Aromatic compound, pharmaceutical composition, and use thereof
By developing aromatic compounds with specific structures to inhibit DNA polymerase theta (Polθ), the problem of abnormal DNA damage repair pathways in tumor cells has been solved, enabling effective treatment of HRD or DDR-deficient tumors and enhancing the effects of chemotherapy and radiotherapy.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2024-12-16
- Publication Date
- 2026-06-25
Smart Images

Figure CN2024139710_25062026_PF_FP_ABST
Abstract
Description
An aromatic compound, a pharmaceutical composition and its application Technical Field
[0001] This invention relates to the field of pharmaceutical chemistry, specifically to an aromatic compound, a pharmaceutical composition, and its application. Background Technology
[0002] DNA damage and its repair play a crucial role in cancer treatment. Cells may suffer DNA damage when subjected to exogenous and endogenous stress. Tumor cells, due to their rapid proliferation, are more sensitive to DNA damage, especially when they lack functional DNA repair pathways. This sensitivity is also a key mechanism by which many anti-tumor drugs exert their effects, such as common chemotherapy drugs like cisplatin and 5-FU, and targeted cancer drugs like olaparib and niraparib.
[0003] Double-strand breaks (DSBs) are among the most serious types of DNA damage. Unrepaired DSBs can disrupt cellular functions such as transcription and replication, posing a serious threat to genome stability and cell survival. DSBs can be repaired through three main pathways: homologous recombination (HR), non-homologous end joining (NHEJ), and microhomologous end joining (MMEJ or TMEJ). HR primarily occurs in the G1 / S phase, relying on nucleases to excise DNA ends and generate a long single-stranded DNA template; it is a high-fidelity repair method. NHEJ occurs at various stages of the cell cycle, with the highest efficiency in the G2 / M phase. It does not require a DNA template and directly performs end joining; therefore, it is an error-prone repair method. MMEJ mainly functions in the M phase and requires 2-6 bp of microhomologous sequences; therefore, it is also an error-prone repair method.
[0004] DNA polymerase theta (Polθ) is a key protein in the MMEJ repair pathway. It is a multifunctional polymerase belonging to the DNA polymerase A family, composed of an N-terminal helicase domain, a C-terminal polymerase domain, and a central linker region. The polymerase domain can perform various DNA strand elongations, including cis-elongation, trans-elongation, and cross-damage synthesis, making it an essential functional domain for DNA strand elongation in the MMEJ repair pathway. The helicase domain competitively binds to damaged DNA with RAD51, thus inhibiting homologous recombination repair. Studies have found that the central linker region is related to substrate specificity.
[0005] Polθ is almost unexpressed or poorly expressed in normal tissues, and MMEJ is considered an alternative pathway for DSB repair. However, when HR or NHEJ are deficient, cells become highly dependent on the MMEJ pathway. A recent study found that knockout of up to 140 genes involved in DNA damage response pathways (DDR) increases cellular dependence on Polθ. Furthermore, Polθ is significantly overexpressed in 17 types of tumors, including esophageal cancer, cervical cancer, breast cancer, advanced serous ovarian cancer, and lung cancer, and is associated with poor prognosis in many cancers. Ovarian cancer, breast cancer, pancreatic cancer, prostate cancer, esophageal cancer, and lung cancer also have the highest incidence of homologous recombination deficiency (HRD), suggesting that Polθ may be a specific target for HRD or other DDR gene-deficient tumors.
[0006] Previous studies have also found that Polθ inhibition or knockout has synergistic anti-tumor effects with various drugs. For example, it has a synergistic effect with PARP inhibitors in HRD tumors, and with DNA-PK inhibitors in TP53-mutant tumors. In addition, in pancreatic cancer, Polθ inhibition can activate the immune system through the cGAS-STING pathway; in lung cancer, Polθ inhibition can also increase the sensitivity of lung cancer cells to radiotherapy.
[0007] In summary, Polθ's high selectivity in both normal and tumor tissues makes its inhibitors highly promising for use as monotherapy or in combination with other DDR inhibitors in tumors with high HRD or DDR deficiency, such as breast cancer, ovarian cancer, pancreatic cancer, prostate cancer, esophageal cancer, and lung cancer, as well as for enhancing the efficacy of radiotherapy, chemotherapy, and immunotherapy. Summary of the Invention
[0008] The purpose of this invention is to overcome the shortcomings of the prior art and provide an aromatic compound, a pharmaceutical composition and its application.
[0009] In a first aspect, the present invention provides a compound having the structure shown in Formula I, or an enantiomer, diastereomer, racemate, tautomer, stereoisomer, geometric isomer, nitride, deuterated product, metabolite, or pharmaceutically acceptable salt, ester, solvate, hydrate, isotopically labeled compound, or prodrug thereof.
[0010] Where A is selected from:
[0011] R a R b R c R e Each is independently selected from -LBE, R d Selected from hydrogen, deuterium, alkyl, cycloalkyl, heteroalkyl, -OR 15The alkyl, cycloalkyl, or heteroalkyl groups are each optionally and independently substituted by one or more substituents R'.
[0012] L is selected from single bond, alkylene, cycloalkylene, spirocycloalkylene, bridged cycloalkylene, heterocycloalkylene, -C(=O)- or any combination thereof, wherein each of the alkylene, cycloalkylene, spirocycloalkylene, bridged cycloalkylene, and heterocycloalkylene is independently and optionally substituted by one or more substituents R';
[0013] B is selected from single bond, alkylene, cycloalkylene, spirocyclic, bridged cycloalkyl, heterocyclic, cycloalkenyl, -NR 13 -、-C(=O)NR 13 -, -O-, -C(=O)-, -S-, -S(=O)2-, -S(=O)-, -C(=O)- or any combination thereof, wherein the alkylene, cycloalkylene, spirocycloalkylene, bridged cycloalkylene, heterocycloalkylene, and cycloalkenylene are each optionally and independently replaced by one or more substituents R'.
[0014] E is selected from hydrogen, alkyl, alkylsilyl, cycloalkyl, spirocyclic, bridged cyclic, heterocyclic, alkenyl, cycloalkenyl, aryl, heteroaryl, ureyl, amino, cyano, -NR 13 R 14 -C(=O)NR 13 R 14 -OR 15 -C(=O)R 16 -C(=O)OR 16 -R 17 C(=O)OR 16 -SR 18 -S(=O)R 19 -S(=O)2R 19 -C(=O)(CH2) p C(=O)OR 16 -C(=O)(CH2OCH2) p C(=O)OR 16 -B(OH)2, wherein the alkyl, alkylsilyl, cycloalkyl, spirocyclic, bridged cyclic, heterocyclic, alkenyl, cycloalkenyl, aryl, heteroaryl, ureyl, amino, and cyano groups are each independently and optionally substituted by one or more substituents R'.
[0015] R 13 and R 14 Each group is independently selected from hydrogen, hydroxyl, alkyl, alkoxy, cycloalkyl, heterocyclic, cycloalkenyl, ureido, and -C(=O)R. 16 -C(=O)OR 16 -R 17 C(=O)OR 16-S(=O)2R 19 -C(=O)NR 22 R 23 The alkyl, alkoxy, cycloalkyl, heterocyclic, and cycloalkenyl groups are each optionally and independently substituted by one or more substituents R'.
[0016] R 15 The group is selected from hydrogen, alkyl, cycloalkyl, aryl, heteroaryl, alkenyl, and heterocyclic groups, wherein the alkyl, aryl, heteroaryl, alkenyl, and heterocyclic groups are optionally substituted by one or more substituents R';
[0017] R 16 Selected from hydrogen, alkyl, cycloalkyl, heterocyclic, aryl, heteroaryl, alkenyl, -NR 22 R 23 The alkyl, cycloalkyl, heterocyclic, heteroaryl, and alkenyl groups are each optionally and independently substituted by one or more substituents R'.
[0018] R 17 Selected from hydrogen and alkylene groups; the alkylene group is optionally substituted with one or more substituents R';
[0019] R 18 Selected from hydrogen, alkyl, cyano, aryl, heteroaryl, -C(=O)R 16 -C(=O)OR 16 The alkyl, cyano, aryl, and heteroaryl groups are each optionally and independently substituted by one or more substituents R'.
[0020] R 19 Selected from hydrogen, alkyl, cycloalkyl, aryl, heteroaryl, -NR 22 R 23 The alkyl, cycloalkyl, aryl, and heteroaryl groups are optionally substituted by one or more substituents R';
[0021] R 22 R 23 Each is independently selected from hydrogen, alkyl, ureyl, aryl, and heteroaryl, wherein the alkyl, ureyl, aryl, and heteroaryl groups are optionally substituted by one or more substituents R';
[0022] R 1 R 2 R 3 R 4 R 5 R 6 R 7 R 8 R 9 R 10 R 11Each of the following is independently selected from hydrogen, deuterium, halogen, amino, hydroxyl, mercapto, alkyl, cycloalkyl, aryl, heteroaryl, heterocyclic, and heteroalkyl, wherein each of the alkyl, cycloalkyl, aryl, heteroaryl, heterocyclic, and heteroalkyl groups is optionally independently substituted by one or more substituents R'.
[0023] Optional, R 1 and R 5 A cycloalkyl, heterocyclic, aryl, or heteroaryl group is formed by linking at any adjacent position, wherein each of the cycloalkyl, heterocyclic, aryl, or heteroaryl group is optionally and independently substituted by one or more substituents R'.
[0024] Optional, R 7 and R 8 A cycloalkyl, heterocyclic, aryl, or heteroaryl group is formed by linking at any adjacent position, wherein each of the cycloalkyl, heterocyclic, aryl, or heteroaryl group is optionally and independently substituted by one or more substituents R'.
[0025] R' is selected from deuterium, halogen, hydroxyl, C1-C10 alkyl, C3-C10 cycloalkyl, and one or more substituted C1-C10 alkyl, C1-C10 alkoxy, amino, C1-C10 alkylamino, carboxyl, C1-C10 alkylcarboxyl, C2-C10 heterocyclic, C6-C10 aryl, C1-C10 heteroaryl, and hydroxyl, halogen, cyano, amino, carboxyl, amide, and oxo groups. One or more substituted C2-C10 heterocyclic groups selected from C1-C10 alkyl and C1-C10 alkoxy groups; one or more substituted C6-C10 aryl groups selected from hydroxyl, halogen, cyano, amino, carboxyl, amide, oxo, C1-C10 alkyl and C1-C10 alkoxy groups; and one or more substituted C1-C10 heteroaryl and oxo groups selected from hydroxyl, halogen, cyano, amino, carboxyl, amide, oxo, C1-C10 alkyl and C1-C10 alkoxy groups.
[0026] Z is selected from single bond, -(CH2) n -, -NH-, -NHC(=O)-, -OP(=O)-, -OP(=O)O-, -P(=O)-, -P(=O)2-, -O-, -S-, -S(=O)-, -S(=O)2-, -Se- and any combination thereof; preferably single bonds, -(CH2) n -、-NH-、-O-;
[0027] X and Y are each independently selected from C and C, respectively. 12 C (=O), N; R 12The group is selected from hydrogen, deuterium, halogen, amino, hydroxyl, mercapto, alkyl, cycloalkyl, aryl, heteroaryl, heterocyclic, and heteroalkyl, wherein each of the alkyl, cycloalkyl, aryl, heteroaryl, heterocyclic, and heteroalkyl groups is optionally and independently substituted by one or more substituents R'.
[0028] W is selected from -O-, -S-, -NR 24 -、-CR 20 R 21 -、-C(=O)-,R 20 R 21 and R 24 Each is independently selected from hydrogen, deuterium, and alkyl groups.
[0029] U is selected from O and S; preferably O;
[0030] m and p are each independently selected from integers from 0 to 10, preferably integers from 0 to 5;
[0031] n is an integer between 1 and 5.
[0032] In a second aspect, the present invention provides a pharmaceutical composition comprising the compound described in the first aspect of the present invention or its enantiomers, diastereomers, racemates, tautomers, stereoisomers, geometric isomers, nitrides, deuterated products, metabolites or pharmaceutically acceptable salts, esters, solvates, hydrates, isotopically labeled compounds or prodrugs or thereof, and pharmaceutically acceptable excipients.
[0033] Thirdly, the present invention provides the use of the compound described in the first aspect or its enantiomers, diastereomers, racemates, tautomers, stereoisomers, geometric isomers, nitrides, deuterated products, metabolites or pharmaceutically acceptable salts, esters, solvates, hydrates, isotopically labeled compounds or prodrugs or the pharmaceutical composition described in the second aspect in the preparation of a drug for inhibiting Polθ overexpression or an antitumor drug.
[0034] Preferably, the tumor includes one or more of breast cancer, ovarian cancer, pancreatic cancer, prostate cancer, esophageal cancer, and lung cancer.
[0035] Compared with the prior art, the present invention has the following beneficial effects:
[0036] The compounds of this invention have strong Polθ inhibitory activity and can be used as monotherapy or in combination therapy for tumors with high incidence of homologous recombination defect (HRD) or DNA damage response (DDR). Detailed Implementation
[0037] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. The specific embodiments described herein are for illustrative purposes only and are not intended to limit the scope of the invention in any way.
[0038] The endpoints and any values of the ranges disclosed herein are not limited to the precise ranges or values, and these ranges or values should be understood to include values close to these ranges or values. For numerical ranges, the endpoint values of the various ranges, the endpoint values of the various ranges and individual point values, and individual point values can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.
[0039] Unless otherwise defined, the technical terms used in the following embodiments have the same meaning as commonly understood by those skilled in the art. Unless otherwise specified, the reagents used in the following embodiments are conventional biochemical reagents; the raw materials, instruments, and equipment used in the following embodiments can all be obtained commercially or by existing methods; unless otherwise specified, the reagent dosages are those used in routine experimental operations; unless otherwise specified, the experimental methods are conventional methods.
[0040] Definitions and general terms
[0041] Unless otherwise stated, the terms used in the specification and claims of this invention have the following definitions.
[0042] Certain embodiments of the invention will now be described in detail, examples of which are illustrated by the accompanying structural and chemical formulas. The invention is intended to cover all alternatives, modifications, and equivalents, all of which are included within the scope of the invention as defined in the claims. Those skilled in the art will recognize that many similar or equivalent methods and materials can be used to practice the invention. The invention is by no means limited to the methods and materials described herein. In the event that one or more of the incorporated documents, patents, and similar materials differ from or contradict this application (including, but not limited to, defined terminology, application of terminology, described techniques, etc.), this application shall prevail.
[0043] It should be further appreciated that certain features of the invention, for clarity, have been described in multiple independent embodiments, but may also be provided in combination in a single embodiment. Conversely, various features of the invention, for brevity, have been described in a single embodiment, but may also be provided individually or in any suitable sub-combination.
[0044] Unless otherwise stated, all technical terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art. All patents and publications related to this invention are incorporated herein by reference in their entirety.
[0045] Unless otherwise stated or there is a clear conflict in the context, the articles “a,” “an,” and “described” as used herein are intended to include “at least one” or “one or more.” Therefore, these articles as used herein refer to articles for one or more (i.e., at least one) objects. For example, “a component” refers to one or more components, meaning that more than one component may be considered for use or adoption in the implementation of the described embodiments.
[0046] The term "comprising" is an open-ended expression, meaning it includes the contents specified in this invention, but does not exclude other aspects.
[0047] "Stereoisomers" are compounds that have the same chemical structure but whose atoms or groups are arranged differently in space. Stereoisomers include enantiomers, diastereomers, conformational isomers (rotational isomers), geometric isomers (cis / trans) isomers, and hindered isomers, etc.
[0048] A diastereomer is a stereoisomer that has two or more chiral centers and whose molecules are not mirror images of each other. Diastereomers have different physical properties, such as melting point, boiling point, spectral properties, and reactivity. Mixtures of diastereomers can be separated by high-resolution analytical procedures such as electrophoresis and chromatography, for example, HPLC.
[0049] Many organic compounds exist in an optically active form, meaning they possess the ability to rotate the plane of plane-polarized light. In describing optically active compounds, the prefixes D and L or R and S are used to indicate the absolute configuration of the molecule with respect to one or more of its chiral centers. The prefixes d and l or (+) and (-) are symbols used to specify the plane-polarized light rotation caused by the compound, where (-) or l indicates that the compound is levorotatory. Compounds with the prefix (+) or d are dextrorotatory. A specific stereoisomer is an enantiomer, and a mixture of such isomers is called an enantiomeric mixture. A 50:50 mixture of enantiomers is called a racemic mixture or racemate, which can occur when there is no stereoselectivity or stereospecificity in the chemical reaction or process.
[0050] Any asymmetric atom (e.g., carbon, etc.) in the compounds disclosed in this invention can exist in a racemic or enantiomerically enriched form, such as in (R)-, (S)-, or (R,S)- configurations. In some embodiments, each asymmetric atom has at least 50% enantiomeric excess, at least 60% enantiomeric excess, at least 70% enantiomeric excess, at least 80% enantiomeric excess, at least 90% enantiomeric excess, at least 95% enantiomeric excess, or at least 99% enantiomeric excess in the (R)- or (S)- configuration.
[0051] Depending on the choice of starting materials and methods, the compounds of this invention can exist as one or a mixture of possible isomers, such as racemic mixtures and diastereomeric mixtures (depending on the number of asymmetric carbon atoms). Optically active (R)- or (S)- isomers can be prepared using chiral synthons or chiral reagents, or resolved using conventional techniques. If the compound contains a double bond, the substituents may be E or Z configurations; if the compound contains a disubstituted cycloalkyl group, the cycloalkyl substituents may be cis or trans configurations.
[0052] Any mixture of stereoisomers obtained can be separated into pure or substantially pure geometric isomers, enantiomers, and diastereomers based on differences in the physicochemical properties of the components, for example, by chromatography and / or fractional crystallization.
