Mirna396 mimicry for promoting plant regeneration
By downregulating miRNA396 to upregulate GRF genes using a miRNA396 mimicry construct, the method improves plant regeneration efficiency and reduces genotype dependency, enhancing callus and shoot formation.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- KWS SAAT SE & CO KGAA
- Filing Date
- 2025-12-10
- Publication Date
- 2026-06-18
AI Technical Summary
Existing methods for plant regeneration, particularly in recalcitrant phenotypes, are inefficient and genotype-dependent, lacking a straightforward mechanism to enhance callus formation and shoot regeneration.
Manipulating miRNA396 levels through a miRNA396 mimicry construct to downregulate endogenous miRNA396, thereby upregulating GRF genes, which enhances plant regeneration efficiency.
The miRNA396 mimicry approach increases callus induction and shoot regeneration frequency, facilitates transgenic plant recovery, and reduces genotype dependency, while maintaining plant health without noticeable phenotypic changes.
Smart Images

Figure 00000027_0000 
Figure 00000027_0001 
Figure 00000027_0002
Abstract
Description
[0001] miRNA396 mimicry for promoting plant regeneration
[0002] The present invention relates to the field of plant breeding and biotechnology and in particular to the generation of plants from cells and other tissues. More particularly, the invention provides methods and means for improving plant regeneration by manipulating the level of miRNA396 in the cells rather than by overexpression or manipulation of Growth Regulating Factor (GRF) genes.
[0003] Technical Background
[0004] GRF genes play a role in leaf morphogenesis and stem development. They are known to regulate cell division, cell differentiation and showed boosting effect in regeneration of plants, e.g. sugar beet. In addition, GRF genes were reported to function in flowering, seed and root development, to control the plant growth under stress conditions and to regulate the plant longevity. AtGRF5 showed boosting effect by increased shoot induction rates in sugar beet (WO2019134884). In literature there are more phenotypes described which are associated with GRFs in different crops. miRNA396 is a negative regulator of GRF expression levels which has for example been shown in overexpression studies. While it is well documented that miR396 obviously negatively regulates the mRNA abundance of its GRF targets, the inverse also is true: GRF expression exerts a negative effect on miR396 abundance, which appears to be manifested on the transcriptional as well as the post-transcriptional level. Therefore, the homeostasis between miRNA396 and the target GRF genes is established through a reciprocal feedback regulation, in which the expression of GRF and miRNA396 negatively regulate each other’s expression. However, there are no simple linear gene expression regulatory mechanisms but rather multi-faceted regulatory networks of varying complexity. Furthermore, crossregulation among transcription factor gene family members targeted by miRNAs also has been reported.
[0005] Regeneration boosting effects like callus formation or shoot regeneration are of high economic importance for e.g. plant transformation approaches especially with recalcitrant phenotypes. Therefore, it was the object of the present invention to provide methods and means for improving plant regeneration. Description of the invention
[0006] The inventors of the present invention surprisingly found that a manipulation of miRNA396 in the cells rather than overexpression or manipulation of GRF genes is capable of boosting plant regeneration. Therefore, a so-called miRNA396 mimicry construct (MimiR396) has been designed, which leads to a reduction of endogenous miRNA396, thereby resulting in upregulation of its target GRF genes. Furthermore, determining the GRF genes that are a potential target of miRNA396 is helpful for identifying the GRF genes relevant for regeneration.
[0007] Overexpression of MimiRNA396 is capable of providing a positive effect on boosting plant regeneration and thus allowing a more efficient recovery of transgenic plants. The present invention allows to improve the regeneration from diverse tissues or cells (e.g. microspores), may overcome recalcitrance to plant regeneration, in particular genotype dependency, improve the recovery of transgenic plants by e.g. co-expression of gene of interest, and of genome-engineered plants by e.g. transient co-expression of genomeediting components as well as shorten the time for the production of transgenic lines and the recovery. Further, it was found that plants subjected to a manipulation of miRNA396 are healthy and do not show any obvious phenotype.
[0008] Thus, the invention provides a method of promoting plant regeneration, comprising incubating a plant cell or a plant material comprising a plant cell in the presence of miRNA396 mimicry.
[0009] As used herein, "regeneration” refers to a process, in which single or multiple cells proliferate and develop into tissues, organs, and eventually entire plants. Regenerating a plant can for example comprise culturing an optionally transformed or genetically modified plant cell on a regeneration medium.
[0010] Regeneration techniques rely on manipulation of certain phytohormones in a tissue culture growth medium, occasionally relying on a biocide and / or herbicide marker that can been introduced together with the desired nucleotide sequence(s) of interest. Plant regeneration from cultured protoplasts is described in Evans et al., Protoplasts Isolation and Culture, Handbook of Plant Cell Culture, pp. 124-176, MacMillilan Publishing Company, New York, 1983; and Binding, Regeneration of Plants, Plant Protoplasts, pp. 21-73, CRC Press, Boca Raton, 1985. Regeneration can also be obtained from plant callus, explants, protoplasts, immature or mature embryos, embryonic tissue, meristematic tissues, organs, or parts thereof. Such regeneration techniques are described generally in Klee (1987) Ann. Rev. of Plant Phys. 38:467486. To obtain whole plants from transgenic tissues such as immature embryos, they can be grown under controlled environmental conditions in a series of media containing nutrients and hormones, a process known as tissue culture. Once whole plants are generated and produce seed, evaluation of the progeny begins.
[0011] With the described miRNA396 mimicry approach the frequency of callus induction and shoot regeneration is increased. Such a dual effect was not identified in the sugar beet AtGRF5 approach (WO2019134884) the GRF5 overexpression lead only to an increase in shoot regeneration.
[0012] The present invention is applicable to any plant species, whether monocot or dicot. Preferably, plants which may be subjected to the methods and uses of the present invention are plants of the genus selected from the group consisting of Hordeum, Sorghum, Saccharum, Zea, Setaria, Oryza, Triticum, Secale, Triticale, Malus, Brachypodium, Aegilops, Daucus, Beta, Eucalyptus, Nicotiana, Solanum, Coffea, Vitis, Erythrante, Genlisea, Cucumis, Marus, Arabidopsis, Crucihimalaya, Cardamine, Lepidium, Capsella, Olmarabidopsis, Arabis, Brassica, Eruca, Raphanus, Citrus, Jatropha, Populus, Medicago, Cicer, Cajanus, Phaseolus, Glycine, Gossypium, Astragalus, Lotus, Torenia, Allium, or Helianthus. More preferably, the plant is selected from the group consisting of Hordeum vulgare, Hordeum bulbusom, Sorghum bicolor, Saccharum officinarium, Zea spp., including Zea mays, Setaria italica, Oryza minuta, Oryza sativa, Oryza australiensis, Oryza alta, Triticum aestivum, Triticum durum, Secale cereale, Triticale, Malus domestica, Brachypodium distachyon, Hordeum marinum, Aegilops tauschii, Daucus glochidiatus, Beta spp., including Beta vulgaris, Daucus pusillus, Daucus muricatus, Daucus carota, Eucalyptus grandis, Nicotiana sylvestris, Nicotiana tomentosiformis, Nicotiana tabacum, Nicotiana benthamiana, Solanum lycopersicum, Solanum tuberosum, Coffea canephora, Vitis vinifera, Erythrante guttata, Genlisea aurea, Cucumis sativus, Marus notabilis, Arabidopsis arenosa, Arabidopsis lyrata, Arabidopsis thaliana, Crucihimalaya himalaica, Crucihimalaya wallichii, Cardamine nexuosa, Lepidium virginicum, Capsella bursa pastoris, Olmarabidopsis pumila, Arabis hirsute, Brassica napus, Brassica oleracea, Brassica rapa, Raphanus sativus, Brassica juncacea, Brassica nigra, Eruca vesicaria subsp. sativa, Citrus sinensis, Jatropha curcas, Populus trichocarpa, Medicago truncatula, Cicer yamashitae, Cicer bijugum, Cicer arietinum, Cicer reticulatum, Cicer judaicum, Cajanus cajanifolius, Cajanus scarabaeoides, Phaseolus vulgaris, Glycine max, Gossypium sp., Astragalus sinicus, Lotus japonicas, Torenia fournieri, Allium cepa, Allium fistulosum, Allium sativum, Helianthus annuus, Helianthus tuberosus and / or Allium tuberosum. Particularly preferred are Beta vulgaris, Zea mays, Triticum aestivum, Hordeum vulgare, Secale cereale, Helianthus annuus, Solanum tuberosum, Sorghum bicolor, Brassica rapa, Brassica napus, Brassica juncacea, Brassica oleracea, Raphanus sativus, Oryza sativa, Glycine max, and / or Gossypium sp.
