Microorganism, and method for producing l-amino acids using same

Abstract

The present disclosure relates to a microorganism of the genus Corynebacterium in which the activity of fumarate hydratase is enhanced, and a method for producing L-amino acids using same. The microorganism of the genus Corynebacterium with enhanced fumarate hydratase exhibits increased production capability of L-amino acids such as L-arginine, L-citrulline, L-ornithine, O-acetylhomoserine, L-homoserine, and L-histidine, compared to a parent strain in which the fumarate hydratase is not enhanced, and the microorganism with enhanced fumarate hydratase can be widely used for the production of L-amino acids.

Description

Microorganisms and methods for producing L-amino acids using them

[0001] Cross-citation with related application(s)

[0002] The present disclosure claims the benefit of priority based on Korean Patent Application No. 10-2024-0167777 filed November 21, 2024, and all contents disclosed in the documents of said Korean patent application are incorporated as part of the present disclosure.

[0003] The present disclosure relates to a microorganism with enhanced fumaric acid hydrase activity and a method for producing L-amino acids using the same.

[0004]

[0005] Microorganisms of the genus Corynebacterium are Gram-positive microorganisms widely used in the production of L-amino acids.

[0006] Various studies are being conducted to develop high-efficiency production microorganisms for the production of L-amino acids and other useful substances. Specifically, for the production of L-arginine, target-substance-specific approaches are mainly used, such as increasing the expression of genes encoding enzymes primarily involved in L-arginine biosynthesis in Corynebacterium strains or removing genes unnecessary for L-arginine biosynthesis (Korean Registered Patent No. 10-1102263).

[0007] However, there is still a growing need for research on methods to produce L-amino acids efficiently with high efficiency.

[0008]

[0009] One example of the present disclosure provides a microorganism of the genus Corynebacterium that produces L-amino acids with enhanced fumarate hydratase activity.

[0010] Another example of the present disclosure is the step of culturing a microorganism of the genus Corynebacterium that produces L-amino acid with enhanced activity of the fumarate hydrase, and

[0011] A method for producing L-amino acids is provided, comprising the step of recovering L-amino acids from the cultured microorganisms, the medium, or both.

[0012] Another example of the present disclosure provides a composition for producing L-amino acids comprising a microorganism of the genus Corynebacterium that produces L-amino acids with enhanced fumaric acid hydrase activity.

[0013] Another example of the present disclosure provides a use for the production of L-amino acids by a microorganism of the genus Corynebacterium that produces L-amino acids with enhanced fumaric acid hydrase activity.

[0014]

[0015] This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in this disclosure may be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in this disclosure fall within the scope of this disclosure. Furthermore, the scope of this disclosure is not to be limited by the specific descriptions provided below. Additionally, a person skilled in the art can recognize or identify numerous equivalents to the specific embodiments of this disclosure described herein using only ordinary experiments. Moreover, such equivalents are intended to be included in this disclosure.

[0016]

[0017] The present disclosure provides a microorganism with enhanced L-amino acid production capacity and a method for producing L-amino acids using the same.

[0018] One example of the present disclosure provides a microorganism that produces L-amino acids with enhanced fumarate hydratase activity.

[0019] In the present disclosure, the term "fumarate hydratase" refers to an enzyme that catalyzes the reversible conversion of fumarate to L-malate. The fumarate hydratase of the present disclosure may be used interchangeably with fumarase and FumC protein. The fumarate hydratase may be derived from a microorganism of the genus Corynebacterium, and specifically may be derived from Corynebacterium glutamicum.

[0020] In the present disclosure, the sequence of the fumarate hydrase can be obtained from GenBank of NCBI, a known database (e.g., NCBI Reference Sequence: WP_003856814.1). More specifically, the fumarate hydrase may have and / or include the amino acid sequence of SEQ ID NO. 1, or may be essentially composed of or consist of said amino acid sequence.

[0021] In one example, the fumarate hydrase may include not only the amino acid sequence of SEQ ID NO. 1, but also an amino acid sequence having at least 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% sequence identity or homology with the amino acid sequence of SEQ ID NO. 1. Furthermore, if the amino acid sequence has such sequence identity or homology and has biological activity identical or corresponding to that of the fumarate hydrase of the present disclosure, cases in which some sequences have deletions, modifications, substitutions, conservative substitutions, or additions may also be included within the scope of the present disclosure.

[0022] In one example, the fumarate hydrase may be a polypeptide having fumarate hydrase activity encoded by a fumarate hydrase gene. The fumarate hydrase gene may be of a microorganism of the genus Corynebacterium (e.g., Corynebacterium glutamicum), but is not limited thereto. The sequence of the fumarate hydrase gene can be obtained from the known database NCBI (e.g., NCBI Reference Sequence: NZ_CP016335.1, NCBI Reference Sequence: NC_003450.3).

[0023] In one example, the fumarate hydrate enzyme gene encoding the fumarate hydrate enzyme may have, include, be composed of, or be essentially composed of the nucleic acid sequence of SEQ ID NO. 2 or SEQ ID NO. 41.

[0024] In one example, the fumarate hydrase gene may comprise a nucleic acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% or more homology or identity with the nucleic acid sequence of SEQ ID NO. 2 or SEQ ID NO. 41, or may be composed of said sequence.

[0025]

[0026] In the present disclosure, the term "L-amino acid-producing microorganism" may be used to refer to cases where a microorganism having L-amino acid-producing capacity has increased L-amino acid-producing capacity due to enhanced activity of fumarate hydrase, and / or cases where a microorganism not having L-amino acid-producing capacity acquires L-amino acid-producing capacity due to enhanced activity of fumarate hydrase. In the present disclosure, "microorganism" encompasses unicellular bacteria and may be used interchangeably with "cell."

[0027] In the present disclosure, in order to distinguish the microorganism before the activity of the fumarate hydrase is enhanced from the “L-amino acid producing microorganism” in which the activity of the fumarate hydrase is enhanced and the L-amino acid production capacity is increased or conferred L-amino acid production capacity, the microorganism before the activity of the fumarate hydrase is enhanced may be referred to as a parent microorganism or parent strain or a host cell.

[0028] In one example, the parent strain may be of the wild type or mutated to increase L-amino acid production capacity, for example, a strain in which the protein activity involved in the biosynthesis or metabolism of L-amino acids is regulated (increased (promoted) or decreased (inhibited) compared to the wild type, but is not limited thereto. For example, the parent strain may be a wild-type Corynebacterium strain having L-amino acid production capacity, a Corynebacterium strain mutated to increase glutamate-based amino acid production capacity, or a Corynebacterium strain mutated to increase homoserine-based amino acid production capacity.

[0029] In one specific example, when the activity of fumarate hydrase was enhanced in a Corynebacterium strain mutated to increase the known L-amino acid, it was confirmed that enhancing the activity of fumarate hydrase can further increase the L-amino acid production capacity.

[0030] The above L-amino acid may be a glutamate-based amino acid, a homoserine-based amino acid, or L-histidine, and specifically, may be one or more selected from the group consisting of L-arginine, L-citrulline, L-ornithine, O-acetyl homoserine, L-homoserine, and L-histidine.

[0031] In the present disclosure, the term “glutamate-based amino acid” means an amino acid that can be biosynthesized using glutamate as a precursor. Specifically, the glutamate-based amino acid may be one or more selected from the group consisting of L-ornithine, L-citrulline, L-arginine, and putrescine, but is not limited thereto as long as it is an amino acid that can be biosynthesized using glutamate as a precursor. The term “glutamate-based amino acid” in the present disclosure may be used interchangeably with “glutamic acid-based amino acid.”

[0032] In the present disclosure, the term “ornithine-based amino acid” means an amino acid that can be biosynthesized using ornithine as a precursor. Specifically, the ornithine-based amino acid may be one or more selected from the group consisting of L-ornithine, L-citrulline, and putrescine, but is not limited thereto as long as it is an amino acid that can be biosynthesized using ornithine as a precursor.

[0033] In one example, the host microorganism may be any microorganism of the genus Corynebacterium or the genus Escherichia that has the ability to produce L-amino acids naturally, or has the ability to produce L-amino acids through the introduction of a mutation into a parent strain that has no or significantly less ability to produce L-amino acids. The microorganism of the genus Corynebacterium may include, but is not limited to, Corynebacterium glutamicum, Corynebacterium stationis, Brevibacterium lactofermentum, Brevibacterium flavum, Corynebacterium thermoaminogenes, Corynebacterium efficiens, etc. More specifically, the above-mentioned microorganism of the genus Corynebacterium may be Corynebacterium glutamicum, and the above-mentioned strain of the genus Escherichia may be Escherichia coli.

[0034]

[0035] In the present disclosure, the term “enhancement” of polypeptide activity means that the activity of the polypeptide is increased compared to its intrinsic activity. Such enhancement may be used interchangeably with terms such as activation, up-regulation, overexpression, and increase. Here, activation, enhancement, up-regulation, overexpression, and increase may include exhibiting activity that was not originally possessed, or exhibiting improved activity compared to the intrinsic activity or activity prior to modification. The “intrinsic activity” refers to the activity of a specific polypeptide originally possessed by the parent strain or the non-modified microorganism prior to the change in traits caused by genetic mutations due to natural or artificial factors. This may be used interchangeably with “activity prior to modification.” "Enhancement," "upregulation," "overexpression," or "increase" of polypeptide activity relative to intrinsic activity means that the activity and / or concentration (expression amount) of a specific polypeptide were originally possessed by the parent strain or non-modified microorganism prior to transformation.

[0036] The above enhancement can be achieved by introducing an exogenous polypeptide or by enhancing the activity and / or concentration (expression amount) of an intrinsic polypeptide. Whether the activity of the polypeptide is enhanced can be confirmed by an increase in the degree of activity, expression amount, or amount of product released from the polypeptide.

[0037] The enhancement of the activity of the above polypeptide may be achieved by applying various methods well known in the art, and is not limited to, as long as the activity of the target polypeptide can be enhanced compared to the microorganism before modification. Specifically, it may utilize, but is not limited to, gene engineering and / or protein engineering known to a person skilled in the art, which are routine methods of molecular biology (e.g., Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012, etc.).

[0038] Specifically, the reinforcement of the polypeptide of the present disclosure is

[0039] 1) Increase in the intracellular copy number of polynucleotides encoding polypeptides;

[0040] 2) Replace the chromosomal gene expression regulatory region encoding a polypeptide with a potent sequence;

[0041] 3) A modification of the nucleotide sequence encoding the start codon or the 5'-UTR region of the gene transcript encoding the polypeptide;

[0042] 4) Modification of the amino acid sequence of the polypeptide to enhance polypeptide activity;

[0043] 5) Modification of the polynucleotide sequence encoding the polypeptide to enhance polypeptide activity (e.g., modification of the polynucleotide sequence of the polypeptide gene to code for a polypeptide modified to enhance polypeptide activity);

[0044] 6) Introduction of a foreign polypeptide exhibiting polypeptide activity or a foreign polynucleotide encoding the same;

[0045] 7) Codon optimization of polynucleotides encoding polypeptides;

[0046] 8) Analyze the tertiary structure of the polypeptide to select and modify or chemically modify the exposed sites;

[0047] 9) Regulation of the cellular localization of polypeptides; or

[0048] 10) It may be a combination of two or more selected from 1) to 9) above, but is not specifically limited thereto.

[0049] More specifically,

[0050] The increase in the intracellular copy number of the polynucleotide encoding the above 1) polypeptide may be achieved by introducing into a host cell a vector to which the polynucleotide encoding the said polypeptide is operably linked, which can replicate and function independently of the host. Alternatively, it may be achieved by introducing one or more copies of the polynucleotide encoding the said polypeptide into the chromosomes within the host cell. The introduction into the chromosomes may be performed by introducing into the host cell a vector capable of inserting said polynucleotide into the chromosomes within the host cell, but is not limited thereto. The said vector is as described above.

[0051] Replacing the gene expression regulatory region (or expression regulatory sequence) on the chromosome encoding the polypeptide 2) above with a sequence having potent activity may, for example, involve deletion, insertion, non-conservative or conservative substitution, or a combination thereof, to further enhance the activity of the expression regulatory region, or may involve a sequence mutation, or replacement with a sequence having stronger activity. The expression regulatory region may include, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation. As an example, the original promoter may be replaced with a potent promoter, but is not limited thereto.

[0052] Examples of known strong promoters include, but are not limited to, CJ1 to CJ7 promoters (US Patent No. 7662943 B2), lac promoter, trp promoter, trc promoter, tac promoter, lambda phage PR promoter, PL promoter, tet promoter, gapA promoter, SPL7 promoter, SPL13(sm3) promoter (US Patent No. 10584338 B2), O2 promoter (US Patent No. 10273491 B2), tkt promoter, yccA promoter, etc.

[0053] The above 3) modification of the nucleotide sequence encoding the start codon or 5'-UTR region of the gene transcript encoding the polypeptide may, for example, be a substitution with a nucleotide sequence encoding another start codon that has a higher polypeptide expression rate compared to the intrinsic start codon, but is not limited thereto.

[0054] The modification of the amino acid sequence or polynucleotide sequence of 4) and 5) above may involve the occurrence of sequence variations in the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide by deletion, insertion, non-conservative or conservative substitution, or a combination thereof, to enhance the activity of the polypeptide, or may involve replacement with an amino acid sequence or polynucleotide sequence modified to have stronger activity or an amino acid sequence or polynucleotide sequence modified to increase activity, but is not limited thereto. Specifically, the replacement may be performed by inserting the polynucleotide into the chromosome by homologous recombination, but is not limited thereto. The vector used in this case may additionally include a selection marker to confirm whether the chromosome is inserted. The selection marker is as described above.

[0055] The introduction of an exogenous polynucleotide exhibiting the activity of the polypeptide described in 6) above may be the introduction into a host cell of an exogenous polynucleotide encoding a polypeptide that exhibits the same or similar activity as the polypeptide. As long as the exogenous polynucleotide exhibits the same or similar activity as the polypeptide, there are no restrictions on its origin or sequence. The method used for the introduction may be performed by a person skilled in the art by appropriately selecting a known transformation method, and the polypeptide may be generated and its activity increased by the expression of the introduced polynucleotide within the host cell.

[0056] The above 7) codon optimization of a polynucleotide encoding a polypeptide may be a codon optimization of the intrinsic polynucleotide such that transcription or translation within the host cell increases, or a codon optimization of the extrinsic polynucleotide such that optimized transcription or translation occurs within the host cell.

[0057] 8) The above method of analyzing the tertiary structure of the polypeptide to select and modify or chemically modify an exposed site may involve, for example, determining a template protein candidate based on the degree of sequence similarity by comparing the sequence information of the polypeptide to be analyzed with a database in which sequence information of known proteins is stored, confirming the structure based on this, and selecting and modifying or modifying an exposed site to be modified or chemically modified.

