparticle composition). The amount of active ingredient is generally equal to the dose of the active ingredient to be administered to a subject and / or a convenient portion of such a dose, such as half or one-third of such a dose.

[0351] Pharmaceutical compositions can be formulated into various forms suitable for a variety of routes and methods of administration. For example, pharmaceutical compositions can be formulated into liquid dosage forms (e.g., emulsions, microemulsions, nanoemulsions, solutions, suspensions, syrups, and elixirs), injectable forms, solid dosage forms (e.g., capsules, tablets, pills, powders, and granules), dosage forms for topical and / or transdermal application (e.g., ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalers, and patches), suspensions, powders, and other forms.

[0352] Liquid dosage forms for oral and parenteral administration include, but are not limited to, pharmaceutically acceptable emulsions, microemulsions, nanoemulsions, solutions, suspensions, syrups, and / or elixirs. In addition to the active ingredient, liquid dosage forms may also contain inert diluents commonly used in this technology, such as water or other solvents, solubilizers, and emulsifiers, such as ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, methyl benzoate, propylene glycol, 1,3-butanediol, dimethylformamide, oils (especially cottonseed oil, peanut oil, corn oil, germ oil, olive oil, castor oil, and sesame oil), glycerin, tetrahydrofurfuryl alcohol, polyethylene glycol, and sorbitan fatty acid esters, and mixtures thereof. In addition to inert diluents, oral compositions may also contain additional therapeutic and / or preventative agents, additional agents such as wetting agents, emulsifiers and suspending agents, sweeteners, flavoring agents, and / or flavoring agents. In some embodiments intended for parenteral administration, the composition is mixed with a solubilizer, such as Cremophor™, alcohol, oil, modified oil, glycol, polysorbate, cyclodextrin, polymer, and / or combinations thereof.

[0353] Injectable formulations, such as sterile injectable aqueous or oily suspensions, can be formulated using suitable dispersants, wetting agents, and / or suspending agents according to known techniques. Sterile injectable formulations can be sterile injectable solutions, suspensions, and / or emulsions in non-toxic, parenteral diluents and / or solvents, such as solutions in 1,3-butanediol. Acceptable media and solvents that can be used include water, Ringer's solution, USP, and isotonic sodium chloride solution. Sterile non-volatile oils are commonly used as solvents or suspension media. For this purpose, any mild non-volatile oil can be used, including synthetic monoglycerides or diglycerides. Fatty acids such as oleic acid can be used in the preparation of injections.

[0354] Injectable formulations may be sterilized, for example by filtration through a bacterial retention filter, and / or by incorporation of a sterilizing agent in the form of a sterile solid composition, which may be dissolved or dispersed in sterile water or other sterile injectable media prior to use.

[0355] This disclosure is characterized by delivering therapeutic and / or preventative agents to mammalian cells or organs, generating polypeptides of interest in mammalian cells, and methods for treating diseases or conditions in mammals in need, said methods comprising administering a nanoparticle composition comprising therapeutic and / or preventative agents to the mammal and / or contacting mammalian cells with said nanoparticle composition.

[0356] Example

[0357] The embodiments in this section are provided by way of example only and are not intended to be limiting.

[0358] Example 1: Synthesis of the precursor of compound 1

[0359] 8-Bromooctanoic acid (696 mg, 3.08 mmol), (1S)-3-[(1Z)-2-[(1R, 3aS, 4E, 7aR)-7a-methyl-1-[(2R)-6-methylhept-2-yl]octahydro-1H-inden-4-yl]ethylene]-4-methylenecyclohexane-1-ol (1.00 g, 2.55 mmol) and dimethylaminopyridine (63.5 mg, 0.510 mmol) were dissolved in dichloromethane (15 mL), and carbodiimide (740 mg, 3.82 mmol) was added. The mixture was stirred overnight at room temperature. The reaction was monitored by thin-layer chromatography. The reaction solution was concentrated, silica gel was added, and column chromatography was performed for separation (ethyl acetate / n-hexane = 0-5%) to obtain (1S)-3-[(1Z)-2-[(1R,3aS,4E,7aR)-7a-methyl-1-[(2R)-6-methylhept-2-yl]octahydro-1H-inden-4-ylidene]ethylene]-4-methylenedicyclohexyl 8-bromooctanoate (856 mg, 1.45 mmol, 57.1 mg) as a colorless oily liquid.

