Method for editing pepper gene by using tobacco rattle virus-based vector

A TRV2 recombinant vector enhances chili pepper gene editing efficiency by using a PEBV promoter, hammerhead ribozyme, and mobile RNA sequences, addressing low efficiency and repeatability issues in chili pepper transformation.

WO2026127237A1PCT designated stage Publication Date: 2026-06-18FARMYIREHSE CO LTD +1

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
FARMYIREHSE CO LTD
Filing Date
2025-06-12
Publication Date
2026-06-18

AI Technical Summary

Technical Problem

The application of gene editing technology in chili peppers has been limited due to low transformation efficiency and lack of repeatability, with previous methods failing to achieve elongated shoots and efficient gene editing.

Method used

A TRV2 recombinant vector is developed, incorporating a PEBV promoter, hammerhead ribozyme, guide RNA specific to the target gene, and a Flowering locus T-coding sequence or tRNA-Met sequence, which is used to transform Cas9-overexpressing chili pepper plants, enhancing gene editing efficiency.

🎯Benefits of technology

The method achieves high gene editing efficiency, allowing for the production of gene-edited chili pepper plants and seeds with heritable traits, and demonstrates improved transformation efficiency and repeatability.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2025008078_18062026_PF_FP_ABST
    Figure KR2025008078_18062026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to a method for editing a pepper gene by using a tobacco rattle virus (TRV)-based vector and, more specifically, to a TRV2 recombinant vector for gene editing of a pepper plant, and a use thereof, the vector comprising a guide RNA expression cassette in which a Peba early browning virus (PEBV)-derived promoter, a sequence encoding a hammerhead ribozyme, a sequence encoding a guide RNA specific to the nucleotide sequence of a target gene, and a Flowering locus T coding sequence or a tRNA-Met coding sequence are operably linked.
Need to check novelty before this filing date? Find Prior Art

Description

Pepper gene editing method using a TOBACCO RATTLE VIRUS-based vector

[0001] The present invention relates to chili pepper gene editing using a Tobacco rattle virus (TRV)-based vector.

[0002]

[0003] This work was carried out with the support of the Next Generation Crop New Breeding Technology Development Project of the Rural Development Administration (Project Nos: RD010084, PJ014807032021, PJ014807032020, 00322053, PJ014807012021).

[0004] Gene editing using the CRISPR / Cas system enables the easy and rapid development of new varieties because it can induce mutations in specific target genes. To perform gene editing in plants using the CRISPR / Cas system, it is necessary to deliver CRISPR reagents, such as Cas proteins and guide RNA (gRNA), into plant cells. Methods include Agrobacterium-mediated transformation, gene guns, ribonucleoproteins (RNPs), and viral vectors. Among these, Virus-induced genome editing (VIGE) is a method that induces gene editing by infecting plants with viruses expressing CRISPR reagents. VIGE can be broadly divided into two types: the first involves infecting Cas9-overexpressing plants with viruses expressing gRNA, and the second involves inoculating them with viruses capable of simultaneously expressing Cas9 and gRNA. The second method requires the delivery of large insert genes, such as the 4.3 kb Cas9 gene, so RNA viruses with flexible filamentous RNA genome structures, such as Potato virus X (PVX), Sonchus yellow net rhabdovirus, or Tomato spotted wilt virus (TSWV), must be used. Tobacco rattle virus (TRV)-mediated gene editing belongs to the first method; it enables gene editing with higher efficiency than the second method and allows for a wide range of gene editing because it has a broad host range of over 400 species. Gene editing can be performed conveniently by inoculating Cas9-overexpressing plants with TRV vectors expressing various gRNAs, without the need to perform transformation every time.

[0005] The concept of such VIGE was first reported in 2015 with the delivery of gRNA via TRV in Cas9-overexpressing tobacco (Nicotiana benthamiana), but the probability of obtaining a gene-edited individual in the next generation was very low, at 1 in 438 individuals (Ali et al., 2015, Mol Plant. 8(8):1288-1291). Studies have been reported that enabled gene editing via seeds without tissue culture by effectively increasing gene editing efficiency through the application of mobile gRNAs attached with mobile RNAs such as Flowering Locus T (FT) or tRNA-Ile to tobacco, Arabidopsis thaliana, cotton, or wheat using TRV, Cotton Leaf Crumple Virus (CLCrV), and Barley Stripe Mosaic Virus (BSMV). Additionally, gene editing was performed by inserting the self-cleaving hammerhead ribozyme (HH) between the downstream genomic promoter and the gRNA sequence to create an intact gRNA sequence, and applying this to VIGE to increase gene editing efficiency Studies have been reported that have increased the number of Cas proteins. In addition, VIGE studies utilizing not only Cas9 but also base editors and Cas12 are being published, and the utility of VIGE is on the rise (Liu et al., 2022, Plant Physiol. 189(4):1920-1924; Liu et al., 2023, Mol Plant. 16(3):616-631). However, while cases of gene editing through VIGE have been reported in model plants and food crops, the application of VIGE in horticultural crops such as chili peppers has been limited.

[0006] Chili peppers are a vegetable crop with an annual production value of approximately 1 trillion won, making them highly economical; however, the application of gene editing technology has been limited due to very low transformation efficiency. The first successful case of chili pepper transformation was reported in 1990. However, only calluses, leaf-like structures, and axillary buds appeared, and elongated shoots could not be obtained. Since then, several cases of chili pepper transformation have been reported, but efficiency has been very low and the protocols lack repeatability (Kothari et al., 2010, Biotechnol. Adv. 28(1):35-48). To apply gene editing technology to chili pepper breeding, a high-efficiency chili pepper-specific gene editing system must be developed.