[0058] The above 9) regulation of the intracellular localization of the polypeptide may involve targeting the polypeptide to a specific intracellular organelle or a specific intracellular space. For example, it may involve targeting to the periplasm or cytoplasm through the addition or removal of a leader sequence that functions for the targeting of the polypeptide, but is not limited thereto.

[0059] Such enhancement of polypeptide activity may involve increasing the activity or concentration of the corresponding polypeptide based on the activity or concentration of the polypeptide expressed in the wild-type or pre-modification microbial strain, or increasing the amount of the product produced from said polypeptide, but is not limited thereto.

[0060] In a specific embodiment of the present invention, the activity of the fumarate hydrase may be enhanced compared to that of a non-mutated microorganism by increasing the copy number or strengthening the activity of the promoter.

[0061] The activity of the above-mentioned promoter may be enhanced by introducing a promoter exhibiting improved activity into fumarate hydrase (FumC) to enhance its activity. As a specific example of the present invention, the promoter exhibiting improved activity includes, without limitation, a promoter whose activity is increased compared to the fumC autopromoter, and includes, without limitation, a promoter of a gene whose activity is higher than the gene expression induction activity of the fumC autopromoter, or a variant promoter whose activity is increased through gene mutations such as the fumC autopromoter. Specifically, the promoter exhibiting improved activity of the present invention may be an SPL13 promoter, and specifically, the SPL13 promoter may be composed of the nucleotide sequence of SEQ ID NO. 9, but may be a nucleotide sequence having homology of 70% or more, specifically 80% or more, and more specifically 90% or more with the nucleotide sequence.

[0062] The increase in the copy number of the above gene may be performed, but is not particularly limited thereto, by being operably linked to a vector or by being inserted into a chromosome within a host cell. Specifically, a vector capable of replicating and functioning independently of the host, to which a polynucleotide encoding fumarate hydrase, the target protein for enhancement of the present invention, is operably linked, may be introduced into a host cell. Alternatively, a vector capable of inserting said polynucleotide into a chromosome within a host cell, to which said polynucleotide is operably linked, may be introduced into a chromosome of a host cell. The insertion of said polynucleotide into a chromosome may be achieved by any method known in the art, for example, by homologous recombination. Since the vector of the present invention can be inserted into a chromosome by causing homologous recombination, it may additionally include a selection marker to confirm whether said chromosome insertion has occurred. Selection markers are used to select cells transformed with a vector to verify the insertion of a target polynucleotide. Markers conferring selectable phenotypes, such as drug resistance, nutritional requirements, resistance to cytotoxic agents, or the expression of surface proteins, may be used, but are not limited thereto. In an environment treated with a selective agent, only cells expressing the selection marker survive or exhibit other phenotypic traits, thereby enabling the selection of transformed cells.

[0063] In the present disclosure, the phrase “a polynucleotide (which may be interchangeably used with “gene”) or polypeptide (which may be interchangeably used with “protein”) comprises a specific nucleic acid sequence or amino acid sequence, consists of a specific nucleic acid sequence or amino acid sequence, or is represented by a specific nucleic acid sequence or amino acid sequence” may mean that the polynucleotide or polypeptide essentially comprises the specific nucleic acid sequence or amino acid sequence, and may be interpreted as comprising (or not excluding) a “substantially equivalent sequence” in which a variation (deletion, substitution, modification, and / or addition) has been applied to the specific nucleic acid sequence or amino acid sequence to maintain the original function and / or intended function of the polynucleotide or polypeptide.

[0064] In one example, the nucleic acid sequence or amino acid sequence provided in the present disclosure may include one that has been modified by conventional mutagenesis, such as direct evolution and / or site-directed mutagenesis, to the extent that their original or intended function is maintained. In one example, the statement that a polynucleotide or polypeptide “comprising a specific nucleic acid sequence or amino acid sequence or composed of a specific nucleic acid sequence or amino acid sequence” may mean that the polynucleotide or polypeptide (i) essentially comprises the specific nucleic acid sequence or amino acid sequence, or (ii) is composed of or essentially comprises an amino acid sequence having 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, 99.5% or more, or 99.9% or more homology with the specific nucleic acid sequence or amino acid sequence, and maintains its original function and / or intended function. In the present disclosure, the intended function may mean a function that increases or imparts the L-amino acid production capacity of a microorganism.

[0065] Due to the degeneracy of codons, the nucleic acid sequences described in this disclosure may undergo various modifications to the coding region within a range that does not alter the amino acid sequence and / or function of the protein expressed from the coding region, taking into account the codons preferred by the microorganism intended to express the protein (lysine-releasing protein).

[0066] In this disclosure, the term "identity" refers to the degree of correspondence with a given nucleic acid sequence or amino acid sequence and may be expressed as a percentage (%). Homology to a nucleic acid sequence can be determined, for example, using the BLAST algorithm described in the literature (cf. Karlin and Altschul, Pro. Natl. Acad. Sci. USA, 90, 5873, 1993) or FASTA by Pearson (cf. Methods Enzymol., 183, 63, 1990). Based on this BLAST algorithm, programs called BLASTN or BLASTX have been developed (cf. http: / www.ncbi.nlm.nih.gov).

[0067] In one example, a polynucleotide comprising a specific nucleic acid sequence provided in the present disclosure may be interpreted as comprising a polynucleotide fragment comprising not only the specific nucleic acid sequence or a substantially equivalent nucleic acid sequence, but also a nucleic acid sequence complementary to the specific nucleic acid sequence. Specifically, the polynucleotide having such complementarity may be hybridized at a Tm value that is appropriately adjustable by a person skilled in the art according to the purpose, e.g., 55°C, 60°C, 63°C, or 65°C, and analyzed under the conditions described below: these conditions are specifically described in the known literature. For example, conditions in which genes with high complementarity of 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 98% or more, 99.5% or more, or 99.9% or more hybridize with each other, and genes with lower complementarity do not hybridize with each other, or the washing conditions of conventional Southern hybridization, such as 60°C, 1x SSC (saline-sodium citrate buffer), and 0.1% (w / v) SDS (Sodium Dodecyl Sulfate); 60°C, 0.1x SSC, and 0.1% SDS; Alternatively, conditions such as washing once, specifically two to three times, at a salt concentration and temperature equivalent to 68°C, 0.1x SSC, and 0.1% SDS may be listed, but are not limited thereto. Hybridization may require that two nucleotides have complementary sequences, or a mismatch between bases may be permitted depending on the strictness of hybridization. The term "complementary" may be used to describe the relationship between nucleotide bases that can hybridize with each other. For example, in the case of DNA, adenosine is complementary to thymine, and cytosine is complementary to guanine.The appropriate strictness for hybridizing polynucleotides depends on the length and degree of complementarity of the polynucleotides, which is well known in the relevant technical field (see Sambrook et al., supra, 9.50-9.51, 11.7-11.8).

[0068] The introduction of the above polynucleotide or vector may be performed by a person skilled in the art by appropriately selecting a known transformation method. In this disclosure, the term "transformation" means introducing a vector containing a polynucleotide encoding a target protein (foreign protein) into a host cell so that the protein encoded by the polynucleotide can be expressed within the host cell. The transformed polynucleotide may include both inserted into the chromosomes of the host cell and located outside the chromosomes, as long as it can be expressed within the host cell. Additionally, the polynucleotide includes DNA and / or RNA encoding the target protein. There is no limitation on the form in which the polynucleotide is introduced, as long as it can be introduced into the host cell and expressed. For example, the polynucleotide may be introduced into the host cell in the form of an expression cassette, which is a gene structure containing all the elements necessary for self-expression. The expression cassette may typically include expression regulatory elements, such as a promoter, a transcription termination signal, a ribosome binding site, and / or a translation termination signal, which are operably linked to the polynucleotide. The expression cassette may be in the form of a self-replicating expression vector. Additionally, the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence required for expression in the host cell.

[0069] In the foregoing, the term "operably linked" may mean that an expression regulatory element (e.g., a promoter) and a polynucleotide are functionally linked so that the expression regulatory element can perform transcriptional regulation (e.g., transcription initiation) of the polynucleotide encoding the target protein of the present invention. Operable linkage may be performed using gene recombination techniques known in the art, for example, by conventional site-specific DNA cleavage and linkage, but is not limited thereto.

[0070] Modifying an expression regulatory sequence to increase the expression of a polynucleotide in the present disclosure may be performed, but is not particularly limited, by inducing sequence variations in the nucleic acid sequence through deletion, insertion, non-conservative or conservative substitution, or a combination thereof, to further enhance the activity of said expression regulatory sequence, or by replacing it with a nucleic acid sequence having stronger activity. Specifically, it may be performed by replacing it with a potent promoter. The said expression regulatory sequence may include, but is not particularly limited to, a promoter, an operator sequence, a sequence coding for a ribosome binding site, a sequence regulating the termination of transcription and translation, etc.

[0071] A strong promoter may be connected to the upper portion of the above polynucleotide expression unit instead of the original promoter, but is not limited thereto. Examples of known strong promoters may include CJ1 to CJ7 promoters (US Patent 7662943 B2), SPL1, SPL7, or SPL13 promoters (US Patent 10584338 B2), O2 promoter (US Patent 10273491 B2), PgapA promoter, lac promoter, trp promoter, trc promoter, tac promoter, lambda phage PR promoter, PL promoter, and tet promoter.

[0072] The method of transforming the above-mentioned polynucleotide into a host cell can be carried out by any method of introducing nucleic acid into a cell (microorganism), and depending on the host cell, transformation techniques known in the art can be appropriately selected. Examples of the above-mentioned known transformation methods include, but are not limited to, electroporation, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG)-mediated uptake, DEAE-dextran method, cationic liposome method, lipofection, and lithium acetate-DMSO method.

[0073] The introduction (insertion) of the above polynucleotide into the host cell genome (chromosome) may be performed by a person skilled in the art by appropriately selecting a known method, for example, using one or more selected from the group consisting of an RNA-guided endonuclease system (RNA-guided endonuclease system or CRISPR system; for example, (a) an RNA-guided endonuclease (e.g., Cas9 protein, etc.), a gene encoding the same, or a vector containing said gene; and (b) a mixture containing a guide RNA (e.g., single guide RNA (sgRNA), etc.), DNA encoding the same, or a vector containing said DNA (e.g., a mixture of an RNA-guided endonuclease protein and a guide RNA, etc.), a complex (e.g., a ribonucleic acid fusion protein (RNP), a recombinant vector (e.g., a vector containing an RNA-guided endonuclease gene and guide RNA encoding DNA, etc.), but is not limited thereto.

[0074] In the present disclosure, the term “vector” means a DNA product containing a sequence of a polynucleotide encoding said target protein, which is operably linked to a suitable regulatory sequence to enable the expression of said target protein within a suitable host. The regulatory sequence may include a promoter capable of initiating transcription, any operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosome binding site, and / or a sequence regulating the termination of transcription and / or translation. After being transformed into a suitable host cell, the vector may be expressed independently of the host cell’s genome or incorporated into the host cell’s genome.

[0075] The vectors available in this disclosure are not particularly limited as long as they are capable of replicating within a host cell and can be selected from all commonly used vectors. Examples of commonly used vectors include plasmids, cosmids, viruses, bacteriophages, etc., in their natural or recombinant state. For example, as the vectors, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A, etc., can be used as phage vectors or cosmid vectors, and pBR-based, pUC-based, pBluescriptII-based, pGEM-based, pTZ-based, pCL-based, and pET-based vectors, etc., can be used as plasmid vectors. Specifically, examples include, but are not limited to, vectors such as pDZ, pDC, pDCM2, pDC24, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC, and pCES208.

[0076]

[0077] In addition, one example of the present disclosure provides a microorganism that produces L-amino acids in which the activity of fumarate hydrase is enhanced, and additionally, the activity of malate:quinone oxidoreductase, malate dehydrogenase, aspartate transaminase, and NADP-specific glutamate dehydrogenase is enhanced compared to a non-modified microorganism.

[0078] In this disclosure, the term “malate:quinone oxidoreductase” refers to an enzyme on the TCA cycle that catalyzes the reversible conversion of malate (malate) and quinone to quinol and oxaloacetate. The malate:quinone oxidoreductase of this disclosure may be used in combination with MQO proteins, and the sequence of the malate:quinone oxidoreductase in this disclosure can be obtained from GenBank of NCBI, a known database. More specifically, the malate:quinone oxidoreductase may have and / or include the amino acid sequence of SEQ ID NO. 32, or may be essentially consisting of or composed of said amino acid sequence.

[0079] For example, the protein consisting of the amino acid sequence of SEQ ID NO. 32 may refer to a protein that is intrinsically present in microorganisms of the genus Corynebacterium encoded by the known NCgl1926 gene, but is not limited thereto. Specifically, the protein consisting of the amino acid sequence of SEQ ID NO. 32 may refer to a malate:quinone oxidoreductase derived from Corynebacterium glutamicum ATCC13032 encoded by the NCgl1926 gene, but is not limited thereto.

[0080] In addition, the malate:quinone oxidoreductase of the present disclosure may include not only the amino acid sequence of SEQ ID NO. 32, but also an amino acid sequence having at least 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% sequence identity or homology with the sequence of SEQ ID NO. 32. Furthermore, if the amino acid sequence has such sequence identity or homology and has biological activity identical or corresponding to that of the malate:quinone oxidoreductase of the present disclosure, cases in which some of the sequences have deleted, modified, substituted, conservatively substituted, or added amino acid sequences may also be included within the scope of the present disclosure.

[0081] In this disclosure, the term “malate dehydrogenase” refers to an enzyme on the TCA cycle that reversibly catalyzes the oxidation of malate (malate) to oxaloacetate by reducing NAD+ to NADH. The malate dehydrogenase of this disclosure may be used in combination with MDH protein, and the sequence of the malate dehydrogenase in this disclosure can be obtained from GenBank of NCBI, a known database. More specifically, the malate dehydrogenase may have and / or include the amino acid sequence of SEQ ID NO. 34, or be essentially composed of, or be composed of, said amino acid sequence.

[0082] For example, the protein consisting of the amino acid sequence of SEQ ID NO. 34 may refer to a protein inherently present in microorganisms of the genus Corynebacterium encoded by the known NCgl0631 gene, but is not limited thereto. Specifically, the protein consisting of the amino acid sequence of SEQ ID NO. 34 may refer to malate dehydrogenase derived from Corynebacterium glutamicum ATCC13032 encoded by the NCgl0631 gene, but is not limited thereto.

[0083] In addition, the malate dehydrogenase of the present disclosure may include not only the amino acid sequence of SEQ ID NO. 34, but also an amino acid sequence having at least 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% sequence identity or homology with the sequence of SEQ ID NO. 34. Furthermore, if the amino acid sequence has such sequence identity or homology and has biological activity identical or corresponding to that of the malate dehydrogenase of the present disclosure, cases in which some of the sequences have deletions, modifications, substitutions, conservative substitutions, or additions may also be included within the scope of the present disclosure.