[0360] Example 2: Synthesis of Compound 1

[0361] Ethanol (3 mL), 6-[(2R)-6-methylhept-2-yl]octahydro-1H-indene-4-ylidene]ethylene]-4-methylenedicyclohexyl 8-bromooctanoate (200 mg, 339 μmol) was added to (1S)-3-[(1Z)-2-[(1R, 3aS, 4E, 7aR)-7a-methyl-1-[(2R)-6-methylhept-2-yl]octahydro-1H-indene-4-yl]ethylenedimethyldicyclohexyl 8-bromooctanoate (145 mg, 339 μmol) and ethyl diisopropylamine (85.6 mg, 678 μmol), respectively. The mixture was heated in an oil bath at 65°C and stirred overnight. The reaction was monitored by thin-layer chromatography. The reaction solution was concentrated, silica gel was added, and column chromatography was performed for separation (methanol / dichloromethane = 0%-10%) to obtain (1S)-3-[(1Z)-2-[(1R,3aS,4E,7aR)-7a-methyl-1-[(2R)-6-methylhept-2-yl]octahydro-1H-indene-4-ylidene]ethylene]-4-methylenedicyclohexyl 8-(9-hexyl-22-hydroxy-10-oxo-18-aza-11-oxopolysaccharide-18-yl)octanoate (28.0 mg, 30.0 μmol, 8.82%) as a white solid (Figure 1).

[0362] Example 3: Synthesis of Compound 2

[0363] Ethanol (3 mL), octadecane-9-yl-8-[(2-hydroxyethyl)amino]octanoate (151 mg, 339 μmol), and ethyl diisopropylamine (85.6 mg, 678 μmol) were added to (1S)-3-[(1Z)-2-[(1R, 3aS, 4E, 7aR)-7a-methyl-1-[(2R)-6-methylhept-2-yl]octahydro-1H-indene-4-yl]ethylene]-4-methylenedicyclohexyl 8-bromooctanoate (200 mg, 339 μmol), respectively. The mixture was heated in an oil bath at 65°C and stirred overnight. The reaction was monitored by thin-layer chromatography. The reaction solution was concentrated, silica gel was added, and column chromatography was performed for separation (methanol / dichloromethane = 0%-5%) to obtain (1S)-3-[(1Z)-2-[(1R,3aS,4E,7aR)-7-methyl-1-[(2R)-6-methylhept-2-yl]octahydro-1H-indene-4-ylidene]ethylene]-4-methylenedicyclohexyl 8-(21-hydroxy-9-octyl-11-oxo-19-aza-10-benzo-19-yl)octanoate (8.00 mg, 8.42 μmol, 2.48%) as a colorless oily liquid (Figure 2).

[0364] Example 4: Synthesis of the precursor of compound 3

[0365] 8-Bromooctanoic acid (562 mg, 2.47 mmol), (1S)-3-[(1Z)-2-[(1R,3aS,4E,7aR)-1-[(2R,3E,5R)-5,6-dimethylhept-3-en-2-yl]-7a-methyloctahydro-1H-inden-4-ethylene]ethylene]-4-methylenecyclohexane-1-ol (1.00 g, 2.47 mmol) and dimethylaminopyridine (61.6 mg, 0.494 mmol) were dissolved in dichloromethane (15 mL), and carbodiimide (718 mg, 3.71 mmol) was added. The mixture was stirred overnight at room temperature. The reaction was monitored by TLC, the reaction solution was concentrated, silica gel was added, and column chromatography (ethyl acetate / n-hexane = 0-5%) was used to separate the reaction solution into a colorless oily liquid (1S)-3-[(1Z)-2-[(1R,3aS,4E,7aR)-1-[(2R,3E,5R)-5,6-dimethylhept-3-en-2-yl]-7a-methyloctahydro-1H-inden-4-ethylene]ethylene]-4-methylenedicyclohexyl 8-bromooctanoate (940 mg, 1.56 mmol, 63.1%).

[0366] Example 5: Synthesis of Compound 3

[0367] Ethanol (3 mL), octadecane-9-yl-8-[(2-hydroxyethyl)amino]octanoate (148 mg, 332 μmol), and ethyl diisopropylamine (86.8 mg, 665 μmol) were added to (1S)-3-[(1Z)-2-[(1R, 3aS, 4E, 7aR)-1-[(2R, 3E, 5R)-5,6-dimethylhept-3-en-2-yl]-7a-methyloctahydro-1H-indene-4-yl]ethylene]-4-methylenedicyclohexyl 8-bromooctanoate (200 mg, 332 μmol) in an oil bath and stirred overnight at 65°C. The reaction was monitored by thin-layer chromatography. The reaction solution was concentrated, silica gel was added, and column chromatography was performed for separation (methanol / dichloromethane = 0%-5%) to obtain (1S)-3-[(1Z)-2-[(1R,3aS,4E,7aR)-1-[(2R,3E,5R)-5,6-dimethylhept-3-en-2-yl]-7a-methyloctahydro-1H-inden-4-ethylene]ethylene]-4-methylenecyclohexyl 8-(21-hydroxy-9-octyl-11-oxo-19-aza-10-benzene-nonadenylon) octanoate (24.0 mg, 24.9 μmol, 7.50%) as a colorless oily liquid (Figure 3).