[0013] Suitable plant cells according the present invention are especially cells of a somatic tissue, callus tissue, a meristematic tissue or an embryonic tissue, or a protoplast, gametophyte, pollen, ovule or microspore. For example, cells of a callus tissue, preferably of a friable callus, of a meristematic tissue, of a reproductive tissue (e.g. microspores) or an embryonic tissue as well as protoplasts can be used.
[0014] A part or parts of plants may be attached to or separated from a whole, intact plant. Such parts of a plant include, but are not limited to, organs, tissues, and cells of a plant, and preferably seeds.
[0015] The new approach of the invention is suitable to improve callus induction and shoot regeneration by knock down of miRNA396. It is demonstrated by a transgene approach, but this improvement can also be achieved by non-transgenic approaches to knock down miRNA396.
[0016] A miRNA mimicry approach is an endogenous mechanism to (down) regulate specific miRNAs, this being realized by a false target transcript that cannot be cleaved (Todesco et al., Franco-Zorilla et al). According to the invention, the miRNA396 mimicry is a miRNA target mimic. In particular, the miRNA396 mimicry may comprise an RNA molecule or derivative thereof that forms a non-cleavable product with the complementary miRNA396. Derivatives can for example be 2'-O-methyl and allyl RNA derivatives or other molecules that are able to form a non-cleavable complex with the complementary miRNA396. Particularly preferred miRNA396 mimicry comprises an antisense oligonucleotide to miRNA396.
[0017] Some plants have multiple miRNA396 genes. For example, soybean is known to have 11 miR396 genes (Gm-miR396a-k), Beta vulgaris has at least two versions of miRNA396 genes, miRNA396a and miRNA396b. The respective sequences are slightly different, as can be seen from the following comparison.
[0018] Bv miR396a: TTCCACAGCTTTCTTGAACTG (SEQ ID NO. 5)
[0019] Bv miR396b: TTCCACAGCTTTCTTGAACTT (SEQ ID NO. 6) Depending on whether the mimicry-approach of the present invention targets all or only single ones of the existing miRNA variants, different effects can be achieved. In one embodiment of the invention, the miRNA mimicry approach targets all variants of miRNA396. According to another embodiment, only one miRNA396 variant is affected. For example, the miRNA396 mimicry may be a specific target mimic for mature miRNA396a. Alternatively, the miRNA mimicry may be a specific target mimic for mature miRNA396b.
[0020] The method of the invention optionally comprises one or more of the following steps:
[0021] (a) inducing callus formation from at least one plant cell,
[0022] (b) cultivating callus, in particular the callus obtained in step (a) under conditions promoting growth of embryos and / or shoots out of the callus, and
[0023] (c) regenerating a plant from embryos or shoots.
[0024] The miRNA396 mimicry is present during callus formation, cultivation, and / or plant regeneration.
[0025] To ensure the presence of the miRNA396 mimicry, it can be added externally to the plant cell or plant material or expressed by the plant cell itself. In a preferred, non-transgenic approach, miRNA396 mimicry is added to the plant cell or plant material, in a concentration sufficient to provide the desired reduction of endogenous miRNA396, thereby resulting in upregulation of its target GRF genes. For example, it can be added to a culture medium comprising the plant cells or to the roots of a seedling.
[0026] Alternatively, to enable expression of miRNA396 mimicry by the plant cells, the method of the invention may further comprise a step of introducing at least one nucleotide sequence encoding the miRNA396 mimicry into the plant cell, in particular into a plant cell or a predecessor thereof to be used in step (a), into a cell of the callus obtained in step (a) and / or to be used in step (b), or into the embryos or shoots obtained in step (b) and / or to be used in step (c).
[0027] Plant cells suitable for inducing callus formation in step (a) include embryonic plant cells and somatic plant cells. The way in which these plant cells are provided is not important for the method according to the present invention. Plant cells can be used either in isolated form or as part of a plant tissue. For example, embryonic or somatic plant cells can be provided from an explant isolated from a plant. Either the cells are isolated from the explant or the explant is directly used for the induction of callus tissue. Which part of a plant is eligible for obtaining an explant depends on the particular plant species. Generally, suitable plant cells can be obtained from hypocotyl, shoot, leaves, buds, flowers and roots of a plant. Preferably, an explant or a part thereof isolated from a plant is used in the method of the invention.
[0028] For inducing callus formation, the plant cells are incubated in a medium. In principle, any culture medium known in the art can be used, in particular a medium commonly used for inducing callus formation. Depending on the plant in question, the composition of the medium may vary. In principle, several types of basal salt mixtures can be added to the medium, but preferably, the medium comprises modified Murashige and Skoog (MS) medium, White's medium, or woody plant medium, most preferably MS medium. Previous studies indicate that callus induction is facilitated in the presence of appropriate amounts and concentrations of auxins and cytokinins alone or in combination with each other in MS medium. According to the invention, these components can also be added preferentially to the culture medium. Exemplary auxins include naphthalene acetic acid (NAA), indole-3- acetic acid (IAA) and indole-3-butyric acid (IBA). Exemplary cytokinins include 6- Benzylaminopurine (BAP) and 6-furfurylamino-purine (kinetin).
[0029] In step (b), cultivation takes place under conditions promoting growth of embryos and / or shoots out of the callus. Cultivating can carried out in a medium optionally comprising plant hormones. The term "plant hormone" is to be understood herein as a chemical that influences the growth and development of plant cells and tissues. Plant growth hormones comprise chemicals from the following five groups: auxins, cytokinins, gibberellins, abscisic acid (ABA) and ethylene. In addition to the five main groups, two other classes of chemical are often regarded as plant growth regulators: brassinosteroids and polyamines. For the induction of regeneration in plant tissues, a combination of one or more cytokinins and one or more auxins is usually employed.