[0084] In the present disclosure, the term "aspartate transaminase" refers to an enzyme that catalyzes a reaction in which the amino group of L-aspartic acid is transferred to 2-oxoglutarate to produce L-glutamic acid and oxaloacetate. The aspartate transaminase of the present disclosure may be used in combination with AspB protein, and the sequence of the aspartate transaminase in the present disclosure can be obtained from GenBank of NCBI, a known database. More specifically, the aspartate transaminase may have and / or include the amino acid sequence of SEQ ID NO. 36, or may be essentially composed of or consist of said amino acid sequence.

[0085] For example, the protein consisting of the amino acid sequence of SEQ ID NO. 36 may refer to a protein that is intrinsically present in microorganisms of the genus Corynebacterium encoded by the known NCgl0237 gene, but is not limited thereto. Specifically, the protein consisting of the amino acid sequence of SEQ ID NO. 36 may refer to an aspartate transaminase derived from Corynebacterium glutamicum ATCC13032 encoded by the NCgl0237 gene, but is not limited thereto.

[0086] In addition, the aspartate transaminases of the present disclosure may include not only the amino acid sequence of SEQ ID NO. 36, but also amino acid sequences having at least 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% sequence identity or homology with the sequence of SEQ ID NO. 36. Furthermore, if the amino acid sequence has such sequence identity or homology and has biological activity identical or corresponding to that of the aspartate transaminases of the present disclosure, cases in which some of the sequences have deletions, modifications, substitutions, conservative substitutions, or additions may also be included within the scope of the present disclosure.

[0087] In the present disclosure, the term "NADP-specific glutamate dehydrogenase" refers to an enzyme that catalyzes the reaction of converting glutamate into 2-oxoglutarate and ammonia in dependence on NADP. The NADP-specific glutamate dehydrogenase of the present disclosure may be used in combination with GDH proteins, and the sequence of the NADP-specific glutamate dehydrogenase in the present disclosure can be obtained from GenBank of NCBI, a known database. More specifically, the NADP-specific glutamate dehydrogenase may have and / or include the amino acid sequence of SEQ ID NO. 38, or may be essentially consisting of or composed of said amino acid sequence.

[0088] For example, the protein consisting of the amino acid sequence of SEQ ID NO. 38 may refer to a protein inherently present in microorganisms of the genus Corynebacterium encoded by the known NCgl1999 gene, but is not limited thereto. Specifically, the protein consisting of the amino acid sequence of SEQ ID NO. 38 may refer to NADP-specific glutamate dehydrogenase derived from Corynebacterium glutamicum ATCC13032 encoded by the NCgl1999 gene, but is not limited thereto.

[0089] In addition, the NADP-specific glutamate dehydrogenase of the present disclosure may include not only the amino acid sequence of SEQ ID NO. 38, but also an amino acid sequence having at least 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% sequence identity or homology with the sequence of SEQ ID NO. 38. Furthermore, if the amino acid sequence has such sequence identity or homology and has biological activity identical or corresponding to that of the NADP-specific glutamate dehydrogenase of the present disclosure, cases in which some of the sequences have deletions, modifications, substitutions, conservative substitutions, or additions may also be included within the scope of the present disclosure.

[0090] In one specific example, in order to increase L-amino acid production capacity, in addition to enhancing the activity of fumarate hydrase, the activities of malate:quinone oxidoreductase, malate dehydrogenase, aspartate transaminase, and NADP-specific glutamate dehydrogenase were simultaneously enhanced, and it was confirmed that L-amino acid production capacity increased. Specifically, it was confirmed that the L-amino acid production capacity of L-amino acid-producing microorganisms was further enhanced by introducing a gene combination encoding fumarate hydratase, malate:quinone oxidoreductase, malate dehydrogenase, aspartate transaminase, and NADP-specific glutamate dehydrogenase using a plasmid.

[0091] The above "L-amino acid," "microorganism," "enhancement of activity," etc. are as described above.

[0092]

[0093] Another example provides a method for increasing the L-amino acid production capacity of said microorganism, or a method for imparting L-amino acid production capacity to said microorganism, comprising the step of enhancing the activity of the fumarate hydrase of said microorganism.

[0094] The step of enhancing the activity of the fumarate hydrase of the microorganism may include introducing a mutation to the microorganism to express a polypeptide having the activity of fumarate hydrase, or connecting a strong promoter to the top of a polynucleotide expression unit encoding the polypeptide.

[0095] The step of introducing the above mutation may include the step of introducing (transforming) a polynucleotide encoding a polypeptide having fumarate hydrase activity or a recombinant vector containing said polynucleotide into a microorganism.

[0096]

[0097] Another example provides a method for producing L-amino acids, comprising the step of culturing a microorganism in which the activity of the fumaric acid hydrase described above is enhanced in a culture medium. The method may further comprise, after the culturing step, the step of recovering L-amino acids from the cultured microorganism, the culture medium, or both.

[0098] In the above method, the step of culturing the microorganism may be performed by known batch culture methods, continuous culture methods, fed-batch culture methods, etc., although not specifically limited thereto. At this time, the culture conditions may be adjusted to an appropriate pH (e.g., pH 5 to 9, specifically pH 6 to 8, most specifically pH 6.8) using a basic compound (e.g., sodium hydroxide, potassium hydroxide, or ammonia) or an acidic compound (e.g., phosphoric acid or sulfuric acid), and aerobic conditions may be maintained by introducing oxygen or an oxygen-containing gas mixture into the culture medium. The culture temperature may be maintained at 20 to 45°C or 25 to 40°C, and culture may be performed for about 10 to 160 hours, but is not limited thereto. Through the above culture, L-amino acids may be secreted into the medium or remain within the cells.

[0099] The culture medium usable for the above-mentioned culture may use one or more selected from the group consisting of sugars and carbohydrates (e.g., glucose, sucrose, lactose, fructose, maltose, molasses, starch, and cellulose), oils and fats (e.g., soybean oil, sunflower oil, peanut oil, and coconut oil), fatty acids (e.g., palmitic acid, stearic acid, and linoleic acid), alcohols (e.g., glycerol and ethanol), and organic acids (e.g., acetic acid) as carbon sources, either individually or in a mixture of two or more. As nitrogen sources, one or more selected from the group consisting of nitrogen-containing organic compounds (e.g., peptone, yeast extract, meat juice, malt extract, corn steep liquid, soybean meal, and urea) and inorganic compounds (e.g., ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate) may be used individually or in a mixture of two or more, but is not limited thereto. One or more selected from the group consisting of potassium dihydrogen phosphate, dipotassium hydrogen phosphate, and equivalent sodium-containing salts may be used individually or two or more may be used in combination as a phosphorus source, but are not limited thereto. Additionally, the medium may contain other metal salts (e.g., magnesium sulfate or iron sulfate), amino acids, and / or vitamins, and other essential growth-promoting substances.

[0100] The step of recovering the L-amino acid may involve collecting the desired amino acid from a culture medium, culture solution, or microorganism using a suitable method known in the art according to the culture method. For example, the recovery step may be performed by one or more methods selected from centrifugation, filtration, anion exchange chromatography, crystallization, HPLC, etc. The method of recovering the L-amino acid may additionally include a purification step prior to, simultaneously with, or after.

[0101] The above "L-amino acid," "microorganism," "enhancement of activity," etc. are as described above.

[0102]

[0103] Another example of the present disclosure provides a composition for producing L-amino acids comprising a microorganism of the genus Corynebacterium that produces L-amino acids with enhanced fumaric acid hydrase activity.

[0104] The composition of the present disclosure may further include any suitable excipients commonly used in compositions for producing amino acids, and such excipients may be, for example, preservatives, wetting agents, dispersants, suspending agents, buffers, stabilizers or isotonic agents, but are not limited thereto.

[0105] In the composition of the present disclosure, the "L-amino acid," "microorganism," "enhancement of activity," etc. are as described above.

[0106]

[0107] Another example of the present disclosure provides a use for the production of L-amino acids by microorganisms of the genus Corynebacterium, in which the activity of the fumarate hydrase of the present disclosure is enhanced.

[0108] The above "L-amino acid," "microorganism," "enhancement of activity," etc. are as described above.

[0109]

[0110] Another aspect of the present disclosure provides a use for the preparation of a composition for producing L-amino acids by a microorganism of the genus Corynebacterium, which produces L-amino acids with enhanced activity of the fumarate hydrase of the present disclosure.

[0111] The above "L-amino acid," "microorganism," "enhancement of activity," etc. are as described above.

[0112]

[0113] According to another aspect of the present disclosure, the present disclosure provides a composition, method, product, process, or use characterized by one or more elements disclosed in the present disclosure.

[0114]

[0115] The present disclosure provides a technology for increasing the L-amino acid production capacity of microorganisms. To this end, a microorganism enhanced with fumaric acid hydrase is provided. It has been confirmed that the microorganism enhanced with fumaric acid hydrase has increased L-amino acid production capacity compared to a parent strain not enhanced with fumaric acid hydrase, and thus the microorganism enhanced with fumaric acid hydrase can be widely utilized for L-amino acid production.

[0116]

[0117] The present disclosure is described in more detail below by way of examples. However, the following examples are merely preferred embodiments for illustrating the present disclosure and are therefore not intended to limit the scope of the rights of the present disclosure. Meanwhile, technical matters not described in the present disclosure can be fully understood and easily implemented by a person skilled in the art who is proficient in the technical field of the present disclosure or a similar technical field.

[0118]

[0119] Example 1. Preparation of a plasmid for fumarate hydrase enhancement

[0120] To determine the effect of enhancing the fumarate hydratase (hereinafter fumC) gene of Corynebacterium glutamicum on L-amino acid production, a vector expressing the BBD29_RS05465 gene (sequence number 2), NCBI registration number NZ_CP016335.1 derived from Corynebacterium glutamicum ATCC13869, was constructed as follows.

[0121] Specifically, to insert the fumarate hydrase gene into the Corynebacterium glutamicum chromosome, BBD29_RS10775 (SEQ No. 4), known as the gene encoding a transposon in Corynebacterium glutamicum, was used as the insertion site (Journal of Biotechnology 104, 5-25 Jorn Kalinowski et al, 2003). To substitute the BBD29_RS10775 gene into a fumC-enhanced form, BBD29_RS10775 deletion and target gene insertion vectors were constructed. To construct the vectors, PCR was performed using the ATCC13869 chromosome as a template and primer pairs of SEQ No. 5 and SEQ No. 6, and SEQ No. 7 and SEQ No. 8, respectively.

[0122] PfuUltra™ high-reliability DNA polymerase (Stratagene) was used as the polymerase for the PCR reaction, and the PCR conditions were denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and polymerization at 72°C for 1 minute, and these denaturation, annealing, and polymerization reactions were repeated 28 times. As a result, DNA fragments of 756 bp and 731 bp were obtained, respectively. The obtained DNA product was purified using a PCR Purification kit (QUIAGEN), and the purified amplification product was treated with the restriction enzyme SmaI and heat-treated at 65°C for 20 minutes. Then, the pDC24 vector (SEQ No. 146) was used, and the vector pDC24ΔBBD29_RS10775 for BBD29_RS10775 deletion and target gene insertion was constructed by cloning according to the provided manual using an Infusion Cloning Kit (TaKaRa).

[0123] In order to enhance the activity of fumarate hydratase (FumC), a plasmid that strengthens the fumC gene was constructed using the Pspl13 promoter (Sequence No. 9, Korean Patent No. 10-1783170), which is known as a strong promoter.

[0124] Specifically, to construct a gene into which FumC having a Pspl13 promoter was introduced, the chromosome of Corynebacterium glutamicum ATCC13869 was used as a template, and PCR was performed on the gene fragment of the downstream region of the FumC gene using primers of SEQ ID NO. 10 and SEQ ID NO. 11, respectively, under the same conditions as the PCR conditions used in the method for constructing the pDC24ΔBBD29_RS10775 vector.

[0125] PfuUltra™ high-reliability DNA polymerase (Stratagene) was used as the polymerase for the PCR reaction. The PCR conditions involved denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and polymerization at 72°C for 1 minute, and these denaturation, annealing, and polymerization reactions were repeated 28 times. As a result, a 1450 bp DNA fragment of Corynebacterium glutamicum ATC13869fumC was obtained. PCR was performed using primers of SEQ ID NO. 10 and SEQ ID NO. 13, using the Pspl13 promoter (SEQ ID NO. 9, Korean Registered Patent No. 10-1783170) and the amplified fumC gene DNA fragment as templates. The PCR conditions involved denaturation at 95°C for 5 minutes, followed by denaturation at 95°C for 30 seconds; and annealing at 55°C for 30 seconds; After repeating the polymerization at 72°C for 2 minutes 28 times, the polymerization reaction was performed at 72°C for 5 minutes.

[0126] As a result, a 1738 bp Pspl13_fumC DNA fragment encoding the Pspl13 promoter and fumC was amplified. The amplified product was purified using a PCR purification kit (QIAGEN) and used as an insert DNA fragment for vector construction. After treating the purified amplified product with the restriction enzyme SmaI and heat-treating it at 65°C for 20 minutes, the molar concentration (M) ratio of the pDC24ΔBBD29_RS10775 vector and the insert DNA fragment, which is the amplified product, was set to 1:2. Then, the vector pDC24ΔBBD29_RS10775::Pspl13-fumC was constructed to introduce Pspl13-fumC into the chromosome by cloning according to the provided manual using the In-Fusion® HD Cloning Kit (Clontech).

[0127] The sequence of the primer used in Example 1 above is shown in Table 1 below.

[0128] Name Sequence (5'-> 3') Sequence Number RS10775-up-FAAACGACGGCCAGTGAATTCTGGCCATAACGAGTGCGGTA Sequence Number 5 RS10775-up-RGGCTCTTCCTGTTTAGTACTAAACCGGAAcccGGGCCTTCACCCC Sequence Number 6 RS10775-down-FGACGGATTCAGGGGGTGAAGGCCCgggTTCCGGTTTAGTACTA Sequence Number 7 RS10775-down-RCTTGCATGCCTGCAGGTCGACTGCTGGAGTGAGCGCATGA Sequence Number 8 fumC-3'-FGATTATTGGAGGAGATCAAAACAATGACCGAGCAGGAATTCC Sequence Number 10 fumC-3'-RGGCTCTTCCTGTTTAGTTTAGAACTTGTTCTCGCGCT Sequence Number 11Pspl13-FGGCCCTTCCGGTTTAGTGGCGCTTCATGTCAACAATCTTTAAC Sequence No. 12Pspl13-RGGAATTCCTGCTCGGTCATTGTTTTGATCTCCTCCAATAATC Sequence No. 13

[0129] Comparative Example 1. Production of a glutamate-based amino acid-producing microorganism not enhanced with fumaric acid hydrase

[0130] As a control group to confirm the effect of increased productivity of glutamate-based amino acids due to fumarate hydratase enhancement, Corynebacterium glutamicum CJR2 strain, in which the argR gene was deleted and an argB (M54V) gene mutation was introduced into the Corynebacterium glutamicum ATCC13869 strain, and Corynebacterium glutamicum CJR100 strain, in which the argR gene was deleted and an argB (M54V) gene mutation and argC gene enhancement were introduced, were prepared as follows (Ikeda, Masato et al., Applied and environmental microbiology 75(6)1635-41, 2009).