[0053] Unless otherwise indicated, the structural formulas described in this invention include all isomers (e.g., enantiomers), diastereomers, and geometric isomers (or conformations): for example, R and S configurations containing an asymmetric center, (Z) and (E) isomers of double bonds, and (Z) and (E) conformations. Therefore, any single stereochemical isomer of the compounds of this invention, or its enantiomers, diastereomers, or mixtures of geometric isomers (or conformations) thereof, is within the scope of this invention.
[0054] As used in this invention, the term "prodrug" refers to the conversion of a compound into the compound represented by formula (I) in vivo. Such conversion is influenced by the hydrolysis of the prodrug in the blood or its enzymatic conversion into the parent structure in the blood or tissues. The prodrug compounds of this invention can be esters; in existing inventions, esters that can serve as prodrugs include phenyl esters, aliphatic (C1-24) esters, acyloxymethyl esters, carbonates, carbamates, and amino acid esters. For example, a compound in this invention contains a hydroxyl group, meaning it can be acylated to obtain the prodrug form. Other prodrug forms include phosphate esters, such as those obtained by phosphorylation of a hydroxyl group on the parent compound.
[0055] Racemic derivatives of any resulting end product or intermediate can be separated into optical enantiomers using known methods familiar to those skilled in the art, such as by separating the obtained diastereomeric salts. Racemic products can also be separated by chiral chromatography, such as high-performance liquid chromatography (HPLC) using chiral adsorbents. In particular, enantiomers can be prepared via asymmetric synthesis.
[0056] The terms "tautomer" or "tautomer form" refer to structural isomers with different energies that can interconvert through a low energy barrier. If tautomerism is possible (e.g., in solution), chemical equilibrium can be achieved for the tautomer. For example, proton tautomers (also called prototropic tautomers) involve interconversions via proton migration, such as keto-enol isomerization and imine-enamine isomerization. Valence tautomers involve interconversions via the rearrangement of some bonding electrons. A specific example of a keto-enol tautomer is the interconversion between pentane-2,4-dione and 4-hydroxypent-3-en-2-one. Another example of tautomerism is phenol-keto tautomerism. A specific example of a phenol-keto tautomer is the interconversion between pyridine-4-ol and pyridine-4(1H)-keto. Unless otherwise stated, all tautomer forms of the compounds of this invention are within the scope of this invention.
[0057] The salt mentioned in this invention is a pharmaceutically acceptable salt, and the term "pharmaceutically acceptable salt" is well known in the field. Pharmaceutically acceptable, non-limiting examples of salts include inorganic acid salts formed by reactions with amino groups, such as hydrochlorides, hydrobroms, phosphates, metaphosphates, sulfates, sulfites, nitrates, and perchlorates, and organic acid salts, such as carboxylates, sulfonates, sulfinates, and thiocarboxylates, specifically, but not limited to, methanesulfonates, ethanesulfonates, formates, acetates, succinates, benzoates, succinates, bis(hydroxynaphthyl) salts, salicylates, galactobionates, gluconates, mandelates, 1,2-ethanedisulfonates, 2-naphthalenesulfonates, carbonates, trifluoroacetates, glycolates, hydroxyethylsulfonates, oxalates, maleates, tartrates, citrates, succinates, malonates, benzenesulfonates, p-toluenesulfonates, malates, fumarates, lactates, lactobionates, or oxalic acid, or obtained by other methods described in the literature, such as ion exchange. Other pharmaceutically acceptable salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, cyclopentylpropionate, digluconate, dodecyl sulfate, ethanesulfonate, glucono-heptahydrate, glycerophosphate, gluconate, hemisulfate, heptahydrate, hexanoate, hydroiodate, 2-hydroxy-ethanesulfonate, lacturonate, laurate, lauryl sulfate, nicotinate, nitrate, oleate, palmitate, pyruvate, pectate, persulfate, 3-phenylpropionate, picrate, pentanoate, propionate, stearate, thiocyanate, undecanoate, valerate, etc. Furthermore, pharmaceutically acceptable salts also include those obtained by means of appropriate bases, such as alkali metals, alkaline earth metals, ammonium, and N+(C) salts. 1-4 Salts of alkyl groups (4). This invention also contemplates quaternary ammonium salts formed from any compound containing an N group. Water-soluble or oil-soluble or dispersed products can be obtained by quaternization. Alkali metal or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, etc. Pharmaceutically acceptable salts further include suitable, non-toxic ammonium, quaternary ammonium salts, and amine cations resistant to the formation of equilibrium ions, such as halides, carboxylates, sulfates, phosphates, nitrates, C 1-8 Sulfonates and aromatic sulfonates.
[0058] Medicinal salts can form with inorganic and organic acids, such as acetates, aspartates, benzoates, benzenesulfonates, bromides / hydrobromoates, bicarbonates / carbonates, hydrogen sulfates / sulfates, camphor sulfonates, chlorides / hydrochlorides, theophylline salts, citrates, ethanedisulfonates, fumarates, gluconate, gluconate, glucuronide, hippurate, hydroiodide / iodide, hydroxyethyl sulfonate, lactates, lacturonide, lauryl sulfate, malates, maleates, malonates, mandelates, methanesulfonates, methyl sulfates, naphthates, naphthalenesulfonates, nicotinates, nitrates, stearates, oleates, oxalates, palmitates, pyrates, phosphates / hydrogen phosphates / dihydrogen phosphates, polygalactosates, propions, stearates, succinates, sulfosalicylates, tartrates, toluenesulfonates, and trifluoroacetates.
[0059] Inorganic acids from which salts can be derived include, for example, hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, and phosphoric acid.
[0060] Organic acids from which salts can be derived include, for example, acetic acid, propionic acid, glycolic acid, oxalic acid, maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, sulfosalicylic acid, etc.
[0061] In this invention, "solvent" refers to an association formed by one or more solvent molecules and the compound of this invention. Solvents forming solvates include, but are not limited to, water, isopropanol, ethanol, methanol, dimethyl sulfoxide, ethyl acetate, acetic acid, and aminoethanol. The term "hydrate" refers to an association formed when the solvent molecules are water.
[0062] "Pharmaceutical composition" means a salt of one or more of the compounds described herein, or a physiologically / pharmaceutically acceptable salt or prodrug, mixed with other chemical components, such as physiologically / pharmaceutical acceptable carriers or excipients. The purpose of a pharmaceutical composition is to facilitate the administration of the compound to a living organism.
[0063] As used in this invention, the term "treatment" refers to any disease or condition, and in some embodiments, it means improving the disease or condition (i.e., slowing down or stopping or alleviating the development of the disease or at least one of its clinical symptoms). In other embodiments, "treatment" means alleviating or improving at least one bodily parameter, including bodily parameters that may not be perceived by the patient. In still other embodiments, "treatment" means regulating the disease or condition physically (e.g., stabilizing perceptible symptoms) or physiologically (e.g., stabilizing bodily parameters) or both. In still other embodiments, "treatment" means preventing or delaying the onset, occurrence, or worsening of the disease or condition.
[0064] Any structural formulas provided in this invention are intended to represent both the unenriched and isotopically enriched forms of these compounds. Isotopically enriched compounds have the structures described by the general formulas provided in this invention, except that one or more atoms are replaced by atoms having a chosen atomic weight or mass number. Exemplary isotopes that may be introduced into the compounds of this invention include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, sulfur, fluorine, and chlorine, such as... 2 H, 3 H, 11 C, 13 C, 14 C, 15 N, 17 O, 18 O, 18 F, 31 P, 32 P, 35 S, 36 Cl and 125 I.
[0065] On the other hand, the compounds described in this invention include isotopically enriched compounds as defined in this invention, for example, compounds containing radioactive isotopes, such as... 3 H, 14 C and 18 Those compounds of F, or those containing non-radioactive isotopes, such as 2 H and 13 C. Compounds enriched by this type of isotope can be used for metabolic studies (using...) 14 C) Reaction kinetic studies (using, for example) 2 H or 3 H) Detection or imaging techniques, such as positron emission tomography (PET) or single-photon emission computed tomography (SPECT) which includes the determination of drug or substrate tissue distribution, may be used in the patient's radiotherapy. 18 F-enriched compounds are particularly desirable for PET or SPECT studies. The isotopically enriched compounds of formula (I) can be prepared using conventional techniques familiar to those skilled in the art, or by replacing the previously used unlabeled reagent with a suitable isotopic labeling reagent, as described in the examples and preparation procedures of this invention.
[0066] In addition, heavier isotopes, especially deuterium (i.e., 2Substitution with H or D can provide certain therapeutic advantages resulting from increased metabolic stability. For example, this may lead to an increased half-life in vivo, a reduced dose requirement, or an improved therapeutic index. It should be understood that deuterium in this invention is considered a substituent in compounds of formula (I). The concentration of such heavier isotopes, particularly deuterium, can be defined using an isotope enrichment factor. The term "isotope enrichment factor" as used in this invention refers to the ratio between the isotopic abundance of the specified isotope and its natural abundance. If the substituent of the compound of the present invention is designated as deuterium, the compound has an isotopic enrichment factor of at least 3500 (52.5% deuterium doping at each designated deuterium atom), at least 4000 (60% deuterium doping), at least 4500 (67.5% deuterium doping), at least 5000 (75% deuterium doping), at least 5500 (82.5% deuterium doping), at least 6000 (90% deuterium doping), at least 6333.3 (95% deuterium doping), at least 6466.7 (97% deuterium doping), at least 6600 (99% deuterium doping), or at least 6633.3 (99.5% deuterium doping) with respect to each designated deuterium atom. The pharmaceutically usable solvates of the present invention include those in which the crystallization solvent may be isotopically substituted, such as D2O, acetone-d6, DMSO-d6.
[0067] As described in this invention, the compounds of this invention may optionally be substituted with one or more substituents, such as the general formula compounds above, or as the specific examples, subclasses, and classes of compounds included in this invention as described in the embodiments. It should be understood that the term "optionally substituted" is used interchangeably with the term "substituted or unsubstituted." Generally, the term "optionally," whether or not preceding the term "substituted," refers to the substitution of one or more hydrogen atoms selected from the given structure by a specific substituent. Unless otherwise indicated, an optional substituent group may have one substituent substituted at each substituted position of the group. When more than one position in the given structural formula is substituted by one or more substituents selected from a specific group, the substituents may be substituted at the same or different positions. The substituents mentioned therein can be, but are not limited to, deuterium, hydroxyl, amino, halogen, cyano, aryl, heteroaryl, alkoxy, alkylamino, alkylthio, alkyl, alkenyl, alkynyl, heterocyclic, mercapto, nitro, aryloxy, heteroaryloxy, oxo (=O), carboxyl, hydroxy-substituted alkoxy, hydroxy-substituted alkyl-C (=O), alkyl-C (=O), alkyl-S (=O), alkyl-S (=O)2-, hydroxy-substituted alkyl-S (=O), hydroxy-substituted alkyl-S (=O)2, carboxyalkoxy, etc.
[0068] As used in this invention, the term "alkyl" refers to a saturated straight-chain or branched monovalent hydrocarbon group having 1-20 carbon atoms, or 1-10 carbon atoms, or 1-8 carbon atoms, or 1-6 carbon atoms, or 1-4 carbon atoms, or 1-3 carbon atoms, wherein the alkyl group may be independently and optionally substituted by one or more substituents described in this invention. Examples of alkyl groups include, but are not limited to, methyl (Me, -CH3), ethyl (Et, -CH2CH3), n-propyl (n-Pr, -CH2CH2CH3), isopropyl (i-Pr, -CH(CH3)2), n-butyl (n-Bu, -CH2CH2CH2CH3), isobutyl (i-Bu, -CH2CH(CH3)2), sec-butyl (s-Bu, -CH(CH3)CH2CH3), tert-butyl (t-Bu, -C(CH3)3), n-pentyl (-CH2CH2CH2CH2CH3), 2-pentyl (-CH(CH3)CH2CH2CH3), 3-pentyl (-CH(CH2CH3)2), 2-methyl-2-butyl (-C(CH3)2CH2CH3), 3-methyl-2-butyl (-CH(CH3)CH(CH3)2), 3-methyl-1-butyl (-CH2CH2CH(CH3)2), 2-methyl-1- Butyl (-CH2CH(CH3)CH2CH3), n-hexyl (-CH2CH2CH2CH2CH2CH3), 2-hexyl (-CH(CH3)CH2CH2CH2CH3), 3-hexyl (-CH(CH2CH3)(CH2CH2CH3)), 2-methyl-2-pentyl (-C(CH3)2CH2CH2CH3), 3-methyl-2-pentyl (-CH(CH3)CH(CH3)CH2CH3) ), 4-methyl-2-pentyl (-CH(CH3)CH2CH(CH3)2), 3-methyl-3-pentyl (-C(CH3)(CH2CH3)2), 2-methyl-3-pentyl (-CH(CH2CH3)CH(CH3)2), 2,3-dimethyl-2-butyl (-C(CH3)2CH(CH3)2), 3,3-dimethyl-2-butyl (-CH(CH3)C(CH3)3), n-heptyl, n-octyl, etc. The term "alkyl" and its prefix "alkane" are used herein to refer to both straight-chain and branched saturated carbon chains. The term "alkane" is used herein to refer to a saturated divalent hydrocarbon group obtained by eliminating two hydrogen atoms from a straight-chain or branched saturated hydrocarbon; examples of such groups include, but are not limited to, methylene, methine, methinepropyl, etc.
[0069] The term "alkoxy" as used in this invention refers to an alkyl group, as defined herein, that is attached to the main carbon chain by an oxygen atom. Examples of such alkyl groups include, but are not limited to, methoxy, ethoxy, propoxy, butoxy, etc. Furthermore, the alkoxy group may be substituted or unsubstituted, wherein the substituent may be, but is not limited to, hydroxyl, amino, halogen, cyano, alkoxy, alkyl, alkenyl, alkynyl, mercapto, nitro, etc.
[0070] The term "alkenyl" refers to a straight-chain or branched monovalent hydrocarbon group with 2-12 carbon atoms, or 2-8 carbon atoms, or 2-6 carbon atoms, or 2-4 carbon atoms, wherein at least one position is unsaturated, i.e., one CC is sp. 2 The double bond, wherein the alkenyl group may be independently and optionally replaced by one or more substituents described in this invention, including groups having "trans", "cis" or "E", "Z" orientations, wherein specific examples of alkenyl include, but are not limited to, vinyl (-CH=CH2), allyl (-CH2CH=CH2), etc.
[0071] The term "cycloalkyl" refers to a monovalent or polyvalent, non-aromatic, saturated or partially unsaturated ring that does not contain heteroatoms, including monocyclic rings of 3-12 carbon atoms or bicyclic rings of 7-12 carbon atoms. Bicyclic carbocyclic rings with 7-12 atoms can be bicyclic [4,5], [5,5], [5,6], or [6,6] systems, while bicyclic carbocyclic rings with 9 or 10 atoms can be bicyclic [5,6] or [6,6] systems. Suitable cyclic aliphatic groups include, but are not limited to, cycloalkyl, cycloalkenyl, and cycloynyl groups. Examples of cyclic aliphatic groups include, but are by no means limited to, cyclopropyl, cyclobutyl, cyclopentyl, 1-cyclopentyl-1-enyl, 1-cyclopentyl-2-enyl, 1-cyclopentyl-3-enyl, cyclohexyl, 1-cyclohexyl-1-enyl, 1-cyclohexyl-2-enyl, 1-cyclohexyl-3-enyl, cyclohexadienyl, cycloheptyl, cyclooctyl, cyclononyl, cyclodecyl, cycloundecyl, cyclododecyl, etc. Furthermore, the "cyclic aliphatic group" or "carbocyclic", "carbocyclic group", and "cycloalkyl" may be substituted or unsubstituted, wherein the substituent may be, but is not limited to, hydroxyl, amino, halogen, cyano, aryl, heteroaryl, alkoxy, alkylamino, alkyl, alkenyl, alkynyl, heterocyclic, mercapto, nitro, aryloxy, hydroxy-substituted alkoxy, hydroxy-substituted alkyl-C(=O), alkyl-C(=O), alkyl-S(=O), alkyl-S(=O)2-, hydroxy-substituted alkyl-S(=O), hydroxy-substituted alkyl-S(=O)2, carboxyalkoxy, etc.
[0072] The terms “heterocyclic,” “heterocyclic group,” “heterocyclic alicyclic group,” or “heterocyclic” are used interchangeably herein to refer to monocyclic, bicyclic, or tricyclic systems in which one or more carbon atoms on the ring are independently and optionally substituted with heteroatoms, which have the meaning as described herein. The ring may be fully saturated or contain one or more unsaturations, but is by no means aromatic, and has only one connection point to another molecule. One or more hydrogen atoms on the ring are independently and optionally substituted with one or more substituents described herein. Some of these embodiments are that the "heterocycle", "heterocyclic group", "heterocyclic alicyclic group" or "heterocyclic" group is a 3-7 membered monocyclic ring (1-6 carbon atoms and 1-3 heteroatoms selected from N, O, P, S, wherein S or P is optionally replaced by one or more oxygen atoms to obtain, for example, a group of S(=O), S(=O)2, P(=O), P(=O)2, and when the ring is a ternary ring, there is only one heteroatom), or a 7-10 membered bicyclic ring (4-9 carbon atoms and 1-3 heteroatoms selected from N, O, P, S, wherein S or P is optionally replaced by one or more oxygen atoms to obtain, for example, a group of S(=O), S(=O)2, P(=O), P(=O)2).