[0030] By means of miRNA396 mimicry, the regeneration capability of a plant cell or plant material comprising a plant cell can be increased. This is particularly helpful for transgenic or genetically modified plant cells, in particular plant cells with an edited genome. Accordingly, the beneficial effect of miRNA396 mimicry as described above can be exploited in methods of producing transgenic plants as well as in methods for producing genetically modified / edited plants
[0031] Thus, in another embodiment of the invention, the method further comprises a step of (d1) introducing at least one nucleotide sequence of interest into the at least one plant cell or a predecessor thereof to be used in step (a), into at least one cell of the callus obtained in step (a) which itself or a progeny thereof is then to be used in step (b) or has been used in step (b), and / or
[0032] (d2) modifying the genome of the at least one plant cell or a predecessor thereof to be used in step (a), of the at least one cell of the callus obtained in step (a) which itself or a progeny thereof is then to be used in step (b) or has been used in step (b), by introducing into said cell a single stranded DNA break (SSB) inducing enzyme or a double stranded DNA break (DSB) inducing enzyme which preferably recognize a predetermined site in the genome of said cell, and optionally a repair nucleic acid molecule, or a single stranded DNA break (SSB) inducing enzyme which preferably recognizes a predetermined site in the genome of said cell and is fused to a base editor enzyme, wherein the modification of said genome is selected from
[0033] I. a replacement of at least one nucleotide;
[0034] II. a deletion of at least one nucleotide;
[0035] III. an insertion of at least one nucleotide; and
[0036] IV. any combination of I. - III.
[0037] Step (d1) involves transformation of a plant cell by introducing a nucleic acid molecule into a plant cell in a manner to cause stable integration into the genome of the plant cell or transient appearance in the plant cell leading to expression of the nucleic acid sequence for example constitutively, temporally or specifically related to particular tissue(s) or certain developmental stage(s) et cetera. Transformation of both monocotyledonous and dicotyledonous plant cells is now routine, and the selection of the most appropriate transformation technique will be determined by the practitioner. The choice of method will vary with the type of plant or genotype to be transformed; those skilled in the art will recognize the suitability of particular methods for given plant types or genotypes. Suitable methods can include, but are not limited to: electroporation of plant protoplasts; liposome- mediated transformation; polyethylene glycol (PEG) mediated transformation; transformation using viruses; micro-injection of plant cells; micro- projectile bombardment of plant cells; vacuum infiltration; and Agrobacterium-mediated transformation.
[0038] Step (d1) of introducing the at least one nucleotide sequence of interest can be performed using any suitable method commonly known in the art. A number of methods is available to transfer nucleic acids of interest into plant cells. An exemplary vector mediated method is Agrobacterium-mediated transformation, as described, for example, by Lindsay & Gallois, 1990, Journal of Experimental Botany, and Kischenko et al., 2005, Cell Biology International for sugar beet, by Ishida et al., 2007, (“Agrobacterium-mediated transformation of maize.” Nature protocols, 2(7), 1614-1621) for corn, or by the PureWheat Technology from Japan Tobacco company for wheat. Other suitable techniques include particle bombardment and electroporation.
[0039] The nucleotide sequence of interest according to the invention may be a DNA or RNA sequence, e.g. mRNA, siRNA, miRNA etc. More particularly, the nucleotide sequence of interest encodes at least one phenotypic trait. Preferably, the phenotypic trait conferred by the DNA or RNA can be selected from the group consisting of resistance / tolerance to biotic stress, including pathogen resistance / tolerance, wherein the pathogen can be a virus, bacterial, fungal or animal pathogen, resistance / tolerance to abiotic stress including chilling resistance / tolerance, drought stress resistance / tolerance, osmotic resistance / tolerance, heat stress resistance / tolerance, cold or frost stress resistance / tolerance, oxidative stress resistance / tolerance, heavy metal stress resistance / tolerance, salt stress or water logging resistance / tolerance, lodging resistance / tolerance, shattering resistance / tolerance, or resistance / tolerance against one or more herbicides like glyphosate, glufosinate, 2,4-D, Dicamba, ALS inhibitors et cetera. The at least one phenotypic trait of interest can also be selected from the group consisting of the modification of a further agronomic trait of interest including yield increase, flowering time modification, seed color modification, endosperm composition modification, nutritional content modification or metabolic engineering of a pathway of interest.
[0040] Step (d2) involves modifying the genome of the plant cell, which can be accomplished by means of a single stranded DNA break (SSB) or double stranded DNA break (DSB) inducing enzyme or a base editor enzyme, which preferably recognizes a predetermined site in the genome of said cell.
[0041] As used herein, a "double-stranded DNA break inducing enzyme” or "DSBI enzyme" is an enzyme capable of inducing a double-stranded DNA break at a particular nucleotide sequence, called the "recognition site". Accordingly, a "single-stranded DNA or RNA break inducing enzyme" or "SSBI enzyme" is an enzyme capable of inducing a single-stranded DNA or RNA break at a particular nucleotide sequence.
[0042] In order to enable a break at a predetermined target site, the enzymes preferably include a binding domain and a cleavage domain. Particular enzymes capable of inducing double or single-stranded breaks are nucleases as well as variants thereof, no longer comprising a nuclease function but rather operating as recognition molecules in combination with another enzyme. In recent years, many suitable nucleases, especially tailored endonucleases have been developed comprising meganucleases, zinc finger nucleases, TALE nucleases, Argonaute nucleases, derived, for example, from Natronobacterium gregoryi, and CRISPR nucleases, comprising, for example, Cas, Cpf1 , CasX or CasY nucleases as part of the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) system. Thus, in a preferred aspect of the invention, the DSB or SSB inducing enzyme is selected from CRISPR systems like CRISPR / Cas9, CRISPR / Cpf1 , CRISPR / CasX, CRISPR / CasY, CRISPR / Csm1 or CRISPR / MAD7a, preferably a CRISPR / Cas9 endonuclease or a CRISPR / Cpf1 endonuclease, a zinc finger nuclease (ZFN), a homing endonuclease, a meganuclease and a TAL effector nuclease.
[0043] Rare-cleaving endonucleases are enzymes that have a recognition site of preferably about 14 to 70 consecutive nucleotides, and therefore have a very low frequency of cleaving, even in larger genomes such as most plant genomes. Homing endonucleases, also called meganucleases, constitute a family of such rare-cleaving endonucleases. They may be encoded by introns, independent genes or intervening sequences, and present striking structural and functional properties that distinguish them from the more classical restriction enzymes, usually from bacterial restriction-modification Type II systems. Their recognition sites have a general asymmetry which contrast to the characteristic dyad symmetry of most restriction enzyme recognition sites. Several homing endonucleases encoded by introns or inteins have been shown to promote the homing of their respective genetic elements into allelic intronless or inteinless sites. By making a site-specific double strand break in the intronless or inteinless alleles, these nucleases create recombinogenic ends, which engage in a gene conversion process that duplicates the coding sequence and leads to the insertion of an intron or an intervening sequence at the DNA level. A list of other rare cleaving meganucleases and their respective recognition sites is provided in Table I of WO 03 / 004659 (pages 17 to 20) (incorporated herein by reference).