[0131]

[0132] Comparative Example 1-1. Production of a microorganism in which the argR gene is deleted and the argB (M54V) mutation is introduced

[0133] Vectors for the introduction of argR deletion and argB (M54V) mutations were constructed as follows. Using the genomic DNA of Corynebacterium glutamicum ATCC13869 as a template, PCR was performed using primer pairs of SEQ ID NOs. 14 and 15 and SEQ ID NOs. 16 and 17, and overlapping PCR was performed using primer pairs of SEQ ID NOs. 14 and 17 to obtain homologous recombination fragments containing the argR deletion mutation sequence. In the same manner as above, to prepare homologous recombination fragments containing the argB (M54V) mutation, PCR was performed using primer pairs of SEQ ID NOs. 18 and 19 and SEQ ID NOs. 20 and 21, and overlapping PCR was performed using SEQ ID NOs. 18 and 21. The PCR reaction consisted of denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and the 2-minute extension process at 72°C was repeated 30 times. Then, the linearized pDC24 vector and each homologous recombination fragment were fusion cloned using the same method as described in Example 1. The constructed vectors (recombination plasmids) were named pDC24-ΔargR and pDC24-argB (M54V), respectively.

[0134] To introduce an argR deletion mutation into wild-type Corynebacterium glutamicum ATCC13869, the above-constructed pDC24-ΔargR plasmid was transformed into the Corynebacterium glutamicum ATCC13869 strain by chromosomal homologous recombination to obtain a recombinant strain (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). PCR was performed on the obtained recombinant strain using the primer pair of SEQ ID NOs. 14 and 17 to confirm that a deletion mutation was introduced into the chromosomal argR gene. The PCR reaction was performed by repeating the following steps 30 times: denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and extension at 72°C for 2 minutes. The transformed strain was named CJR1.

[0135] The argB (M54V) mutation was introduced into the above Corynebacterium glutamicum CJR1 using the same method as above. The above-constructed pDC24-argB (M54V) plasmid was used, and PCR was performed using primer pairs (sequence numbers 18 and 21) on the transformed strain after secondary recombination was completed to confirm that the M54V mutation was introduced into the chromosomal argB gene, and the transformed strain was named Corynebacterium glutamicum CJR2.

[0136]

[0137] The sequence of the primer used in Comparative Example 1 above is shown in Table 2 below.

[0138] Name Sequence (5'-> 3') Sequence Number argR-5'-Ftgaattcgagctcggtaccccactggtgaactccttgtcc Sequence Number 14 argR-5'-Rttgaactaggggcgctttaaaagttttccggtgttgacgg Sequence Number 15 argR-3'-Fccgtcaacaccggaaaacttttaaagcgcccctagttcaa Sequence Number 16 argR-3'-Rgtcgactctagaggatcccccgttgaactgcttgccagcc Sequence Number 17 argB-5'-Ftgaattcgagctcggtaccctgcggctcgcacggttgctc Sequence Number 18 argB-5'-Racggtgcgcaagaagaccacgtcggcaaaagcagcct Sequence Number 19argB-3'-FggctgcttttgctgccgacgtggtcttcttgcgcaccgtgSequence No. 20argB-3'-RgtcgactctagaggatccccctcttatcaggccaatcggtSequence No. 21

[0139] Comparative Example 1-2. Production of a microorganism having a deleted argR gene, an argB (M54V) gene mutation, and an argC gene enhancement introduced

[0140] Using the Corynebacterium glutamicum CJR2 strain produced in Comparative Example 1-1 above, a CJR100 strain was produced in which the N-acetyl-gamma-glutamyl-phosphate reductase gene (hereinafter, argC) was further enhanced to improve L-arginine productivity.

[0141] Specifically, to enhance the activity of the N-acetyl-gamma-glutamyl-phosphoriphosphate reductase gene argC (Sequence No. 23, NCBI Registration No. BBD29_RS07535), a plasmid was constructed to enhance argC activity by replacing the wild-type promoter of the argC gene with Po2 using the o2 promoter (Korean Patent Registration No. 10-1632642, hereinafter Po2), which is known as a potent promoter. The upstream and downstream regions of the argC gene were obtained. More specifically, to construct a strain of argC introduced with Po2, PCR was performed using the chromosomal DNA of Corynebacterium glutamicum ATCC13869 as a template to amplify the gene fragment of the upstream region of the argC gene using primers of SEQ ID NO. 24 and SEQ ID NO. 25, and the gene fragment of the downstream region of the argC gene using primers of SEQ ID NO. 26 and SEQ ID NO. 27. PfuUltra™ high-reliability DNA polymerase (Stratagene) was used as the polymerase for the PCR reaction. The PCR conditions were denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and polymerization at 72°C for 1 minute, and the denaturation, annealing, and polymerization reactions under the above conditions were repeated 28 times. As a result, a 610 bp upstream DNA fragment and a 1086 bp downstream DNA fragment of Corynebacterium glutamicum ATCC13869argC were obtained, respectively. PCR was performed using primers of SEQ ID NO. 24 and SEQ ID NO. 25 with the o2 promoter (Korean Registered Patent No. 10-1632642) and the amplified argC upstream and downstream DNA fragments as templates. Under PCR conditions, after denaturation at 95°C for 5 minutes, annealing at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and polymerization at 72°C for 2 minutes were repeated 28 times, followed by a polymerization reaction at 72°C for 5 minutes.The PCR fragment obtained above underwent DNA purification and was then linked to a pDC24 plasmid treated with SmaI restriction enzyme using the In-Fusion® HD Cloning Kit (Clontech) for fusion cloning. The resulting vector was named pDC24-Po2-argC.

[0142] Then, a recombinant strain was obtained by transforming the CJR2 strain produced in Comparative Example 1 into the Corynebacterium glutamicum CJR2 strain by chromosomal homologous recombination using the pDC24-Po2-argC plasmid produced above (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). PCR was performed on the obtained recombinant strain and the transformed strain using the primer pair of SEQ ID NOs. 27 and 28 to confirm that the chromosomal argC gene was strengthened to Po2. At this time, the PCR reaction was performed by repeating the process of denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and extension at 72°C for 2 minutes 30 times. The transformed strain was named Corynebacterium glutamicum CJR100.

[0143]

[0144] The sequence of the primer used in Comparative Example 2 above is shown in Table 3 below.

[0145] Name Sequence (5'-> 3') Sequence Number argC-5'-FGTGAATTCGAGCTCGGTACCCGCCCCGAAAAGCCGTTAAAAG Sequence Number 24 argC-5'-RtgccaaaattcacgattattgCCCACCTACAGCTAAAACTGC Sequence Number 25 argC-3'-FttattggaggagatcaaaacaATGACAATCAAGGTTGCAATC Sequence Number 26 argC-3'-RTTAAGGTGCGACGCCGACCTGGGGGATCCTCTAGAGTCGACC Sequence Number 27 Po2-Fcaataatcgtgaattttggca Sequence Number 28 Po2-Rtgttttgatctcctccaataa Sequence Number 29

[0146] Example 2. Preparation of a glutamate-family amino acid-producing microorganism with enhanced fumaric acid hydrase activity and evaluation of glutamate-family amino acid production capacity

[0147] Example 2-1. Production of a glutamate-based amino acid-producing microorganism with enhanced fumaric acid hydrase activity

[0148] In order to construct a glutamate-series amino acid microorganism with enhanced fumarate hydratase activity, a recombinant strain was obtained by transforming the Corynebacterium glutamicum CJR100 strain constructed in Comparative Examples 1-2 with the pDC24ΔBBD29_RS10775::Pspl13-fumC plasmid constructed in Example 1 via chromosomal homologous recombination (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). PCR was performed on the obtained recombinant strain using the primer pair of SEQ ID NOs. 11 and 12 to confirm that fumarate hydratase was introduced in a form enhanced by Pspl13. At this time, the PCR reaction was performed with denaturation at 95°C for 30 seconds; The process of annealing at 55°C for 30 seconds and elongation at 72°C for 2 minutes was repeated 30 times. The transformed strain was named Corynebacterium glutamicum CJR1002 (CJR100-Pspl13_fumC).

[0149]

[0150] Example 2-2. Confirmation of increased glutamate-family amino acid production capacity in microorganisms with enhanced fumaric acid hydrase activity

[0151] In order to confirm the effect of enhancing fumarate hydrase activity on the production capacity of glutamate-based amino acids, the Corynebacterium glutamicum CJR1002 strain with enhanced fumarate hydrase activity prepared in Example 2-1, the Corynebacterium glutamicum CJR2 strain without enhanced fumarate hydrase activity prepared in Comparative Examples 1-1 and 1-2, and the Corynebacterium glutamicum CJ100 strain were cultured in the following manner to confirm the production capacity of glutamate-based amino acids L-arginine, L-citrulline, and L-ornithine.

[0152] Specifically, the Corynebacterium glutamicum CJR2 strain, the Corynebacterium glutamicum CJ100 strain, and the Corynebacterium glutamicum CJR1002 strain were each inoculated into a 250 ml corner-baffle flask containing 25 ml of the following production medium, and cultured at 30°C for 44 hours with shaking at 200 rpm. The composition of the production medium is as follows.

[0153]

[0154] Production Medium (pH 7.2)

[0155] Sucrose 50 g, ammonium sulfate 57 g, magnesium sulfate heptahydrate 2 g, beet molasses 5 g, calcium chloride 1 mg, cobalt chloride 1 mg, monopotassium phosphate 2 g, biotin 0.01 mg, thiamine-HCl 0.1 mg, calcium pantothenate 2 mg, nicotinamide 3 mg, ferrous sulfate 10 mg, manganese sulfate 10 mg, zinc sulfate 0.02 mg, copper sulfate 0.5 mg, calcium carbonate 30 g (based on 1 liter of distilled water)

[0156]

[0157] After the culture was finished, the production capacity (concentration) of L-arginine, L-citrulline, and L-ornithine was measured using HPLC (Waters 2478). The experiment was repeated three times, and the average concentration values ​​of L-arginine, L-citrulline, and L-ornithine from the analysis results are shown in Table 4 below.

[0158] Strain Name L-Arginine(g / ℓ)L-Citrulline(g / ℓ)L-Ornithine(g / ℓ)CJR25.11.00.1CJR1005.91.00.2CJR1002(CJR100-Pspl13_fumC)6.21.30.4

[0159] As a result, as shown in Table 4, it was confirmed that the CJR1002 strain of Corynebacterium glutamicum, in which the fumC gene is enhanced by the powerful promoter Pspl13, has an improved L-arginine production capacity of 105% compared to the unenhanced strain, Corynebacterium glutamicum CJR100, and has L-citrulline and L-ornithine production capacities of 130% and 200%, respectively.

[0160] From the above results, it was confirmed that enhancing the activity of fumarate hydratase increases the glutamate-series amino acid production capacity of microorganisms of the genus Corynebacterium.

[0161]

[0162] Example 3. Construction of a plasmid for inserting the complex genes of malate:quinone oxidoreductase, malate dehydrogenase, aspartate transaminase, NADP-specific glutamate dehydrogenase, and fumarate hydrase.

[0163] Glutamate family resulting from the introduction of a complex comprising all of the genes encoding malate:quinone oxidoreductase (SEQ No. 30) (SEQ No. 31, hereinafter mqo), malate dehydrogenase (SEQ No. 34) (SEQ No. 35, hereinafter mdh), aspartate transaminase (SEQ No. 36) (SEQ No. 37, hereinafter asaspB), NADP-specific glutamate dehydrogenase (SEQ No. 38) (SEQ No. 39, hereinafter gdh), and fumarate hydratase (SEQ No. 40) (SEQ No. 41, hereinafter fumC) of Corynebacterium glutamicum. To verify the effect of improving amino acid productivity, a complex reinforcement vector was constructed using the following method.

[0164] Specifically, to insert the complex gene into the Corynebacterium glutamicum chromosome, the mqo gene within the complex was used as the insertion site. A target gene insertion vector containing the mqo gene was constructed to replace the complex form within the mqo gene. PCR was performed using the primer pairs of each complex gene listed in Table 5, with the chromosome of the Corynebacterium glutamicum ATCC13032 strain as a template.

[0165] PfuUltra™ high-reliability DNA polymerase (Stratagene) was used as the polymerase for the PCR reaction, and the PCR conditions were denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and polymerization at 72°C for 1 minute, and the denaturation, annealing, and polymerization reactions under the above conditions were repeated 28 times. As a result, DNA fragments were obtained using primer pairs of SEQ ID NOs. 42 and 43 for the mqo gene fragment (1947 bp), primer pairs of SEQ ID NOs. 44 and 45 for the mdh gene fragment (1357 bp), primer pairs of SEQ ID NOs. 46 and 47 for the aspB gene fragment (1575 bp), primer pairs of SEQ ID NOs. 48 and 49 for the gdh gene fragment (1794 bp), primer pairs of SEQ ID NOs. 50 and 51 for the fumC gene fragment (1686 bp), and primer pairs of SEQ ID NOs. 52 and 53 for the mqo gene fragment (1916 bp). PCR was performed using the obtained DNA products with primers of SEQ ID NOs. 42 and 53. PfuUltra™ high-reliability DNA polymerase (Stratagene) was used as the polymerase for the PCR reaction, and the PCR conditions were denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and polymerization at 72°C for 10 minutes, and the denaturation, annealing, and polymerization reactions under the above conditions were repeated 28 times. As a result, a 10,275 bp mqo-mdh-aspB-gdh-fumC-mqo complex gene DNA fragment was obtained.The obtained DNA product was purified using a PCR Purification kit (QUIAGEN), and the purified amplification product was treated with the restriction enzyme SmaI and heat-treated at 65°C for 20 minutes. Then, the pDC24 vector (SEQ No. 146) was prepared and the pDC24mqo-mdh-aspB-gdh-fumC-mqo vector was constructed to introduce mqo-mdh-aspB-gdh-fumC-mqo into the chromosome using an Infusion Cloning Kit (TaKaRa) according to the provided manual.

[0166] The sequence of the primers used in Example 3 above is shown in Table 5 below.