[0368] Example 6: Synthesis of the precursor of compound 4

[0369] 8-Bromooctanoic acid (497.54 mg, 2.23 mmol), 2,5,7,8-tetramethyl-2-(4,8,12-trimethyltridecyl)-3,4-dihydro-2H-chromen-6-ol (1.00 g, 2.23 mmol), and 4-dimethylaminopyridine (55.8 mg, 0.446 mmol) were dissolved in dichloromethane (15 mL), and 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide (647 mg, 3.34 mmol) was added. The mixture was stirred overnight at room temperature. The reaction was monitored by TLC, the reaction solution was concentrated, silica gel was added, and column chromatography (ethyl acetate / n-hexane = 0-5%) was used to separate the 2,5,7,8-tetramethyl-2-(4,8,12-trimethyltetrazyl)-3,4-dihydro-2H-chromene-6-yl 8-bromooctanoate (1.31 g, 2.06 mmol, 92.4%) into a colorless oily liquid.

[0370] Example 7: Synthesis of Compound 4

[0371] Ethanol (3 mL), octadecyl-9-yl-8-[(2-hydroxyethyl)amino]octanoate (140 mg, 315 μmol), and ethyl diisopropylamine (82.1 mg, 629 μmol) were added to 2,5,7,8-tetramethyl-2-(4,8,12-trimethyltetrazyl)-3,4-dihydro-2H-chromene-6-yl-8-bromooctanoate (200 mg, 315 μmol), respectively, and the mixture was heated in an oil bath at 65°C with stirring overnight. The reaction was monitored by thin-layer chromatography. The reaction solution was concentrated, silica gel was added, and column chromatography was performed for separation (methanol / dichloromethane = 0%-5%) to obtain 2,5,7,8-tetramethyl-2-(4,8,12-trimethyltetrazyl)-3,4-dihydro-2H-chromen-6-yl-8-(21-hydroxy-9-octyl-11-oxo-19-aza-10-benzoic acid-19-yl) octanoate (54.0 mg, 54.2 μmol, 17.2%) as a yellow oily liquid (Figure 4).

[0372] Example 8: Synthesis of Compound 5

[0373] Ethanol (3 mL), 6-[(4-hydroxybutyl)amino]2-hexyldecanoate (1R, 3aS, 4E, 7aR)-1-[(2R, 3E, 5R)-5,6-dimethylhept-3-en-2-yl]-7a-methyloctahydro-1H-inden-4-ethylene]ethylene]-4-methylenedicyclohexyl 8-bromooctanoate (200 mg, 332 μmol) and ethyl diisopropylamine (86.8 mg, 665 μmol) were added to (1S)-3-[(1Z)-2-[(1R, 3aS, 4E, 7aR)-1-[(2R, 3E, 5R)-5,6-dimethylhept-3-en-2-yl]-7a-methyloctahydro-1H-inden-4-ethylene]ethylene]-4-methylenedicyclohexyl 8-bromooctanoate (142 mg, 332 μmol) and stirred overnight in an oil bath at 65°C. The reaction was monitored by thin-layer chromatography. The reaction solution was concentrated, silica gel was added, and column chromatography (methanol / dichloromethane = 0-10%) was used to separate the reaction solution into (1S)-3-[(1Z)-2-[(1R,3aS,4E,7aR)-1-[(2R,3E,5R)-5,6-dimethylhept-3-en-2-yl]-7a-methyloctahydro-1H-inden-4-ylidene]ethylene]-4-methylenecyclohexyl 8-(9-hexyl22-hydroxy-10-oxo-18-aza-11-oxodoco-18-yl)octanoate (105 mg, 0.111 mmol, 33.3%) as a yellow oily liquid (Figure 5).

[0374] Example 9: Synthesis of Compound 6

[0375] Ethanol (3 mL), 6-[(4-hydroxybutyl)amino]2-hexyldecanoate (134 mg, 314 μmol), and ethyl diisopropylamine (82.1 mg, 629 μmol) were added to 2,5,7,8-tetramethyl-2-(4,8,12-trimethyltridecyl)-3,4-dihydro-2H-chromene-6-yl-8-bromooctanoate (200 mg, 314 μmol), respectively, and the mixture was heated in an oil bath at 65°C with stirring overnight. The reaction was monitored by TLC, the reaction solution was concentrated, silica gel was added, and column chromatography (methanol / dichloromethane = 0-5%) was performed to obtain 2,5,7,8-tetramethyl-2-(4,8,12-trimethyltetrazyl)-3,4-dihydro-2H-chromen-6-yl-8-(9-hexyl-22-hydroxy-10-oxo-18-aza-11-oxdocos-18-yl)octanoate (134 mg, 0.136 mmol, 43.4%) as a yellow oily liquid (Figure 6).