[0044] Furthermore, methods are available to design custom-tailored rare-cleaving endonucleases that recognize basically any target nucleotide sequence of choice. Briefly, chimeric restriction enzymes can be prepared using hybrids between a zinc-finger domain designed to recognize a specific nucleotide sequence and the non-specific DNA-cleavage domain from a natural restriction enzyme, such as Fokl. Such methods have been described e.g. in WO 03 / 080809, WO 94 / 18313 or WO 95 / 09233 and in Isalan et al. (2001). A rapid, generally applicable method to engineer zinc fingers illustrated by targeting the HIV-1 promoter. Nature biotechnology, 19(7), 656; Liu et al. (1997). Design of polydactyl zinc-finger proteins for unique addressing within complex genomes. Proceedings of the National Academy of Sciences, 94(11), 5525-5530.). Another example of custom-designed endonucleases includes the TALE nucleases (TALENs), which are based on transcription activator-like effectors (TALEs) from the bacterial genus Xanthomonas fused to the catalytic domain of a nuclease (e.g. Fokl or a variant thereof). The DNA binding specificity of these TALEs is defined by repeat-variable di-residues (RVDs) of tandem-arranged 34 / 35-amino acid repeat units, such that one RVD specifically recognizes one nucleotide in the target DNA. The repeat units can be assembled to recognize basically any target sequences and fused to a catalytic domain of a nuclease create sequence specific endonucleases (see e.g. Boch et al. (2009). Breaking the code of DNA binding specificity of TAL-type III effectors. Science, 326(5959), 1509- 1512; Moscou & Bogdanove (2009). A simple cipher governs DNA recognition by TAL effectors. Science, 326(5959), 1501-1501 ; and WO 2010 / 079430, WO 2011 / 072246, WO 2011 / 154393, WO 2011 / 146121 , WO 2012 / 001527, WO 2012 / 093833, WO 2012 / 104729, WO 2012 / 138927, WO 2012 / 138939). WO 2012 / 138927 further describes monomeric (compact) TALENs and TALEs with various catalytic domains and combinations thereof.
[0045] Recently, a new type of customizable endonuclease system has been described; the so- called CRISPR / Cas system. A CRISPR system in its natural environment describes a molecular complex comprising at least one small and individual non-coding RNA in combination with a Cas nuclease or another CRISPR nuclease like a Cpf1 nuclease (Zetsche et al., „Cpf1 Is a Single RNA-Guides Endonuclease of a Class 2 CRISPR-Cas System", Cell, 163, pp. 1-13, October 2015) which can produce a specific DNA doublestranded break. Presently, CRISPR systems are categorized into 2 classes comprising five types of CRISPR systems, the type II system, for instance, using Cas9 as effector and the type V system using Cpf1 as effector molecule (Makarova et al., Nature Rev. Microbiol., 2015). In artificial CRISPR systems, a synthetic non-coding RNA and a CRISPR nuclease and / or optionally a modified CRISPR nuclease, modified to act as nickase or lacking any nuclease function, can be used in combination with at least one synthetic or artificial guide RNA or gRNA combining the function of a crRNA and / or a tracrRNA (Makarova et al., 2015, supra). The immune response mediated by CRISPR / Cas in natural systems requires CRISPR-RNA (crRNA), wherein the maturation of this guiding RNA, which controls the specific activation of the CRISPR nuclease, varies significantly between the various CRISPR systems which have been characterized so far. Firstly, the invading DNA, also known as a spacer, is integrated between two adjacent repeat regions at the proximal end of the CRISPR locus. Type II CRISPR systems code for a Cas9 nuclease as key enzyme for the interference step, which system contains both a crRNA and also a trans-activating RNA (tracrRNA) as the guide motif. These hybridize and form double-stranded (ds) RNA regions which are recognized by RNAselll and can be cleaved in order to form mature crRNAs. These then in turn associate with the Cas molecule in order to direct the nuclease specifically to the target nucleic acid region. Recombinant gRNA molecules can comprise both the variable DNA recognition region and also the Cas interaction region and thus can be specifically designed, independently of the specific target nucleic acid and the desired Cas nuclease. As a further safety mechanism, PAMs (protospacer adjacent motifs) must be present in the target nucleic acid region; these are DNA sequences which follow on directly from the Cas9 / RNA complex-recognized DNA. The PAM sequence for the Cas9 from Streptococcus pyogenes has been described to be "NGG" or "NAG" (Standard IIIPAC nucleotide code) (Jinek et al, "A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity", Science 2012, 337: 816-821). The PAM sequence for Cas9 from Staphylococcus aureus is "NNGRRT" or "NNGRR(N)". Further variant CRISPR / Cas9 systems are known. Thus, a Neisseria meningitidis Cas9 cleaves at the PAM sequence NNNNGATT. A Streptococcus thermophilus Cas9 cleaves at the PAM sequence NNAGAAW. Recently, a further PAM motif NNNNRYAC has been described for a CRISPR system of Campylobacter (WO 2016 / 021973 A1). For Cpfl nucleases it has been described that the Cpf1-crRNA complex, without a tracrRNA, efficiently recognize and cleave target DNA proceeded by a short T-rich PAM in contrast to the commonly G-rich PAMs recognized by Cas9 systems (Zetsche et al., supra). Furthermore, by using modified CRISPR polypeptides, specific single-stranded breaks can be obtained. The combined use of Cas nickases with various recombinant gRNAs can also induce highly specific DNA doublestranded breaks by means of double DNA nicking. By using two gRNAs, moreover, the specificity of the DNA binding and thus the DNA cleavage can be optimized. Further CRISPR effectors like CasX and CasY effectors originally described for bacteria, are meanwhile available and represent further effectors, which can be used for genome engineering purposes (Burstein et al., “New CRISPR-Cas systems from uncultivated microbes”, Nature, 2017, 542, 237-241).
[0046] The cleavage site of a DSBI / SSBI enzyme relates to the exact location on the DNA or RNA where the double-stranded break is induced. The cleavage site may or may not be comprised in (overlap with) the recognition site of the DSBI / SSBI enzyme and hence it is said that the cleavage site of a DSBI / SSBI enzyme is located at or near its recognition site. The recognition site of a DSBI / SSBI enzyme, also sometimes referred to as binding site, is the nucleotide sequence that is (specifically) recognized by the DSBI / SSBI enzyme and determines its binding specificity. For example, a TALEN or ZNF monomer has a recognition site that is determined by their RVD repeats or ZF repeats respectively, whereas its cleavage site is determined by its nuclease domain (e.g. Fokl) and is usually located outside the recognition site. In case of dimeric TALENs or ZFNs, the cleavage site is located between the two recognition / binding sites of the respective monomers, this intervening DNA or RNA region where cleavage occurs being referred to as the spacer region.
[0047] A person skilled in the art would be able to either choose a DSBI / SSBI enzyme recognizing a certain recognition site and inducing a DSB or SSB at a cleavage site at or in the vicinity of the preselected / predetermined site or engineer such a DSBI / SSBI enzyme. Alternatively, a DSBI / SSBI enzyme recognition site may be introduced into the target genome using any conventional transformation method or by crossing with an organism having a DSBI / SSBI enzyme recognition site in its genome, and any desired nucleic acid may afterwards be introduced at or in the vicinity of the cleavage site of that DSBI / SSBI enzyme.