[0167] Name Sequence (5'-> 3') Sequence Number mqo-5'-FGTGAATTCGAGCTCGGTACCCATACTACTCATGTTTGCGAAT Sequence Number 42 mqo-3'-RTCCTGATATCGGGCACCATTTGGCAAAGAATACGCAAAGCAC Sequence Number 43 mdh-5'-FTGCTTTGCGTATTCTTTGCCAAATGGTGCCCGATATCAGGA Sequence Number 44 mdh-3'-RAACAAAGCAGCCATGCGTTGCAGCCGTTACTTAAACCAAGTC Sequence Number 45 aspB-5'-FCGACTTGGTTTAAGTAACGGCTGCAACGCATGGCTGCTTTGTT Sequence Number 46 aspB-3'-RGCGAATGAGACCAGTTGACTGTTAGTTAGCGTAATGCTCCGC Sequence Number 47gdh-5'-FGCGGAGCATTACGCTAACTAACAGTCAACTGGTCTCATTCGC Sequence No. 48gdh-3'-RGGTTAATATCCAATATGGAAGTTAGATGACGCCCTGTGCCAG Sequence No. 49fumC-5'-FCTGGCACAGGGCGTCATCTAACTTCCATATTGGATATTAACC Sequence No. 50fumC-3'-RATTCGCAAACATGAGTAGTATTTAGAACTTGTTCTCGCGCTC Sequence No. 51mqo-5'-FCGCGAGAACAAGTTCTAAATACTACTCATGTTTGCGAATTG Sequence No. 52mqo-3'-RGGTCGACTCTAGAGGATCCCCTTAGGCTTCCTCAAGCTTCAG Sequence No. 53Mqo-FCTCTTCACCAGCATT Sequence No. 54Mqo-RTTGTCACAACATCTGTTTCA Sequence No. 55

[0168] Example 4. Preparation of microorganisms with enhanced activities of malate:quinone oxidoreductase, malate dehydrogenase, aspartate transaminase, NADP-specific glutamate dehydrogenase, and fumarate hydrase, and evaluation of glutamate-family amino acid production capacity

[0169] Example 4-1. Preparation of a microorganism in which the activities of malate:quinone oxidoreductase, malate dehydrogenase, aspartate transaminase, NADP-specific glutamate dehydrogenase, and fumarate hydrase are all enhanced

[0170] In order to produce a microorganism in which the activities of malate:quinone oxidoreductase, malate dehydrogenase, aspartate transaminase, NADP-specific glutamate dehydrogenase, and fumarate hydrase were all enhanced, a recombinant strain was obtained by transforming the Corynebacterium glutamicum CJR100 strain prepared in Comparative Examples 1-2 with the pDC24mqo-mdh-aspB-gdh-fumC-mqo plasmid prepared in Example 3 by chromosomal homologous recombination (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). PCR was performed on the recombinant strain obtained above using the primer pair of SEQ ID NOs. 54 and 55 to confirm that the mqo-mdh-aspB-gdh-fumC-mqo complex was introduced into the chromosome of Corynebacterium glutamicum. At this time, the PCR reaction consisted of 30 cycles of denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and extension at 72°C for 2 minutes. The transformed strain was named Corynebacterium glutamicum CJR1012.

[0171]

[0172] Example 4-2. Confirmation of increased glutamate-family amino acid production capacity in microorganisms with enhanced activities of malate:quinone oxidoreductase, malate dehydrogenase, aspartate transaminase, NADP-specific glutamate dehydrogenase, and fumarate hydrase.

[0173] In order to confirm the effect of enhancing the activity of malate:quinone oxidoreductase, malate dehydrogenase, aspartate transaminase, NADP-specific glutamate dehydrogenase, and fumarate hydrase on L-amino acid production capacity, the Corynebacterium glutamicum CJR1012 strain prepared in Example 4-1, the Corynebacterium glutamicum CJR1002 strain prepared in Example 2-1 in which only the activity of fumarate hydrase was enhanced, the Corynebacterium glutamicum CJR2 strain prepared in Comparative Examples 1-1 and 1-2 in which the activity of fumarate hydrase was not enhanced, and the Corynebacterium glutamicum CJ100 strain were cultured in the following manner to confirm the production capacity of L-arginine.

[0174] Specifically, the Corynebacterium glutamicum CJR2 strain, Corynebacterium glutamicum CJ100 strain, Corynebacterium glutamicum CJR1002 strain, and Corynebacterium glutamicum CJR1012 strain were each inoculated into a 250 ml corner-baffle flask containing 25 ml of the following production medium, and cultured at 30°C for 44 hours with shaking at 200 rpm. The composition of the production medium is as follows.

[0175]

[0176] Production Medium (pH 7.2)

[0177] Sucrose 50 g, ammonium sulfate 57 g, magnesium sulfate heptahydrate 2 g, beet molasses 5 g, calcium chloride 1 mg, cobalt chloride 1 mg, monopotassium phosphate 2 g, biotin 0.01 mg, thiamine-HCl 0.1 mg, calcium pantothenate 2 mg, nicotinamide 3 mg, ferrous sulfate 10 mg, manganese sulfate 10 mg, zinc sulfate 0.02 mg, copper sulfate 0.5 mg, calcium carbonate 30 g (based on 1 liter of distilled water)

[0178]

[0179] After the culture was finished, the production capacity (concentration) of L-arginine was measured using HPLC (Waters 2478). The above experiment was repeated three times, and the average value of the L-arginine concentrations analyzed is shown in Table 6 below.

[0180] Strain Name L-Arginine(g / ℓ)CJR25.1CJR1005.9CJR1002(CJR100-Pspl13_fumC)6.2CJR1012(CJR100-mqo-mdh-aspB-gdh-fumC-mqo)6.4

[0181] As a result, as shown in Table 6, it was confirmed that the Corynebacterium glutamicum CJR1012 strain, which introduced pDC24mqo-mdh-aspB-gdh-fumC-mqo, had an increased L-arginine production capacity of 109% compared to the Corynebacterium glutamicum CJR100 strain, which was not enhanced with the fumC gene, and that it had a higher L-arginine production capacity than the CJR1002 strain, which was enhanced with only the fumC gene.

[0182] From the above results, it was confirmed that enhancing the activity of malate:quinone oxidoreductase, malate dehydrogenase, aspartate transaminase, NADP-specific glutamate dehydrogenase, and fumarate hydrase increases the production capacity of arginine, a representative example among glutamate-based amino acids, thereby increasing the production capacity of glutamate-based amino acids in microorganisms of the genus Corynebacterium.

[0183]

[0184] Example 5. Preparation of O-acetylhomoserine-producing microorganisms with enhanced fumaric acid hydrase activity and evaluation of O-acetylhomoserine production capacity

[0185] Example 5-1. Construction of a plasmid for the insertion of a gene encoding fumarate hydrase.

[0186] To determine the effect of enhancing the activity of fumarate hydratase on O-acetyl homoserine production in Corynebacterium glutamicum strains capable of producing O-acetyl homoserine and L-homoserine, the gene encoding fumarate hydratase derived from Corynebacterium glutamicum ATCC13032 (SEQ No. 41, NCBI Registration No. "NCgl0967", in the Corynebacterium glutamicum O-acetyl homoserine and homoserine-producing strain ATCC13032 ΔNCgl2335::PCJ7-yjeH(eco,F351L) ΔmetBΔmetYlysC(L377K)ΔNCgl0616 (Korean Patent Publication No. 10-2022-0038131) A vector for introducing the following fumC was created as follows.

[0187] Specifically, to insert the fumarate hydratase gene fumC into the chromosome of Corynebacterium glutamicum, the NCgl1490 gene, known as the gene encoding a transposon in Corynebacterium glutamicum, was used as the insertion site (Journal of Biotechnology 104, 5-25 Jorn Kalinowski et al, 2003). To replace the NCgl1490 gene with a fumC-enhanced form, NCgl1490 deletion and target gene insertion vectors were constructed. To construct the vectors, PCR was performed using primer pairs of SEQ ID NOs 58 and 59, and SEQ ID NOs 60 and 61, with the chromosome of the Corynebacterium glutamicum ATCC13032 strain as a template.

[0188] PfuUltra™ high-reliability DNA polymerase (Stratagene) was used as the polymerase for the PCR reaction. The PCR conditions involved denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and polymerization at 72°C for 1 minute, and these cycles of denaturation, annealing, and polymerization were repeated 28 times. As a result, a 1057 bp upstream DNA fragment of Corynebacterium glutamicum ATC13032NCgl1490 and a 1146 bp downstream DNA fragment were obtained, respectively. PCR was performed using the amplified promoter and DNA fragments as templates with primers of SEQ ID NO. 58 and SEQ ID NO. 61. The PCR conditions involved denaturation at 95°C for 5 minutes, followed by denaturation at 95°C for 30 seconds; and annealing at 55°C for 30 seconds; After repeating polymerization at 72°C for 2 minutes 28 times, a polymerization reaction was performed at 72°C for 5 minutes. The two fragments obtained above underwent DNA purification, and then a plasmid was obtained by fusion cloning according to the provided manual using the In-Fusion® HD Cloning Kit (Clontech) with the pDC24 vector (SEQ No. 146) treated with SmaI restriction enzyme. The obtained vector was named pDC24-ΔNCgl1490.

[0189] In order to enhance the activity of fumarate hydratase, a plasmid was constructed to enhance the fumC gene using Pspl13 (Sequence No. 9, Korean Patent No. 10-1783170), a promoter known as a potent promoter.

[0190] Specifically, to construct a FumC-introduced gene containing Pspl13, PCR was performed on the FumC gene fragment using primers of SEQ ID NO. 62 and SEQ ID NO. 63, respectively, with the chromosome of Corynebacterium glutamicum ATCC13032 as a template. In addition, a Pspl13 promoter fragment was obtained using primers of SEQ ID NO. 64 and SEQ ID NO. 65 with the pDC24-Pspl13 template.

[0191] PfuUltra™ high-reliability DNA polymerase (Stratagene) was used as the polymerase for the PCR reaction. The PCR conditions were denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and polymerization at 72°C for 1 minute; these denaturation, annealing, and polymerization steps were repeated 28 times. As a result, a 330 bp DNA fragment of the Pspl13 promoter region and a 1448 bp DNA fragment of fumC derived from Corynebacterium glutamicum ATC13032 were obtained, respectively. PCR was performed using the amplified promoter and DNA fragments as templates with primers of SEQ ID NO. 64 and SEQ ID NO. 62. The PCR conditions were denaturation at 95°C for 5 minutes, followed by denaturation at 95°C for 30 seconds; and annealing at 55°C for 30 seconds; After repeating the polymerization at 72°C for 2 minutes 28 times, the polymerization reaction was performed at 72°C for 5 minutes.

[0192] As a result, a 1738 bp Pspl13_fumCDNA fragment encoding FumC with the Pspl13 promoter was amplified. The amplified product was purified using a PCR purification kit (QIAGEN) and used as an insert DNA fragment for vector construction. After treating the purified amplified product with the restriction enzyme SmaI and heat-treating it at 65°C for 20 minutes, the vector pDC24ΔNCgl1490 was heat-treated to achieve a molar concentration (M) ratio of the amplified product (insertion DNA fragment) to 1:2. Then, the vector pDC24-ΔNCgl1490:Pspl13-fumC was constructed to introduce Pspl13-fumC onto the chromosome by cloning according to the provided manual using the In-Fusion® HD Cloning Kit (Clontech).

[0193] The sequence of the primer used in Example 5-1 above is shown in Table 7 below.

[0194] Name Sequence (5'-> 3') Sequence Number NCgl1490-up-FAGTGAATTCGAGCTCGGTACCCGCGACATTTCGATGACCTAGGA Sequence Number 58 NCgl1490-up-RAGAGTGGCAGCAGTCCCGGGAGGGAAATTAGTCAGA Sequence Number 59 NCgl1490-down-FTGACTAATTTCCCTCCCGGGACTGCTGCCACTCTCACTGCTT Sequence Number 60 NCgl1490-down-RGGTCGACTCTAGAGGATCCCCTACAGTGCTTCAGTATCGGTA Sequence Number 61 fumC-3'-FTTATTGGAGGAGATCAAAACAATGACCGAGCAGGAATTCC Sequence Number 62 fumC-3'-RAGAGTGGCAGCAGTCCCTTAGAACTTGTTCTCGCGCT Sequence Number 63Pspl13-FTGACTAATTTCCCTCCCGGCGCTTCATGTCAACAATC Sequence No. 64Pspl13-RGGAATTCCTGCTCGGTCATTGTTTTGATCTCCTCCAATA Sequence No. 65

[0195] Example 5-2. Preparation of O-acetylhomoserine-producing microorganisms with enhanced fumaric acid hydrase activity

[0196] In order to construct an O-acetyl homoserine-producing microorganism with enhanced fumarate hydrase activity, the pDC24-ΔNCgl1490:Pspl13-fumC plasmid constructed in Example 5-1 was transgenically recombined with Corynebacterium glutamicum ATCC13032 ΔNCgl2335::PCJ7-yjeH(eco,F351L) ΔmetBΔmetYlysC(L377K)ΔNCgl0616 (Korean Patent Publication No. 10-2022-0038131) by chromosomal homologous recombination of Corynebacterium glutamicum ATCC13032 ΔNCgl2335::PCJ7-yjeH(eco,F351L) A recombinant strain was obtained by transforming the strain ΔmetBΔmetYlysC(L377K)ΔNCgl0616 (Korean Patent Publication No. 10-2022-0038131) (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). PCR was performed on the obtained recombinant strain using the primer pair of SEQ ID NOs. 58 and 63 to confirm that the fumarate hydratase gene was introduced onto the chromosome in a form enhanced by Pspl13. At this time, the PCR reaction was performed by repeating the process of denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and extension at 72°C for 2 minutes 30 times. The transformed strain was named Corynebacterium glutamicum CM04-8005.

[0197]

[0198] Example 5-3. Production of an O-acetylhomoserine-producing microorganism with simultaneous enhanced activity of malate:quinone oxidoreductase, malate dehydrogenase, aspartate transaminase, NADP-specific glutamate dehydrogenase, and fumarate hydrase

[0199] In order to construct an O-acetyl homoserine-producing microorganism with enhanced activities of malate:quinone oxidoreductase, malate dehydrogenase, aspartate transaminase, NADP-specific glutamate dehydrogenase, and fumarate hydrase, the pDC24Δmqo-mdh-aspB-gdh-fumC-mqo plasmid constructed in Example 3 was applied to the Corynebacterium glutamicum ATCC13032 O-acetyl homoserine and homoserine-producing strain ATCC13032 ΔNCgl2335::PCJ7-yjeH(eco,F351L) ΔmetBΔmetYlysC(L377K)ΔNCgl0616 (Korean Patent Publication No. 10-2022-0038131) A recombinant strain was obtained by transforming the strain ΔNCgl2335::PCJ7-yjeH(eco,F351L) ΔmetBΔmetYlysC(L377K)ΔNCgl0616 (Korean Patent Publication No. 10-2022-0038131) (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). PCR was performed on the obtained recombinant strain using the primer pair of sequence numbers 54 and 55 to confirm that the chromosomal mqo-mdh-aspB-gdh-fumC-mqo complex was introduced. At this time, the PCR reaction was performed by repeating the process of denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and extension at 72°C for 2 minutes 30 times. The above-mentioned transformed strain was named the Corynebacterium glutamicum CM04-8006 strain.