[0073] Heterocyclic groups can be carbonyl or heteroatomyl. "Heterocyclic group" also includes groups formed by the fusion of a heterocyclic group with a saturated or partially unsaturated ring or heterocycle. Examples of heterocycles include, but are not limited to, pyrrolidinyl, tetrahydrofuranyl, dihydrofuranyl, tetrahydrothiophenyl, tetrahydropyranyl, dihydropyranyl, tetrahydrothiophenyl, piperidinyl, morpholinyl, thiomorpholinyl, thiazolyl, thiazolyl, oxazolyl, piperazine, homopiperazine, aziridine, oxacyclobutyl, thiohexacyclobutyl, piperidinyl, homopiperidinyl, glycidyl, aziridineheptyl, oxacycloheptyl, thiohexacycloheptyl, 4-methoxy-piperidin-1-yl, 1,2,3,6-tetrahydropyridin-1-yl, oxacyclobutyl... 2-diazine Base, sulfur nitrogen 1-pyrrololin-1-yl, 2-pyrrololin-3-pyrrololin-1-yl, dihydroindolyl, 2H-pyranyl, 4H-pyranyl, dioxacyclohexyl, 1,3-dioxopentyl, pyrazolinyl, dithiaalkyl, dithiamonyl, dihydrothiophenyl, pyrazolinyl imidazolinyl, imidazolinyl, 1,2,3,4-tetrahydroisoquinolinyl, 1,2,6-thiadiazinane 1,1-dioxo-2-yl, 4-hydroxy-1,4-azaphosphane 4-oxide-1-yl, 2-hydroxy-1-(piperazin-1-yl)acetone-4-yl, 2-hydroxy-1-(5,6-dihydro-1,2,4-triazin-1(4H)-yl)acetone-4-yl, 5,6-dihydro-4 H-1,2,4-oxadiazine-4-yl, 2-hydroxy-1-(5,6-dihydropyridin-1(2H)-yl) acetone-4-yl, 3-azabicyclo[3.1.0]hexyl, 3-azabicyclo[4.1.0]heptyl, azabicyclo[2.2.2]hexyl, 2-methyl-5,6,7,8-tetrahydro-[1,2,4]triazol[1,5-c]pyrimidin-6-yl, 4,5,6,7-tetrahydroisoxazol[4,3-c]pyridin-5-yl, 3H-indolyl-2-oxo-5-azabicyclo[2.2.1]heptane-5-yl, 2-oxo-5-azabicyclo[2.2.2]octane-5-yl, quinazinyl and N-pyridinyl urea. Examples of heterocyclic groups also include 1,1-dioxothiomorpholino, and those in which two carbon atoms on the ring are replaced by oxygen atoms, such as pyrimidinide groups. Furthermore, the heterocyclic group can be substituted or unsubstituted, wherein the substituent can be, but is not limited to, oxo(=O), hydroxyl, amino, halogen, cyano, heteroaryl, alkoxy, alkylamino, alkyl, alkenyl, alkynyl, heterocyclic, mercapto, nitro, aryloxy, hydroxy-substituted alkoxy, hydroxy-substituted alkyl-C(=O), alkyl-C(=O), alkyl-S(=O), alkyl-S(=O)2-, hydroxy-substituted alkyl-S(=O), hydroxy-substituted alkyl-S(=O)2, carboxyalkoxy, etc.
[0074] The term "aryl" can be used alone or as a part of "aranyl," "aranalkoxy," or "aranoxyalkyl," referring to a monocyclic, bicyclic, or tricyclic carbocyclic system containing 6-14 membered rings, wherein at least one ring system is aromatic, and each ring system contains 3-7 membered rings with only one attachment point connected to the rest of the molecule. The term "aryl" can be used interchangeably with the term "aromatic ring," as aromatic rings can include phenyl, naphthyl, and anthracene. Furthermore, the aryl group may be substituted or unsubstituted, wherein the substituent may be, but is not limited to, hydroxyl, amino, halogen, cyano, aryl, heteroaryl, alkoxy, alkylamino, alkyl, alkenyl, alkynyl, heterocyclic, mercapto, nitro, aryloxy, hydroxy-substituted alkoxy, hydroxy-substituted alkyl-C(=O), alkyl-C(=O), alkyl-S(=O), alkyl-S(=O)2-, hydroxy-substituted alkyl-S(=O), hydroxy-substituted alkyl-S(=O)2, carboxyalkoxy, etc.
[0075] The term "heteroaryl" refers to a monocyclic, bicyclic, and tricyclic system containing 5-14 membered rings, wherein at least one ring system is aromatic and at least one ring system contains one or more heteroatoms, wherein the heteroatoms have the meaning as described in this invention, wherein each ring system contains 3-7 membered rings and has only one attachment point connected to the rest of the molecule. The term "heteroaryl" may be used interchangeably with the terms "aromatic heterocycle" or "heteroaromatic compound." Furthermore, the heteroaryl group may be substituted or unsubstituted, wherein the substituent may be, but is not limited to, hydroxyl, amino, halogen, cyano, aryl, heteroaryl, alkoxy, alkylamino, alkyl, alkenyl, alkynyl, heterocyclic, mercapto, nitro, aryloxy, hydroxylated alkoxy, hydroxylated alkyl-C(=O)-, alkyl-C(=O)-, alkyl-S(=O)2-, hydroxylated alkyl-S(=O)-, hydroxylated alkyl-S(=O)2-, carboxyalkoxy, etc.
[0076] Other embodiments include, but are not limited to, the following monocyclic compounds: 2-furanyl, 3-furanyl, N-imidazolyl, 2-imidazolyl, 4-imidazolyl, 5-imidazolyl, 3-isoxazolyl, 4-isoxazolyl, 5-isoxazolyl, 2-oxazolyl, 4-oxazolyl, 5-oxazolyl, 4-methylisoxazol-5-yl, N-pyrrolyl, 2-pyrrolyl, 3-pyrrolyl, 2-pyridyl, 3-pyridyl, 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-pyrimidinyl, 4-pyrimidinyl, pyrimidin-5-yl, pyridazinyl (e.g., 3-pyridazinyl), 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, tetrazolyl (e.g., 5-tetrazolyl), triazolyl (e.g., 2-triazolyl and 5-triazolyl), 2-thienyl, 3-thienyl, pyrazolyl (e.g., 2-pyrazolyl) ), isothiazolyl, 1,2,3-oxadiazolyl, 1,2,5-oxadiazolyl, 1,2,4-oxadiazolyl, 1,2,3-triazolyl, 1,2,3-thiodiazolyl, 1,3,4-thiodiazolyl, 1,2,5-thiodiazolyl, 1,3,4-thiadiazol-2-yl, pyrazinyl, pyrazin-2-yl, 1,3,5-triazinyl; also includes the following bis Cyclic, but not limited to these bicyclic rings: benzimidazolyl, benzofuranyl, benzothiophenyl, indolyl (e.g., 2-indolyl), purinyl, quinolinyl (e.g., 2-quinolinyl, 3-quinolinyl, 4-quinolinyl), and isoquinolinyl (e.g., 1-isoquinolinyl, 3-isoquinolinyl, or 4-isoquinolinyl), benzo[d]thiazolyl-2-yl, imidazo[1,5-a]pyridin-6-yl.
[0077] The term “heteroatom” refers to one or more O, S, N, P, and Si atoms, including N, S, and P in any oxidation state; primary, secondary, tertiary amines, and quaternary ammonium salts; or in the form where the hydrogen atom on the nitrogen atom in the heterocycle is substituted, for example, N (e.g., N in 3,4-dihydro-2H-pyrrole), NH (e.g., NH in pyrroleyl), or NR (e.g., NR in N-substituted pyrroleyl).
[0078] The term "halogen" refers to F, Cl, Br, or I.
[0079] In this invention, "halogenated" means replacing the following group with a halogen, and the number of halogens can be one or more.
[0080] In this invention, "hydroxyl-substituted" means that the group following it is replaced by a hydroxyl group, and the number of substitutions can be one or more.
[0081] When the term "substituted" is used between two groups in this invention, it is preceded by a substituent, such as "aryl-substituted alkyl" indicating that the alkyl group has an aryl substituent, and "alkoxycarbonyl-substituted alkyl" indicating that the alkyl group has an alkoxycarbonyl substituent.
[0082] As used herein, "heteroalkyl" refers to an alkyl group in which one or more carbon atoms are independently substituted by one or more heteroatoms (e.g., nitrogen, oxygen, phosphorus, and / or sulfur atoms) (wherein the alkyl group is as defined herein). Unless otherwise stated, the heteroalkyl group is attached at any suitable atom. The heteroalkyl group may be unsubstituted. Alternatively, the heteroalkyl group may be substituted at any suitable atom. Examples of heteroalkyl groups include, but are not limited to, ethers, thioethers, primary amines, secondary amines, tertiary amines, etc.
[0083] When multiple groups of the present invention are used in combination, from left to right, they are in a substitution relationship, such as "arylalkyl", which means aryl-substituted alkyl, and "alkoxyalkoxy", which means alkoxy-substituted alkoxy.
[0084] The term "unsaturated" as used in this invention means that a structural portion contains one or more degrees of unsaturation.
[0085] In this invention, the term "single bond" means non-existent, for example, when A is selected from... At that time, R a Selected from LBE, where L is a single bond, B is a single bond, and E is a methyl group, A represents...
[0086] In this invention, unless explicitly specified, for example, that adjacent substituents can optionally connect to form a ring, adjacent substituents in the compound cannot connect to form a ring. In the compounds mentioned in this disclosure, the optional connection of adjacent substituents to form a ring includes both cases where adjacent substituents can connect to form a ring and cases where adjacent substituents do not connect to form a ring. When adjacent substituents can optionally connect to form a ring, the formed ring can be a monocyclic or polycyclic ring, and can be an alicyclic, heterocyclic, aromatic, or heteroaromatic ring. In this context, adjacent substituents can refer to substituents bonded to the same atom, substituents bonded to carbon atoms directly bonded to each other, or substituents bonded to carbon atoms further away. Preferably, adjacent substituents refer to substituents bonded to the same carbon atom and substituents bonded to carbon atoms directly bonded to each other.
[0087] The statement that adjacent substituents can optionally connect to form a ring also refers to the formation of a ring by two substituents bonded to the same carbon atom, which can be exemplified by the following formula:
[0088] The statement that adjacent substituents can optionally connect to form a ring also refers to the formation of a ring by two substituents that are considered to be bonded to carbon atoms directly bonded to each other, which can be exemplified by the following formula:
[0089] Furthermore, the statement that adjacent substituents can optionally connect to form a ring is also intended to mean that, in the case where one of the two substituents bonded to the carbon atom directly bonded to each other represents hydrogen, the second substituent bonds at the position where the hydrogen atom is bonded, thereby forming a ring. This is illustrated by the following example:
[0090] In a first aspect, the present invention provides a compound having the structure shown in Formula I, or an enantiomer, diastereomer, racemate, tautomer, stereoisomer, geometric isomer, nitride, deuterated product, metabolite, or pharmaceutically acceptable salt, ester, solvate, hydrate, isotopically labeled compound, or prodrug thereof.
[0091] Where A is selected from:
[0092] R a R b R c R e Each was independently selected from LBE, R d Selected from hydrogen, deuterium, alkyl, cycloalkyl, heteroalkyl, -OR 15 The alkyl, cycloalkyl, or heteroalkyl groups are each optionally and independently substituted by one or more substituents R'.
[0093] L is selected from single bond, alkylene, cycloalkylene, spirocycloalkylene, bridged cycloalkylene, heterocycloalkylene, -C(=O)- or any combination thereof, wherein each of the alkylene, cycloalkylene, spirocycloalkylene, bridged cycloalkylene, and heterocycloalkylene is independently and optionally substituted by one or more substituents R';
[0094] B is selected from single bond, alkylene, cycloalkylene, spirocyclic, bridged cycloalkyl, heterocyclic, cycloalkenyl, -NR 13 -、-C(=O)NR 13 -, -O-, -C(=O)-, -S-, -S(=O)2-, -S(=O)-, -C(=O)- or any combination thereof, wherein the alkylene, cycloalkylene, spirocycloalkylene, bridged cycloalkylene, heterocycloalkylene, and cycloalkenylene are each optionally and independently replaced by one or more substituents R'.
[0095] E is selected from hydrogen, alkyl, alkylsilyl, cycloalkyl, spirocyclic, bridged cyclic, heterocyclic, alkenyl, cycloalkenyl, aryl, heteroaryl, ureyl, amino, cyano, -NR 13 R 14 -C(=O)NR 13 R 14 -OR 15 -C(=O)R 16 -C(=O)OR16 -R 17 C(=O)OR 16 -SR 18 -S(=O)R 19 -S(=O)2R 19 -C(=O)(CH2) p C(=O)OR 16 -C(=O)(CH2OCH2) p C(=O)OR 16 -B(OH)2, wherein the alkyl, alkylsilyl, cycloalkyl, spirocyclic, bridged cyclic, heterocyclic, alkenyl, cycloalkenyl, aryl, heteroaryl, ureyl, amino, and cyano groups are each independently and optionally substituted by one or more substituents R'.
[0096] R 13 and R 14 Each group is independently selected from hydrogen, hydroxyl, alkyl, alkoxy, cycloalkyl, heterocyclic, cycloalkenyl, ureido, and -C(=O)R. 16 -C(=O)OR 16 -R 17 C(=O)OR 16 -S(=O)2R 19 -C(=O)NR 22 R 23 The alkyl, alkoxy, cycloalkyl, heterocyclic, and cycloalkenyl groups are each optionally and independently substituted by one or more substituents R'.
[0097] R 15 The group is selected from hydrogen, alkyl, cycloalkyl, aryl, heteroaryl, alkenyl, and heterocyclic groups, wherein the alkyl, aryl, heteroaryl, alkenyl, and heterocyclic groups are optionally substituted by one or more substituents R';
[0098] R 16 Selected from hydrogen, alkyl, cycloalkyl, heterocyclic, aryl, heteroaryl, alkenyl, -NR 22 R 23 The alkyl, cycloalkyl, heterocyclic, heteroaryl, and alkenyl groups are each optionally and independently substituted by one or more substituents R'.
[0099] R 17 Selected from hydrogen and alkylene groups; the alkylene group is optionally substituted with one or more substituents R';
[0100] R 18 Selected from hydrogen, alkyl, cyano, aryl, heteroaryl, -C(=O)R 16 -C(=O)OR 16 The alkyl, cyano, aryl, and heteroaryl groups are each optionally and independently substituted by one or more substituents R'.
[0101] R 19 Selected from hydrogen, alkyl, cycloalkyl, aryl, heteroaryl, -NR 22 R 23 The alkyl, cycloalkyl, aryl, and heteroaryl groups are optionally substituted by one or more substituents R';
[0102] R 22 R 23 Each is independently selected from hydrogen, alkyl, ureyl, aryl, and heteroaryl, wherein the alkyl, ureyl, aryl, and heteroaryl groups are optionally substituted by one or more substituents R';
[0103] R 1 R 2 R 3 R 4 R 5 R 6 R 7 R 8 R 9 R 10 R 11 Each of the following is independently selected from hydrogen, deuterium, halogen, amino, hydroxyl, mercapto, alkyl, cycloalkyl, aryl, heteroaryl, heterocyclic, and heteroalkyl, wherein each of the alkyl, cycloalkyl, aryl, heteroaryl, heterocyclic, and heteroalkyl groups is optionally independently substituted by one or more substituents R'.
[0104] Optional, R 1 and R 5 A cycloalkyl, heterocyclic, aryl, or heteroaryl group is formed by linking at any adjacent position, wherein each of the cycloalkyl, heterocyclic, aryl, or heteroaryl group is optionally and independently substituted by one or more substituents R'.
[0105] Optional, R 7 and R 8 A cycloalkyl, heterocyclic, aryl, or heteroaryl group is formed by linking at any adjacent position, wherein each of the cycloalkyl, heterocyclic, aryl, or heteroaryl group is optionally and independently substituted by one or more substituents R'.
[0106] R' is selected from deuterium, halogen, hydroxyl, C1-C10 alkyl, C3-C10 cycloalkyl, and one or more substituted C1-C10 alkyl, C1-C10 alkoxy, amino, C1-C10 alkylamino, carboxyl, C1-C10 alkylcarboxyl, C2-C10 heterocyclic, C6-C10 aryl, C1-C10 heteroaryl, and hydroxyl, halogen, cyano, amino, carboxyl, amide, and oxo groups. One or more substituted C2-C10 heterocyclic groups selected from C1-C10 alkyl and C1-C10 alkoxy groups; one or more substituted C6-C10 aryl groups selected from hydroxyl, halogen, cyano, amino, carboxyl, amide, oxo, C1-C10 alkyl and C1-C10 alkoxy groups; and one or more substituted C1-C10 heteroaryl and oxo groups selected from hydroxyl, halogen, cyano, amino, carboxyl, amide, oxo, C1-C10 alkyl and C1-C10 alkoxy groups.
[0107] Z is selected from single bond, -(CH2) n -, -NH-, -NHC(=O)-, -OP(=O)-, -OP(=O)O-, -P(=O)-, -P(=O)2-, -O-, -S-, -S(=O)-, -S(=O)2-, -Se- and any combination thereof; preferably single bonds, -(CH2) n -、-NH-、-O-;
[0108] X and Y are each independently selected from C and C, respectively. 12 C (=O), N; R 12 The group is selected from hydrogen, deuterium, halogen, amino, hydroxyl, mercapto, alkyl, cycloalkyl, aryl, heteroaryl, heterocyclic, and heteroalkyl, wherein each of the alkyl, cycloalkyl, aryl, heteroaryl, heterocyclic, and heteroalkyl groups is optionally and independently substituted by one or more substituents R'.
[0109] W is selected from -O-, -S-, -NR 24 -、-CR 20 R 21 -、-C(=O)-,R 20 R 21 and R 24 Each is independently selected from hydrogen, deuterium, and alkyl groups.
[0110] U is selected from O and S; preferably O;
[0111] m and p are each independently selected from integers from 0 to 10, preferably integers from 0 to 5;
[0112] n is an integer between 1 and 5.
[0113] In this application, It represents a carbon-carbon double bond, which can be E-type, Z-type, or a mixture thereof.
[0114] In some embodiments, the compound is not one of the following compounds:
[0115] In some implementations, when A is R a Not the following groups:
[0116] In some implementations, when A is R d When R is hydrogen, m is 0, and Z is a single bond, c It is not one of the following groups: hydrogen, deuterium, or cyano.