[0007] Meanwhile, Korean Registered Patent No. 1554678 discloses a ‘gene delivery system for plant transformation using a plant virus and its use’ using a recombinant plant expression vector comprising a gene delivery system (GDS) cassette and a reverse transcriptase capable of being inserted into a plant virus gene including a polypurine tract, LB, promoter, MCS (multiple cloning site), terminator, RB, and tRNA Met binding sequence, and Korean Registered Patent No. 2274496 discloses a ‘method for gene editing of a plant using an RNA plant virus and its use’ comprising, as active ingredients, an RNA plant virus-based infectious clone containing a guide RNA coding sequence within a multicloning site and two RNA plant virus-based infectious clones each containing an N-terminal or C-terminal fragment coding sequence of a Cas9 protein within a multicloning site, respectively, but the ‘method for gene editing of a pepper using a TRV-based vector’ of the present invention has not been described.

[0008] The present invention was derived from the above-mentioned requirements, and the inventors intended to develop a high-efficiency chili pepper-specific gene editing system.

[0009] To this end, a non-modified gRNA expression TRV2 vector and a modified gRNA expression TRV2 vector in which a hammerhead ribozyme (HH) and / or mobile RNA (FT or tRNA-Met) were attached to the end of the gRNA sequence were constructed. Subsequently, the constructed non-modified and modified gRNA expression TRV2 vectors were inoculated into Cas9-overexpressing peppers, and the gene editing efficiency was analyzed. As a result, it was confirmed that the TRV2 vector with an HH sequence added to the 5' end of the gRNA sequence and an FT or tRNA-Met sequence added to the 3' end exhibited high gene editing efficiency.

[0010] In addition, the present invention was completed by confirming that culturing chili plants at 20°C after inoculating Cas9-overexpressing chilies with a modified gRNA-expressing TRV2 vector contributes to an increase in gene editing efficiency.

[0011] To solve the above problem, the present invention provides a TRV2 (Tobacco rattle virus 2) recombinant vector for gene editing of pepper plants, comprising a PEBV (Pea early browning virus) derived promoter; a sequence encoding a hammerhead ribozyme; a sequence encoding a guide RNA specific to the nucleotide sequence of a target gene; and a guide RNA expression cassette operably linked to a Flowering locus T-coding sequence or a tRNA-Met-coding sequence.

[0012] In addition, the present invention provides a gene editing method for a chili pepper plant, comprising the step of transforming a chili pepper plant overexpressing Cas9 (CRISPR associated protein 9) with the TRV2 recombinant vector.

[0013] In addition, the present invention provides a method for producing a gene-edited pepper plant, comprising: (a) transforming a pepper plant expressing Cas9 (CRISPR associated protein 9) with the TRV2 (Tobacco rattle virus 2) recombinant vector; and (b) regenerating a pepper plant from the transformed pepper plant cell.

[0014] In addition, the present invention provides a gene-edited chili pepper plant produced by the above method and a seed with the same in which the gene is edited.

[0015] In addition, the present invention provides a composition for gene editing of a pepper plant comprising, as an active ingredient, a TRV2 recombinant vector comprising a guide RNA expression cassette operably linked to a PEBV-derived promoter; a sequence encoding a hammerhead ribozyme; a sequence encoding a guide RNA specific to the nucleotide sequence of a target gene; and a Flowering locus T-coding sequence or a tRNA-Met-coding sequence.

[0016] In this invention, a heritable gene editing system for chili peppers was constructed through gRNA modification. It is expected that the development of chili pepper breeding materials with various traits will be possible by utilizing the TRV-mediated chili pepper gene editing system constructed in this invention.

[0017] Figure 1 is a schematic diagram of the T-DNA region inserted into the genome of the Cas9 overexpressing pepper 'TG-S #1' transformant provided by Toolgen Inc.

[0018] Figure 2 shows schematic diagrams (A, B) of TRV1 vectors and TRV2 vectors containing gRNA targeting CaPDS, and the CaPDS target site (C). A: Schematic diagram of TRV1 vector, B: Schematic diagram of TRV2-gRNA vectors containing U6-26 promoters and PEBV promoters, and TRV2-gRNA vectors with added Hammerhead ribozyme (HH) and Flowering locus T (FT) sequences. LB, left border; 35S, CaMV35S promoter; RdRp, RNA-dependent RNA polymerase; MP, movement protein; 16K, 16 Kd protein; Rz, self-cleaving ribozyme; NOSt, NOS terminator; CP, coat protein; U6, U6-26 promoter; PEBV, Pea early browning virus promoter; HH, hammerhead ribozyme; FT, Flowering locus T; RB, right border.

[0019] Figure 3 shows the characteristics of the Cas9 overexpressing pepper 'TG-S #1' transformant, (A) is the appearance of the Cas9 overexpressing pepper 'TG-S #1' transformant, (B) is the result of confirming Cas9 transformation through PCR in the T1 generation, (C) is the result of confirming Cas9 expression through RT-PCR, and (D) is the result of confirming the transformant through the green fluorescent protein signal.

[0020] Figure 4 shows the results of selecting homozygous lines of Cas9 overexpressing pepper 'TG-S #1' transformants, (A) showing the results of determining the transformation of each T2 generation individual through Cas9 amplification, and (B) showing the confirmed Cas9 transformation genotype for each line.