[0048] A "base editor enzyme" or “base editor” as used herein refers to a protein or a fragment thereof having the same catalytical activity as the protein it is derived from, which protein or fragment thereof, alone or when provided as molecular complex, referred to as base editing complex herein, has the capacity to mediate a targeted base modification, i.e., the conversion of a base of interest resulting in a point mutation of interest which in turn can result in a targeted mutation, if the base conversion does not cause a silent mutation, but rather a conversion of an amino acid encoded by the codon comprising the position to be converted with the base editor. Preferably, the at least one base editor according to the present invention is temporarily or permanently linked to at least one site-specific effector, or optionally to a component of at least one site-specific effector complex. The linkage can be covalent and / or non-covalent.
[0049] Any base editor or site-specific effector, or a catalytically active fragment thereof, or any component of a base editor complex or of a site-specific effector complex as disclosed herein can be introduced into a cell as a nucleic acid fragment, the nucleic acid fragment representing or encoding a DNA, RNA or protein effector, or it can be introduced as DNA, RNA and / or protein, or any combination thereof.
[0050] There are two major and distinct pathways to repair breaks - homologous recombination and non-homologous end-joining (NHEJ). Homologous recombination requires the presence of a homologous sequence as a template (e.g., "donor") to guide the cellular repair process and the results of the repair are error-free and predictable. In the absence of a template (or "donor") sequence for homologous recombination, the cell typically attempts to repair the break via the process of non-homologous end-joining (NHEJ). In a particularly preferred aspect of this embodiment, a repair nucleic acid molecule is additionally introduced into the plant cell. As used herein, a “repair nucleic acid molecule” is a single-stranded or double-stranded DNA molecule or RNA molecule that is used as a template for modification of the genomic DNA at the preselected site in the vicinity of or at the cleavage site. As used herein, “use as a template for modification of the genomic DNA”, means that the repair nucleic acid molecule is copied or integrated at the preselected site by homologous recombination between the flanking region(s) and the corresponding homology region(s) in the target genome flanking the preselected site, optionally in combination with non-homologous end-joining (NHEJ) at one of the two end of the repair nucleic acid molecule (e.g. in case there is only one flanking region). Integration by homologous recombination will allow precise joining of the repair nucleic acid molecule to the target genome up to the nucleotide level, while NHEJ may result in small insertions / deletions at the junction between the repair nucleic acid molecule and genomic DNA.
[0051] As used herein, “a modification of the genome”, means that the genome has changed by at least one nucleotide. This can occur by replacement of at least one nucleotide and / or a deletion of at least one nucleotide and / or an insertion of at least one nucleotide, as long as it results in a total change of at least one nucleotide compared to the nucleotide sequence of the preselected genomic target site before modification, thereby allowing the identification of the modification, e.g. by techniques such as sequencing or PCR analysis and the like, of which the skilled person will be well aware.
[0052] As used herein “a preselected site”, “a predetermined site” or “predefined site” indicates a particular nucleotide sequence in the genome (e.g. the nuclear genome or the chloroplast genome) at which location it is desired to insert, replace and / or delete one or more nucleotides. This can e.g. be an endogenous locus or a particular nucleotide sequence in or linked to a previously introduced foreign DNA or transgene. The preselected site can be a particular nucleotide position at (after) which it is intended to make an insertion of one or more nucleotides. The preselected site can also comprise a sequence of one or more nucleotides which are to be exchanged (replaced) or deleted.
[0053] As used in the context of the present application, the term “about” means + / - 10% of the recited value, preferably + / - 5% of the recited value. For example, about 100 nucleotides (nt) shall be understood as a value between 90 and 110 nt, preferably between 95 and 105. As used herein, a “flanking region”, is a region of the repair nucleic acid molecule having a nucleotide sequence which is homologous to the nucleotide sequence of the DNA region flanking (i.e. upstream or downstream) of the preselected site. It will be clear that the length and percentage sequence identity of the flanking regions should be chosen such as to enable homologous recombination between said flanking regions and their corresponding DNA region upstream or downstream of the preselected site. The DNA region or regions flanking the preselected site having homology to the flanking DNA region or regions of the repair nucleic acid molecule are also referred to as the homology region or regions in the genomic DNA.
[0054] To have sufficient homology for recombination, the flanking DNA regions of the repair nucleic acid molecule may vary in length, and should be at least about 10 nt, about 15 nt, about 20 nt, about 25 nt, about 30 nt, about 40 nt or about 50 nt in length. However, the flanking region may be as long as is practically possible (e.g. up to about 100-150 kb such as complete bacterial artificial chromosomes (BACs). Preferably, the flanking region will be about 50 nt to about 2000 nt, e.g. about 100 nt, 200 nt, 500 nt or 1000 nt. Moreover, the regions flanking the DNA of interest need not be identical to the homology regions (the DNA regions flanking the preselected site) and may have between about 80% to about 100% sequence identity, preferably about 95% to about 100% sequence identity with the DNA regions flanking the preselected site. The longer the flanking region, the less stringent the requirement for homology. Furthermore, to achieve exchange of the target DNA sequence at the preselected site without changing the DNA sequence of the adjacent DNA sequences, the flanking DNA sequences should preferably be identical to the upstream and downstream DNA regions flanking the preselected site.
[0055] As used herein, “upstream” indicates a location on a nucleic acid molecule which is nearer to the 5' end of said nucleic acid molecule. Likewise, the term “downstream” refers to a location on a nucleic acid molecule which is nearer to the 3' end of said nucleic acid molecule. For avoidance of doubt, nucleic acid molecules and their sequences are typically represented in their 5' to 3' direction (left to right).
[0056] In order to target sequence modification at the preselected site, the flanking regions must be chosen so that 3' end of the upstream flanking region and / or the 5' end of the downstream flanking region align(s) with the ends of the predefined site. As such, the 3' end of the upstream flanking region determines the 5' end of the predefined site, while the 5' end of the downstream flanking region determines the 3' end of the predefined site. As used herein, said preselected site being located outside or away from said cleavage (and / or recognition) site, means that the site at which it is intended to make the genomic modification (the preselected site) does not comprise the cleavage site and / or recognition site of the DSBI / SSBI enzyme or the base editor enzyme, i.e. the preselected site does not overlap with the cleavage (and / or recognition) site. Outside / away from in this respect thus means upstream or downstream of the cleavage (and / or recognition) site.
[0057] Further, the present invention also provides a method of growing a plant, comprising plant regeneration as described above. Depending on whether transformation or gene editing of plant cells is also carried out, a whole (fertile) plant is obtained that possibly has a modified genome.
[0058] Subject matter of the present invention are also the plants that are obtained or obtainable by the methods described above. Accordingly, one embodiment of the invention is a transgenic plant obtained or obtainable by the above method of transforming a plant cell and regenerating a plant from said cell, as well as progeny or parts thereof, wherein the progeny or the part comprises the at least one nucleotide sequence of interest as transgene. Another embodiment of the invention is a genetically modified plant obtained or obtainable by the above method of modifying the genome of a plant cell and regenerating a plant from said cell as well as progeny or parts thereof, wherein the progeny or the part comprises the modification in the genome introduced by the above method of modification.