[0376] Example 10: Synthesis of the precursor of compound 7

[0377] (2E,4E,6E,8E)-3,7-dimethyl-9-(2,6,6-trimethylcyclohexyl-1-enyl)non-2,4,6,8-tetraenoic acid (1.00 g, 3.26 mmol), 8-bromooctane-1-ol (683 mg, 3.26 mmol) and dimethylaminopyridine (81.3 mg, 0.652 mmol) were dissolved in dichloromethane (15 mL), and carbodiimide (947 mg, 4.89 mmol) was added. The mixture was stirred overnight at room temperature. The reaction was monitored by thin-layer chromatography. The reaction solution was concentrated, silica gel was added, and column chromatography was performed to separate the reaction solution (ethyl acetate / n-hexane = 0-5%), yielding 8-bromooctyl(2E,4E,6E,8E)-3,7-dimethyl-9-(2,6,6-trimethylcyclohex-1-enyl)non-2,4,6,8-tetraenoic acid (463 mg, 0.942 mmol, 28.9%) as a yellow oily liquid.

[0378] Example 11: Synthesis of Compound 7

[0379] Ethanol (3 mL), 6-[(4-hydroxybutyl)amino]2-hexyldecanoate (174 mg, 407 μmol), and ethyl diisopropylamine (106 mg, 814 μmol) were added to 8-bromooctyl(2E,4E,6E,8E)-3,7-dimethyl-9-(2,6,6-trimethylcyclohex-1-enyl)non-2,4,6,8-tetraenoic acid (200 mg, 407 μmol), respectively, and the mixture was heated in an oil bath at 65°C with stirring overnight. The reaction was monitored by thin-layer chromatography. The reaction solution was concentrated, silica gel was added, and column chromatography was performed for separation (methanol / dichloromethane = 0%-5%) to obtain (1E,3E,5E,7E)-19-(4-hydroxybutyl)-3,7-dimethyl-9-oxo-1-(2,6,6-trimethylcyclohex-1-enyl)-19-aza-10-oxotetrapentane-1,3,5,7-tetraen-25-yl-hexyldecanoate (17.0 mg, 20.0 μmol, 4.98%) as a yellow oily liquid (Figure 7).

[0380] Example 12: Synthesis of Compound 8

[0381] Ethanol (3 mL), octadecane-9-yl-8-[(2-hydroxyethyl)amino]octanoate (182 mg, 407 μmol), and ethyl diisopropylamine (106 mg, 814 μmol) were added to 8-bromooctyl(2E,4E,6E,8E)-3,7-dimethyl-9-(2,6,6-trimethylcyclohexyl-1-enyl)non-2,4,6,8-tetraenoic acid (200 mg, 407 μmol) in an oil bath and stirred overnight at 65°C. The reaction was monitored by thin-layer chromatography. The reaction solution was concentrated, silica gel was added, and column chromatography was performed for separation (methanol / dichloromethane = 0%-5%) to obtain heptadecan-9-yl-8-[(1E,3E,5E,7E)-21-hydroxy-3,7-dimethyl-9-oxo-1-(2,6,6-trimethylcyclohexyl-1-enyl)-19-aza-10-hydroxy-1,3,7,7-tetraen-19-yl]octanoate (32.0 mg, 37.5 μmol, 9.23%) as a yellow oily liquid (Figure 8).

[0382] Example 13: Preparation of LNP

[0383] The formulation ratio (molar percentage) for synthesizing the novel vector LNP is: ionizable lipid molecules / DMG-PEG2000 / DSPC / cholesterol (Chol) = 40-49 / 1.0-2.0 / 10.0-11.8 / 38.5-47.2 (mol%). The specific process for preparing the novel vector LNP encapsulating luciferase mRNA (Luci-mRNA) is as follows:

[0384] 1. Prepare working solutions for each lipid component.

[0385] (1) Prepare the stock solutions of each lipid component: ionizable lipid molecules: 50 mg / mL, DSPC: 20 mg / mL, cholesterol (Chol): 20 mg / mL, DMG-PEG2000: 20 mg / mL.

[0386] (2) Based on the concentrations in (1) above, dissolve each lipid component thoroughly in anhydrous ethanol. Place the ionizable lipid molecules, DSPC, cholesterol (Chol), and DMG-PEG2000 in an ultrasonic cleaner at 40°C and sonicate for 20 minutes. The concentration of the mother liquor can be reduced based on the solubility of the ionizable lipid molecules in ethanol.