[0021] Figure 5 shows the results of obtaining gene-edited individuals through TRV2-U6-CaPDS-gRNA inoculation and tissue culture. (A) shows the results of gene editing assays performed by amplifying the CaPDS target site and treating with BstXⅠ restriction enzymes; bands that are not cut by the restriction enzymes indicate mutations, meaning that mutations have occurred at the target site. (B) shows the process of obtaining gene-edited individuals through redifferentiation from TRV2-U6-CaPDS-gRNA inoculated leaves, and a photobleaching phenotype caused by bi-allelic mutations was observed in some individuals during the tissue culture process. (C) shows the results of CaPDS target site sequence analysis in the shoots of the gene-edited E0 generation, and (D) shows the gene-editing expression in the E1 offspring of individual 1-1.

[0022] Figure 6 analyzes the change in gene editing efficiency through modified gRNA TRV2 vectors and low-temperature cultivation. (A) is a photograph showing the phenotype in the uppermost leaf after the first branching following inoculation with TRV2-CaPDS-gRNA, TRV2-HH-CaPDS-gRNA, TRV2-CaPDS-gRNA-FT, and TRV2-HH-CaPDS-gRNA-FT vectors, and it can be confirmed that the albino phenotype is maintained in the uppermost leaf of individuals grown at 20°C after inoculation with TRV2-CaPDS-gRNA-FT and TRV2-HH-CaPDS-gRNA-FT. (B) shows the gene editing efficiency in the uppermost leaf after the first branching of the pepper, (C) is the result of comparing the gRNA expression levels in the uppermost leaf after the first branching of the pepper, and (D) is the result of confirming whether gene editing occurred in flower tissue according to the cultivation temperature of individuals inoculated with TRV2-HH-CaPDS-gRNA-FT.

[0023] Figure 7 shows the results of a comparison of gene editing efficiency among various mobile RNAs, where (A) is a schematic diagram of the TRV2-CaPDS-sgRNA vector with various mobile RNAs added, (B) shows the albino phenotype observed in plants inoculated with TRV2-CaPDS-sgRNA containing each mobile RNA, (C) shows the results of analyzing gene editing efficiency in the upper leaves of the first branch of plants inoculated with each TRV2-CaPDS-sgRNA, and (D) shows the results of analyzing gRNA expression levels in the upper leaves of the first branch of plants inoculated with each TRV2-CaPDS-sgRNA. *; P<0.5, ns; no significant.

[0024] Figure 8 shows the results of confirming the offspring generation of gene-edited individuals through TRV2-mediated gene editing, (A) is a photograph showing the albino phenotype observed in the fruit stalk and peel of a fruit of an individual grown at 20°C after inoculation with TRV2-HH-CaPDS-sgRNA-FT, (B) is a photograph showing the albino phenotype of the next generation of gene-edited individuals of an individual edited with TRV2-HH-CaPDS-sgRNA-FT, and (C) is the result of sequencing analysis of the CaPDS target site of the albino phenotype individual of (B).

[0025] To achieve the objective of the present invention, the present invention provides a TRV2 (Tobacco rattle virus 2) recombinant vector for gene editing of pepper plants, comprising: a PEBV (Pea early browning virus) derived promoter; a sequence encoding a hammerhead ribozyme; a sequence encoding a guide RNA specific to the nucleotide sequence of a target gene; and a guide RNA expression cassette operably linked to a Flowering locus T-coding sequence or a tRNA-Met-coding sequence.

[0026] In the present invention, the term "recombinant" refers to a cell that replicates a heterogeneous nucleic acid, expresses said nucleic acid, or expresses a protein encoded by a peptide, a heterogeneous peptide, or a heterogeneous nucleic acid. A recombinant cell may express a gene or gene fragment not found in the natural form of said cell in either a sense or antisense form. Additionally, a recombinant cell may express a gene found in a cell in its natural state, provided that said gene is modified and reintroduced into the cell by artificial means.

[0027] Additionally, the term "vector" is used to refer to DNA fragment(s) or nucleic acid molecules delivered into a cell. Vectors replicate DNA and can be reproduced independently within the host cell. The term "carrier" is commonly used interchangeably with "vector."

[0028] In the recombinant vector according to the present invention, the PEBV-derived promoter may be composed of the nucleotide sequence of SEQ ID NO. 1, the hammerhead ribozyme coding sequence may be composed of the nucleotide sequence of SEQ ID NO. 2, the Flowering locus T coding sequence may be composed of the nucleotide sequence of SEQ ID NO. 3, and the tRNA-Met is a methionine transfer RNA, and the tRNA-Met coding sequence according to the present invention may be composed of the nucleotide sequence of SEQ ID NO. 33, but is not limited thereto.

[0029] In the present invention, the term "operably linked" refers to a state in which one nucleic acid fragment is combined with another nucleic acid fragment so that its function or expression is influenced by the other nucleic acid fragment. That is, it means that a sequence encoding a guide RNA specific to the base sequence of the hammerhead ribozyme and the target gene, a Flowering locus T-coding sequence, or a tRNA-Met-coding sequence are linked so that their expression can be regulated by a PEBV-derived promoter.

[0030] Tobacco rattle virus (TRV) is a bipartite positive-strand RNA virus consisting of TRV1 and TRV2 genomes. To use TRV as a vector, pTRV1 and pTRV2 must be modified to include key elements such as movement proteins, coat proteins, and RdRp (RNA-dependent RNA polymerase) so that they can spread throughout the plant body.

[0031] The TRV2 recombinant vector according to the present invention refers to a TRV2 genome-based vector.