[0200]

[0201] Example 5-4. Confirmation of increased O-acetyl homoserine production capacity of O-acetyl homoserine-producing microorganisms with enhanced fumarate hydrase activity and O-acetyl homoserine-producing microorganisms with simultaneously enhanced activities of malate:quinone oxidoreductase, malate dehydrogenase, aspartate transaminase, NADP-specific glutamate dehydrogenase, and fumarate hydrase.

[0202] To confirm the increase in O-acetyl homoserine production capacity of O-acetyl homoserine-producing microorganisms with enhanced fumaric acid hydrase activity and simultaneously enhanced activity of malate:quinone oxidoreductase, malate dehydrogenase, aspartate transaminase, NADP-specific glutamate dehydrogenase, and fumaric acid hydrase, the concentration of O-acetyl homoserine produced after culture was measured by the following method.

[0203] Specifically, the control group Corynebacterium glutamicum ATCC13032 ΔNCgl2335::PCJ7-yjeH(eco,F351L) ΔmetBΔmetYlysC(L377K)ΔNCgl0616, the Corynebacterium glutamicum strain CM04-8005 prepared in Example 5-2, and the Corynebacterium glutamicum strain CM04-8006 prepared in Example 5-3 were each inoculated with one platinum loop into a 250 ml corner-baffle flask containing 25 ml of the O-acetyl homoserine production medium described below, and cultured at 33°C for 20 hours with shaking at 200 rpm. The composition of the production medium is as follows.

[0204]

[0205] <O-아세틸 호모세린 생산 배지 (pH 7.2)>

[0206] Glucose 30 g, KH2PO4 2 g, Urea 3 g, (NH4)2SO4 40 g, Peptone 2.5 g, CSL(Sigma) 5 g (10 ml), MgSO4.7H2O 0.5 g, CaCO3 20 g (based on 1 liter of distilled water)

[0207]

[0208] After the culture was finished, the production capacity (concentration) of O-acetyl homoserine was measured using HPLC (Waters 2478). The above experiment was repeated 3 times, and the average O-acetyl homoserine concentration values ​​from the analysis results are shown in Table 8 below.

[0209]

[0210] Strain Name O-Acetyl Homoserine (g / L)ATCC130320.27ATCC13032ΔNCgl2335::PCJ7-yjeH(eco,F351L) ΔmetBΔmetYlysC(L377K)ΔNCgl06161.73CM04-8005 (ATCC13032 ΔNCgl2335::PCJ7-yjeH(eco,F351L) ΔmetBΔmetYlysC(L377K)ΔNCgl0616ΔNCgl1490::Pspl13_fumC)2.21CM04-8006 (ATCC13032 ΔNCgl2335::PCJ7-yjeH(eco,F351L) ΔmetBΔmetYlysC(L377K)ΔNCgl0616_mqo-mdh-aspB-gdh-fumC-mqo)2.32

[0211] As a result, as shown in Table 8, compared to the Corynebacterium glutamicum ATCC13032 ΔNCgl2335::PCJ7-yjeH(eco,F351L) ΔmetBΔmetYlysC(L377K)ΔNCgl0616 strain, which did not have enhanced fumarate hydratase activity, the concentration of O-acetyl homoserine in the Corynebacterium glutamicum CM04-8005 strain, which had enhanced fumarate hydratase activity, was approximately 128%, and the activities of malate:quinone oxidoreductase, malate dehydrogenase, aspartate transaminase, NADP-specific glutamate dehydrogenase, and fumarate hydratase were simultaneously enhanced in the Corynebacterium glutamicum It was confirmed that the concentration of O-acetyl homoserine in the CM04-8006 strain was improved by approximately 134%.

[0212] From the above results, it was confirmed that the enhancement of fumarate hydratase activity and / or the simultaneous enhancement of the activities of malate:quinone oxidoreductase, malate dehydrogenase, aspartate transaminase, NADP-specific glutamate dehydrogenase, and fumarate hydratase increased the O-acetylhomoserine production capacity of microorganisms of the genus Corynebacterium.

[0213]

[0214] Example 5-5. Confirmation of increased O-acetyl homoserine production capacity in O-acetyl homoserine-producing microorganisms with enhanced fumarate hydrase activity and O-acetyl homoserine-producing microorganisms with simultaneously enhanced activities of malate:quinone oxidoreductase, malate dehydrogenase, aspartate transaminase, NADP-specific glutamate dehydrogenase, and fumarate hydrase, in addition to further enhanced O-acetyl homoserine transferase activity.

[0215] To confirm the effect of increased O-acetyl homoserine production capacity resulting from the simultaneous enhancement of the activities of malate:quinone oxidoreductase, malate dehydrogenase, aspartate transaminase, NADP-specific glutamate dehydrogenase, and fumarate hydrase in O-acetyl homoserine-producing microorganisms with enhanced fumarate hydrase activity and additionally enhanced O-acetyl homoserine transferase activity, the following experiment was performed.

[0216] Specifically, to amplify the metX gene encoding O-acetyl homoserine transferase, nucleotide sequence information of the metX gene (sequence number 67, NCBI registry number NCgl0624) was obtained from the National Institutes of Health (NIH) GenBank. Based on this, BamHI restriction enzyme sites were inserted at both ends of primers of sequence numbers 68 and 69 to amplify the region from the promoter region (approx. 300 bp above the start codon) to the terminator region (approx. 100 bp below the stop codon). The PCR conditions involved denaturation at 95°C for 5 minutes, followed by 30 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 90 seconds, followed by polymerization at 72°C for 7 minutes. As a result, a 1546 bp DNA fragment of the coding region of the metX gene was obtained. A plasmid was obtained by treating the pECCG117 (Republic of Korea Registered Patent No. 10-0057684) vector and the metXDNA fragment with the restriction enzyme BamHI, linking them using DNA conjugation enzyme, and then cloning, and this was named pECCG117-metXWT.

[0217] The primer sequences used in the above Example 5-5 are shown in Table 9 below.

[0218] Name Sequence (5'-> 3') Sequence Number metXFGGATCCCCTCGTTGTTCACCCAGCAACC Sequence Number 68 metXRGGATCCCAAAGTCACAACTACTTATGTTAG Sequence Number 69

[0219] After introducing the produced pECCG117-metXWT vector into Corynebacterium glutamicum ATCC13032 ΔNCgl2335::PCJ7-yjeH(eco,F351L) ΔmetBΔmetYlysC(L377K)ΔNCgl0616, the Corynebacterium glutamicum CM04-8005 strain produced in Example 5-2 and the Corynebacterium glutamicum CM04-8006 strain produced in Example 5-3 using the electric pulse method, the transformed strains were obtained by plating on a screening medium containing 25 mg / L of kanamycin.

[0220] To compare the O-acetyl homoserine production capacity of the strains prepared above, the strains were cultured in the following manner, and the concentration of O-acetyl homoserine in the culture medium was analyzed.

[0221] One inoculation loop of the strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of the O-acetyl homoserine production medium described below, and cultured at 33°C for 20 hours with shaking at 200 rpm. Then, the concentration of O-acetyl homoserine was analyzed using HPLC, and the analyzed concentration values ​​are shown in Table 10 below.

[0222]

[0223] <O-아세틸 호모세린 생산 배지 (pH 7.2)>

[0224] Glucose 30 g, KH2PO4 2 g, Urea 3 g, (NH4)2SO4 40 g, Peptone 2.5 g, CSL(Sigma) 5 g (10 ml), MgSO4.7H2O 0.5 g, CaCO3 20 g (based on 1 liter of distilled water)

[0225] 균주명O-아세틸 호모세린 (g / L)ATCC13032ΔNCgl2335::PCJ7-yjeH(eco,F351L) ΔmetBΔmetYlysC(L377K)ΔNCgl061604.804-CM (ATCC13032 ΔNCgl2335::PCJ7-yjeH(eco,F351L) ΔmetBΔmetY_lysC(L377K)ΔNCgl0616ΔNCgl1490)1.76CM04-8005 (ATCC13032 ΔNCgl2335::PCJ7-yjeH(eco,F351L) ΔmetBΔmetY_lysC(L377K)ΔNCgl0616ΔNCgl1490::Pspl13_fumC)2.21CM04-8006 (ATCC13032 ΔNCgl2335::PCJ7-yjeH(eco,F351L) ΔmetBΔmetY_lysC(L377K)ΔNCgl0616_mqo-mdh-aspB-gdh-fumC-mqo)2.32ATCC13032ΔNCgl2335:PCJL231(F351L) ΔmetBΔmetY_lysC(L377K)ΔNCgl0616) / pECCG117-metXWT2.83CM04-8004 (ATCC13032 ΔNCgl2335::PCJ7-yjeH(eco,F351L) ΔmetBΔmetY_lysC(L377K)ΔNCgl0616ΔNCgl1490)) / pECCG117-metXWT2.87CM04-8005 (ATCC13032 ΔNCgl2335::PCJ7-yjeH(eco,F351L) ΔmetBΔmetY_lysC(L377K)ΔNCgl0616ΔNCgl1490::Pspl13_fumC) / pECCG117-metXWT4.22CM04-8006 (ATCC13032 ΔNCgl2335::PCJ7-PCJH,F ΔmetBΔmetY_lysC(L377K)ΔNCgl0616_mqo-mdh-aspB-gdh-fumC-mqo) ) / pECCG117-metXWT4.57

[0226] As a result, as shown in Table 10 above, when the ATCC13032 ΔNCgl2335::PCJ7-yjeH(eco,F351L) ΔmetBΔmetYlysC(L377K) ΔNCgl0616 / pECCG117-metXWT strain was cultured, the concentration of O-acetyl homoserine was found to be 2.83 g / L, which was an increase compared to the concentration of O-acetyl homoserine of 1.76 g / L of the CM04-8004 strain (ATCC13032 ΔNCgl2335::PCJ7-yjeH(eco,F351L) ΔmetBΔmetY_lysC(L377K)ΔNCgl0616ΔNCgl1490), the strain before the metX gene was enhanced. In addition, when culturing the CM04-8005 strain with additional metX gene enhancement, the concentration of O-acetyl homoserine was found to be 4.22 g / L, confirming that the productivity of O-acetyl homoserine was improved by 149% compared to the strain with additional metX gene enhancement but no fumarate hydratase activity enhancement. When culturing the CM04-8006 strain with additional metX gene enhancement, the concentration of O-acetyl homoserine was found to be 4.57 g / L, confirming that the productivity of O-acetyl homoserine was improved by approximately 161% compared to the strain with additional metX gene enhancement but no malate:quinone oxidoreductase, malate dehydrogenase, aspartate transaminase, NADP-specific glutamate dehydrogenase, or fumarate hydratase activity enhancement.

[0227] Through the above results, it was confirmed that in strains with increased O-acetyl-L-homoserine production capacity due to metX gene enhancement, O-acetyl-L-homoserine production capacity increased when fumarate hydratase activity was enhanced and the activities of malate:quinone oxidoreductase, malate dehydrogenase, aspartate transaminase, NADP-specific glutamate dehydrogenase, and fumarate hydratase were simultaneously enhanced.

[0228]

[0229] Example 6. Preparation of homoserine-producing microorganisms with enhanced fumaric acid hydrase activity and evaluation of homoserine production capacity

[0230] Example 6-1. Preparation of a homoserine-producing microorganism with enhanced fumaric acid hydrase activity

[0231] In order to determine the effect of enhancing fumarate hydratase activity on homoserine production in a homoserine-producing Corynebacterium glutamicum strain, a recombinant strain was obtained by transforming the known homoserine-producing strain Corynebacterium glutamicum KCCM12120P (Korean Registered Patent No. 10-1947959) with the pDC24-ΔNCgl1490:Pspl13-fumC plasmid prepared in Example 5-1 above (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). PCR was performed on the recombinant strain obtained above using the primer pair of SEQ ID NOs. 58 and 62 to confirm that fumarate hydratase on the chromosomes was introduced in a form enhanced by Pspl13. At this time, the PCR reaction was performed by repeating the process of denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and extension at 72°C for 2 minutes 30 times. The transformed strain was named Corynebacterium glutamicum CM10-0194.

[0232]

[0233] Example 6-2. Confirmation of increased homoserine production capacity of homoserine-producing microorganisms with enhanced fumaric acid hydrase activity

[0234] To confirm the increase in homoserine production capacity of homoserine-producing microorganisms with enhanced fumaric acid hydrase activity, strains were cultured as follows, and the concentration of L-homoserin in the culture medium was analyzed.

[0235] Specifically, the control strain Corynebacterium glutamicum KCCM12120P and the Corynebacterium glutamicum CM10-0194 strain prepared in Example 6-1 were each inoculated with 1 platinum loop into a 250 ml corner-baffle flask containing 25 ml of the homoserine production medium below, and cultured at 33°C for 20 hours with shaking at 200 rpm.

[0236]

[0237] <Homoserin Production Medium (pH 7.2)>

[0238] Glucose 30 g, KH2PO4 2 g, Urea 3 g, (NH4)2SO4 40 g, Peptone 2.5 g, CSL(Sigma) 5 g (10 ml), MgSO4.7H2O 0.5 g, CaCO3 20 g (based on 1 liter of distilled water)

[0239]

[0240] After the culture was finished, the homoserine production capacity (concentration) was measured using HPLC (Waters 2478). The above experiment was repeated three times, and the average homoserine concentration values ​​of the analysis results are shown in Table 11 below.

[0241] Strain Name Homoserin (g / L)KCCM12120P0.95CM10-0194(KCCM12120PΔNCgl1490:Pspl13-fumC)1.12

[0242] As a result, as shown in Table 11, it was confirmed that the concentration of homoserine in the culture medium of the Corynebacterium glutamicum CM10-0194 strain, which has enhanced fumarate hydratase activity, increased by approximately 118% compared to the Corynebacterium glutamicum KCCM12120P strain, which is a homoserine-producing strain with enhanced fumarate hydratase activity.

[0243]

[0244] Example 6-3. Production of homoserine-producing microorganisms with simultaneous enhancement of the activities of malate:quinone oxidoreductase, malate dehydrogenase, aspartate transaminase, NADP-specific glutamate dehydrogenase, and fumarate hydrase.

[0245] In order to produce a homoserine-producing microorganism with enhanced activity of malate:quinone oxidoreductase, malate dehydrogenase, aspartate transaminase, NADP-specific glutamate dehydrogenase, and fumarate hydrase, a recombinant strain was obtained by transforming the known homoserine-producing strain Corynebacterium glutamicum KCCM12120P (Korean Registered Patent No. 10-1947959) with the pDC24Δmqo-mdh-aspB-gdh-fumC-mqo plasmid produced in Example 3 above (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). PCR was performed on the recombinant strain obtained above using the primer pair of sequences 54 and 55 to confirm that the chromosomal mqo-mdh-aspB-gdh-fumC-mqo complex was introduced. At this time, the PCR reaction was performed by repeating the process of denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and extension at 72°C for 2 minutes 30 times. The transformed strain was named Corynebacterium glutamicum CM10-0195.