[0117] In some implementations, L is a single bond, i.e., -LBE is -BE. In some implementations, B is a single bond, i.e., -LBE is -LE. In some implementations, both L and B are single bonds, i.e., -LBE is -E.
[0118] In some implementations, Z is a single bond, i.e. for
[0119] In some embodiments, formula I is as shown in formula I-1, I-2, or I-3.
[0120] A, W, U, R 1 R 2 R 3 R 4 R 5 R 6 R 7 R 8 R 9 R 10 R 11 Define the same formula as I;
[0121] R 12 The group is selected from hydrogen, deuterium, halogen, amino, hydroxyl, mercapto, alkyl, cycloalkyl, aryl, heteroaryl, heterocyclic, and heteroalkyl, wherein each of the alkyl, cycloalkyl, aryl, heteroaryl, heterocyclic, and heteroalkyl groups is optionally and independently substituted by one or more substituents R'.
[0122] R' is selected from deuterium, halogen, hydroxyl, C1-C10 alkyl, C3-C10 cycloalkyl, and one or more substituted C1-C10 alkyl, C1-C10 alkoxy, amino, C1-C10 alkylamino, carboxyl, C1-C10 alkylcarboxyl, C2-C10 heterocyclic, C6-C10 aryl, C1-C10 heteroaryl, and hydroxyl, halogen, cyano, amino, carboxyl, amide, and oxo groups. One or more substituted C2-C10 heterocyclic groups selected from C1-C10 alkyl and C1-C10 alkoxy groups, C6-C10 aryl groups selected from hydroxyl, halogen, cyano, amino, carboxyl, amide, oxo, C1-C10 alkyl and C1-C10 alkoxy groups, and C1-C10 heteroaryl and oxo groups selected from hydroxyl, halogen, cyano, amino, carboxyl, amide, oxo, C1-C10 alkyl and C1-C10 alkoxy groups.
[0123] In some embodiments, L is selected from single bonds, C1-C30 alkylene groups, C3-C30 cycloalkylene groups, C3-C30 spirocyclic groups, C5-C30 bridged cycloalkyl groups, C2-C30 heterocyclic groups, -C(=O)-, or any combination thereof; each of the alkylene groups, cycloalkylene groups, spirocyclic groups, bridged cycloalkyl groups, and heterocyclic groups is independently and optionally substituted by one or more, preferably 1-3, substituents R'.
[0124] In some embodiments, B is selected from single bonds, C1-C30 alkylene groups, C3-C30 cycloalkylene groups, C3-C30 spirocyclic groups, C5-C30 bridged cyclic groups, C2-C30 heterocyclic groups, C3-C30 cycloalkenyl groups, and -NR groups. 13 -、-C(=O)NR 13 -, -O-, -C(=O)-, -S, -S(=O)2-, -S(=O)- or any combination thereof, wherein the alkylene, cycloalkylene, spirocycloalkylene, bridged cycloalkylene, heterocycloalkylene, and cycloalkenylene are each independently and optionally substituted by one or more, preferably 1-3, substituents R'.
[0125] In some embodiments, E is selected from hydrogen, C1-C30 alkyl, C1-C30 alkylsilyl, C3-C30 cycloalkyl, C3-C30 spirocyclic, C5-C30 bridged cyclic, C2-C30 heterocyclic, C2-C30 alkenyl, C3-C30 cycloalkenyl, C6-C30 aryl, C1-C30 heteroaryl, ureyl, amino, cyano, -NR 13 R 14 -C(=O)NR 13 R 14 -OR 15 -C(=O)R 16-C(=O)OR 16 -R 17 C(=O)OR 16 -SR 18 -S(=O)R 19 -S(=O)2R 19 -C(=O)(CH2) p C(=O)OR 16 -C(=O)(CH2OCH2) p C(=O)OR 16 -B(OH)2, wherein the alkyl, alkylsilyl, cycloalkyl, spirocyclic, bridged cyclic, heterocyclic, alkenyl, cycloalkenyl, aryl, heteroaryl, ureyl, amino, and cyano groups are each independently and optionally substituted by one or more, preferably 1 to 3, substituents R'.
[0126] In some implementations, R 13 and R 14 Each is independently selected from hydrogen, hydroxyl, C1-C30 alkyl, C1-C30 alkoxy, C1-C30 cycloalkyl, C2-C30 heterocyclic, C3-C30 cycloalkenyl, urea, -C(=O)R 16 -C(=O)OR 16 -R 17 C(=O)OR 16 -S(=O)2R 19 -C(=O)NR 22 R 23 The alkyl, alkoxy, cycloalkyl, heterocyclic, cycloalkenyl, and ureidyl groups are each optionally and independently replaced by one or more, preferably 1-3, substituents R'.
[0127] In some implementations, R 15 The group is selected from hydrogen, C1-C30 alkyl, C3-C30 cycloalkyl, C6-C30 aryl, C1-C30 heteroaryl, C2-C30 alkenyl, and C2-C30 heterocyclic, wherein the alkyl, cycloalkyl, aryl, heteroaryl, alkenyl, and heterocyclic groups are optionally substituted by one or more, preferably 1 to 3, substituents R'.
[0128] In some implementations, R 16 Selected from hydrogen, C1-C30 alkyl, C3-C30 cycloalkyl, C2-C30 heterocyclic, C6-C30 aryl, C1-C30 heteroaryl, C2-C30 alkenyl, -NR 22 R 23 The alkyl, cycloalkyl, heterocyclic, heteroaryl, and alkenyl groups are each optionally and independently replaced by one or more, preferably 1-3, substituents R'.
[0129] In some implementations, R17 Selected from hydrogen, C1-C30 alkylene groups, wherein the alkylene group is optionally substituted by one or more, preferably 1-3, substituents R'.
[0130] In some implementations, R 18 Selected from hydrogen, C1-C30 alkyl, cyano, C6-C30 aryl, C1-C30 heteroaryl, -C(=O)R 16 -C(=O)OR 16 The alkyl, cyano, aryl, and heteroaryl groups are each optionally and independently replaced by one or more, preferably 1-3, substituents R'.
[0131] In some implementations, R 19 Selected from hydrogen, C1-C30 alkyl, C3-C30 cycloalkyl, C6-C30 aryl, C1-C30 heteroaryl, -NR 22 R 23 The alkyl, cycloalkyl, aryl, and heteroaryl groups are optionally substituted by one or more, preferably 1-3, substituents R'.
[0132] In some implementations, R 22 R 23 Each is independently selected from hydrogen, C1-C30 alkyl, urea, C6-C30 aryl, and C1-C30 heteroaryl, wherein the alkyl, urea, aryl, and heteroaryl groups are optionally substituted by one or more, preferably 1-3, substituents R'.
[0133] In some embodiments, R' is selected from deuterium, halogen, hydroxyl, C1-C5 alkyl, C3-C8 cycloalkyl, C1-C8 alkyl, C1-C8 alkoxy, amino, C1-C8 alkylamino, carboxyl, C1-C8 alkylcarboxyl, C2-C6 heterocyclic, C6-C10 aryl, C1-C6 heteroaryl, and hydroxyl, halogen, cyano, amino, carboxyl, amide. One or more substituted C2-C8 heterocyclic groups selected from oxo, C1-C8 alkyl, and C1-C8 alkoxy; one or more substituted C6-C10 aryl groups selected from hydroxy, halogen, cyano, amino, carboxyl, amide, oxo, C1-C8 alkyl, and C1-C8 alkoxy; and one or more substituted C1-C10 heteroaryl and oxo groups selected from hydroxy, halogen, cyano, amino, carboxyl, amide, oxo, C1-C8 alkyl, and C1-C8 alkoxy.
[0134] In some implementations, A is R a Selected from LBE
[0135] L is selected from single bonds, C1-C10 alkylene groups, C3-C10 cycloalkylene groups, C2-C10 heterocyclic groups, -C(=O)-, or any combination thereof; each of the alkylene groups, cycloalkylene groups, and heterocyclic groups is independently and optionally substituted by one or more substituents R'.
[0136] In some implementations, A is R a Selected from LBE, where B is selected from single bond, C1-C10 alkylene group, C3-C10 cycloalkylene group, C2-C10 heterocyclic group, C3-C10 cycloalkenylene group, -O-, -S-, -S(=O)2-, -S(=O)-, -NR 13 -、-C(=O)NR 13 -, -C(=O)- or any combination thereof, wherein the alkylene, cycloalkylene, heterocyclic, and cycloalkenyl groups are each optionally and independently substituted by one or more substituents R'.
[0137] In some implementations, A is R a Selected from LBE, E is selected from hydrogen, cyano, C1-C10 alkyl, C1-C10 alkylsilyl, C3-C10 cycloalkyl, C3-C10 spirocyclic, C5-C10 bridged cyclic, C2-C10 heterocyclic, C2-C10 alkenyl, C3-C10 cycloalkenyl, -NR 13 R 14 -C(=O)NR 13 R 14 -OR 15 -C(=O)R 16 -C(=O)OR 16 -SR 18 -S(=O)2R 19 C6-C10 aryl, C1-C10 heteroaryl, -C(=O)(CH2) p C(=O)OR 16 -C(=O)(CH2O CH2) p C(=O)OR 16 The alkyl, alkylsilyl, cycloalkyl, spirocyclic, bridged cyclic, heterocyclic, alkenyl, cycloalkenyl, aryl, and heteroaryl groups are each optionally and independently replaced by one or more substituents R'.
[0138] In some implementations, R 13 and R 14 Each is independently selected from hydrogen, hydroxyl, C1-C10 alkyl, -C(=O)R 16 -R 17 C(=O)OR 16 -C(=O)NR 22 R23 Urea group, wherein the alkyl group is optionally substituted with one or more substituents R'.
[0139] In some implementations, R 15 The group is selected from hydrogen, C1-C10 alkyl, C6-C10 aryl, C1-C10 heteroaryl, and C2-C10 alkenyl, wherein each of the alkyl, aryl, heteroaryl, and alkenyl groups is independently and optionally substituted by one or more substituents R'.
[0140] In some implementations, R 16 Selected from hydrogen, C1-C10 alkyl, C2-C10 heterocyclic, C1-C10 heteroaryl, C2-C10 alkenyl, -NR 22 R 23 The alkyl, heterocyclic, and heteroaryl groups are each optionally and independently replaced by one or more substituents R'.
[0141] In some implementations, R 17 Selected from hydrogen, C1-C10 alkylene groups, wherein the alkylene group is optionally substituted with one or more substituents R';
[0142] In some implementations, R 18 Selected from hydrogen, cyano, C1-C10 alkyl, -C(=O)R 16 -C(=O)OR 16 C6-C10 aryl, C1-C20 heteroaryl, wherein each alkyl, aryl, and heteroaryl group is optionally substituted independently by one or more substituents R'.
[0143] In some implementations, R 19 The group is selected from hydrogen, C1-C10 alkyl, C6-C10 aryl, and C1-C10 heteroaryl, wherein each alkyl, aryl, and heteroaryl group is optionally substituted independently by one or more substituents R'.
[0144] In some implementations, R 22 R 23 Each is independently selected from hydrogen and C1-C10 alkyl groups, wherein the alkyl group is optionally substituted by one or more substituents R'.
[0145] In some embodiments, R' is selected from deuterium, fluorine, chlorine, C1-C5 alkyl, C3-C6 cycloalkyl, C1-C5 alkyl, C1-C5 alkoxy, amino, C1-C5 alkylamino, carboxyl, C1-C5 alkylcarboxyl, C2-C6 heterocyclic, C6-C10 aryl, C1-C10 heteroaryl, and hydroxyl, halogen, cyano, amino, carboxyl, amide, oxo. One or more substituted C2-C6 heterocyclic groups selected from C1-C5 alkyl and C1-C5 alkoxy groups, C6-C10 aryl groups selected from hydroxyl, halogen, cyano, amino, carboxyl, amide, oxo, C1-C5 alkyl and C1-C5 alkoxy groups, and C1-C10 heteroaryl and oxo groups selected from hydroxyl, halogen, cyano, amino, carboxyl, amide, oxo, C1-C5 alkyl and C1-C5 alkoxy groups.
[0146] In some implementations, when L and B are both single bonds and E is hydrogen, in formula I, R 10 R 11 They are not both hydrogen.
[0147] In some implementations, when E is selected from C6-C10 aryl or C1-C10 heteroaryl, L and B are not both single bonds.
[0148] In some implementations, when B is selected from -NR 13 -, E is selected from -C(=O)R 16 And R 16 When selected from C1-C5 alkyl groups, L is not methylene.
[0149] In some implementations, when R 16 When selected from C1-C10 heteroaryl groups, B is not -NR. 13 -
[0150] In some implementations, when R 16 When selected from C1-C10 heteroaryl groups, B is -NR. 13 -, L is not a C1-C10 alkylene group.
[0151] In some embodiments, L is selected from a single bond, B is selected from a single bond, and E is selected from hydrogen, C1-C5 alkyl, C1-C5 alkylsilyl, C3-C6 cycloalkyl, C5-C8 spirocyclic, C3-C6 heterocyclic, -C(=O)OR 16 -C(=O)R 16 R 16The group is selected from hydrogen, C1-C5 alkyl, or C2-C6 heterocyclic groups, wherein each of the alkyl, alkylsilyl, cycloalkyl, spirocyclic, or heterocyclic groups is independently and optionally substituted by one to three C1-C5 alkyl, C1-C5 alkoxy, amino, C1-C5 alkylamino, carboxyl, C1-C5 alkylcarboxyl, C2-C6 heterocyclic, C6-C10 aryl, C1-C10 heteroaryl, or hydroxyl-substituted groups. The C2-C6 heterocyclic group substituted with one or more of the following: hydroxyl, halogen, cyano, amino, carboxyl, amide, oxo, C1-C5 alkyl, C1-C5 alkoxy; the C6-C10 aryl group substituted with one or more of the following: hydroxyl, halogen, cyano, amino, carboxyl, amide, oxo, C1-C5 alkyl, C1-C5 alkoxy; and the C1-C10 heteroaryl and oxo group substituted with one or more of the following: hydroxyl, halogen, cyano, amino, carboxyl, amide, oxo, C1-C5 alkyl, C1-C5 alkoxy.
[0152] In some embodiments, L is selected from single bonds, B is selected from single bonds, and E is selected from hydrogen, methyl, ethyl, propyl, isopropyl, butyl, pentyl, trimethylsilyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, piperidinyl, tetrahydropyrrolyl, azirrobutyl, oxacyclobutyl, -C(=O)OR 16 -C(=O)R 16 , R 16 The group is selected from hydrogen, methyl, methylpiperazinyl, and the methyl, ethyl, propyl, isopropyl, butyl, pentyl, trimethylsilyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, piperidinyl, tetrahydropyrrolyl, azirrobutyl, and oxacyclobutyl groups are each independently and optionally replaced by 1 to 3 substituents selected from deuterium, fluorine, chlorine, hydroxyl, amino, carboxyl, methyl, ethyl, propyl, isopropyl, methoxy, cyclopropyl, and cyclobutyl.
[0153] In some embodiments, L is selected from a single bond, B is selected from a C1-C5 alkylene group, and E is selected from a C2-C6 heterocyclic group, a C5-C6 bridged cyclic group, or -NR. 13 R 14 -SR 18 -S(=O)2R 19 -OR 15 R 13 and R 14 Each is independently selected from hydrogen, hydroxyl, C1-C5 alkyl, R 15 Selected from C1-C5 alkyl, C1-C10 heteroaryl, R 18 Selected from hydrogen, cyano, C1-C5 alkyl, C6-C10 aryl, C1-C10 heteroaryl; R19 The group is selected from hydrogen, C1-C5 alkyl, C6-C10 aryl, and C1-C10 heteroaryl, wherein each of the alkylene, heterocyclic, bridged cyclic, alkyl, alkenyl, heteroaryl, and aryl groups is independently and optionally substituted by one to three C1-C5 alkyl, C1-C5 alkoxy, amino, C1-C5 alkylamino, carboxyl, C1-C5 alkylcarboxyl, C2-C6 heterocyclic, C6-C10 aryl, and C1-C10 heteroaryl groups selected from deuterium, halogen, C1-C5 alkyl, C3-C6 cycloalkyl, hydroxyl, halogen, cyano, amino, carboxyl, and amide groups. The aryl group, a C2-C6 heterocyclic group substituted with one or more of hydroxyl, halogen, cyano, amino, carboxyl, amide, oxo, C1-C5 alkyl, and C1-C5 alkoxy, a C6-C10 aryl group substituted with one or more of hydroxyl, halogen, cyano, amino, carboxyl, amide, oxo, C1-C5 alkyl, and C1-C5 alkoxy, and a C1-C10 heteroaryl and oxo group substituted with one or more of hydroxyl, halogen, cyano, amino, carboxyl, amide, oxo, C1-C5 alkyl, and C1-C5 alkoxy.
[0154] In some embodiments, L is selected from a single bond, B is selected from C1-C3 alkylene or deuterated C1-C3 alkylene, and E is selected from morpholino, aziridine, piperidinyl, piperazine, -NR 13 R 14 -SR 18 -S(=O)2R 19 -OR 15 , R 13 and R 14 Each is independently selected from hydrogen, hydroxyl, C1-C3 alkyl, R 15 Selected from benzotriazolyl, pyridyltriazolyl, C1-C3 alkyl, R 18 Selected from hydrogen, cyano, C1-C3 alkyl, phenyl, imidazolyl, R 19 The group is selected from hydrogen, C1-C3 alkyl, phenyl, thienyl, imidazolyl, benzothiazolyl, pyridyl, pyrazinyl, pyrimidinyl, and pyridazinyl, wherein each of the following groups is independently and optionally substituted by 1 to 3 substituents selected from deuterium, fluorine, chlorine, hydroxyl, amino, methyl, cyano, and amide.