[0032] Plant virus-based vectors are a useful system for the effective expression of targeted foreign proteins in plants, and can provide rapid and transient expression of foreign genes in plants.

[0033] In the recombinant vector of the present invention, the guide RNA expression cassette has a promoter sequence attached to the 5' of the guide RNA, and a hammerhead ribozyme sequence having self-cleavage activity is attached to prevent the gene editing efficiency from being inhibited. In order to increase the mobility of the guide RNA from the leaves of the pepper plant to the shoot apical meristem, the sequence of the RNA mobility-conferging factor FT (Flowering locus T) gene or the tRNA-Met coding sequence is added to the 3' of the guide RNA to improve the gene editing efficiency in the pepper plant and enable systemic correction.

[0034] In the present invention, the term “expression cassette” comprises the following three main elements: i) a promoter; ii) a second polynucleotide which may be referred to as a “coding polynucleotide” or “coding sequence” (also called a coding gene) which is operably linked to said promoter and whose transcription is directed by said promoter when said expression cassette is introduced into a cell; and iii) a terminator polynucleotide (also called a transcription termination factor) which directs the termination of transcription and is located immediately below said second polynucleotide.

[0035] The recombinant vector of the present invention may include a terminator at the bottom of a guide RNA expression cassette. The terminator may be a conventional terminator, examples of which include nophalin synthase (NOS), rice α-amylase RAmy1 A terminator, phaseoline terminator, and the terminator of the octopine gene of Agrobacterium tumefaciens, but are not limited thereto.

[0036] In this invention, the term "genome / gene editing" refers to a technology capable of introducing targeted mutations into the genomic base sequences of animal and plant cells, including human cells, and capable of knocking out or knocking in specific genes through deletion, insertion, or substitution of nucleic acid molecules by DNA cutting, or introducing mutations into non-coding DNA sequences that do not produce proteins.

[0037] For the purposes of the present invention, the gene editing may, in particular, introduce a mutation into a plant using an endonuclease, such as Cas9 (CRISPR associated protein 9) protein and guide RNA.

[0038] In addition, the term "target gene" refers to a portion of DNA within the genome of a plant to be corrected through the present invention, and may include both coding and non-coding regions. A person skilled in the art may select a target gene for a gene-edited plant to be manufactured, depending on the purpose.

[0039] In addition, the term "guide RNA" refers to a short single-stranded RNA that includes RNA specific to the target DNA among the base sequences encoding the target gene, and is a ribonucleic acid that binds wholly or partially complementarily to the target DNA base sequence to guide an endonuclease protein to the corresponding target DNA base sequence. The guide RNA refers to a dual RNA comprising two RNAs, namely crRNA (CRISPR RNA) and tracrRNA (trans-activating crRNA), as components; or a single-stranded guide RNA (sgRNA) form comprising a first region containing a sequence wholly or partially complementary to the base sequence within the target gene and a second region containing a sequence that interacts with the endonuclease (particularly, RNA-guide nuclease). However, any form capable of having activity at the target base sequence may be included within the scope of the present invention without limitation, and may be manufactured and used according to known techniques in the art, taking into account the type of endonuclease used together or the microorganism from which the endonuclease originates.

[0040] The present invention also provides a gene editing method for a chili pepper plant, comprising the step of transforming a chili pepper plant overexpressing Cas9 (CRISPR associated protein 9) with the TRV2 (Tobacco rattle virus 2) recombinant vector.

[0041] A Cas9-overexpressing pepper plant according to one embodiment of the present invention is a pepper plant developed by Toolgen Inc., which is transformed with a recombinant vector (Fig. 1) comprising a CaMV 35S promoter; a plant codon-optimized Cas9 protein-coding sequence; a 2A peptide-coding sequence; a fluorescent protein-coding sequence and a CaMV 35S terminator; and is a pepper plant that simultaneously expresses not only Cas9 but also a fluorescent protein (GFP), characterized by improved screening efficiency of gene-edited plants using fluorescent protein expression (Korean Patent Publication No. 10-2024-0103104).

[0042] The gene editing method according to the present invention may additionally transform a recombinant vector comprising a TRV1 (Tobacco rattle virus 1) recombinant vector and a viral suppressor of RNA silencing coding sequence in addition to the TRV2 recombinant vector, but is not limited thereto.

[0043] According to one embodiment of the present invention, the RNA silencing inhibitor protein may be the P19 protein of TBSV (tomato bushy stunt virus), preferably composed of the amino acid sequence of SEQ ID NO. 4, but is not limited thereto.

[0044] In addition, in a gene editing method according to one embodiment of the present invention, the transformation may be an Agrobacterium tumefaciens strain-mediated transformation, but is not limited thereto.

[0045] In addition, in a gene editing method according to one embodiment of the present invention, the transformed pepper plant may preferably be grown at 18 to 22°C and more preferably at 20°C, but is not limited thereto.

[0046] The present invention also provides a method for producing a gene-edited pepper plant, comprising: (a) transforming a pepper plant expressing Cas9 (CRISPR associated protein 9) with the TRV2 (Tobacco rattle virus 2) recombinant vector; and (b) regenerating a pepper plant from the transformed pepper plant cell.

[0047] In the manufacturing method of the present invention, any method known in the art may be used for regenerating a pepper plant from a transformed pepper plant cell. Techniques for regenerating a mature plant from callus or protoplast culture are known in the art for numerous different species.

[0048] The present invention also provides a gene-edited pepper plant produced by the above method and a seed with the same in which the gene is edited.