[0059] Further subject matter of the present invention is a plant cell or a seed derived from the above transgenic plant or genetically modified plant. Such a plant cell preferably comprises a polynucleotide encoding a miRNA396 mimicry transiently or stably integrated and a single-stranded DNA break (SSB)- or double-stranded DNA break (DSB)-inducing enzyme or base editor enzyme, which preferably recognizes a predetermined site in the genome of said cell and optionally a repair nucleic acid molecule. The polynucleotide encoding the miRNA396 mimicry is preferably operably linked to a suitable regulatory sequence so that the plant cell is capable of expressing the miRNA396 mimicry. A regulatory sequence means, for example, a "promoter" which refers to a nucleotide sequence, usually upstream (5') to its coding sequence, which controls the expression of the coding sequence by providing the recognition for RNA polymerase and other factors required for proper transcription. "Constitutive promoter" refers to promoters that direct gene expression in nearly all tissues and at all times. Examples of constitutive promoters include CaMV 35S promoter, double CaMV 35S promoter (70S promoter), nopaline synthase (nos) promoter, BdEF1 promoter, or ubiquitin promoter like Pcllbi4 or Zmllbil . "Regulated promoter" refers to promoters that direct gene expression not constitutively but in a temporally and / or spatially regulated manner and include both tissue-specific and inducible promoters. It includes natural and synthetic sequences as well as sequences, which may be a combination of synthetic and natural sequences. Different promoters may direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental conditions. New promoters of various types useful in plant cells are constantly being discovered and are well-known to a person skilled in the art. "Tissue-specific promoter" refers to regulated promoters that are not expressed in all plant cells but only in one or more cell types in specific organs (such as leaves or seeds), specific tissues (such as embryo or cotyledon), or specific cell types (such as leaf parenchyma or seed storage cells). These also include promoters that are temporally regulated (such as in early or late embryogenesis), during fruit ripening in developing seeds or fruit, in fully differentiated leaf, or at the onset of senescence. "Inducible promoter" refers to those regulated promoters that can be turned on in one or more cell types by an external stimulus (such as a chemical, light, hormone, stress, or pathogen). Examples for inducible promoter are promoters inducible by ecdysone, dexamethasone, ethanol. Such promoters are well-known from the state of the art (e.g., Samalova et al. (2005). pOp6 / LhGR: a stringently regulated and highly responsive dexamethasone-inducible gene expression system for tobacco. The Plant Journal, 41(6), 919-935; Gatz & Lenk (1998). Promoters that respond to chemical inducers. Trends in Plant Science, 3(9), 352-358.).
[0060] Another subject-matter of the present invention is a plant cell comprising a polynucleotide encoding a miRNA396 mimicry transiently or stably integrated, and a single-stranded DNA break (SSB) or double stranded DNA break (DSB) inducing enzyme or base editor enzyme, which preferably recognize a predetermined site in the genome of said cell, and optionally a repair nucleic acid molecule, wherein preferably the polynucleotide encoding the miRNA396 mimicry being operatively linked to a suitable regulatory sequence, so that the plant cell is capable of expressing the miRNA396 mimicry. Such plant cell can be obtained when conducting the above described method for modifying the genome of a plant cell.
[0061] A further aspect of the present invention is the use of miRNA396 mimicry for promoting plant regeneration
[0062] (a) in a method for inducing callus formation from at least one plant cell, preferably a plant cell from genus Beta, more preferably Beta vulgaris, or in a method for somatic embryogenesis or indirect regeneration of a plant, preferably a plant from the genus Beta, more preferably Beta vulgaris plant, from callus; (b) in a method of transformation of a plant cell, preferably a plant cell from the genus Beta, more preferably Beta vulgaris, or in a method of modifying the genome of a plant cell, preferably a plant cell from the genus Beta, more preferably Beta vulgaris, or
[0063] (c) in the production of a transgenic plant cell, plant or seed, preferably from the genus Beta, more preferably Beta vulgaris, or in the production of a genetically modified plant cell, plant or seed, preferably from the genus Beta, more preferably Beta vulgaris.
[0064] Unless stated otherwise in the Examples, all recombinant DNA techniques are carried out according to standard protocols as described in Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, NY and in Volumes 1 and 2 of Ausubel et al. (1994) Current Protocols in Molecular Biology, Current Protocols, USA. Standard materials and methods for plant molecular work are described in Plant Molecular Biology Labfax (1993) by R.D.D. Cray, jointly published by BIOS Scientific Publications Ltd (UK) and Blackwell Scientific Publications, UK. Other references for standard molecular biology techniques include Sambrook and Russell (2001) Molecular Cloning: A Laboratory Manual, Third Edition, Cold Spring Harbor Laboratory Press, NY, Volumes I and II of Brown (1998) Molecular Biology LabFax, Second Edition, Academic Press (UK). Standard materials and methods for polymerase chain reactions can be found in Dieffenbach and Dveksler (1995) PCR Primer: A Laboratory Manual, Cold Spring Harbor Laboratory Press, and in McPherson at al. (2000) PCR - Basics: From Background to Bench, First Edition, Springer Verlag, Germany.
[0065] All patents, patent applications, and publications or public disclosures (including publications on internet) referred to or cited herein are incorporated by reference in their entirety.
[0066] The invention will be further described with reference to the following Figures and Examples described herein. However, it is to be understood that the invention is not limited to such Examples.
[0067] Figures
[0068] Fig. 1 Overexpression of miR396 mimicry (MimiRNA) improves callus induction in sugar beet Leaf explants from WT, d35s-tDT, mimiR L1 , mimiRL3 and mimiR L8 are incubated on callus induction media for 7-8 weeks. A pronounced callus development was observable for mimiR L1 , mimiRL3 and mimiR L8 lines, whereas the two control lines WT and d35s-tDT showed no or only low callus induction.
[0069] Fig. 2 Repetition of MimiR396 overexpression approach to improve callus induction in sugar beet
[0070] Leaf explants from WT, mimiRL3 and mimiR L8 are incubated on callus induction media for 7-8 weeks. Pronounced callus development was observable for mimiRL3 and mimiR L8 lines, whereas the control line WT showed no or only low callus induction.
[0071] Fig. 3 Quantification of callus induction in sugar beet
[0072] A: Exemplary visualization how the diameter of the explants was measured after callus induction for the different lines.
[0073] B: Quantification of callus production based on the diameter of callus per leaf explant. In both data sets, the mimiRNA396 lines showed a clear increase in callus production in comparison to the controls (WT and d35s tDT).
[0074] Fig. 4 Overexpression of MimiR396 improves shoot regeneration in sugar beet
[0075] A: Visualization of shoot regeneration with the callus tissue of the different lines
[0076] B: Quantification of shoot regeneration based on the number of regenerated shoots per lead explant. Number of regenerated shoots per leaf explants remains on a low level in both independent experimental settings for the WT as well as for d35d-tDT whereas the mimiRNA396 lines show a clearly enhanced number of regenerated shoots.
[0077] Fig. 5 Overexpression of MimiRNA396 does not show obvious phenotype.