[0155] In some embodiments, L is selected from a single bond, B is selected from C(=O)-, C3-C6 cycloalkylene groups, and E is selected from C2-C6 heterocyclic groups, C5-C6 bridged cyclic groups, and -NR groups. 13 R 14-S(=O)2R 19 R 13 and R 14 Each is independently selected from hydrogen and C1-C5 alkyl groups.
[0156] In some embodiments, L is selected from a single bond, B is selected from -C(=O)-, cyclobutylene, cyclopentylene, cyclohexylene, and E is selected from -NR 13 R 14 R 13 and R 14 Each is independently selected from hydrogen and methyl.
[0157] In some embodiments, L is selected from a single bond, B is selected from a C2-C6 heterocyclic group, and E is selected from C1-C5 alkyl, C3-C6 cycloalkyl, C3-C6 cycloalkenyl, and C2-C6 heterocyclic groups. Each of the heterocyclic groups, alkyl, cycloalkyl, cycloalkenyl, and heterocyclic groups is independently and optionally substituted by 1 to 3 substituents selected from deuterium, fluorine, chlorine, hydroxyl, amino, methyl, and methoxy.
[0158] In some embodiments, L is selected from a single bond, B is selected from tetrahydropyrroleyl, piperidinyl, and aziridine, wherein the tetrahydropyrroleyl, piperidinyl, and aziridine are substituted with 1-3 hydroxyl groups; E is selected from cyclopropyl and cyclobutenyl, wherein the cyclopropyl and cyclobutenyl are each optionally substituted independently by a substituent selected from oxo, amino, methoxy, and dimethylamino groups.
[0159] In some embodiments, L is selected from C1-C5 alkylene groups, and B is selected from -NR. 13 -、-S-、-S(=O)2-、-S(=O-、-O-、C2-C6 heterocyclic group, E is selected from hydrogen, C1-C5 alkyl, -C(=O)R 16 -S(=O)2R 19 R 13 Selected from hydrogen, C1-C5 alkyl, R 16 Selected from hydrogen, C1-C5 alkyl, -NR 22 R 23 R 19 Selected from hydrogen, C1-C5 alkyl, R 22 R 23 Each of the alkyl and heterocyclic groups is independently selected from hydrogen, and each of the alkyl and heterocyclic groups is optionally substituted by 1 to 3 substituents selected from deuterium, fluorine, chlorine, hydroxyl, amino, methyl, methoxy, oxo, phenyl, carboxyl, and dimethylamino.
[0160] In some embodiments, L is selected from C1-C5 alkylene groups, B is selected from C2-C6 heterocyclic groups, and E is selected from -OR groups. 15 -C(=O)R 16-C(=O)(CH2) p C(=O)OR 16 -C(=O)(CH2OCH2) p C(=O)OR 16 C1-C5 alkyl, R 15 Selected from hydrogen, C1-C5 alkyl, R 16 The group is selected from hydrogen, C1-C5 alkyl, and C2-C5 alkenyl, wherein each of the alkylene, heterocyclic, alkyl, and alkenyl groups is independently and optionally substituted by 1 to 3 substituents selected from deuterium, fluorine, chlorine, hydroxyl, amino, methyl, methoxy, oxo, phenyl, carboxyl, and dimethylamino.
[0161] In some embodiments, L is selected from C3-C6 heterocyclic groups, B is selected from C3-C6 cycloalkylene groups, C1-C5 alkylene groups, and E is selected from C2-C6 heterocyclic groups, -NR groups, etc. 13 R 14 -C(=O)OR 16 R 13 and R 14 Each is independently selected from hydrogen, C1-C5 alkyl, -R 17 C(=O)OR 16 R 16 Selected from hydrogen, C1-C5 alkyl, R 17 The group is selected from hydrogen and C1-C5 alkylene groups, wherein each of the heterocyclic group, cycloalkenyl group, alkylene group, heterocyclic group, and alkyl group is optionally substituted by 1-3 substituents selected from deuterium, fluorine, chlorine, hydroxyl, amino, C1-C3 alkyl, C1-C3 alkoxy, C3-C5 cycloalkyl, oxo, phenyl, carboxyl, and dimethylamino.
[0162] In some embodiments, L is selected from piperidinyl, B is selected from cyclobuteneyl, methylene, ethylene, and E is selected from piperidinyl, -NR 13 R 14 -C(=O)OR 16 R 13 and R 14 Each is independently selected from hydrogen, methyl, ethyl, -R 17 C(=O)OR 16 R 16 Selected from hydrogen, C1-C3 alkyl, R 17 The group is selected from hydrogen and C1-C3 alkylene groups; each of the piperidinyl, cyclobuteneyl, methylene, ethylene, piperidinyl, methyl, and ethyl groups is independently and optionally substituted by 1-3 substituents selected from deuterium, fluorine, chlorine, hydroxyl, amino, C1-C3 alkyl, C1-C3 alkoxy, C3-C5 cycloalkyl, oxo, phenyl, carboxyl, and dimethylamino groups.
[0163] In some implementations, A is R b and R e Each was selected independently from LBE.
[0164] In some embodiments, L is selected from a single bond, a C1-C20 alkylene group, or any combination thereof; the alkylene group is optionally substituted by one or more substituents R'.
[0165] In some embodiments, B is selected from single bonds, C1-C20 alkylene groups, C2-C10 heterocyclic groups, -S(=O)2-, -O-, or any combination thereof, wherein the alkylene group or heterocyclic group is optionally substituted by one or more substituents R'.
[0166] In some embodiments, E is selected from hydrogen, cyano, C1-C20 alkyl, C2-C20 heterocyclic, -OR 15 Or any combination thereof; R 15 Selected from hydrogen and C1-C10 alkyl groups; the alkyl or heterocyclic group may optionally be substituted by one or more substituents R'.
[0167] In some embodiments, R' is selected from deuterium, halogen, hydroxyl, C1-C10 alkyl, C3-C10 cycloalkyl, C1-C10 alkyl group substituted with one or more of hydroxyl, halogen, cyano, amino, carboxyl, amide, and oxo groups, C1-C10 alkyl, C1-C10 alkoxy, amino, C1-C10 alkylamino, carboxyl, C1-C10 alkylcarboxyl, C2-C10 heterocyclic, C6-C10 aryl, C1-C10 heteroaryl, and hydroxyl, halogen, cyano, amino, carboxyl, and amide groups. One or more substituted C2-C10 heterocyclic groups selected from oxo, C1-C10 alkyl, and C1-C10 alkoxy; one or more substituted C6-C10 aryl groups selected from hydroxy, halogen, cyano, amino, carboxyl, amide, oxo, C1-C10 alkyl, and C1-C10 alkoxy; and one or more substituted C1-C10 heteroaryl and oxo groups selected from hydroxy, halogen, cyano, amino, carboxyl, amide, oxo, C1-C10 alkyl, and C1-C10 alkoxy.
[0168] In some embodiments, L is selected from a single bond, a C1-C10 alkylene group, or any combination thereof; the alkylene group is optionally substituted by one or more substituents R'.
[0169] In some embodiments, B is selected from single bonds, C1-C10 alkylene groups, C2-C6 heterocyclic groups, -S(=O)2-, -O-, or any combination thereof; the alkylene groups or heterocyclic groups are optionally substituted by one or more substituents R'.
[0170] In some embodiments, E is selected from hydrogen, cyano, C1-C5 alkyl, C2-C6 heterocyclic, or -OR. 15 Or any combination thereof, R 15 Selected from hydrogen and C1-C5 alkyl groups.
[0171] In some embodiments, R' is selected from deuterium, halogen, hydroxyl, C1-C5 alkyl, C1-C10 alkoxy, amino, C1-C10 alkylamino, carboxyl, C1-C10 alkylcarboxyl, and oxo group; preferably, L is selected from single bond and methylene; B is selected from single bond, methylene, -S(=O)2-, and piperazine; E is selected from hydrogen, C1-C5 alkyl, C1-C5 alkyl substituted with carboxyl, and -OR 15 ;R 15 Selected from hydrogen and C1-C5 alkyl groups.
[0172] In some embodiments, L is selected from a single bond or a methylene group, B is selected from a single bond, a methylene group, -S(=O)2- or a piperazine group, and E is selected from a methyl group or a carboxyl-substituted methyl group.
[0173] In some embodiments, L is selected from methylene, B is selected from -S(=O)2-, and E is selected from carboxyl-substituted methyl groups.
[0174] In some implementations, L is selected from a single bond, B is selected from a single bond, and E is selected from hydrogen, -OR 15 R 15 Selected from methyl.
[0175] In some implementations, R b and R e Each is independently selected from the following groups:
[0176] hydrogen
[0177] In some implementations, A is selected from
[0178] In some implementations, Z is selected from -(CH2). n -, -NH-, -NHC(=O)-, -OP(=O)-, -OP(=O)O-, -P(=O)-, -P(=O)2-, -O-, -S-, -S(=O)-, -S(=O)2- and any combination thereof; preferably -(CH2). n -, -NH-, -O- or any combination thereof.
[0179] In some implementations, m is an integer from 1 to 5 (e.g., 1, 2, 3, 4, 5); n is an integer from 1 to 5 (e.g., 1, 2, 3, 4, 5).
[0180] In some implementations, R dSelected from the following groups: hydrogen, deuterium, C1-C30 alkyl, C3-C10 cycloalkyl, C1-C30 heteroalkyl, -OR 15 The alkyl, cycloalkyl, or heteroalkyl groups are each optionally and independently replaced by one or more substituents R'.
[0181] In some embodiments, R' is selected from deuterium, halogen, hydroxyl, C1-C10 alkyl, C3-C10 cycloalkyl, C1-C10 alkyl group substituted with one or more of hydroxyl, halogen, cyano, amino, carboxyl, amide, and oxo groups, C1-C10 alkyl, C1-C10 alkoxy, amino, C1-C10 alkylamino, carboxyl, C1-C10 alkylcarboxyl, C2-C10 heterocyclic, C6-C10 aryl, C1-C10 heteroaryl, and hydroxyl, halogen, cyano, amino, carboxyl, and amide groups. One or more substituted C2-C10 heterocyclic groups selected from oxo, C1-C10 alkyl, and C1-C10 alkoxy; one or more substituted C6-C10 aryl groups selected from hydroxy, halogen, cyano, amino, carboxyl, amide, oxo, C1-C10 alkyl, and C1-C10 alkoxy; and one or more substituted C1-C10 heteroaryl and oxo groups selected from hydroxy, halogen, cyano, amino, carboxyl, amide, oxo, C1-C10 alkyl, and C1-C10 alkoxy.
[0182] In some implementations, R d Selected from the following groups: hydrogen, deuterium, C1-C10 alkyl, C3-C10 cycloalkyl, C1-C10 heteroalkyl, -OR 15 R 15 Selected from hydrogen, C1-C5 alkyl, C3-C10 cycloalkyl; each of the alkyl, cycloalkyl or heteroalkyl groups is optionally substituted independently by one or more substituents R'.
[0183] In some implementations, R d Selected from the following groups: hydrogen, deuterium, C1-C5 alkyl, C3-C6 cycloalkyl, C1-C5 heteroalkyl, -OR 15 R 15 Selected from hydrogen, C1-C3 alkyl, C3-C6 cycloalkyl; each of the alkyl, cycloalkyl or heteroalkyl groups is optionally substituted independently by one or more substituents R'.
[0184] In some implementations, R d It is selected from the following groups: hydrogen, methyl, ethyl, propyl, isopropyl, butyl, pentyl.
[0185] In some implementations, R c Selected from LBE, where L is selected from single bond, C2-C20 subheterocyclic group; the subheterocyclic group is optionally substituted by one or more substituents R'.
[0186] In some embodiments, B is selected from single bonds, C1-C20 alkylene groups, C2-C20 heterocyclic groups, C3-C20 cycloalkylene groups, and C3-C20 spirocyclic groups; each of the alkylene groups, cycloalkylene groups, spirocyclic groups, and heterocyclic groups is optionally and independently substituted by one or more substituents R'.
[0187] In some embodiments, E is selected from hydrogen, C1-C20 alkyl, C3-C20 cycloalkyl, C3-C20 spirocyclic, C2-C20 heterocyclic, C3-C20 cycloalkenyl, -NR 13 R 14 -C(=O)NR 13 R 14 -OR 15 -C(=O)R 16 -C(=O)OR 16 -S(=O)2R 19 C6-C20 aryl, C1-C20 heteroaryl, ureyl; the alkyl, cycloalkyl, spirocyclic, heterocyclic, and cycloalkenyl groups are each optionally and independently substituted by one or more substituents R'.
[0188] In some implementations, R 13 and R 14 Each is independently selected from hydrogen, C1-C20 alkyl, C3-C20 cycloalkenyl, -C(=O)R 16 The alkyl and cycloalkenyl groups are each optionally and independently replaced by one or more substituents R'.
[0189] In some implementations, R 15 Selected from C1-C20 alkyl groups and C2-C20 heterocyclic groups; each of the alkyl and heterocyclic groups is optionally substituted independently by one or more substituents R'.
[0190] In some implementations, R 16 The group is selected from hydrogen, C1-C20 alkyl, C2-C20 heterocyclic, and C1-C20 heteroaryl; each of the alkyl, heterocyclic, and heteroaryl groups is optionally and independently substituted by one or more substituents R'.
[0191] In some implementations, R 19 Selected from C1-C20 alkyl groups, -NR 22 R 23 The alkyl group is optionally substituted with one or more substituents R'.
[0192] In some implementations, R 22 R 23 Each is independently selected from hydrogen and C1-C20 alkyl groups, wherein the alkyl group is optionally substituted by one or more substituents R'.
[0193] In some embodiments, R' is selected from deuterium, halogen, hydroxyl, C1-C10 alkyl, C3-C10 cycloalkyl, C1-C10 alkyl group substituted with one or more of hydroxyl, halogen, cyano, amino, carboxyl, amide, and oxo groups, C1-C10 alkyl, C1-C10 alkoxy, amino, C1-C10 alkylamino, carboxyl, C1-C10 alkylcarboxyl, C2-C10 heterocyclic, C6-C10 aryl, C1-C10 heteroaryl, and hydroxyl, halogen, cyano, amino, carboxyl, and amide groups. One or more substituted C2-C10 heterocyclic groups selected from oxo, C1-C10 alkyl, and C1-C10 alkoxy; one or more substituted C6-C10 aryl groups selected from hydroxy, halogen, cyano, amino, carboxyl, amide, oxo, C1-C10 alkyl, and C1-C10 alkoxy; and one or more substituted C1-C10 heteroaryl and oxo groups selected from hydroxy, halogen, cyano, amino, carboxyl, amide, oxo, C1-C10 alkyl, and C1-C10 alkoxy.
[0194] In some embodiments, L is selected from a single bond, B is selected from a single bond, and E is selected from hydrogen, C1-C5 alkyl, C3-C6 cycloalkyl, C3-C6 cycloalkenyl, C6-C10 aryl, C2-C6 heterocyclic, and C3-C10 spirocyclic; each of the alkyl, cycloalkyl, cycloalkenyl, aryl, heteroaryl, heterocyclic, and spirocyclic groups is independently and optionally substituted by 1-3 C1-C5 alkyl, C1-C5 alkoxy, amino, C1-C5 alkylamino, carboxyl, and C1-C5 alkylcarboxyl groups selected from deuterium, fluorine, chlorine, C1-C5 alkyl, C3-C6 cycloalkyl, hydroxyl, halogen, cyano, amino, carboxyl, and amide groups. C2-C6 heterocyclic group, C6-C10 aryl group, C1-C10 heteroaryl group, C2-C6 heterocyclic group substituted with one or more of hydroxyl, halogen, cyano, amino, carboxyl, amide, oxo, C1-C5 alkyl, C1-C5 alkoxy, C6-C10 aryl group substituted with one or more of hydroxyl, halogen, cyano, amino, carboxyl, amide, oxo, C1-C5 alkyl, C1-C5 alkoxy, C1-C10 heteroaryl and oxo group substituted with one or more of hydroxyl, halogen, cyano, amino, carboxyl, amide, oxo, C1-C5 alkyl, C1-C5 alkoxy
[0195] In some embodiments, L is selected from a single bond, B is selected from a single bond, and E is selected from hydrogen, C1-C3 alkyl, aziridine, tetrahydropyrrolyl, piperidinyl, cyclobutyl, cyclopentyl, cyclohexyl, tetrahydropyranyl, etc. The alkyl, azacyclobutane, tetrahydropyrrolyl, piperidinyl, cyclobutyl, cyclopentyl, cyclohexyl, and tetrahydropyranyl groups are each independently replaced by 1 to 3 substituents selected from deuterium, halogen, cyano, amino, methyl, methoxy, phenyl, and hydroxyl.
[0196] In some embodiments, L is selected from a single bond, B is selected from C1-C5 alkylene groups, and E is selected from C1-C10 heteroaryl groups, -OR 15 -C(=O)NR 13 R 14 -NR 13 R 14 R 13 and R 14 Each is independently selected from hydrogen, C3-C6 cycloalkenyl, -C(=O)R 16 R 15 Selected from C2-C6 heterocyclic groups, R 16 Selected from hydrogen, the alkylene, heteroaryl, cycloalkenyl, and heterocyclic groups are each optionally substituted by one to three C1-C5 alkyl, C1-C5 alkoxy, amino, C1-C5 alkylamino, carboxyl, C1-C5 alkylcarboxyl, C2-C6 heterocyclic, C6-C10 aryl, C1-C10 heteroaryl, or substituted by one or more of the following: deuterium, fluorine, chlorine, C1-C5 alkyl, C3-C6 cycloalkyl, hydroxyl, halogen, cyano, amino, carboxyl, and amide. One or more substituted C2-C6 heterocyclic groups selected from carboxyl, amide, oxo, C1-C5 alkyl, and C1-C5 alkoxy groups; one or more substituted C6-C10 aryl groups selected from hydroxyl, halogen, cyano, amino, carboxyl, amide, oxo, C1-C5 alkyl, and C1-C5 alkoxy groups; and one or more substituted C1-C10 heteroaryl and oxo groups selected from hydroxyl, halogen, cyano, amino, carboxyl, amide, oxo, C1-C5 alkyl, and C1-C5 alkoxy groups.