[0049] The present invention also provides a composition for gene editing of pepper plants comprising, as an active ingredient, a TRV2 (Tobacco rattle virus 2) recombinant vector comprising a PEBV (Pea early browning virus) derived promoter; a sequence encoding a hammerhead ribozyme; a sequence encoding a guide RNA specific to the nucleotide sequence of a target gene; and a Flowering locus T-coding sequence or a tRNA-Met-coding sequence operably linked to a guide RNA expression cassette.

[0050] The composition according to the present invention contains a TRV2-based recombinant vector as an active ingredient that can specifically increase the gene editing efficiency of a chili pepper plant, so that when the composition is applied to a chili pepper plant overexpressing Cas9, a chili pepper plant with a target gene edited can be effectively produced.

[0051]

[0052] The present invention will be explained in detail below through examples. However, the following examples are merely illustrative of the present invention, and the scope of the present invention is not limited to the following examples.

[0053]

[0054] Materials and Methods

[0055] Production of Cas9 overexpressing chili peppers

[0056] A pepper Cas9 overexpression vector was constructed by introducing the pECO301 vector via infusion cloning after PCR sequence amplification using primers containing an E2A coding sequence between the carboxy terminal of plant codon-optimized Cas9 (expression regulated by the 35S promoter) and the eGFP sequence (35SP-pCas9+E2A+eGFP-35ST, Fig. 1), which co-expresses Cas9 and GFP. The kanamycin gene from the pCambia vector was amplified via PCR and introduced into the aforementioned vector, thereby changing the selected antibiotic of the final vector (pCAM-35SP-pCas9+E2A+eGFP-35ST) to kanamycin. This constructed vector was introduced into the Agrobacterium EHA105 strain and subjected to the pepper transformation process of Toolgen Inc. Cas9 overexpressing T1 pepper (Capsicum annuum 'TG-S #1') was produced (Korean Patent Publication No. 10-2024-0103104).

[0057]

[0058] Plant materials and cultivation conditions

[0059] To perform TRV-mediated gene editing in chili peppers, Cas9-overexpressing chili peppers (Capsicum annuum 'TG-S #1') developed by Toolgen Inc. were used as the material. Chili pepper seeds were disinfected with 10% sodium triphosphate and 1 / 4 bleach and then sown in the soil. They were then cultivated in a chamber at 25°C under a photoperiod of 16 hours light / 8 hours dark.

[0060]

[0061] Confirmation of transformation via PCR and green fluorescent protein signal

[0062] PCR was performed using Cas9 amplification primers to confirm Cas9 transformation (Table 1). In addition, the green fluorescent protein signal present in the vector used to prepare the Cas9 transformant was confirmed using a confocal laser scanning microscope (SP8X, Leica, Germany).

[0063] List of primers used in the present invention Primer Sequence Information (5'→3') (Sequence No.) Purpose pBIN-pCas9#2-FTTCGATAAGAACCTTCCAAA (6)Cas9 amplification pBIN-pCas9#2-RTTGAGCCTTTCTTCAATCAT (7)TG_S_Cas9_qRT_FGTACGTGACCGAGGGAATGA (8)Cas9 expression confirmation TG_S_Cas9_qRT_RCACGGTCACCTTTCTGTTGG (9)CaPDS-sgRNA-MfeI-FCGAGCAATTGAATAACAATCTCCAGTGGTTGTTTTAGAGCTAGAAATA (10)TRV2-CaPDS-sgRNA construction sgRNA-XmaI-RCATGCCCGGGAATTCTGAGGAGAAGAG (11)PEBV-Pst1-FGCTACTGCAGGCAAGAACAG (12)PEBV-Bbs1-HF-RGCATGAAGACCCTATTCTCGTTAACTCGGGTA (13)CaPDS-sgRNA-Bbs1-HF-FGCTAGAAGACCTAATAACAATCTCCAGTGGTT (14)CaPDS-sgRNA-RCGACCCCGGGAAAAAAAGCACCGACTCGGTGC (15)PEBV-Bbs1-HF-RGCATGAAGACCCTATTCTCGTTAACTCGGGTA (16)CaPDS-HH-sgRNA.F1CGATCAATTGGTTATTCTGATGAGTCCGGTGAGGACGA (17)CaPDS-HH-sgRNA.F2AGTCCGTGAGGACGAAACGAGTAAGCTCGTCAATAACAAATTCTCAGTG (18)CaPDS-HH-sgRNA.F3AATAACAATCTCCAGTGGTTGTTTTAGAGCTAGAAATAGC (19)sgRNA-Bbs1-RGCATGAAGACCCACTAGCACCGACTCGGTGC (20)mFT-Bbs1-FGCTAGAAGACCTTAGTCTATAAATATAAGAGACCC (21)mFT-Xma1-RCGACCCCGGGAAAAAAATTGGCCATAAGTAACCT (22)sgRNA-tRNA-Ile-R.1CAACGCTCTAACCAACTGAGCTACGGGAGCGCACCGACTCGGTGC (27)sgRNA-tRNA-Ile-R.2CTCGAACCCGCGACCTTCGGCTCATAAGACCAACGCTCTAACCAA (28)sgRNA-tRNA-Ile-R. (29)sgRNA-tRNA-Met-R.1CCACCACGCTTCCGCTGCGCCACTCTGATGCACCGACTCGGTGC (30)sgRNA-tRNA-Met-R.2TTTCGATCCTGGGACCTGTGGGTTATGGGCCCACCACGCTTCCGC (31)sgRNA-tRNA-Met-R.3CGACCCCGGGAAAAAAATATCAGAGCCAGGTTTCGATCCTGGGAC (32)TRV_seq_FCTGTTTGAGGGAAAAGTAG (23)TRV2 sequence confirmationTRV_seq_RCAAAAGACTTACCGATCAATC (24)CaPDS-sgRNA3-F2AGCTCGAGGTCTTCTTTGGGA (25)CaPDSmutation detectionCaPDS-sgRNA3-R2TAGTGGGATCAATCTTGCACTGG (26)CaPDS_sgRNA3_qRT_FAATAACAATCTCCAGTGGTTGTTT3-GGAGRNAGGG confirmationsgRNA_qRT_RACTCGGTGCCACTTTTTCAAG (35).