[0078] Pictures of regenerated plants were taken at 3 weeks & 9 weeks of incubation. The regenerated mimiRNA396 lines did not show any pleiotropic phenotype in comparison to the control lines or any other abnormality.
[0079] Fig. 6 Overexpression of MimiRNA396 leads to upregulation of some GRF genes.
[0080] A: Expression of mimiRNA396 construct has been verified in the transgenic lines but was not detectable in the control lines.
[0081] B: The relative expression of four different GRFs (Bv3_049470: BvGRF4;
[0082] Bv7_160040: BvGRF3; Bv6_128450: BvGRF2; Bv_000980: BvGRFI) was is clearly enhanced in the three transgenic lines L01 , L03 and L08, whereas the respective control lines (d35s-tDT, non-transgenic control and wildtype) showed in comparison to the three transgenic lines relatively low expression levels.
[0083] Fig. 7 Vector Map: d35s-mimiRNA396 (SEQ ID NO. 8). The sequence of the corresponding mimiRNA396 is given in SEQ ID NO. 9.
[0084] Fig. 8 Vector Map: pZFNnptll-70StDT (SEQ ID NO. 7)
[0085] Fig. 9 Uptake of fluorescence labeled AMOs by sugar beet seedling roots. Sugar beet seedlings were incubated for 48 h in medium containing 5-FAM-anti-miR396 and sucrose and monitored by fluorescence microscopy. (A:control, B: 48h incubation with 5-FAM-anti-miR396)
[0086] Fig. 10 Activation of GRFs by AMO inhibiting miR396
[0087] Examples
[0088] Example 1 : miRNA396 mimicry promotes callus formation
[0089] • Sugar beet callus induction
[0090] Micropropagated shoots of the genotypes (I) 9BS0448, (II) transgenic d35s - tDT and (III) transgenic d35s-miRNA396 mimicry lines were used as starting material. Shoots were multiplied in medium A [MS salts + 30 g / l sucrose + 0.25 mg / l benzyladenine (BAP) + 10 g / l agar, pH 6.0],
[0091] To induce friable callus, leaf explants were incubated in medium B, at 28°C for 7-8 weeks [MS salts + 15 g / l sucrose + 2 mg / l BAP + 8 g / l agar, pH 6.0],
[0092] Friable calli were mounted in medium (MS salts + 30 g / l sucrose + 0.25 mg / l benzyladenine (BAP) + 10 g / l agar, pH 6.0) and kept for 1 week in the dark, 24 °C. Agrobacterium AGL-1 harbouring the vector pZFN-nptll-70s::tDT or pZFN-nptll-70s::MimiRNA396 was grown in medium (5 g / l tryptone + 2.5 g / l yeast extract + 1 g / l NaCI + 5 g / l mannitol + 0.1 g / l MgSO4x7H2O + 0.25 g / l KH2PO4 + 1 g / l glutamic acid, pH 7.0, pH 7.0) supplemented with the appropriate antibiotics, at 28 °C, for 24 h. Calli were inoculated with Agrobacterium suspension (440 mg / l CaCI2x2H2O + 170 mg / l KH2PO4 + 1.9 g / l KNO3 + 180.7 mg / l MgSO4 + 1 .65 g / l NH4NO3 + 2 mg / l BAP + 40 pg / l Acetosyringone + 20 g / l sucrose + 2 g / l glucose, pH 6.0) at an OD600 of 0.8. the callus tissue and the Agrobacterium were incubated (440 mg / l CaCI2x2H2O + 170 mg / l KH2PO4 + 1 .9 g / l KNO3 + 180.7 mg / l MgSO4 + 1.65 g / l NH4NO3 + 2 mg / l BAP + 40 pg / l Acetosyringone + 20 g / l sucrose + 2 g / l glucose + 10 g / l agar, pH 6.0), at 21 °C for 3 days in the dark. Calli were subcultured (MS salts + 30 g / l sucrose + 1 mg / l GA3 + 1 mg / l TDZ + 500 mg / l Timentin + 10 g / l agar, pH 6.0) and incubated in the dark, at 24 °C for 1 week. To select the transgenic calli, samples were transferred (MS salts + 30 g / l sucrose + 1 mg / l GA3 + 1 mg / l TDZ + 500 mg / l Timentin + 100 mg / l paromomycin + 10 g / l agar, pH 6.0) and incubated at 24 °C in the light / dark cycle (16 h / 8 h) for 3 weeks. Transgenic calli were selected and subcultured for several times in the same medium and conditions.
[0093] As shown in Fig. 1 three lines of mimiRNA396 overexpression (L01 , L03 and L08) from miRNA mimicry construct show significant increases in callus induction compared to controls (wildtype and d35s-tDT).
[0094] Similar results of improved callus induction in the MimiR396 overexpression lines have been reproduced in an independent approach as shown for L03 and L08 in Fig. 2.
[0095] To quantify the effect on callus induction the size of respective leaf explants have been determined as shown in Fig. 3a. This has been done independently for both repetitive approaches which are shown in Fig, 1 and 2. The results are shown in Fig. 3B.
[0096] Callus induction was significantly increased in lines with the mimiRNA396 construct by showing a 5x - 9x times higher callus production.
[0097] Example 2: miRNA396 mimicry promoters shoot regeneration
[0098] Friable calli were harvested from the induction (experiment 1) and transferred to the shoot induction media (MS salts + 30 g / l sucrose + 1 mg / l GA3 + 1 mg / l Thidiazuron (TDZ) + 10 g / l agar, pH 6.0). The calli were incubated at 24 °C in the light / dark cycle (16 h / 8h) for 1-2 weeks. Regenerated shoots were mounted and cultured in Media containing MS salts + 30 g / l sucrose + 0.25 mg / l benzyladenine (BAP) + 10 g / l agar, pH 6.0 and the plants were grown at 24 °C in the light / dark cycle (16 h / 8h). The overexpression of MimiRNA396 significantly improves also shoot regeneration capacity from callus (Fig. 4 A and B). In Fig. 4a selected examples are presented to visualize the clearly visible difference between the control lines (WT and d35s-tDT) and the MimiRNA396 overexpression lines. In Fig, 4b quantitative results of the shoot regeneration are shown. The three mimiRNA396 overexpression lines L01 , L03 and L08 showed an improved shoot regeneration compared with controls (Wildtype and d35s-tDT) by factor 2 - 11.
[0099] After development of regenerated shoots respective material from L01 , L03 and L08 were cultured on medium containg MS salts + 30 g / l sucrose + 0.25 mg / l benzyladenine (BAP) + 10 g / l agar, pH 6.0.
[0100] Plants were optically analyzed at two different time point after 3 weeks as well as after aprrox. 9 weeks and did not shown any phenotype in comparison to the wildtype control.
[0101] Example 3: miRNA396 mimicry triggers upregulation of GRF genes
[0102] To identify which specific GRFs are upregulated in SB due to the overexpression of the MimiRNA396 a RT-PCR experiment was done. The Platinum™ SYBR™ Green qPCR SuperMix-UDG from Invitrogen was used with the respective protocols.
[0103] The qRT-PCR was carried out in 10- / 1 reaction mixtures containing 5 I of Platinum SYBR green qPCR SuperMix-UDG (Thermofisher), according to the manufacturer's instructions. With this approach the high expression level of MimiRNA396 in the transgenic lines has been verified (Fig. 6a).