[0197] In some embodiments, L is selected from a single bond, B is selected from a C1-C3 alkylene group, and E is selected from an imidazolium group or a -C(=O)NR group. 13 R 14 -OR 15 R 13 and R 14 Each is independently selected from hydrogen, R 15 Selected from nitrogen-containing heterocyclic butyl groups.
[0198] In some embodiments, L is selected from a single bond, B is selected from C2-C6 heterocyclic, C3-C6 cycloalkyl, and C3-C10 spirocyclic, and E is selected from C3-C6 cycloalkenyl, C1-C5 alkyl, and -C(=O)R. 16 -C(=O)OR 16-C(=O)NR 13 R 14 -NR 13 R 14 -S(=O)2R 19 Urea, C1-C10 heteroaryl, C2-C6 heterocyclic, C3-C6 cycloalkyl, R 13 and R 14 Each is independently selected from hydrogen, C1-C5 alkyl, R 16 Selected from hydrogen, C1-C5 alkyl, R 19 Selected from -NR 22 R 23 R 22 R 23 Each group is independently selected from hydrogen and C1-C5 alkyl groups. The heterocyclic group, cycloalkyl group, spirocyclic group, cycloalkenyl group, alkyl group, heteroaryl group, cycloalkyl group, and heterocyclic group are each optionally substituted with one to three C1-C5 alkyl groups, C1-C5 alkoxy groups, amino groups, C1-C5 alkylamino groups, carboxyl groups, C1-C5 alkylcarboxyl groups, C2-C6 heterocyclic groups, C6-C10 aryl groups, and C1-C10 heteroaryl groups selected from hydroxyl, halogen, cyano, amino, carboxyl, and amide groups. It is a C2-C6 heterocyclic group substituted with one or more of the following: hydroxyl, halogen, cyano, amino, carboxyl, amide, oxo, C1-C5 alkyl, C1-C5 alkoxy; a C6-C10 aryl group substituted with one or more of the following: hydroxyl, halogen, cyano, amino, carboxyl, amide, oxo, C1-C5 alkyl, C1-C5 alkoxy; or a C1-C10 heteroaryl and oxo group substituted with one or more of the following: hydroxyl, halogen, cyano, amino, carboxyl, amide, oxo, C1-C5 alkyl, C1-C5 alkoxy.
[0199] In some embodiments, L is selected from a single bond, B is selected from azacyclobutyl, piperidinyl, and cyclopentyl, and E is selected from piperidinyl, C1-C3 alkyl, cyclobutenyl, amide, ureyl, pyrazinyl, pyridazinyl, cyclobutyl, cyclopentyl, cyclohexyl, azacyclobutyl, pyranyl, sulfide cyclopentyl, pyrroleyl, oxacyclobutyl, morpholinyl, and -C(=O)R 16 -C(=O)OR 16 -C(=O)NR 13 R 14 -NR 13 R 14 -S(=O)2R 19 R 13 and R 14 Each is independently selected from hydrogen, C1-C3 alkyl, R 16 Selected from hydrogen, C1-C3 alkyl, R19 Selected from -NR 22 R 23 R 22 R 23 Selected from hydrogen and C1-C3 alkyl groups.
[0200] In some embodiments, L is selected from C2-C6 heterocyclic groups, B is selected from C1-C5 alkylene groups, and E is selected from -C(=O)R. 16 -C(=O)OR 16 -C(=O)NR 13 R 14 C2-C6 heterocyclic groups, -NR 13 R 14 R 13 and R 14 Each is independently selected from hydrogen, C1-C5 alkyl, R 16 The group is selected from hydrogen, C2-C6 heterocyclic groups, and C1-C5 alkyl groups; preferably, L is selected from azapyrocyclic butyl, B is selected from C1-C3 alkylene groups, and E is selected from piperazinyl, morpholinyl, piperidinyl, and -NR. 13 R 14 R 13 and R 14 Each is independently selected from hydrogen and C1-C3 alkyl groups.
[0201] In some implementations, A is selected from
[0202] Z represents a single bond, R d Selected from hydrogen; m is 0;
[0203] R c Selected from LBE;
[0204] In some embodiments, L is selected from single bonds, C3-C20 subspirocyclic groups, C5-C20 subbridged cyclic groups, and C2-C20 subheterocyclic groups; each of the subspirocyclic groups, subbridged cyclic groups, and subheterocyclic groups is independently and optionally substituted by one or more substituents R'.
[0205] In some embodiments, B is selected from single bond, -C(=O)-, C1-C20 alkylene, C3-C20 cycloalkylene, C3-C20 spirocyclic, C5-C20 bridged cycloalkyl, C2-C20 heterocyclic, -NR 13 -, -O-, -S-, -S(=O)2-, -C(=O)NR 13 - Each of the alkylene, cycloalkylene, spirocycloalkylene, bridged cycloalkylene, and heterocycloalkylene groups is independently and optionally substituted by one or more substituents R'.
[0206] In some embodiments, E is selected from hydrogen, C2-C20 alkyl, C3-C20 cycloalkyl, C3-C20 spirocyclic, C5-C20 bridged cyclocyclic, C2-C20 heterocyclic, C3-C20 cycloalkenyl, C2-C20 alkenyl, C1-C20 heteroaryl, and -NR. 13 R 14 -C(=O)NR 13 R 14 -OR 15 -C(=O)R 16 -C(=O)OR 16 -S(=O)2R 19 C6-C30 aryl, C1-C20 heteroaryl, -B(OH)2, ureyl, amino, wherein the alkyl, cycloalkyl, spirocyclic, bridged cyclic, heterocyclic, cycloalkenyl, alkenyl, heteroaryl, aryl, ureyl, and amino groups are each optionally and independently substituted by one or more substituents R'.
[0207] In some implementations, R 13 and R 14 Each is independently selected from hydrogen, C1-C20 alkyl, C3-C20 cycloalkenyl, -C(=O)R 16 The alkyl, cycloalkenyl, and ureidyl groups are each optionally and independently substituted by one or more substituents R'.
[0208] In some implementations, R 15 The alkyl group is selected from hydrogen and C1-C20 alkyl groups, wherein the alkyl group is optionally substituted by one or more substituents R'.
[0209] In some implementations, R 16 Selected from hydrogen, C1-C20 alkyl, C3-C20 cycloalkyl, C6-C20 aryl, C1-C20 heteroaryl, C2-C20 heterocyclic, -NR 22 R 23 The alkyl, cycloalkyl, aryl, heteroaryl, and heterocyclic groups are each optionally and independently replaced by one or more substituents R'.
[0210] In some implementations, R 18 Selected from hydrogen, C1-C20 alkyl, -C(=O)R 16 , cyano, -C(=O)OR 16 The alkyl group is optionally substituted with one or more substituents R'.
[0211] In some implementations, R 19 Selected from hydrogen, C1-C20 alkyl, C3-C20 cycloalkyl, C6-C20 aryl, C1-C20 heteroaryl, -NR 22 R 23The alkyl, cycloalkyl, aryl, and heteroaryl groups are each optionally and independently substituted by one or more substituents R'.
[0212] In some implementations, R 22 R 23 The group is selected from hydrogen, C1-C20 alkyl, and urea, wherein each alkyl and urea group is optionally substituted independently by one or more substituents R'.
[0213] R' is selected from deuterium, halogen, hydroxyl, C1-C10 alkyl, C3-C10 cycloalkyl, and one or more substituted C1-C10 alkyl, C1-C10 alkoxy, amino, C1-C10 alkylamino, carboxyl, C1-C10 alkylcarboxyl, C2-C10 heterocyclic, C6-C10 aryl, C1-C10 heteroaryl, and hydroxyl, halogen, cyano, amino, carboxyl, amide, and oxo groups. One or more substituted C2-C10 heterocyclic groups selected from C1-C10 alkyl and C1-C10 alkoxy groups, C6-C10 aryl groups selected from hydroxyl, halogen, cyano, amino, carboxyl, amide, oxo, C1-C10 alkyl and C1-C10 alkoxy groups, and C1-C10 heteroaryl and oxo groups selected from hydroxyl, halogen, cyano, amino, carboxyl, amide, oxo, C1-C10 alkyl and C1-C10 alkoxy groups.
[0214] In some embodiments, L is selected from a single bond, B is selected from a single bond, and E is selected from hydrogen, amino, C2-C5 alkyl, -B(OH)2, C5-C6 bridged cycloalkyl, C3-C10 spirocycloalkyl, C3-C10 cycloalkyl, C2-C6 heterocycloalkyl, C2-C5 alkenyl, C1-C10 heteroaryl, -C(=O)R 16 -S(=O)R 19 R 16 Selected from -NR 22 R 23 R 22 R 23 Selected from hydrogen, C1-C5 alkyl, urea, R 19 Selected from C1-C10 heteroaryl groups.
[0215] In some embodiments, L is selected from single bonds, B is selected from single bonds, and E is selected from hydrogen, amino, ethyl, propyl, isopropyl, butyl, pentyl, tetrahydroimidazolylpyrazinyl, azacyclic butyl, piperazinyl, piperidinyl, morpholinyl, -B(OH)2, cyclohexyl, pyrazinyl, -C(=O)R 16 -S(=O)R 19 , R 16 Selected from -NR 22 R23 R 22 R 23 Selected from hydrogen, C1-C3 alkyl, R 19 Selected from pyridazinyl.
[0216] In some embodiments, L is selected from a single bond, B is selected from C5-C6 bridged cycloyl group, C3-C10 spirocycloyl group, C2-C6 heterocycloyl group, -C(=O)-, and E is selected from C1-C5 alkyl group, C1-C10 heteroaryl group, C2-C6 heterocycloyl group, C3-C6 cycloalkenyl group, -NR 13 R 14 -C(=O)R 16 -S(=O)2R 19 R 13 and R 14 Each is independently selected from hydrogen, C1-C5 alkyl, urea, -C(=O)R 16 R 16 Selected from C1-C5 alkyl, C3-C6 cycloalkyl, C2-C6 heterocyclic, and C1-C10 heteroaryl groups, R 19 Selected from hydrogen, C1-C5 alkyl, C3-C6 cycloalkyl, C6-C10 aryl,
[0217] In some embodiments, L is selected from single bonds, B is selected from C5-C6 subbridged cyclic groups, C3-C10 subspirocyclic groups, C2-C6 subheterocyclic groups, and -C(=O)-, and E is selected from pyridazinyl, morpholinyl, cyclobutenyl, and -NR. 13 R 14 -C(=O)R 16 -S(=O)2R 19 R 13 and R 14 Each is independently selected from hydrogen, C1-C3 alkyl, urea, -C(=O)R 16 R 16 Selected from C1-C3 alkyl, cyclopropyl, pyrrole, and oxadiazolyl groups, R 19 Selected from hydrogen, cyclopropyl, and phenyl.
[0218] In some embodiments, L is selected from C3-C10 subspirocyclic groups and C5-C6 subbridged cyclic groups, and B is selected from -NR 13 - C1-C5 alkylene, -C(=O)-, E is selected from C1-C5 alkyl, C2-C6 heterocyclic, C1-C10 heteroaryl, C3-C6 cycloalkenyl, -C(=O)R 16 R 13 Selected from hydrogen, C1-C5 alkyl, R 16 Selected from C1-C5 alkyl and C1-C10 heteroaryl groups.
[0219] In some embodiments, E is selected from C1-C3 alkyl, piperazine, and -C(=O)R. 16 R 16 Selected from oxadiazole group.
[0220] In some embodiments, L is selected from C5-C6 bridging cycloalcosides and C3-C10 spirocycloalcosides, and B is selected from C1-C5 alkylene groups and -NR groups. 13 -, -CO-, E is selected from C1-C5 alkyl, C2-C6 heterocyclic, C(=O)R 16 ;R 13 Selected from hydrogen, C1-C5 alkyl, R 16 The group is selected from C1-C5 alkyl and C1-C10 heteroaryl groups; each of the bridged cycloyl group, spirocycloyl group, and alkyl group is independently and optionally substituted by 1-3 C2-C6 heterocyclic groups, C2-C6 heterocyclic groups, and oxo groups selected from deuterium, fluorine, chlorine, C1-C5 alkyl, carboxyl, C1-C5 alkylcarboxyl, hydroxyl, halogen, cyano, amino, C1-C5 alkyl, and C1-C5 alkoxy groups.
[0221] In some implementations, L is selected from B is selected from C1-C5 alkylene groups, -NR 13 -, -CO-, E are selected from C1-C5 alkyl, piperazine, C1-C5 alkyl substituted with piperazine, C(=O)R 16 ;R 13 Selected from hydrogen, C1-C5 alkyl, R 16 Selected from C1-C3 alkyl and oxadiazole groups.
[0222] In some embodiments, L is selected from C2-C6 heterocyclic groups, B is selected from C1-C5 alkylene groups, and E is selected from C2-C6 heterocyclic groups, C1-C10 heteroaryl groups, and -OR groups. 15 -C(=O)R 16 -C(=O)NR 13 R 14 R 13 and R 14 Each is independently selected from hydrogen, C1-C5 alkyl, R 15 Selected from hydrogen, C1-C5 alkyl, R 16 Selected from hydrogen and C2-C6 heterocyclic groups.
[0223] In some embodiments, L is selected from C2-C6 heterocyclic groups, B is selected from C1-C5 alkylene groups, and E is selected from piperazine, piperidinyl, pyranyl, morpholinyl, imidazolyl, pyrroleyl, and -OR. 15 -C(=O)R 16 -C(=O)NR 13 R 14 R13 and R 14 Each is independently selected from hydrogen, C1-C3 alkyl, R 15 Selected from hydrogen, C1-C3 alkyl, R 16 Selected from hydrogen and piperazine group.
[0224] In some implementations, R 1 R 2 R 3 R 4 R 5 R 6 R 7 R 8 R 9 R 10 R 11 R 12 Each of the following groups is independently selected from hydrogen, deuterium, halogen, amino, hydroxyl, mercapto, C1-C20 alkyl, C1-C20 heteroalkyl, C3-C20 cycloalkyl, C6-C20 aryl, C1-C20 heteroaryl, and C2-C20 heterocyclic groups, wherein each of the alkyl, cycloalkyl, aryl, heteroaryl, heterocyclic, and heteroalkyl groups is optionally substituted by one to three C1-C10 alkyl, C1-C10 alkoxy, amino, C1-C10 alkylamino, carboxyl, and C1-C10 alkylcarboxyl groups selected from deuterium, halogen, hydroxyl, C1-C10 alkyl, C3-C10 cycloalkyl, hydroxyl, halogen, cyano, amino, carboxyl, amide, and oxo groups. C2-C10 heterocyclic group, C6-C10 aryl group, C1-C10 heteroaryl group, C2-C10 heterocyclic group substituted with one or more of hydroxyl, halogen, cyano, amino, carboxyl, amide, oxo, C1-C10 alkyl, C1-C10 alkoxy, C6-C10 aryl group substituted with one or more of hydroxyl, halogen, cyano, amino, carboxyl, amide, oxo, C1-C10 alkyl, C1-C10 alkoxy, C1-C10 heteroaryl and oxo group substituted with one or more of hydroxyl, halogen, cyano, amino, carboxyl, amide, oxo, C1-C10 alkyl, C1-C10 alkoxy
[0225] In some implementations, R 1 R 2 R 3 R 4 R 5 R 6 R 7 R 8 R 9 R 10 R 11 R 12Each is independently selected from hydrogen, deuterium, halogen, amino, C1-C10 alkyl, C1-C10 heteroalkyl, C3-C10 cycloalkyl, C6-C10 aryl, C1-C10 heteroaryl, and C2-C10 heterocyclic.
[0226] In some implementations, R 1 R 5 They can be linked at any adjacent position to form cycloalkyl, heterocyclic, aryl, or heteroaryl groups.
[0227] In some implementations, R 7 and R 8 A cycloalkyl, heterocyclic, aryl, or heteroaryl group is formed by connecting them at any adjacent position, wherein each of the cycloalkyl, heterocyclic, aryl, or heteroaryl group is optionally and independently substituted by one or more substituents R'.
[0228] In some implementations, R 1 R 2 R 3 R 4 R 5 R 6 R 7 R 8 R 9 R 10 R 11 Each is independently selected from hydrogen, deuterium, fluorine, trifluoromethyl, methoxy, cyclopropyl, And / or, R 12 Selected from hydrogen, deuterium, fluorine, chlorine, methyl, ethyl, propyl, and isopropyl.
[0229] In some implementations, W is selected from -O-, -S-, and -NR. 24 -、-CR 20 R 21 -C(=O)-, R 20 R 21 and R 24 Each is independently selected from hydrogen, deuterium, and C1-C30 alkyl groups, preferably R. 20 R 21 and R 24 Each is independently selected from hydrogen, deuterium, and C1-C10 alkyl groups, preferably R. 20 R 21 and R 24 Each is independently selected from hydrogen and C1-C5 alkyl groups.
[0230] In some implementations, R 20 R 21 and R 24 Each is independently selected from hydrogen and C1-C10 alkyl groups. In some embodiments, R 20 R21 and R 24 Each is independently selected from hydrogen and C1-C6 alkyl groups. In some embodiments, R 20 R 21 and R 24 Each is independently selected from hydrogen and C1-C5 alkyl groups. In some embodiments, R 20 R 21 and R 24 Each is independently selected from hydrogen and methyl.
[0231] In some implementations, W is selected from methylene.