[0064]

[0065] TRV-gRNA 벡터 제작 및 접종

[0066] To enable immediate identification of the albino phenotype upon mutation induction, gene editing was performed targeting phytoene desaturase (PDS), a key gene in the carotenoid biosynthesis pathway. To facilitate mutation identification, the 'AACCACTGGAGATTGTTATT' sequence (Sequence No. 5) located in the second exon of the CaPDS gene coding sequence (CA03g36860), which contains a BstXⅠ restriction site preceding the protospacer-adjacent motif (PAM) site, was designated as the target site (Fig. 2C). The CaPDS-gRNA insert sequence was amplified using TRV-CaPDS-gRNA vector primers containing the target sequence, then cleaved with MfeⅠ and XmaⅠ and ligated into the TRV2 vector (Table 1, Fig. 2B). To construct TRV-gRNA with added HH and FT of the PEBV promoter, the PEBV promoter sequence, the gRNA insert containing the HH sequence, and the FT insert were amplified, respectively, and then cleaved into PstⅠ / BbsⅠ-HF, MfeⅠ / BbsⅠ-HF, and BbsⅠ-HF / XmaⅠ, respectively, and ligated into the TRV2 vector (Fig. 2B). To construct TRV2-gRNA vectors containing tRNA-Ile or tRNA-Met instead of FT, the HH-CaPDS-gRNA-tRNA insert was amplified and then ligated into the TRV2 vector using the MfeⅠ and XmaⅠ restriction enzyme cleavage sites (Table 1, Fig. 7A). Subsequently, E. coli DH5α competent cells were transformed, and positive colonies were selected by performing colony PCR using gene amplification primers. TRV2 plasmids were extracted from selected colonies, and their sequences were confirmed by Sanger sequencing using TRV-seq-F / R primers (Table 1).

[0067] The sequenced TRV2-gRNA vectors were transformed into the Agrobacterium GV3101 strain via electroporation and used for inoculation. Cells were collected from the Agrobacterium culture medium containing TRV2-gRNA and resuspended in inoculation buffer (10 mM MES, 10 mM MgCl2, 200 μM acetosyringone, pH 5.6). The OD of the resuspended solution 600 After adjusting the value to 0.6, the mixture was mixed with TRV1 and P19 inoculum in a 1:1:1 ratio and inoculated into 'TG-S #1' peppers with established cotyledons using a 1 ml syringe. After inoculating with TRV2-U6-CaPDS-gRNA, the samples were placed in a 20°C chamber at 4 DPI until tissue culture was performed to test gene editing efficiency. Individuals inoculated with TRV2-CaPDS-gRNA, TRV2-HH-CaPDS-gRNA, TRV2-CaPDS-gRNA-FT, and TRV2-HH-CaPDS-gRNA-FT were also placed in growth chambers at 25°C and 20°C to compare gene editing in the upper leaves.

[0068]

[0069] Gene editing test

[0070] Genomic DNA (gDNA) was extracted from inoculated leaf or shoot samples into 1.5 ml tubes using the cetytrimethylammonium bromide (CTAB) method. The gDNA was adjusted to 100 ng and amplified using primers for the CaPDS gene editing assay (Table 1). Subsequently, the PCR products were purified via a column and treated with BstX I restriction enzyme for at least 5 hours. Band sizes were then analyzed using a 1% agarose gel. Gene editing efficiency was verified by calculating band intensities from gel images using the ImageJ program. Additionally, to identify mutant sequences in the shoots, PCR products amplified using the same primers were purified and Sanger sequencing was performed. Mutant sequences were identified by analyzing the resulting ab1 file using the ICE CRISPR Analysis Tool (https: / / www.synthego.com / products / bioinformatics / crispr-analysis).

[0071]

[0072] pepper regeneration

[0073] Tissue culture was performed using TRV2-CaPDS-gRNA inoculated leaves to obtain gene-edited individuals. After inoculation, inoculated leaves sampled at 4 DPI were disinfected by treating them in 70% (v / v) ethanol for 1 minute, 0.4% (v / v) bleach containing one drop of Tween-20 for 15 minutes, and sterile water containing 1 g / L timentin for 1 hour, followed by washing with water five times. After disinfection, the inoculated leaves were cut using a No. 11 scalpel, and the cut sections were tissue cultured according to the medium composition listed in Table 2. The tissue culture sections were incubated in a chamber with a photoperiod of 16 hours light / 8 hours dark at 25±1℃.