[0246]

[0247] Example 6-4. Confirmation of increased homoserine production capacity in homoserine-producing microorganisms with simultaneous enhancement of the activities of malate:quinone oxidoreductase, malate dehydrogenase, aspartate transaminase, NADP-specific glutamate dehydrogenase, and fumarate hydrase.

[0248] To confirm the increase in homoserine production capacity of homoserine-producing microorganisms with enhanced fumaric acid hydrase activity and simultaneously enhanced activity of malate:quinone oxidoreductase, malate dehydrogenase, aspartate transaminase, NADP-specific glutamate dehydrogenase, and fumaric acid hydrase, the concentration of homoserine produced after culture was measured by the following method.

[0249] Specifically, the control strain Corynebacterium glutamicum KCCM12120P and the Corynebacterium glutamicum CM10-0195 strain prepared in Example 6-3 were each inoculated with 1 platinum loop into a 250 ml corner-baffle flask containing 25 ml of the homoserine production medium described in Example 6-3, and cultured at 33°C for 20 hours with shaking at 200 rpm.

[0250] After the culture was finished, the homoserine production capacity (concentration) was measured using HPLC (Waters 2478). The above experiment was repeated 3 times, and the average homoserine concentration values ​​of the analysis results are shown in Table 12 below.

[0251]

[0252] Strain Name Homoserin (g / L)KCCM12120P0.95CM10-0195(KCCM12120P_mqo-mdh-aspB-gdh-fumC-mqo)1.19

[0253] As a result, as shown in Table 12, it was confirmed that the homoserine concentration of the Corynebacterium glutamicum CM10-0196 strain, which had simultaneously enhanced activities of malate:quinone oxidoreductase, malate dehydrogenase, aspartate transaminase, NADP-specific glutamate dehydrogenase, and fumarate hydrase, was increased by approximately 125% compared to the Corynebacterium glutamicum KCCM12120P strain, a homoserine-producing strain in which the activities of malate:quinone oxidoreductase, malate dehydrogenase, aspartate transaminase, NADP-specific glutamate dehydrogenase, and fumarate hydrase were not enhanced.

[0254] From the above results, it was confirmed that the enhancement of fumarate hydratase activity and / or the simultaneous enhancement of the activities of malate:quinone oxidoreductase, malate dehydrogenase, aspartate transaminase, NADP-specific glutamate dehydrogenase, and fumarate hydratase increases the homoserine production capacity of microorganisms of the genus Corynebacterium.

[0255]

[0256] Comparative Example 7. Production of a histidine-producing microorganism with unenhanced fumarate hydrase activity

[0257] As a control to confirm the effect of increasing glutamate-family amino acid productivity due to fumarate hydratase enhancement, a strain of Corynebacterium glutamicum CA14-0114 was constructed in which the gene for the histidine biosynthetic pathway was enhanced from the wild-type Corynebacterium glutamicum ATCC13032. Specifically, to resolve the feedback inhibition of the HisG polypeptide, the first enzyme of the L-histidine biosynthetic pathway, the 233rd and 235th amino acids from the N-terminus of HisG were simultaneously substituted from glycine to histidine and from threonine to glutamine, respectively (SEQ No. 74) (ACS Synth. Biol., 2014, 3 (1), pp 21-29). In addition, to enhance the activity of the hisE gene, which is present in the same operon as hisG, the start codon was substituted from GTG to ATG. Additionally, to enhance the L-histidine biosynthetic pathway, the promoters of the biosynthetic genes hisE, hisG, hisN, hisD, hisA, and hisB were replaced with strong promoters, and the hisE(V1M)G(G233H / T235Q) operon and the hisD gene were strengthened by introducing additional copies.

[0258]

[0259] Comparative Example 7-1 Production of a histidine-producing strain with resolved feedback limitations

[0260] To construct a histidine-producing strain with resolved feedback limitation, PCR was performed using the chromosomal DNA of Corynebacterium glutamicum ATCC13032 as a template to obtain the 'hisE(V1M)G(G233H / T235Q)' left DNA fragment using primers SEQ NO. 86 and SEQ NO. 87, and the 'hisE(V1M)G(G233H / T235Q)' right DNA fragment using primers SEQ NO. 88 and SEQ NO. 89. PfuUltra™ high-reliability DNA polymerase (Stratagene) was used as the polymerase for the PCR reaction. The PCR conditions were denaturation at 95°C for 30 seconds; denaturation at 55°C for 30 seconds; and polymerization at 72°C for 1 minute, and these denaturation, annealing, and polymerization reactions were repeated 28 times. Using the two amplified DNA fragments above as templates, PCR was performed using primers of SEQ ID NO. 86 and SEQ ID NO. 89 in the same manner as in Comparative Example 7-1, and as a result, the 'hisE(V1M)G(G233H / T235Q)' gene fragment was obtained. In addition, PCR was performed using primers of SEQ ID NO. 90 and 91 with the chromosomal DNA of the Corynebacterium glutamicum ATCC13032 strain as a template, and the upstream region of the hisE gene was obtained. The primer sequences used in Comparative Example 7-1 are shown in Table 13 below.

[0261] Sequence (5'-> 3') Sequence Number gaggagatcaaaacaATGAAGACATTTGAC Sequence Number 86ACACCAAGCTTGATGGATACCTCTACTGCA Sequence Number 87CAGTAGAGGTATCCATCAAGCTTGGTGTC Sequence Number 88ACTCTAGAGGATCCCCCTAGATGCGGGC Sequence Number 89TCGAGCTCGGTACCCACCGAACTCCTGACAGAGT Sequence Number 90acatgaagcgccTCGGTACATTCTTCCACA Sequence Number 91AAGAATGTACCGAggcgcttcatgtcaaca Sequence Number 92CAAATGTCTTCATtgttttgatctcctcca Sequence Number 93ACTGCCTGGTACCACCAGA Sequence Number 94CTGCCTCTCACAAGTTGAAG Sequence Number 95

[0262] In order to replace with a strong promoter, PCR was performed in the same manner as in Comparative Example 7-1 using primers of sequence numbers 92 and 93 with the synthetic promoter Pspl13 promoter (sequence number 9, Korean Patent No. 10-1783170) as a template.

[0263] After treating the pDC24 vector with the restriction enzyme SmaI, a recombinant plasmid was obtained by cloning the upstream DNA fragment of the amplified hisE gene, the Pspl13 promoter, and the 'hisE(V1M)G(G233H / T235Q)' gene fragment using the Gibson assembly method (DG Gibson et al., NATURE METHODS, VOL.6 NO.5, MAY 2009, NEBuilder HiFi DNA Assembly Master Mix), and it was named pDC24ΔPn_hisEG::Pspl13_hisE(V1M)G(G233H / T235Q). Cloning was performed by mixing the Gibson assembly reagents with each gene fragment in calculated moles and incubating at 50°C for 1 hour.

[0264] The constructed pDC24ΔPn_hisEG::Pspl13_hisE(V1M)G(G233H / T235Q) vector was transformed into Corynebacterium glutamicum ATCC13032 by electroporation, and a secondary crossover process was performed to introduce a mutation into the existing hisG gene, thereby resolving the feedback limitation, and to substitute the start codon of the hisE gene, a strain with enhanced hisE activity was obtained. The genetic manipulation was confirmed through PCR and genome sequencing using primers of SEQ ID NO. 94 and SEQ ID NO. 95, which are capable of amplifying the external regions of the homologous recombination upstream and downstream regions, respectively, into which the gene was inserted. The strain obtained in this way was named CJ-HIS1.

[0265]

[0266] Comparative Example 7-2. Production of a histidine-producing strain with an enhanced biosynthetic pathway through promoter replacement

[0267] Next, to enhance the activity of the biosynthetic genes hisN, hisH, hisD, hisA, and hisB, plasmids were constructed as follows to replace the wild-type promoters of each gene with strong promoters.

[0268] Specifically, using Corynebacterium glutamicum ATCC13032 chromosomal DNA as a template, PCR was performed in the same manner as in Comparative Example 7-1 using primers of SEQ ID NO. 96 and 97, SEQ ID NO. 98 and 99, SEQ ID NO. 100 and 101, SEQ ID NO. 102 and 103, and SEQ ID NO. 104 and 105, and the upstream regions of the hisN, hisH, hisD, hisA, and hisB genes were obtained. In addition, using the chromosomal DNA of the Corynebacterium glutamicum ATCC13032 strain as a template, downstream regions of the hisN, hisH, hisD, hisA, and hisB genes were obtained using primers of SEQ ID NO. 106, SEQ ID NO. 107, SEQ ID NO. 108, SEQ ID NO. 109, SEQ ID NO. 110, SEQ ID NO. 111, SEQ ID NO. 112, SEQ ID NO. 113, SEQ ID NO. 114, and SEQ ID NO. 115.

[0269] In order to replace the hisN, hisH, and hisD genes with the strong promoter Pcj7 promoter, PCR was performed in the same manner as in Comparative Example 7-1 using primers of SEQ ID NO. 116 and SEQ ID NO. 117, SEQ ID NO. 118 and SEQ ID NO. 119, and SEQ ID NO. 120 and SEQ ID NO. 121, using the genomic DNA of Corynebacterium stearis as a template.

[0270] In addition, to replace the hisA and hisB genes with the strong promoter Pspl13 promoter, PCR was performed in the same manner as in Comparative Example 7-1 using primers of SEQ ID NO. 122 and SEQ ID NO. 123, and SEQ ID NO. 124 and SEQ ID NO. 125 with the Pspl13 promoter as a template.

[0271] After treating the pDC24 vector with restriction enzyme SmaI, recombinant plasmids were obtained by cloning the upstream DNA fragments of the amplified hisN, hisH, and hisD genes, the Pcj7 promoter fragment, and the downstream DNA fragments of the hisN, hisH, and hisD genes, respectively, using the Gibson assembly method, and were named pDC24ΔPn::Pcj7_hisN, pDC24ΔPn::Pcj7_hisH, and pDC24ΔPn::Pcj7_hisD. Additionally, after treating the pDC24 vector with restriction enzyme SmaI, recombinant plasmids were obtained by cloning the upstream DNA fragments of the amplified hisA and hisB genes, the Pspl13 promoter fragment, and the downstream DNA fragments of the hisA and hisB genes, respectively, using the Gibson assembly method, and were named pDC24ΔPn::Pspl13_hisA and pDC24ΔPn::Pspl13_hisB. Gibson cloning was performed in the same manner as in Comparative Example 7-1.

[0272] A strain was obtained in which the gene was strengthened by replacing the promoter of the existing hisN gene through a secondary crossover process after transforming the CJ-HIS1 produced in Comparative Example 7-1 with the constructed pDC24ΔPn::Pcj7_hisN vector by electroporation. The genetic modification was confirmed through PCR and genome sequencing using primers of SEQ ID NO. 126 and SEQ ID NO. 127, which are capable of amplifying the external regions of the homologous recombination upstream and downstream regions, respectively, into which the gene was inserted. The strain obtained in this way was named CJ-HIS2.

[0273] Sequentially, the constructed pDC24ΔPn::Pcj7_hisH vector was transformed into the above-mentioned CJ-HIS2 via electroporation, and a strain with enhanced hisH gene was obtained by replacing the promoter of the existing hisH gene through a secondary crossover process. The genetic modification was confirmed through PCR and genome sequencing using primers of SEQ ID NO. 128 and SEQ ID NO. 129, which are capable of amplifying the external regions of the homologous recombination upstream and downstream regions, respectively, into which the gene was inserted. The strain obtained in this way was named CJ-HIS3.

[0274] Sequentially, the constructed pDC24ΔPn::Pcj7_hisD vector was transformed into the above-mentioned CJ-HIS3 by electroporation, and a secondary crossover process was performed to replace the promoter of the existing hisD gene, thereby obtaining a strain with the corresponding gene strengthened. The genetic modification was confirmed through PCR using primers of SEQ ID NO. 130 and SEQ ID NO. 131 and genome sequencing. The strain obtained in this way was named CJ-HIS4.

[0275] Sequentially, the constructed pDC24ΔPn::Pspl13_hisA vector was transformed into the above-mentioned CJ-HIS4 by electroporation, and a secondary crossover process was performed to replace the promoter of the existing hisA gene, thereby obtaining a strain with the corresponding gene strengthened. The genetic modification was confirmed through PCR using primers of SEQ ID NO. 132 and SEQ ID NO. 133 and genome sequencing. The strain obtained in this way was named CJ-HIS5.

[0276] Sequentially, the constructed pDC24ΔPn::Pspl13_hisB vector was transformed into the above-mentioned CJ-HIS5 by electroporation, and a strain with enhanced hisB gene was obtained by replacing the promoter of the existing hisB gene through a secondary crossover process. The genetic modification was confirmed through PCR using primers of SEQ ID NO. 134 and SEQ ID NO. 135 and genome sequencing. The strain obtained in this way was named CJ-HIS6.

[0277] The primer sequences used in Comparative Example 7-2 above are shown in Table 14 below.