[0232] In some implementations, R a R b R c R e Selected from the following groups:
[0233] hydrogen,
[0234] In some implementations, R a R b R c R e Each is independently selected from the following groups:
[0235] In some implementations, R a R b R c R e Selected from the following groups:
[0236] In some implementations, R a R b R c Each is independently selected from the following groups:
[0237] Hydrogen, amino, methyl, -B(OH)2
[0238] Preferably, R a R b R c Selected from the following groups:
[0239] In some implementations, R a R b R cR e Each is independently selected from the following groups:
[0240] Hydrogen, amino, methyl, -B(OH)2
[0241] Preferably, R a Selected from the following groups:
[0242] In some implementations, R c Selected from the following groups:
[0243] In some embodiments, the compound is selected from the compounds listed in the following table:
[0244] In a second aspect, the present invention provides a pharmaceutical composition comprising the compound described in the first aspect of the present invention or its enantiomers, diastereomers, racemates, tautomers, stereoisomers, geometric isomers, nitrides, deuterated products, metabolites or pharmaceutically acceptable salts, esters, solvates, hydrates, isotopically labeled compounds or prodrugs or thereof, and pharmaceutically acceptable excipients.
[0245] Thirdly, the present invention provides the use of the compound described in the first aspect or its enantiomers, diastereomers, racemates, tautomers, stereoisomers, geometric isomers, nitrides, deuterated products, metabolites or pharmaceutically acceptable salts, esters, solvates, hydrates, isotopically labeled compounds or prodrugs or the pharmaceutical composition described in the second aspect in the preparation of a drug for inhibiting Polθ overexpression or an antitumor drug.
[0246] Preferably, the tumor includes one or more of breast cancer, ovarian cancer, pancreatic cancer, prostate cancer, esophageal cancer, and lung cancer.
[0247] Example 1: N-(4-amino-4-methylpentan-2-yn-1-yl)-2-(2,4-di(trifluoromethyl)phenyl)-N-(4-fluorophenyl)acetamide
[0248] Synthetic route and method:
[0249] (1) Synthesis of intermediate 1-1
[0250] 2-Methyl-3-butyn-2-amine (0.5 g, 6.01 mmol) was dissolved in methanol (5 mL), and DMAP (36.7 mg, 300.7 mmol) and Boc2O (1.97 g, 9.02 mmol) were added. The mixture was reacted at room temperature for 2 hours. After the reaction was completed by TLC, the solution was concentrated and separated by column chromatography to obtain compound 1-1 (716 mg, 64% yield).
[0251] (2) Synthesis of intermediate 1-2
[0252] 4-Fluoroaniline (5.5 g, 49.5 mmol) was dissolved in acetonitrile (36 mL), and sodium iodide (1.24 g, 8.25 mmol), potassium carbonate (8.55 g, 61.9 mmol), and allyl bromide (3.6 mL, 41.6 mmol) were added. The reaction was carried out at room temperature for 15 hours. After the reaction was completed, the acetonitrile was removed, the solution was dissolved in ethyl acetate, washed with water, dried over anhydrous Na₂SO₄, concentrated, and separated by column chromatography to give compounds 1-2 (2.31 g, 37% yield).
[0253] (3) Synthesis of intermediates 1-3
[0254] Weigh 1-1 (218.2 mg, 1.2 mmol), 1-2 (150 mg, 992.2 mmol), p-benzoquinone (BQ, 128.7 mg, 1.2 mmol), and cuprous chloride (9.8 mg, 99.2 mmol) into a reaction flask. Transfer the flask to a glove box, add anhydrous methanol (4 mL), seal, remove from the glove box, and irradiate at room temperature for 30 hours using a 10W blue LED lamp (450 nm). Monitor the reaction by TLC. After the reaction is complete, filter off the solid, concentrate, and separate by TLC to obtain 1-3 (96 mg, 27% yield).
[0255] (4) Synthesis of intermediates 1-4
[0256] Intermediate 1-3 (90 mg, 0.26 mmol) was dissolved in DCM (3 mL), and 1,3-dimethylbarbituric acid (40.6 mg, 0.26 mmol) and Pd(PPh3)4 (15 mg, 13 μmol) were added. The mixture was microwaved at 60 °C for 40 minutes under a N2 atmosphere. After the reaction was completed, the mixture was concentrated and separated by TLC to obtain 1-4 (52 mg, 65% yield).
[0257] (5) Synthesis of intermediates 1-5
[0258] Intermediate 1-4 (48 mg, 0.16 mmol) was dissolved in DCM (3 mL), and Et3N (23.8 mg, 0.24 mmol) and 2,4-bis(trifluoromethyl)phenylacetic acid (51.2 mg, 0.19 mmol) were added. The mixture was stirred at room temperature for 20 minutes. Then HOBT (28.8 mg, 0.19 mmol) and EDCI (36 mg, 0.19 mmol) were added, and the mixture was reacted at room temperature for 15 hours. The reaction was monitored by TLC. After the reaction was completed, the mixture was concentrated, and TLC was used to separate 1-5 (47 mg, 53% yield).
[0259] (6) Synthesis of Example 1
[0260] Intermediate 1-5 (47 mg, 84 μmol) was dissolved in DCM (2 mL), and trifluoroacetic acid (95.6 mg, 840 μmol, 65 μL) was added. The mixture was reacted at room temperature for 2 hours. The reaction was monitored by TLC. After the reaction was completed, the mixture was concentrated and separated by TLC to obtain the target compound in Example 1 (25.6 mg, 53% yield). 1 H NMR (400MHz, CDCl3, ppm) δ: 7.85 (s, 1H), 7.76 (d, J = 8.1Hz, 1H), 7.51 (d, J = 8.0Hz, 1H), 7. 29(dd,J=8.8,4.9Hz,2H),7.17(t,J=8.4Hz,2H),4.48(s,2H),3.59(s,2H),1.32(s,6H). ESI-MS[M+H] + :461.2.
[0261] Examples 2-36 were synthesized according to the method of Example 1, using the alkynes listed in Table 2 to prepare the corresponding target compounds (synthesis of non-commercial raw materials is described later). Commercially available aniline and carboxylic acid derivative raw materials are not listed in the table. Deuterated products were prepared using deuterated methanol instead of methanol as the reaction solvent.
[0262] Table 2: Examples 2-36
[0263] Example 37 N-(3-((1r,4r)-4-aminocyclohexyl)prop-2-yn-1-yl)-2-(4-fluoro-2-(trifluoromethyl)phenyl)-N-(9-oxo-9H-fluorene-3-yl)acetamide
[0264] Synthetic route and method:
[0265] (1) Synthesis of intermediate 37-2
[0266] Intermediate 37-2 is synthesized using the same method as intermediates 1-3.
[0267] (2) Synthesis of intermediate 37-3
[0268] Intermediate 37-2 (20.0 mg, 75 μmol) was dissolved in THF (10 mL), and morpholine (10.0 mg, 0.113 mmol), triethylamine (14 μL, 98 μmol), and cuprous chloride (0.7 mg, 8 μmol) were added. The mixture was microwaved at 100 °C for 3 hours. After the reaction was completed, water (10 mL) was added, and the mixture was extracted with ethyl acetate (10 mL × 3). The organic phases were combined, dried over anhydrous sodium sulfate, filtered, concentrated, and purified by column chromatography to obtain intermediate 37-3 (10 mg, 42% yield).
[0269] (3) Synthesis of Example 37
[0270] Example 37 was synthesized using the method described in Example 1. 1 H NMR(600MHz,CD3OD,ppm)δ:7.90(d,J=8.1Hz,2H),7.64(d,J=8.0Hz,1H),7.50–7.44(m,2H),7.32– 7.25(m,2H),4.56(s,2H),3.73(s,2H),3.68(t,J=4.8Hz,4H),2.55(d,J=4.9Hz,4H),1.31(s,6H). ESI-MS[M+H] + :531.2.
[0271] Example 38 N-(3-((1r,4r)-4-aminocyclohexyl)prop-2-yn-1-yl)-2-(4-fluoro-2-(trifluoromethyl)phenyl)-N-(9-oxo-9H-fluorene-3-yl)acetamide
[0272] Synthetic route and method:
[0273] (3) Synthesis of intermediate 38-1
[0274] Trans-1-(BOC-amino)-4-ethynylcyclohexane (100.0 mg, 0.445 mmol) was dissolved in anhydrous THF (2 mL), and sodium hydride (21.4 mg, 60% in oil) was added at 0 °C. The mixture was stirred at room temperature for 0.5 h. Then, 2-(trimethylsilyl)ethoxymethyl chloride (89.2 mg, 0.534 mmol) was added at 0 °C, and the reaction was carried out at 20 °C for 4 h. After the reaction was completed by TLC monitoring, saturated ammonium chloride (10 mL) was added, and the mixture was extracted with ethyl acetate (10 mL × 3). The organic phases were combined, dried over anhydrous sodium sulfate, concentrated, and purified by column chromatography to give intermediate 38-1 (90 mg, 57% yield).
[0275] (4) Synthesis of intermediate 38-2
[0276] Intermediate 38-1 (120.0 mg, 0.339 mmol) was dissolved in anhydrous THF (5 mL), and n-butyllithium (26.1 mg, 0.407 mmol) was added dropwise at -78 °C, and the reaction was carried out at -78 °C for 1 hour. Then, anhydrous DMF (29.8 mg, 0.407 mmol) was added dropwise at -78 °C, and the reaction was carried out at -78 °C for 1 hour. After the reaction was completed by TLC monitoring, water (10 mL) was added, and the mixture was extracted with ethyl acetate (10 mL × 3). The organic phases were combined, dried over anhydrous sodium sulfate, concentrated, and purified by TLC to give intermediate 38-2 (76 mg, 58% yield).
[0277] (2) Synthesis of intermediate 38-3
[0278] Intermediate 38-2 (76.0 mg, 0.199 mmol) and 3-amino-9-fluorenone (31.4 mg, 0.159 mmol) were dissolved in methanol (5 mL). After stirring at room temperature for 1 hour, sodium triacetoxyborohydride (101.31 mg, 0.478 mmol) was added, and the reaction was carried out at room temperature for 1 hour. The reaction was monitored by TLC. After completion, water (10 mL) was added, and the mixture was extracted with ethyl acetate (10 mL × 3). The organic phases were combined, dried over anhydrous sodium sulfate, concentrated, and purified by TLC to give intermediate 38-3 (7 mg, 8% yield).
[0279] (3) Synthesis of intermediate 38-4
[0280] Intermediate 38-3 (7 mg, 12.4 μmol) was dissolved in DCM (2 mL), and 2-[4-fluoro-2-(trifluoromethyl)phenyl]acetic acid (3.3 mg, 14.9 μmol) and triethylamine (2.5 mg, 24.8 μmol) were added. The mixture was stirred at room temperature for 10 minutes, and then HOBT (2.7 mg, 17.4 μmol) and EDCI (3.3 mg, 17.4 μmol) were added. The mixture was reacted overnight at room temperature. After the reaction was completed, the mixture was concentrated and purified by TLC to give intermediate 38-4 (7.4 mg, 77% yield).
[0281] (4) Synthesis of Example 38
[0282] Intermediate 38-4 (7.4 mg, 9.6 μmol) was dissolved in DCM (2 mL), and TFA (11.0 mg, 96.5 μmol) was added. The mixture was reacted at room temperature for 2 hours. After the reaction was completed, the solution was concentrated and purified by TLC to obtain Example 38 (3.3 mg, 62% yield). 1 H NMR(600MHz,Chloroform-d)δ7.71(d,J=7.3Hz,1H),7.62(d,J=7.8Hz,1H),7.60–7.51(m,3H),7.41–7.38(m,1H),7.35(dd,J=7.7,4.8Hz,2H),7. 30(dd,J=9.1,2.6Hz,1H),7.21(td,J=8.1,2.6Hz,1H),4.50–4.47(m,2H) ,3.56(s,2H),2.90(s,1H),2.18(s,1H),2.04–1.90(m,8H).ESI-MS[M+H] + 535.3.
[0283] Example 39 2-(2,4-Di(trifluoromethyl)phenyl)-N-(4-(dimethylamino)-4-methylpent-2-yn-1-yl)-N-(4-fluorophenyl)acetamide
[0284] Synthetic route and method:
[0285] Example 1 (20 mg, 43.4 μmol) was dissolved in MeOH (1 mL), and acetic acid (261 μg, 4.3 μmol) and formaldehyde (36-38 wt% aqueous solution, stabilized with 10-15 wt% MeOH, 5.3 mg, 65.2 μmol) were added. The mixture was stirred at room temperature for 2 hours. Then, sodium triacetoxyborohydride (13.8 mg, 65.2 μmol) was added, and the reaction was carried out for 1 hour. After the reaction was completed, the mixture was concentrated, and the target product Example 39 (9.2 mg, 41% yield) was obtained by TLC separation. 1 H NMR (600MHz, CDCl3, ppm) δ: 7.85 (s, 1H), 7.78–7.74 (m, 1H), 7.51 (d, J = 8.0Hz, 1H), 7.33– 7.26(m,2H),7.16(t,J=8.4Hz,2H),4.55(s,2H),3.60(s,2H),2.19(s,6H),1.29(s,6H). ESI-MS[M+H] + :489.2.
[0286] Examples 40-54 were synthesized with reference to Example 39.
[0287] Table 3: Examples 40-54
[0288] Example 55 2-(2,4-Di(trifluoromethyl)phenyl)-N-(3-(1-cyclopropyl-3-hydroxypyrrolidine-3-yl)prop-2-yn-1-yl)-N-(4-fluorophenyl)acetamide
[0289] Synthesis route:
[0290] In Example 29, sodium cyanoborohydride (23.1 mg, 367.8 μmol), and acetic acid (3.7 mg, 61.3 μmol) were dissolved in MeOH (0.5 mL) and reacted at 65 °C for 2 hours. TLC was used for monitoring. After the reaction was complete, ethyl acetate (20 mL) was added, followed by washing with saturated NaCl (20 mL × 3). The organic phase was dried over anhydrous Na₂SO₄, filtered, concentrated, and purified by prep-HPLC to obtain the target product.
[0291] Example 55 (8 mg, 24% yield). 1H NMR (600MHz, CD3OD, ppm) δ7.85 (s, 1H), 7.77 (d, J = 8.1Hz, 1H), 7.51 (d, J = 8.0Hz, 1 H),7.30(dd,J=8.5,4.8Hz,2H),7.17(t,J=8.1Hz,2H),4.51(s,2H),3.59(s,2H), 3.13–3.04(m,2H),2.83(d,J=10.4Hz,1H),2.75–2.68(m,1H),2.33(s,1H),2.20( dt,J=14.8,7.7Hz,1H),2.13–2.05(m,1H),1.83–1.78(m,1H),0.55–0.46(m,4H). ESI-MS[M+H] + :529.2.
[0292] Example 56
[0293] 2-(2,4-Di(trifluoromethyl)phenyl)-N-(3-(1-cyclopropyl-4-hydroxypiperidin-4-yl)prop-2-yn-1-yl-1,1-d2)-N-(4-fluorophenyl)acetamide
[0294] The synthesis method of Example 56 is the same as that of Example 55, and the reaction uses the raw materials of Example 11. 1 H NMR (600MHz, CDCl3, ppm) δ: 7.84 (s, 1H), 7.76 (d, J = 8.1Hz, 1H), 7.52 (d, J = 8.1Hz, 1H), 7.28 (dd, J = 8.2, 4.7Hz, 2H), 7.15 (t ,J=8.2Hz,2H),3.58(s,2H),2.81(s,2H),2.31(d,J=25.0Hz,3H),1.74(s,2H),1.52(d,J=14.5Hz,3H),0.52–0.33(m,4H). ESI-MS[M+H] + :529.3.
[0295] Example 57 2-(2,4-Di(trifluoromethyl)phenyl)-N-(4-fluorophenyl)-N-(3-(1-(2-methoxy-3,4-dioxocyclobut-1-en-1-yl)azacyclobutane-3-yl)prop-2-yn-1-yl)acetamide and Example 58 N-(3-(1-(2-amino-3,4-dioxocyclobutane-1-en-1-yl)azacyclobutane-3-yl)prop-2-yn-1-yl)-2-(2,4-di(trifluoromethyl)phenyl)-N-(4-fluorophenyl)acetamide
[0296] Synthesis route:
[0297] (1) Synthesis of Example 57
[0298] Example 1 (23.7 mg, 41.4 μmol) was dissolved in anhydrous DCM (1 mL), and dimethyl squaric acid (7.1 mg, 49.7 μmol) and triethylamine (8.4 mg, 82.8 μmol) were added. The mixture was reacted at room temperature for 15 hours. After the reaction was completed, the mixture was concentrated and separated by TLC to obtain Example 57 (15 mg, 63% yield). 1 H NMR (400MHz, CDCl3, ppm) δ: 7.85 (s, 1H), 7.76 (d, J = 8.1Hz, 1H), 7.50 (d, J = 8.0Hz, 1H), 7.29 (dd, J = 8.6, 4.8Hz ,2H),7.18(t,J=8.3Hz,2H),4.59(s,2H),4.50(d,J=2.0Hz,2H),4.33(s,5H),3.70–3.61(m,1H),3.59(s,2H). ESI-MS[M+H] + :569.2.
[0299] (2) Synthesis of Example 58
[0300] Example 57 (8 mg, 14.1 μmol) was dissolved in acetonitrile (1.5 mL), and ammonia (≥28%, 5 mg, 141 μmol) was added. The mixture was reacted at room temperature for 15 hours. After the reaction was completed by TLC monitoring, the solution was evaporated to dryness to obtain Example 58 (6.4 mg, 76% yield). 1 H NMR(600MHz,CD3OD,ppm)δ:7.90(d,J=7.5Hz,2H),7.64(d,J=7.9Hz,1H),7.51–7.45(m,2H),7.30–7.25( m,2H),4.68(t,J=8.8Hz,2H),4.54(d,J=2.0Hz,2H),4.35–4.29(m,2H),3.73(s,2H),3.72–3.67(m,1H). ESI-MS[M+H] + :554.2.
[0301] The synthesis of Examples 59-62 follows the same synthetic route as Example 58.