[0387] (3) The formulation for synthesizing the novel carrier LNP was as follows: its components are ionizable lipids, neutral phospholipids, steroidal lipids, and polyethylene glycol lipid conjugates. The ratio of ionizable lipid molecules / DSPC / cholesterol (Chol) / DMG-PEG2000 = 47.5 / 10 / 40.7 / 1.8 (mol%) was added to the stock solution of each lipid component and mixed thoroughly. The remaining volume was made up with anhydrous ethanol and mixed thoroughly to serve as the working solution for each lipid component. The control was encapsulated with luciferase mRNA according to the formulation of ALC-0315 / DSPC / cholesterol / ALC-0159 in a molar ratio of 47.5% / 10% / 40.7% / 1.8%. (Table 1)

[0388] Table 1 shows the formulations of LNP preparations made from ionizable lipids (molar percentage, mol%).

[0389] 2. Dilute the luciferase mRNA solution

[0390] Dilute the mRNA solution to 0.2 mg / mL with 50 mM citrate buffer at pH 4.0.

[0391] 3. LNP preparation via microfluidic control

[0392] LNPs were prepared using a Myanna microfluidic device and a Myanna microfluidic chip. The microfluidic chip channels were cleaned and emptied with anhydrous ethanol and enzyme-free water. 1 mL of working solution for each lipid component was drawn into the left side of the device using a syringe, and 3 mL of mRNA solution was drawn into the right side using the same syringe. The microfluidic device software parameters were set as follows: total volume 4.000 mL, total flow rate 12 mL / min, left-right flow rate ratio 1:3, initial waste volume 0.500 mL, and final waste volume 0.100 mL. The process was repeated several times according to the set parameters. All LNP solutions were collected and diluted with DPBS to reduce the ethanol content.

[0393] 4. Purification of LNP by tangential flow filtration (TFF)

[0394] The LNP solution was first concentrated to approximately 0.5 mg / mL using a Ribogreen KR2i TFF system and a hollow fiber column. Then, it was ultrafiltered with DPBS at a volume of 8-10 DV to remove ethanol, dispersing the LNP in the DPBS. The LNP solution was then concentrated to approximately 0.67 mg / mL, collected, and 1.2 M sucrose solution was added, resulting in a final sucrose concentration of 0.3 M. The LNP samples were stored at -80°C. The encapsulation efficiency was calculated according to the Ribogreen kit instructions. Particle size and polydispersity index (PDI) were measured using standard methods on a Malvern Zetasizer nano instrument. Zeta potential analysis showed encapsulation efficiency exceeding 96%, with particle sizes ranging from 69 to 100 nm and PDIs between 0.01 and 0.08. (Table 2)

[0395] Table 2 Physicochemical test results of LNP

[0396] Example 14: Animal experiments to test the performance of LNP delivery vectors

[0397] 1. Intramuscular injection of LNP into mice

[0398] Female Balb / c mice (6-8 weeks old, purchased from Zhejiang Vital River Laboratory Animal Technology Co., Ltd.) were housed under experimental conditions of 22±2℃ and relative humidity of 45%–75%. Using mRNA encoding luciferase as a reporter gene, the mice underwent an oxidative decarboxylation reaction in the presence of ATP, magnesium ions, oxygen, and substrate (D-Luciferin), emitting blue-green bioluminescence with a wavelength of approximately 560 nm. After 15 minutes of reaction, the bioluminescence signal in the mice was detected by an in vivo imaging system, and the in vivo transfection efficiency of the LNP preparation was evaluated by the intensity of the luciferase fluorescence signal. Taking luciferase mRNA as an example, six different LNP preparations were prepared using several different molecules: LNP 1, LNP 2, LNP 3, LNP 4, LNP 5, and LNP 6. Samples prepared with luciferase mRNA packaged in Acuitas and saline were used as control samples. A dose of 5 μg / mouse mRNA was administered to the left leg muscle of mice. At 4 h and 24 h post-administration, mice were intraperitoneally injected with a quantitative amount of potassium luciferase (15 mg / mL, 200 μL). Fifteen minutes later, the fluorescence signal of luciferase in the mice and muscles was detected using a small animal in vivo imaging system. The specific detection principle is shown in Figure 11.

[0399] (1) The mice were randomly divided into groups of 3, with the weight difference between the mice in each group not exceeding 20%, and the mice were numbered.

[0400] (2) Preparation of test solution: Take out the preparation sample stored at -80℃, thaw it at room temperature, and shake it evenly. After the test solution has completely thawed, use a pipette to take the required volume, dilute the preparation sample with physiological saline to the required concentration according to the test sample list, mix well, and place it on ice for later use.

[0401] (3) Draw 100uL of test sample mixture with a 1.0mL insulin syringe, gently tap the syringe to expel the air, and then cover the syringe with the protective cap and place it on ice for later use.