[0278] Sequence (5'-> 3') Sequence Number TCGAGCTCGGTACCCATTGGTGCTCGGCGC Sequence Number 96 tgggatgtttctGTGTTGTTAGTCTAGTG Sequence Number 97 TCGAGCTCGGTACCCAACCAAGTTTAGATGCGCC Sequence Number 98 gctgggatgtttctGCCGATAGTTTATGTCA Sequence Number 99 TCGAGCTCGGTACCCGGTGACAGCTCGCGCCGCAT Sequence Number 100 gcgctgggatgtttctGGCGAAAAGTTCTCCC Sequence Number 101 TCGAGCTCGGTACCCTTGATGCCTGCATGAAGG Sequence Number 102 tgacatgaagcgccGAATATTGATCCTATCT Sequence Number 103 TTCGAGCTCGGTACCCACCTTCAGCAACCACTC Sequence Number 104tgacatgaagcgccGAAAAATTCTTCTCT Sequence No. 105aaaggaaacactcATGAGCAAATATGCAGACG Sequence No. 106CTAGAGGATCCCCCAGCCGGAGAGGGA Sequence No. 107aaaggaaacactcATGACCAAAACTGTCGC Sequence No. 108CTAGAGGATCCCCACCTCTGGAGGCGTGGTC Sequence No. 109cgaaaggaaacactcATGTTGAATGTCACTGACC Sequence No. 110CTAGAGGATCCCCCCGTGCTCAGCCTGAGGAG Sequence No. 111ggagatcaaaacaATGACCTTCACTATTCTTCC Sequence No. 112CTAGAGGATCCCCACGAAACGTGCACAACCTT Sequence No. 113gagatcaaaacaATGACTGTCGCACCA Sequence No. 114CTAGAGGATCCCCGGGTCGCGGCCGTAGTGGC Sequence No. 115ACTAGACTAACAACACagaaacatcccagcgc Sequence No. 116TCTGCATATTTGCTCATgagtgtttccttt Sequence No. 117ACATAAACTATCGGCagaaacatcccagcgcta Sequence No. 118GACAGTTTTGGTCATgagtgtttcctttcg Sequence No. 119GAGAACTTTTCGCCagaaacatcccagcgct Sequence No.120AGTGACATTCAACATgagtgtttcctttcg Sequence No. 121AGGATCAATATTCggcgcttcatgtcaac Sequence No. 122GAATAGTGAAGGTCATtgttttgatctcct Sequence No. 123GAGAAGAATTTTTCggcgcttcatgtcaa Sequence No. 124TGGTGCGACAGTCATtgttttgatctcct Sequence No. 125GAGCATGCATCAAAG Sequence No. 126AGAAATTTGATCCTTATAA Sequence No. 127TTGAGAGATGCTTATCG Sequence No. 128CACTTCAGTGCGGATTCCAA Sequence No. 129AGCGGGTTTAATTCAGG Sequence No. 130GTGGGTAAGGGTTTTCGT Sequence No. 131CACGAAAATGATCGTTTTG Sequence No. 132TATGGGATTCGATGGCCA Sequence No. 133TGTGGGAATCGCTGGGCAC Sequence No. 134CGGTCGCCCGCATCTG Sequence No. 135

[0279] Comparative Example 7-3. Production of a histidine-producing strain with an enhanced biosynthetic pathway through additional gene insertion

[0280] Subsequently, NCgl1021, known as a gene encoding a transposon in Corynebacterium glutamicum, was used as the insertion site to further insert the hisE(V1M)G(G233H / T235Q) operon and the hisD gene. Specifically, to construct a vector for NCgl1021 (Sequence No. 70) deletion and target gene insertion, PCR was performed in the same manner as in Comparative Example 7-1 using primer pairs of Sequence No. 136 and Sequence No. 137, and Sequence No. 138 and Sequence No. 139, with the chromosome of ATCC13032 as a template. PCR was performed in the same manner as in Comparative Example 7-1 using primers of SEQ ID NO. 140 and SEQ ID NO. 141 with the vector pDC24ΔPn_hisEG::Pspl13_hisE(V1M)G(G233H / T235Q) prepared in Comparative Example 7-1 as a template, and the 'Pspl13_hisE(V1M)G(G233H / T235Q)' gene fragment was obtained.

[0281] In addition, PCR was performed in the same manner as in Example 1 using the vector pDC24ΔPn::Pcj7_hisD prepared in Comparative Example 7-2 as a template and primers of SEQ ID NO. 142 and SEQ ID NO. 143, and the 'Pcj7_hisD' gene fragment was obtained.

[0282] After treating the pDC24 vector with the restriction enzyme SmaI, a recombinant plasmid was obtained by cloning the amplified left homologous cancer region of NCgl1021, the right homologous cancer region of NCgl1021, the 'Pspl13_hisE(V1M)G(G233H / T235Q)', and the 'Pcj7_hisD' gene fragments using the Gibson assembly method, and was named 'pDC24ΔNCgl1021::Pspl13_hisE(V1M)G(G233H / T235Q)-Pcj7_hisD'. Gibson cloning was performed in the same manner as in Comparative Example 7-1. The 'pDC24ΔNCgl1021::Pspl13_hisE(V1M)G(G233H / T235Q)-Pcj7_hisD' vector was transformed into CJ-HIS6 prepared in Comparative Example 7-2 by electroporation, and a strain with an enhanced histidine biosynthetic pathway was obtained through a secondary crossover process with additional gene insertion. The genetic modification was confirmed by PCR using primers of SEQ ID NO. 144 and SEQ ID NO. 145, which are capable of amplifying the external regions of the homologous recombination upstream and downstream regions where the gene was inserted, respectively, and by genome sequencing. The strain obtained in this way was named CA14-0114.

[0283] The primer sequences used in Comparative Example 7-3 above are shown in Table 15 below.

[0284] Sequence (5'-> 3') Sequence No. TTCGAGCTCGGTACCCATGAAGTCTACCGGC Sequence No. 136 gacatgaagcgccGACATCTAATAACCGGG Sequence No. 137 CCGACGAGGCCTAAGAACTCATTCCTTCTGCT Sequence No. 138 CTCTAGAGGATCCCCTTAGAGTGCATTGATC Sequence No. 139 CCGGTTATTAGATGTCggcgcttcatgtca Sequence No. 140 ggatgtttctCTAGATGCGGGCGAT Sequence No. 141 GCCCGCATCTAGagaaacatcccagcgct Sequence No. 142 AGAAGGAATGAGTTCTTAGGCCTCGTCGG Sequence No. 143 CTTTCAGCTTTCCCTCCCG Sequence No. 144 GCTGTACTTTTAGTACA Sequence No. 145

[0285]

[0286] Example 7. Preparation of histidine-producing microorganisms with enhanced fumaric acid hydrase activity and evaluation of histidine production capacity

[0287] Example 7-1. Preparation of a histidine-producing microorganism with enhanced fumaric acid hydrase activity

[0288] To determine the effect of enhancing fumarate hydratase activity on histidine production in a Corynebacterium glutamicum strain capable of producing histidine, a transformed strain was obtained by transforming the histidine-producing Corynebacterium glutamicum CA14-0114 strain, prepared in Comparative Example 7-3, with the pDC24-ΔNCgl1490:Pspl13-fumC plasmid prepared in Example 5-1 using the electro-pulse method. Then, PCR was performed on the transformed strain using the primer pair of SEQ ID NOs. 58 and 62 to confirm that fumarate hydratase was introduced into the chromosomes in a form enhanced to Pspl13. At this time, the PCR reaction was performed by repeating the process of denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and extension at 72°C for 2 minutes 30 times. The above-mentioned transformed strain was named Corynebacterium glutamicum CA14-0114 ΔNCgl1490-91::Pspl13-fumC strain.

[0289]

[0290] Example 7-2. Confirmation of increased histidine production capacity of histidine-producing microorganisms with enhanced fumarate hydrase activity

[0291] To confirm the increased histidine production capacity of histidine-producing microorganisms with enhanced fumarate hydrase activity, the strains were cultured according to the following method, and the concentration of histidine in the culture medium was analyzed.

[0292] Specifically, the control strain Corynebacterium glutamicum CA14-0114 and the Corynebacterium glutamicum CA14-0114 ΔNCgl1490-91::Pspl13-fumC strain prepared in Comparative Example 7-3 were each inoculated into a 250 ml corner-baffle flask containing 25 ml of the following seed medium and cultured at 33°C for 20 hours with shaking at 200 rpm. Then, 1 ml of the seed culture was inoculated into a 250 ml corner-baffle flask containing 25 ml of the production medium and cultured at 30°C for 24 hours with shaking at 200 rpm.

[0293] <Seed Medium (pH 7.0)>

[0294] Glucose 5%, Bactopeptone 1%, Sodium Chloride 0.25%, Yeast Extract 1%, Urea 0.4%

[0295] Histidine Production Medium (pH 7.2)

[0296] Glucose 5%, Ammonium sulfate 2%, Potassium dihydrogen phosphate 0.1%, Magnesium sulfate heptahydrate 0.05%, CSL (Corn steep extract) 2.0%, Biotin 200 µg / L, Calcium carbonate 30 g / L (per 1 liter of distilled water)

[0297]

[0298] After the culture was finished, the production capacity (concentration) of histidine was measured using HPLC (Waters 2478). The above experiment was repeated three times, and the average histidine concentration values ​​of the analysis results are shown in Table 16 below.

[0299] Strain Name Histidine (g / L) CA14-0114 4.6 CA14-0114ΔNC gl1490-91::Pspl13-fumC4.7

[0300] As a result, as shown in Table 16, it was confirmed that the concentration of histidine in the culture medium of Corynebacterium glutamicum CA14-0114 ΔNCgl1490-91::Pspl13-fumC strain, which has enhanced fumarate hydratase activity, increased by approximately 102% compared to Corynebacterium glutamicum CA14-0114 strain, which is a histidine-producing strain with enhanced fumarate hydratase activity.

[0301]

[0302] Example 7-3. Production of a histidine-producing microorganism with simultaneous enhancement of the activities of malate:quinone oxidoreductase, malate dehydrogenase, aspartate transaminase, NADP-specific glutamate dehydrogenase, and fumarate hydrase.

[0303] In order to construct a histidine-producing microorganism with enhanced activity of malate:quinone oxidoreductase, malate dehydrogenase, aspartate transaminase, NADP-specific glutamate dehydrogenase, and fumarate hydrase, a recombinant strain was obtained by transforming the histidine-producing strain Corynebacterium glutamicum CA14-0114 with the pDC24Δmqo-mdh-aspB-gdh-fumC-mqo plasmid constructed in Example 3 above (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). PCR was performed on the recombinant strain obtained above using the primer pair of sequences 54 and 55 to confirm that the chromosomal mqo-mdh-aspB-gdh-fumC-mqo complex was introduced. At this time, the PCR reaction was performed by repeating the process of denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and extension at 72°C for 2 minutes 30 times. The transformed strain was named Corynebacterium glutamicum CA14-0114_mqo-mdh-aspB-gdh-fumC-mqo strain.

[0304]

[0305] Example 7-4. Confirmation of increased histidine production capacity in histidine-producing microorganisms with simultaneous enhancement of the activities of malate:quinone oxidoreductase, malate dehydrogenase, aspartate transaminase, NADP-specific glutamate dehydrogenase, and fumarate hydrase.

[0306] To confirm the increase in histidine production capacity of histidine-producing microorganisms with simultaneously enhanced activities of malate:quinone oxidoreductase, malate dehydrogenase, aspartate transaminase, NADP-specific glutamate dehydrogenase, and fumarate hydrase, strains were cultured in the following manner and the concentration of histidine in the culture medium was analyzed.

[0307] Specifically, the control strain Corynebacterium glutamicum CA14-0114 and the Corynebacterium glutamicum CA14-0114_mqo-mdh-aspB-gdh-fumC-mqo strain produced in Example 7-3 were each inoculated into a 250 ml corner-baffle flask containing 25 ml of the seed medium described in Example 7-2, and cultured at 33°C for 20 hours with shaking at 200 rpm. Then, 1 ml of the seed culture was inoculated into a 250 ml corner-baffle flask containing 25 ml of the production medium described in Example 7-2, and cultured at 30°C for 24 hours with shaking at 200 rpm.

[0308] After the culture was finished, the production capacity (concentration) of histidine was measured using HPLC (Waters 2478). The above experiment was repeated three times, and the average histidine concentration values ​​of the analysis results are shown in Table 17 below.

[0309] Strain Name Histidine (g / L)CA14-0114 4.6CA14-0114_mqo-mdh-aspB-gdh-fumC-mqo)5.2

[0310] As a result, as shown in Table 17, it was confirmed that the concentration of histidine in the culture medium of the Corynebacterium glutamicum CA14-0114_mqo-mdh-aspB-gdh-fumC-mqo strain, which had simultaneously enhanced activities of malate:quinone oxidoreductase, malate dehydrogenase, aspartate transaminase, NADP-specific glutamate dehydrogenase, and fumarate hydrase, increased by approximately 113% compared to the Corynebacterium glutamicum CA14-0114 strain, a histidine-producing strain in which the activities of malate:quinone oxidoreductase, malate dehydrogenase, aspartate transaminase, NADP-specific glutamate dehydrogenase, and fumarate hydrase were not enhanced.

[0311] From the above results, it was confirmed that the enhancement of fumarate hydrase activity and / or the simultaneous enhancement of the activities of malate:quinone oxidoreductase, malate dehydrogenase, aspartate transaminase, NADP-specific glutamate dehydrogenase, and fumarate hydrase increases the histidine production capacity of microorganisms of the genus Corynebacterium.

[0312]

[0313] From the foregoing description, those skilled in the art to which this disclosure pertains will understand that this disclosure may be implemented in other specific forms without altering its technical concept or essential features. In this regard, the embodiments described above should be understood as illustrative in all respects and not restrictive. The scope of this disclosure should be interpreted as including all modifications or variations derived from the meaning and scope of the claims set forth below and their equivalents, rather than from the detailed description above.

Claims

1. Microorganisms of the genus Corynebacterium that produce L-amino acids with enhanced fumarate hydratase activity.

2. A microorganism of the genus Corynebacterium according to claim 1, wherein the fumaric acid hydrate enzyme comprises an amino acid sequence having 90% or more sequence identity with the amino acid sequence of SEQ ID NO.

1.

3. A microorganism of the genus Corynebacterium according to claim 1, wherein the fumarate hydrate enzyme is encoded by a polynucleotide comprising a nucleic acid sequence having 90% or more sequence identity with the nucleic acid sequence of SEQ ID NO. 2 or SEQ ID NO.

41.

4. In claim 1, the microorganism of the genus Corynebacterium is additionally a microorganism of the genus Corynebacterium in which the activity of malate:quinone oxidoreductase, malate dehydrogenase, aspartate transaminase, and NADP-specific glutamate dehydrogenase is enhanced.

5. A microorganism of the genus Corynebacterium according to claim 4, wherein the malate:quinone oxidoreductase is composed of the amino acid sequence of SEQ ID NO. 30, the malate dehydrogenase is composed of the amino acid sequence of SEQ ID NO. 34, the aspartate transaminase is composed of the amino acid sequence of SEQ ID NO. 36, and the NADP-specific glutamate dehydrogenase is composed of the amino acid sequence of SEQ ID NO.

38.

6. In paragraph 1, the microorganism of the genus Corynebacterium is Corynebacterium glutamicum.

7. In paragraph 1, the Corynebacterium microorganism is a Corynebacterium microorganism with increased L-amino acid production capacity compared to a non-modified microorganism of the same species in which the activity of fumarate hydrase is not enhanced.

8. A microorganism of the genus Corynebacterium, wherein the L-amino acid is a glutamate-based amino acid, a homoserine-based amino acid, or L-histidine.

9. A microorganism of the genus Corynebacterium, wherein the glutamate-based amino acid in paragraph 8 is L-arginine, L-citrulline, or L-ornithine.

10. A microorganism of the genus Corynebacterium, wherein the homoserine-based amino acid in claim 8 is O-acetylhomoserine or L-homoserine.

11. A step of culturing a microorganism of the genus Corynebacterium according to any one of claims 1 to 10 in a culture medium; and A method for producing L-amino acids, comprising the step of recovering L-amino acids from the cultured microorganisms, the medium, or both.

12. A method for producing L-amino acids according to claim 11, wherein the microorganism of the genus Corynebacterium is Corynebacterium glutamicum.

13. A method for producing L-amino acids according to claim 11, wherein the L-amino acid is a glutamate-based amino acid, a homoserine-based amino acid, or L-histidine.

14. A method for producing L-amino acids according to claim 13, wherein the glutamate-based amino acid is L-arginine, L-citrulline, or L-ornithine.

15. A method for producing L-amino acids according to claim 13, wherein the homoserine-based amino acid is O-acetyl homoserine or L-homoserine.

16. Use of the microorganism of the genus Corynebacterium of paragraph 1 for the production of L-amino acids.