[0074] 고추 조직배양 배지 조성MediaCompositionpHPeriodShoot induction mediaMS including MES buffer, B5 vitamin, 3% Sucrose, 0.4% Phytagel, 3 mg / L BAP, 0.1 mg / L IAA, 2 mg / L AgNO3, 250 mg / L Timentin5.74 weeksElongation mediaMS including MES buffer, B5 vitamin, 2% Sucrose, 0.4% Phytagel, 2 mg / L GA3, 2 mg / L trans zeatin riboside, 2 mg / L AgNO3, 250 mg / L Timentin6-8 weeksRooting media1 / 2 MS including MES buffer, 1 / 2 B5 vitamin, 0.5% Sucrose, 0.8% Microagar, 0.1 mg / L NAA, 2 mg / L AgNO3, 250 mg / L Timentin3-4 weeks

[0075]

[0076] gRNA 발현 분석

[0077] Reverse-transcription quantitative PCR (RT-qPCR) was performed to evaluate gRNA expression in plants inoculated with TRV. Primary strand cDNA synthesis was carried out using 1 μg of total RNA and AccuPower RT PreMix (Bioneer, KR). RT-qPCR was performed using primers specific to CaPDS-gRNA (Table 1, SEQ ID NOs 34 and 35). The reaction was conducted using 2X Real-Time PCR Master Mix (Biofact, KR) according to the manufacturer's protocol. Using a QuantStudio 3 Real-Time PCR instrument (Thermo Fisher Scientific, USA), the PCR amplification conditions were as follows: initial denaturation was performed at 95°C for 15 minutes, followed by a cycle of 95°C for 10 seconds, 58°C for 15 seconds, and 72°C for 15 seconds, repeated a total of 40 times. The relative expression levels of gRNA were normalized using Actin as the reference gene and quantified using the ΔCt method.

[0078]

[0079] Example 1. Confirmation of Cas9 pepper transformation

[0080] To apply TRV-mediated gene editing to chili peppers, Cas9 transgenic chili peppers were obtained from Toolgen Inc. (Fig. 3A). To confirm the transformation of the plants, gDNA was extracted from each individual in the T1 generation and Cas9 was amplified (Fig. 3B). As a result, isolation occurred, and positive bands were observed in only 6 out of 10 individuals. Cas9 expression was reconfirmed via RT-PCR (Fig. 3C), and to confirm the expression of green fluorescent protein (GFVI) co-inserted into the Cas9 vector, the GFVI signal was examined using a confocal laser scanning microscope. Unlike the wild type (WT), a clear GFVI signal was observed in the 'TG-S #1' individual (Fig. 3D). Subsequently, homozygous lines were selected in the T2 generation after confirming Cas9 transformation via PCR amplification (Fig. 4A), and Cas9 homozygous T3 individuals were then used for TRV-gRNA inoculation experiments (Fig. 4B).

[0081]

[0082] Example 2. Confirmation of gene editing by TRV-CaPDS-gRNA inoculation

[0083] TRV2-U6-CaPDS-gRNA targeting CaPDS was inoculated into Cas9-overexpressing pepper cotyledons along with TRV1 and P19. After extracting gRNA from the inoculated leaves at 10 DPI, gene editing was performed through PCR amplification and treatment with BstX I restriction enzyme (Fig. 5A). As a result of analysis using Image J, an average gene editing efficiency of 56.2% was confirmed in the inoculated leaves.

[0084]

[0085] Example 3. Obtaining Gene-Edited Individuals Through Redifferentiation

[0086] Tissue culture was performed using TRV2-U6-CaPDS-gRNA inoculated leaves to obtain gene-edited individuals. During the redifferentiation process, shoots exhibiting an albino phenotype appeared due to double-allele mutations (Fig. 5B). Redifferentiation was carried out on the inoculated individuals, and 33 out of a total of 220 shoots (15.0%) were identified as gene-edited individuals. When the target site sequences of the CaPDS gene in the obtained mutant shoots were analyzed, various deletions were observed 3 bp away from the PAM site cleaved by Cas9 (Fig. 5C). When the phenotypes of offspring were observed after advancing generations in 1-1 E0 individuals with 3 bp and 8 bp deletions, individuals with the 3 bp deletion allele, where no frameshift occurred, exhibited a yellowish-green phenotype, while individuals with only the 8 bp deletion allele exhibited an albino phenotype (Fig. 5D).

[0087]

[0088] Example 4. Enhancement of Gene Editing Efficiency through gRNA Modification and Low-Temperature Cultivation

[0089] We aimed to increase gene editing efficiency through gRNA modification. In addition to replacing the plant-derived U6-26 promoter with the Pea early browning virus (PEBV) promoter, we inserted an HH sequence between the PEBV promoter and CaPDS-gRNA to create a complete gRNA sequence, or attached a mobile FT sequence to the 3' end of the gRNA to increase gene editing efficiency in the upper leaves and subsequent generations using mobile gRNA (Fig. 2B). Furthermore, we cultivated inoculated individuals at a low temperature of 20°C to enhance viral persistence and maintain gene editing for a longer period. The TRV2-CaPDS-gRNA, TRV2-HH-CaPDS-gRNA, TRV2-CaPDS-gRNA-FT, and TRV2-HH-CaPDS-gRNA-FT vectors were inoculated into Cas9-overexpressing peppers along with TRV1 and P19, respectively. Albino phenotypes began to be observed in the upper leaves of TRV2-CaPDS-gRNA-FT and TRV2-HH-CaPDS-gRNA-FT inoculated individuals around 14 DPI after inoculation. After the first branching of the peppers, the albino phenotype was maintained in individuals grown at 20°C among those inoculated with TRV2-CaPDS-gRNA-FT and TRV2-HH-CaPDS-gRNA-FT (Fig. 6A). When checking the gene editing rate, individuals grown at 20°C also showed high editing efficiency, while individuals inoculated with TRV2-HH-CaPDS-gRNA-FT showed an efficiency of 36.3% (Fig. 6B). When examining gRNA expression under each vector and temperature condition, high gRNA expression levels were also confirmed in individuals grown at 20°C (Fig. 6C). Gene editing was confirmed up to the flowers of TRV2-HH-CaPDS-gRNA-FT inoculated individuals grown at 20°C through the vector modification and low-temperature cultivation as described above (Fig. 6D).