[0402] (4) Remove the mouse from the cage, lift its tail and place it on the stainless steel mesh cover or other rough surface of the IVC cage, and observe the mouse's condition.

[0403] (5) After the mouse is in normal condition, one person holds the skin on the back of the mouse and fixes the mouse on a rough surface.

[0404] (6) Another person holds the mouse’s left hind limb with their left hand and wipes the muscles of the lower leg with alcohol. After finding the best injection site, inject the test mixture into the syringe at an angle to the left hind limb. After aspirating and finding no reflux, the injection is complete.

[0405] (7) Pull out the syringe, put it into the sharps box, observe the mouse's condition, and after confirming that the mouse's condition is normal, put the mouse back into the cage and repeat the operation for the next mouse; after all the injections are completed, put the cage back on the feeding rack.

[0406] (8) After the injection is completed, spray the entire operating table with 75% alcohol to clean and disinfect it, and throw the garbage into a medical waste bag;

[0407] (9) Four hours and 24 hours after administration, all mice were removed and injected intraperitoneally with fluorescein potassium salt. In vivo imaging experiments were conducted on the mice to observe the bioluminescence signal intensity in the left leg muscle of the mice, and the experimental data were photographed and saved.

[0408] 2. In vivo imaging of mice

[0409] Preparation of D-luciferin potassium salt: Remove D-luciferin potassium salt from the refrigerator, allow it to equilibrate to room temperature, dissolve it in PBS to prepare a D-luciferin potassium salt solution with a concentration of 15 mg / mL, filter it through a 0.22 μm filter membrane, transfer it to a 15 mL centrifuge tube, and store it in the dark with aluminum foil for later use.

[0410] (1) Use a 1.0 mL insulin syringe to draw 200 μL of 15 mg / mL D-luciferin potassium salt solution. After gently tapping the syringe to expel the air, cover the syringe with the protective cap and place it on ice to avoid light for later use.

[0411] (2) Remove the cage, open the cage box, grab the mouse by the tail, lift it up and place it on the stainless steel mesh cover or other rough surface of the IVC cage box;

[0412] (3) Grasp the skin on the back of the mouse with one hand, fix the mouse, find the position of the mouse's abdominal cavity, and keep the mouse's head down and the abdominal cavity up.

[0413] (4) Wipe the mouse’s abdominal cavity with alcohol with the other hand and inject D-luciferin potassium salt solution into the abdominal cavity at an angle.

[0414] (5) After the injection, put the mouse back into the cage and wait for 10 minutes. At the same time, turn on the anesthesia machine and put the mouse in the anesthesia machine to anesthetize it. After 3 minutes of anesthesia, take the mouse out and place it in the dark box of the mouse in vivo imaging instrument. Keep the mouse lying on its side with its left hind limb facing up to facilitate the collection of luciferase fluorescence signal at the injection site.

[0415] (6) Adjust the instrument interface on the computer, set the parameter group information, and take a picture and save the experimental data immediately after the D-luciferin potassium salt injection time reaches 15 minutes.

[0416] The results in the table show that the in vivo transfection efficiency of LNP 4 and LNP 5 was significantly higher than that of the Acuitas delivery system. (Table 3) (Figure 9)

[0417] Table 3. Fluorescence imaging results of small animals

[0418] The data in the table show that after injection of LNPs prepared from different formulations of the novel compound, the rate of weight change in mice over two days (D1, D2) was comparable to that of the saline injection group, indicating that this type of ionizable lipid has good biocompatibility. (Table 4) (Figure 10)

[0419] Table 4. Mouse body weight after LNP injection

[0420] The above experimental results show that the mRNA-LNP prepared by the novel ionizable lipid compound has high in vivo mRNA transfection efficiency, high biosafety, and low toxicity. The raw materials required for synthesis are readily available, the reaction conditions are mild, the equipment requirements are low, and the operation is simple, making it suitable for large-scale production and achieving significant beneficial technical effects.

[0421] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0422] The embodiments described above are merely illustrative of several implementation methods of this application, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the patent application. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of this application, and these all fall within the protection scope of this application. Therefore, the protection scope of this patent application should be determined by the appended claims.