[0104] The expression level of GRF genes have been analyzed, since these genes are the target of miRNA396 which expression levels are reduced in the described approach by overexpression of MimiRNA396 potentially leading to an upregulation of the GRFs (Fig. 6b).
[0105] It has been shown in this analysis that the expression four GRF genes are upregulated by factor 2,5x - 10x in the MimiRNA396 lines (L01 , L03, L08) compared to control (d35s-tDT, non-transgenic control but callus derived plant, wildtype control without callus phase).
[0106] Bv3 049470: BvGRF4: L01 and L03 showed 5x-6x higher relative expression levels of Bv3_049470 (SEQ ID NO. 1): BvGRF4 compared to the three control lines. For L08 the increase was even higher with a 9-fold higher relative expression of Bv3_049470: BvGRF4 compared to the three control lines.
[0107] - Bv7 160040: BvGRF3: L03 and L01 showed an increase of relative Bv7_160040 (SEQ ID NO. 2): BvGRF3 expression by factor 2.5 -3 compared to the controls, whereas the relative expression in L08 was 4 times higher than in the controls.
[0108] - Bv6 128450: BvGRF2: L01 and L03 had approx. 8x higher relative expression levels of_Bv6 128450 (SEQ ID NO. 3): BvGRF2 in comparison to the controls. Again, for L08 a slightly higher increase was observed for the relative expression level of Bv6 128450: BvGRF2 with an 10x increase.
[0109] - Bv 000980: BvGRFI: For L03 and L08 a 2.5x - 3x increase of the relative expression of Bv_000980 (SEQ ID NO. 4): BvGRFI was observed whereas for L01 a clearly more intensive increase of the relative expression was found. Experimental data showed approx. 6x higher expression compared to the controls.
[0110] References
[0111] Franco-Zorilla et al. Target mimicry provides a new mechanism for regulation of microRNA activity https: / / doi.org / 10.1038 / ng2079;
[0112] Nelissen et al. Dynamic Changes in ANGUSTIFOLIA3 Complex Composition Reveal a Growth Regulatory Mechanism in the Maize Leaf https: / / doi.org / 10.1105 / tpc.15.00269;
[0113] Omidbakhshfard et al, Growth-Regulating Factors (GRFs): A Small Transcription Factor Family with Important Functions in Plant Biology. https: / / doi.Org / 10.1016 / j.molp.2015.01.013;
[0114] Todesco et al. A Collection of Target Mimics for Comprehensive Analysis of MicroRNA Function in Arabidopsis thaliana A Collection of Target Mimics for Comprehensive Analysis of MicroRNA Function in Arabidopsis thaliana (plos.org);
[0115] Wang et al, miR396-targeted AtGRF transcription factors are required for coordination of cell division and differentiation during leaf development in Arabidopsis. https: / / doi.Org / 10.1093 / jxb / erq307;
[0116] WO2012149316, US9896698 - miRNA396 and growth regulating factors for cyst nematode tolerance in plants;
[0117] US9890388 - GRF3 Mutants, Methods and Plants;
[0118] LIS20210071191 - Methods of increasing nutrient use efficiency.
Claims
24Claims1. A method of promoting plant regeneration, comprising incubating a plant cell or a plant material comprising a plant cell in the presence of miRNA396 mimicry.
2. The method according to claim 1, wherein the plant material comprises an explant, a callus tissue, a plant embryo, or a seedling.
3. The method of any one of the preceding claims, wherein the plant cell is a somatic or embryonic cell.
4. The method of any one of the preceding claims, optionally comprising one or more of the following steps(a) inducing callus formation from at least one plant cell,(b) cultivating callus, in particular the callus obtained in step (a), under conditions promoting growth of embryos and / or shoots out of the callus, and(c) regenerating a plant from embryos or shoots, wherein the miRNA396 mimicry is present during callus formation, cultivation, and / or plant regeneration.
5. The method of any one of the preceding claims, wherein the plant cell is a cell from the genus Beta, more preferably Beta vulgaris.
6. The method of any one of the preceding claims, wherein the miRNA396 mimicry is a miRNA target mimic, in particular wherein the miRNA396 mimicry comprises a RNA molecule or derivative thereof that forms a non-cleavable product with the complementary miRNA396, preferably an antisense oligonucleotide to miRNA396.
7. The method of any one of the preceding claims, wherein the miRNA396 mimicry is specific for miRNA396a of specific for miRNA396b.
8. The method of any one of the preceding claims, wherein the miRNA396 mimicry is externally added,9. The method of claims 8, comprising a step of applying the miRNA mimicry to the plant cell or plant material, in particular to the roots of a seedling.
10. The method of any one of claims 1-7, wherein the miRNA396 mimicry is expressed by the plant cell.11 . The method of claim 10, further comprising a step of introducing at least one nucleotide sequence encoding the miRNA396 mimicry into the plant cell, in particular into a plant cell or a predecessor thereof to be used in step (a), into a cell of the callus obtained in step (a) and / or to be used in step (b), or into the embryos or shoots obtained in step (b) and / or to be used in step (c).
12. The method of any one of the preceding claims, further comprising a step of(d1) introducing at least one nucleotide sequence of interest into the at least one plant cell or a predecessor thereof to be used in step (a), into at least one cell of the callus obtained in step (a) which itself or a progeny thereof is then to be used in step (b) or has been used in step (b), and / or(d2) modifying the genome of the at least one plant cell or a predecessor thereof to be used in step (a), of the at least one cell of the callus obtained in step (a) which itself or a progeny thereof is then to be used in step (b) or has been used in step (b), by introducing into said cell a single stranded DNA break (SSB) inducing enzyme or a double stranded DNA break (DSB) inducing enzyme which preferably recognize a predetermined site in the genome of said cell, and optionally a repair nucleic acid molecule, or a single stranded DNA break (SSB) inducing enzyme which preferably recognizes a predetermined site in the genome of said cell and is fused to a base editor enzyme, wherein the modification of said genome is selected fromI. a replacement of at least one nucleotide;II. a deletion of at least one nucleotide;III. an insertion of at least one nucleotide; andIV. any combination of I. - III.
13. A method of growing a plant, comprising plant regeneration according to any one of the preceding claims.
14. A plant obtained or obtainable by the method of claim 13 or a progeny plant thereof.
15. A plant cell or a seed of the plant of claim 11.
16. Use of miRNA396 mimicry for promoting plant regeneration(a) in a method for inducing callus formation from at least one plant cell, preferably a plant cell from the genus Beta, more preferably Beta vulgaris, or in a method for somatic embryogenesis or indirect regeneration of a plant, preferably a plant from the genus Beta, more preferably Beta vulgaris plant, from callus;(b) in a method of transformation of a plant cell, preferably a plant cell from the genus Beta, more preferably Beta vulgaris, or in a method of modifying the genome of a plant cell, preferably a plant cell from the genus Beta, more preferably Beta vulgaris’, or(c) in the production of a transgenic plant cell, plant or seed, preferably from the genus Beta, more preferably Beta vulgaris, or in the production of a genetically modified plant cell, plant or seed, preferably from the genus Beta, more preferably Beta vulgaris.