[0090]

[0091] Example 5. Comparison of gene editing efficiency of gRNAs with various motility factors in upper lobes

[0092] In addition to FT, tRNAs have been reported to confer mobility to gRNAs and enhance editing efficiency in the VIGE system (Ellison et al., 2020, Nature Plants, 6(6):620-624). Among various tRNAs, tRNA-Met and tRNA-Ile were found to exhibit the highest genetic editing efficiency in tobacco. These tRNAs were added to the TRV2-gRNA vector, and their editing efficiency was compared with that of TRV2-HH-CaPDS-gRNA-FT (Fig. 7A). Similar to TRV2-HH-CaPDS-gRNA-FT, an albino phenotype was observed in the upper leaves of plants inoculated with TRV2-HH-CaPDS-gRNA-tRNA-Ile and TRV2-HH-CaPDS-gRNA-tRNA-Met (Fig. 7B). Vectors containing FT, tRNA-Ile, or tRNA-Met exhibited higher editing efficiency compared to the unmodified vector in the inoculated leaves and upper leaves below the first branch. However, when evaluating editing efficiency in the uppermost leaves above the first branch, FT and tRNA-Met showed higher editing efficiency than tRNA-Ile, and no significant difference was observed between FT and tRNA-Met (Fig. 7C). Additionally, gRNA expression levels in the uppermost leaves remained high only in plants inoculated with vectors containing FT or tRNA-Met (Fig. 7D). These results demonstrate that tRNA can enhance systemic editing efficiency in peppers and suggest that tRNA-Met is as effective as FT in achieving high editing efficiency.

[0093]

[0094] Example 6. Acquisition of edited offspring in subsequent generations via TRV-mediated gene editing

[0095] To obtain edited plants without tissue culture in the next generation, fruits were harvested from plants inoculated with TRV2-HH-CaPDS-gRNA-FT. A striped albino phenotype was observed on the fruit stalks and peel of the harvested fruits (Fig. 8A). When 181 E1 plants obtained from plants grown at 25°C after inoculation with TRV2-HH-CaPDS-gRNA-FT were analyzed, no mutations were found. However, when E1 plants obtained from 3 E0 plants grown at 20°C were analyzed, 5.8% (5 out of 59 total) were identified as mutants. Of these, 3.4% (2 out of 59 total) were identified as homozygous mutants exhibiting an albino phenotype (Fig. 8B). It was confirmed that these mutants contained a 1 bp insertion (Fig. 8C).

Claims

1. A TRV2 (Tobacco rattle virus 2) recombinant vector for gene editing in pepper plants, comprising a guide RNA expression cassette operably linked to a PEBV (Pea early browning virus) derived promoter; a sequence encoding a hammerhead ribozyme; a sequence encoding a guide RNA specific to the nucleotide sequence of a target gene; and a Flowering locus T-coding sequence or a tRNA-Met-coding sequence.

2. A TRV2 recombinant vector for gene editing of a pepper plant according to claim 1, characterized in that the PEBV-derived promoter is composed of the nucleotide sequence of SEQ ID NO. 1, the hammerhead ribozyme coding sequence is composed of the nucleotide sequence of SEQ ID NO. 2, the Flowering locus T coding sequence is composed of the nucleotide sequence of SEQ ID NO. 3, and the tRNA-Met coding sequence is composed of the nucleotide sequence of SEQ ID NO.

33.

3. A gene editing method for a chili pepper plant comprising the step of transforming a chili pepper plant expressing Cas9 (CRISPR associated protein 9) with the TRV2 (Tobacco rattle virus 2) recombinant vector of claim 1.

4. A gene editing method for a chili pepper plant according to claim 3, characterized by additionally transforming a recombinant vector comprising a TRV1 (Tobacco rattle virus 1) recombinant vector and a viral suppressor of RNA silencing coding sequence in addition to the TRV2 recombinant vector.

5. A gene editing method for a chili pepper plant according to claim 4, characterized in that the RNA silencing inhibitory protein is the P19 protein.

6. A method for gene editing a chili pepper plant according to claim 5, characterized in that the P19 protein is composed of the amino acid sequence of SEQ ID NO.

4.

7. (a) transforming a Cas9 (CRISPR associated protein 9) overexpressing pepper plant with the TRV2 (Tobacco rattle virus 2) recombinant vector of claim 1; and (b) a step of regenerating a pepper plant from the transformed pepper plant cell; comprising a method for producing a gene-edited pepper plant.

8. Genetically edited pepper plant produced by the method of paragraph 7.

9. Genetically edited seeds of a chili pepper plant according to Paragraph 8.

10. A composition for gene editing of pepper plants comprising, as an active ingredient, a TRV2 (Tobacco rattle virus 2) recombinant vector comprising a guide RNA expression cassette operably linked to a promoter derived from PEBV (Pea early browning virus); a sequence encoding a hammerhead ribozyme; a sequence encoding a guide RNA specific to the nucleotide sequence of a target gene; and a Flowering locus T-coding sequence or a tRNA-Met-coding sequence.