Claims

1. Compounds of formula (I): or a pharmaceutically acceptable salt, tautomer, prodrug, or stereoisomer thereof, wherein: G 1 and G 2 each independently is a bond, C1-C 12 alkylene or C2-C 12 alkenylene; L 1 -OC(=O)R 1 , -C(=O)OR 1 , -OC(=O)OR 1 , -C(=O)R 1 , -OR 1 , -S(O) x R 1 , -S-SR 1 , -C(=O)SR 1 , -SC(=O)R 1 , -NR a C(=O)R 1 , -C(=O)NR b R c , -NR a C(=O)NR b R c , -OC(=O)NR b R c , -NR a C(=O)OR 1 , -SC(=S)R 1 , -C(=S)SR 1 , -C(=S)R 1 , -CH(OH)R 1 , -P(=O)(OR b )(OR c ), -(C6-C 10 arylene)-R 1 , -(6 to 10 membered heteroarylene)-R 1 or R 1 ; R 1 is C6-C 24 alkyl or C6-C 24 alkenyl or C6-C 24 alkynyl; R a and R b each independently is H, C1-C 12 alkyl, C2-C 12 alkenyl or C2-C 12 alkynyl; R c is C1-C 32 alkyl or C2-C 32 alkenyl; L 2 -OC(=O)L 3 , -C(=O)OL 3 , -OC(=O)OL 3 , -C(=O)L 3 , -OL 3 , -CH(OH)L 3 or L 3 ; L 3 = R 2 = R 3 = R 4 = R 5 = R 6 = R 7 = R 8 = R 9 = R R 2 C 3-8 cycloalkylene, which can optionally be C6cycloalkylene or R 2 C R d is C 3-8 ycloalkylene, optionally C6ycloalkylene, R e and R f are each independently H or C 1-12 alkyl, R 3 is C1-C 12 alkylene or C2-C 12 alkenylene, R 4 is bicycloalkylene, optionally C 5-8 ycloalkylene and C 5-8 ycloalkyl, more optionally C6cycloalkylene and C5cycloalkyl, R 5 is C2-C 24 alkyl or C2-C 24 alkenyl or C2-C 24 alkynyl; R 6 It is a bicyclic group, and can be optionally a C6 aryl-C ... 5-8 Heterocyclic alkyl, more preferably C6-aryl-C6 heterocyclic alkyl, R 7 For C6-C 24 Alkyl or C6-C 24 alkenyl or C6-C 24 alkynyl group; R 8 alkylene or C2-C 24 alkylene or C2-C 24 alkylene or C2-C 18 alkylene or C2-C 18 alkylene or C2-C 10 alkylene or C2-C 10 alkylene or C2-C 9 alkylene or C2-C 5-8 alkylene or C2-C G 3 is C1-C 12 alkylene, optionally C2-C6alkylene, more optionally C2-C4alkylene; R 10 is hydroxyl; x is 0, 1, or 2; and wherein each alkyl, alkenyl, alkynyl, cycloalkyl, heterocycloalkyl, cycloalkenyl, alkylene, alkenylene, arylene, heteroarylene, cycloalkylene, bicycloalkylene, aryl is independently optionally substituted.

2. The compound of claim 1, wherein L 1 is -OC(=O)R 1 or -C(=O)OR 1 or -NR a C(=O)NR b R c or -OC(=O)OR 1 or -C(=O)NR b R c or -NR a C(=O)R 1 .

3. The compound according to claim 1 or 2, wherein R 1 is linear C6-C 24 alkyl or branched C6-C 24 alkyl, optionally linear C 10 -C 20 alkyl or branched C 10 -C 20 alkyl, more optionally linear C 15 -C 17 alkyl or branched C 15 -C 17 alkyl.

4. The compound of any one of claims 1 to 3, wherein: R a is H; and / or R b is H; and / or R c is straight-chain C6-C 24 alkyl or branched C6-C 24 alkyl, optionally straight-chain C 10 -C 20 alkyl or branched C6-C 10 -C 20 alkyl, more optionally straight-chain C 15 -C 17 alkyl or branched C6-C 15 -C 17 alkyl.

5. The compound according to any one of claims 1 to 4, wherein L 1 is:

6. The compound according to any one of claims 1 to 5, wherein G 1 is a straight or branched chain C2-C 10 alkylene, optionally a straight or branched chain C6-C7 alkylene, more optionally:

7. The compound according to any one of claims 1 to 6, wherein G 2 is a straight or branched chain C2-C 10 alkylene, optionally a straight or branched chain C7-C8alkylene, more optionally:

8. The compound according to any one of claims 1 to 7, wherein L 2 is -C(=O)OL 3 , L 3 is -R 2 = R 3 = R 4 -R 5 and wherein: R 2 for R d is C6cycloalkylene, R e and R f are each H; and / or R 3 C2-C6alkylene, which can optionally be C2alkylene; and / or R 4 is bicyclyl, which is C6 cycloalkyl and C5 cycloalkyl; and / or R 5 is linear or branched C6-C 16 alkyl or linear or branched C6-C 16 alkyl or linear or branched C6-C alkyl or linear or branched C6-C 9. The compound according to any one of claims 1 to 8, wherein L 2 is -C(=O)OL 3 , L 3 is -R 2 = R 3 = R 4 -R 5 , and wherein: R 2 for R a’ , R b’ , R c’ , R d’ , R e’ are independently selected from H, C1-C6alkyl, optionally substituted and / or R 3 for and / or R 4 For R f’ R g’ R h’ R i’ R j’ R k’ R l’ R m’ Independently selected from H, C1-C6 alkyl, optionally being and / or R 5 for 10. The compound according to any one of claims 1 to 9, wherein L 3 is: Optionally, wherein L 3 is:

11. The compound according to any one of claims 1 to 10, wherein L 2 is -C(=0)OL 3 , L 3 is -R 6 -R 7 and wherein: R 6 is bicyclyl, which is C6aryl and C6heterocycloalkyl; and / or R 7 linear or branched C6-C 24 linear or branched C 12 -C 18 linear or branched C 16 linear or branched C 12. The compound according to any one of claims 1 to 11, wherein L 2 is -C(=0)OL 3 , L 3 is -R 6 -R 7 and wherein: R 6 for R n’ R o’ R p’ R q’ R r’ R s’ Independently selected from H, C1-C6 alkyl, optionally being and / or R 7 for Optionally, wherein L 3 is:

13. The compound according to any one of claims 1 to 12, wherein L 2 is -OC(=0)L 3 , L 3 is -R 8 -R 9 and wherein: R 8 linear or branched C2-C 12 alkenylene; and / or R 9 is C6cycloalkenyl.

14. The compound according to any one of claims 1 to 13, wherein L 2 is -OC(=0)L 3 , L 3 is -R 8 -R 9 and wherein: R 8 for and / or R 9 for R t’ , R u’ , R v’ , R w’ , R x’ , R y’ is independently selected from H, C1-C6alkyl, optionally substituted Optionally, wherein L 3 is:

15. The compound according to any one of claims 1 to 14, wherein G 3 is:

16. The compound according to any one of claims 1 to 15, wherein the compound is selected from:

17. A composition comprising the compound of any one of claims 1 to 16 and a therapeutic or prophylactic agent.

18. The composition of claim 17, further comprising one or more structural lipids.

19. The composition of claim 18, wherein the one or more structural lipids are selected from the group consisting of DSPC, a sterol, or a combination thereof.

20. The composition of claim 19, wherein the molar ratio of the compound to the DSPC is in the range of about 2: 1 to about 8: 1, alternatively about 3: 1 to about 5: 1, more alternatively about 47.5:

10.

21. The composition of claim 19, wherein the sterol is cholesterol.

22. The composition of claim 21, wherein the molar ratio of the compound to the sterol is in the range of about 5: 1 to about 1: 1, alternatively about 2: 1 to about 1: 1, more alternatively about 47.5: 40.

7.

23. The composition of any one of claims 18 to 22, wherein the composition further comprises one or more polymer-conjugated lipids.

24. The composition of claim 23, wherein the polymer-conjugated lipid is DMG-PEG2000 or DMPE-PEG2000, alternatively DMG-PEG2000.

25. The composition of claim 24, wherein the molar ratio of the compound to the polymer-conjugated lipid is in the range of about 100: 1 to about 20: 1, alternatively about 50: 1 to about 25: 1, more alternatively about 47.5: 1.

8.

26. The composition of any one of claims 17 to 25, wherein the therapeutic or prophylactic agent comprises one or more selected from the group consisting of a small molecule drug, a nucleic acid molecule, a protein.

27. The composition of claim 26, wherein the nucleic acid molecule comprises at least one mRNA or siRNA or nclRNA encoding an antigen or a fragment or epitope thereof.

28. The composition of claim 27, wherein the mRNA is a monocistronic mRNA or a polycistronic mRNA.

29. The composition of claim 27, wherein the antigen is a pathogenic antigen or a tumor associated antigen.

30. The composition of claim 27, wherein the mRNA comprises one or more functional nucleotide analogs.

31. The composition of claim 30, wherein the functional nucleotide analogs are selected from the group consisting of one or more of pseudouridine, 1-methyl-pseudouridine, and 5-methylcytosine.

32. The composition of any one of claims 17-31, wherein the composition is a nanoparticle.

33. A lipid nanoparticle comprising the compound of any one of claims 1-16 or the composition of any one of claims 17-32.

34. A pharmaceutical composition comprising the compound of any one of claims 1-16, the composition of any one of claims 17-32, or the lipid nanoparticle of claim 33, and a pharmaceutically acceptable excipient or diluent.

35. A vaccine comprising the compound of any one of claims 1-16, the composition of any one of claims 17-32, or the lipid nanoparticle of claim 33.

36. Use of the composition of any one of claims 17-32, the lipid nanoparticle of claim 33, or the pharmaceutical composition of claim 34 in the manufacture of a medicament.

Images