[0302] Table 4: Compounds from Examples 59-62
[0303] Example 63 2-(2,4-Di(trifluoromethyl)phenyl)-N-(4-((cyanomethyl)amino)-4-methylpent-2-yn-1-yl)-N-(4-fluorophenyl)acetamide
[0304] Synthetic route and method:
[0305] Example 1 (25 mg, 54.3 μmol) was dissolved in acetonitrile (1 mL), and DIPEA (14 mg, 108.6 μmol) and bromoacetonitrile (7.8 mg, 65.2 μmol) were added. The mixture was reacted at room temperature for 1 hour. After the reaction was completed, the mixture was concentrated and separated by TLC to obtain Example 63 (6.9 mg, 24% yield). 1 H NMR (600MHz, CDCl3, ppm) δ: 7.85 (s, 1H), 7.79–7.75 (m, 1H), 7.51 (d, J = 8.1Hz, 1H), 7.33– 7.28(m,2H),7.19(t,J=8.4Hz,2H),4.50(s,2H),3.60(s,2H),3.51(s,2H),1.32(s,6H). ESI-MS[MH] - :498.2.
[0306] Example 64: N-(4-((2-amino-2-oxoethyl)amino)-4-methylpent-2-yn-1-yl)-2-(2,4-di(trifluoromethyl)phenyl)-N-(4-fluorophenyl)acetamide and Example 65: (5-(2-(2,4-di(trifluoromethyl)phenyl)-N-(4-fluorophenyl)acetamide)-2-methylpent-3-yn-2-yl)glycine
[0307] Synthetic route and method:
[0308] Example 63 (50 mg, 99.7 μmol) and NaOH (19.9 mg, 49.8 μmol) were dissolved in ethanol (2.1 mL) and water (0.9 mL) and reacted at room temperature for 12 hours. After TLC monitoring, the mixture was concentrated and purified by prep-HPLC to obtain Example 64 (20 mg, 39% yield) and Example 65 (hydrochloride, 8.6 mg, 14% yield).
[0309] Example 64: 1H NMR (400MHz, DMSO-d6, ppm) δ: 8.04 (d, J = 8.0Hz, 1H), 7.94 (s, 1H), 7.70 (d, J = 8.0Hz, 1H), 7.47 (dd, J = 8.8, 4.8Hz, 2H), 7.37 (t, J=8.8Hz,2H),7.23(s,1H),7.07(s,1H),4.46(s,2H),3.66(s,2H),3.02(d,J=6.4Hz,2H),2.29(t,J=6.4Hz,1H),1.18(s,6H). 19 F NMR (377MHz, DMSO-d6, ppm) δ: -59.61 (s, 3F), -61.23 (s, 3F), -112.91 (s, 1F). ESI-MS[M+H] + :518.1.
[0310] Example 65: 1 H NMR (400MHz, DMSO-d6, ppm) δ: 9.55 (s, 2H), 8.04 (d, J = 8.0Hz, 1H), 7.95 (s, 1H), 7.69 (d, J = 8.0Hz, 1H), 7 .54(dd,J=8.8,4.8Hz,2H),7.39(t,J=8.8Hz,2H),4.55(s,2H),3.80(s,2H),3.68(s,2H),1.52(s,6H). 19 F NMR (377MHz, DMSO-d6, ppm) δ: -59.55 (s, 3F), -61.24 (s, 3F), -112.53 (s, 1F). ESI-MS[M+H] + :519.1.
[0311] Example 66 2-(4-(3-(2-(2,4-di(trifluoromethyl)phenyl)-N-(4-fluorophenyl)acetamide)prop-1-yn-1-yl-3,3-d2)-4-hydroxypiperidin-1-yl)acetic acid
[0312] Synthetic route and method:
[0313] First, following the method of Example 63, 64-1 (17 mg, 77% yield) was synthesized from the starting material of Example 31 (20 mg, 35.7 μmol). Then, the obtained 64-1 was dissolved in THF (1 mL), and hydrochloric acid (1 M, 1 mL, 1 mmol) was added. The reaction was carried out at 40 °C for 2 hours. After TLC monitoring, the solvent was evaporated to obtain Example 66 (12 mg, 72% yield). 1H NMR (600MHz, CDCl3, ppm) δ: 7.79 (d, J = 4.5Hz, 1H), 7.74–7.71 (m, 1H), 7.52 (s, 1H), 7.34 (s, 2H), 7.15 ( s,2H),3.74(q,J=6.1,4.4Hz,2H),3.65–3.53(m,4H),3.47(d,J=5.1Hz,2H),2.35(s,2H),2.12(s,2H). ESI-MS[M+H] + :563.2.
[0314] Example 67 N-(4-acetamido-4-methylpent-2-yn-1-yl)-2-(2,4-di(trifluoromethyl)phenyl)-N-(4-fluorophenyl)acetamide
[0315] Synthetic route and method:
[0316] Example 1 (30 mg, 65.2 μmol) was dissolved in anhydrous DCM (2 mL), and triethylamine (16.5 mg, 162.9 μmol) and acetyl chloride (5.6 mg, 71.7 μmol) were added. The mixture was reacted at room temperature for 1 hour. After the reaction was completed, the mixture was concentrated and separated by TLC to obtain Example 67 (6.6 mg, 20% yield). 1 H NMR (400MHz, CDCl3, ppm) δ: 7.84 (s, 1H), 7.77 (d, J = 8.1Hz, 1H), 7.52 (d, J = 8.1Hz, 1H), 7.37 (ddt ,J=8.3,5.6,2.7Hz,2H),7.21–7.12(m,2H),4.47(s,2H),3.59(s,2H),1.93(s,3H),1.55(s,6H). ESI-MS[M+H] + :503.2.
[0317] Example 68 2-(2,4-Di(trifluoromethyl)phenyl)-N-(4-fluorophenyl)-N-(4-(methylsulfonamido)but-2-yn-1-yl)acetamide
[0318] Example 68 was synthesized using the method described in Example 67. 1H NMR(400MHz,DMSO-d6,ppm)δ:8.04(d,J=8.0Hz,1H),7.94(s,1H),7.70(d,J=8.0Hz,1H),7.55–7 .43(m,3H),7.38(t,J=8.8Hz,2H),4.49(s,2H),3.79(d,J=6.0Hz,2H),3.67(s,2H),2.86(s,3H). 19 F NMR (377MHz, DMSO-d6, ppm) δ: -59.54 (s, 3F), -61.24 (s, 3F), -112.89 (s, 1F). ESI-MS[M+H] + :511.1.
[0319] Example 69
[0320] 2-(2,4-Di(trifluoromethyl)phenyl)-N-(4-fluorophenyl)-N-(4-(hydroxyamino)-4-methylpent-2-yn-1-yl)acetamide
[0321] Synthetic route and method:
[0322] (1) Synthesis of intermediate 69-1
[0323] The product from Example 63 (60 mg, 119 μmol) was dissolved in DCM (3 mL), and m-CPBA (45.4 mg, 263 μmol) was added at 0 °C. The mixture was stirred at room temperature for 0.5 hours. After the reaction was complete, saturated Na₂S₂O₃ (2 mL) was added, and the mixture was extracted with DCM (5 mL × 3). The organic phase was washed with saturated NaHCO₃ (5 mL) and saturated brine (5 mL), dried over anhydrous Na₂SO₄, filtered, and concentrated to obtain the crude intermediate 69-1 (100 mg, 60% purity).
[0324] (2) Synthesis of Example 69
[0325] Weigh intermediate 69-1 (90 mg, 60% purity) and hydroxylamine hydrochloride (36.4 mg, 524 μmol), add MeOH (3 mL), and react at 60 °C for 2 hours. Monitor the reaction by TLC. After the reaction is complete, concentrate and purify by prep-HPLC to obtain the hydrochloride of Example 69 (28.8 mg, 52% for two steps). 1H NMR (400MHz, DMSO-d6, ppm) δ: 11.63 (brs, 2H), 11.00 (brs, 1H), 8.05 (d, J = 8.0Hz, 1H), 7.95 (s, 1H), 7.70 (d ,J=8.0Hz,1H),7.53(dd,J=8.4,5.2Hz,2H),7.40(t,J=8.8Hz,2H),4.53(s,2H),3.67(s,2H),1.45(s,6H). 19 F NMR (377MHz, DMSO-d6, ppm) δ: -59.52 (s, 3F), -61.26 (s, 3F), -112.78 (s, 1F). ESI-MS[M+H] + :477.1.
[0326] Example 70
[0327] 2-(2,4-Di(trifluoromethyl)phenyl)-N-(4-fluorophenyl)-N-(4-methyl-4-ureidopent-2-yn-1-yl)acetamide
[0328] Synthetic route and method:
[0329] (1) Synthesis of intermediate 70-1
[0330] Example 1 (60 mg, 129 μmol) and N,N'-disuccinimidyl carbonate (33.2 mg, 129 μmol) were dissolved in DCM (5 mL), and triethylamine (26.2 mg, 259 μmol) was added. The mixture was stirred at room temperature for 1 hour. The reaction was monitored by TLC. After completion, the mixture was used directly in the next reaction without any further treatment.
[0331] (2) Synthesis of Example 70
[0332] A methanol solution of ammonia (7M, 1 mL) was added to the mixture obtained in the previous step, and the mixture was stirred at room temperature for 10 minutes. After the reaction was completed by TLC monitoring, the mixture was concentrated and purified by prep-HPLC to obtain Example 70 (40.3 mg, 61% yield). 1 H NMR (400MHz, DMSO-d6, ppm) δ: 8.04 (d, J = 8.0 Hz, 1H), 7.94 (s, 1H), 7.71 (d, J = 8.0 Hz, 1H), 7.54 (dd, J = 8. 8,5.2Hz,2H),7.36(t,J=8.8Hz,2H),6.12(s,1H),5.36(s,2H),4.41(s,2H),3.64(s,2H),1.39(s,6H). 19F NMR (377MHz, DMSO-d6, ppm) δ: -59.59 (s, 3F), -61.24 (s, 3F), -113.11 (s, 1F). ESI-MS[M+H] + :504.1.
[0333] Example 71
[0334] N-(4-amino-4-methylpentan-2-yn-1-yl)-2-(2,4-di(trifluoromethyl)phenyl)-N-(4-fluorophenyl)propionamide
[0335] Synthetic route and method:
[0336] (1) Synthesis of intermediate 71-1
[0337] Intermediate 1-5 (20 mg, 35.7 μmol) was dissolved in DMF (1 mL), and Cs₂CO₃ (17.5 mg, 53.5 μmol) was added. The mixture was stirred at room temperature for 0.5 h, and then iodomethane (10.1 mg, 71.3 μmol) was added. The reaction was continued at room temperature for another 0.5 h. The reaction was monitored by TLC. After the reaction was complete, the solvent was evaporated, and intermediate 69-1 (15 mg, 73% yield) was obtained by TLC separation.
[0338] (2) Synthesis of Example 71
[0339] Intermediate 71-1 (15 mg, 26.1 μmol) was dissolved in DCM (1 mL), and TFA (29.8 mg, 261 μmol) was added. The mixture was stirred at room temperature for 2 hours. After the reaction was completed by TLC monitoring, the solvent was evaporated and purified by prep-HPLC to obtain Example 71 (6.8 mg, 43% yield). 1 H NMR (600MHz, CD3OD, ppm) δ: 7.96 (dd, J=8.4, 1.9Hz, 1H), 7.92 (d, J=8.3Hz, 1H), 7.82 (d, J=2.0Hz ,1H),7.10(s,4H),4.59–4.47(m,2H),4.13(q,J=6.8Hz,1H),1.52(s,6H),1.42(d,J=6.8Hz,3H). ESI-MS[M+H] + :475.2.
[0340] Example 72
[0341] N-(3-((1r,4r)-4-aminocyclohexyl)prop-2-yn-1-yl)-N-(4-fluorophenyl)-2-(2-oxo-4,6-bis(trifluoromethyl)pyridin-1(2H)-yl)acetamide
[0342] Synthetic route and method:
[0343] (1) Synthesis of intermediate 72-1
[0344] Intermediate 72-1 was synthesized using the same method as intermediates 1-4.
[0345] (2) Synthesis of intermediate 72-2
[0346] Intermediate 72-1 (200 mg, 577.3 μmol) was dissolved in DCM (3 mL), and triethylamine (87.6 mg, 866.0 μmol) and bromoacetyl chloride (109 mg, 692.8 μmol) were added. The mixture was reacted at room temperature for 3 hours. After the reaction was completed, the solvent was evaporated and intermediate 72-2 (110 mg, 40% yield) was obtained by TLC separation.
[0347] (3) Synthesis of intermediate 72-3
[0348] 2-Chloro-4,6-bis(trifluoromethyl)pyridine (100 mg, 400.7 μmol) was dissolved in tert-butanol (1.5 mL), and KOH (224.9 mg, 4.01 μmol) was added. The reaction was carried out under nitrogen protection at 80 °C for 2 hours. TLC monitoring was performed. After the reaction was complete, H₂O (3 mL) and ethyl acetate (2 mL) were added. The organic layer was dried over anhydrous Na₂SO₄, and the solvent was evaporated to give intermediate 72-3 (71 mg, 76% yield).
[0349] (4) Synthesis of intermediate 72-4
[0350] Intermediate 72-3 (21.8 mg, 94.1 μmol) was dissolved in DMF (1 mL), and Cs₂CO₃ (30.7 mg, 94.1 μmol) and 72-2 (22 mg, 47.1 μmol) were added. The reaction was carried out under nitrogen protection at 70 °C for 2 hours. After the reaction was completed, the solvent was evaporated and intermediate 72-4 (15 mg, 51% yield) was obtained by TLC separation.
[0351] (4) Synthesis of Example 72
[0352] Intermediate 72-4 (15 mg, 24.3 μmol) was dissolved in DCM (1 mL), and TFA (27.7 mg, 243 μmol) was added. The mixture was stirred at room temperature for 1 hour. After the reaction was completed by TLC monitoring, the solvent was evaporated to obtain Example 72 (7.6 mg, 45% yield). 1H NMR (400MHz, CDCl3, ppm) δ: 7.47 (s, 1H), 7.39 (dd, J = 8.7, 4.7Hz, 2H), 7.28 (s, 1H), 7.19 (t, J = 8.2Hz, 2H),4.67(s,2H),4.45–4.41(m,2H),3.07(s,1H),2.18(s,1H),2.07–1.88(m,4H),1.44–1.29(m,4H). ESI-MS[M+H] + :518.2.
[0353] The synthesis methods of Examples 73-75 are the same as those of Example 72, and the alkylation methods of Examples 74-75 are the same as those of Example 39.
[0354] Table 5: Examples 73-75
[0355] Example 76 2-(2,4-Di(trifluoromethyl)phenyl)-N-(4-fluorophenyl)-N-(4-((2-hydroxyethyl)thio)but-2-yn-1-yl)acetamide and Example 77 2-(2,4-Di(trifluoromethyl)phenyl)-N-(4-fluorophenyl)-N-(4-((2-hydroxyethyl)sulfonyl)but-2-yn-1-yl)acetamide
[0356] Synthetic route and method:
[0357] (1) Synthesis of intermediate 76-1
[0358] 1,4-Dichloro-2-butyne (10.0 g, 81.3 mmol) was added to 100 mL of acetonitrile containing 4-fluoroaniline (9.94 g, 89.4 mmol), K₂CO₃ (16.8 g, 121 mmol), and NaI (2.44 g, 16.2 mmol), and the reaction was carried out at room temperature for 12 hours. After TLC monitoring, the mixture was filtered, concentrated, and purified by column chromatography to give intermediate 76-1 (4.6 g, 27% yield).
[0359] (2) Synthesis of intermediate 76-2
[0360] Intermediate 76-1 (4.33 g, 21.9 mmol), 2,4-bis(trifluoromethyl)phenylacetic acid (6.0 g, 21.9 mmol), and DIPEA (14.1 g, 109 mmol) were dissolved in THF (60 mL). T4P (47.3 g, 50 wt% in EtOAc) was added at 0 °C, and the reaction was carried out at room temperature for 4 hours. After TLC monitoring, the mixture was concentrated and purified by column chromatography to obtain intermediate 76-2 (8.87 g, 89%).
[0361] (3) Synthesis of Example 76
[0362] Intermediate 76-2 (80.0 mg, 176 μmol), mercaptoethanol (16.5 mg, 211 μmol), and K₂CO₃ (48.7 mg, 352 μmol) were dissolved in DMF (2 mL) and reacted at room temperature for 2 hours. The reaction was monitored by TLC. After completion, the solution was concentrated and purified by reverse-phase column chromatography to obtain Example 76 (63.0 mg, 68%). 1 H NMR(400MHz,DMSO-d6,ppm)δ:8.04(d,J=8.0Hz,1H),7.94(s,1H),7.71(d,J=8.0Hz,1H),7.49(dd,J=8.8,5.2Hz,2H),7.38( t,J=8.8Hz,2H),4.80(t,J=5.2Hz,1H),4.49(s,2H),3.67(s,2H),3.53(q,J=6.4Hz,2H),3.36(s,2H),2.59(t,J=6.8Hz,2H). 19 F NMR (377MHz, DMSO-d6, ppm) δ: -59.58 (s, 3F), -61.24 (s, 3F), -112.94 (s, 1F). ESI-MS[MH] - :491.95.
[0363] (4) Synthesis of Example 77
[0364] Example 76 (38.0 mg, 46.7 μmol) was dissolved in DCM (8 mL), and m-CPBA (52.9 mg, 306 μmol) was added. The reaction was carried out at room temperature for 3 hours. TLC monitoring was performed. After the reaction was complete, the reaction was quenched with saturated Na₂S₂O₃ (10 mL), and the mixture was extracted with ethyl acetate (15 mL × 3). The organic layer was dried over anhydrous Na₂SO₄, filtered, concentrated, and purified by column chromatography to obtain Example 77 (26.0 mg, 63%). 1 H NMR(400MHz,DMSO-d6,ppm)δ:8.04(d,J=8.4Hz,1H),7.94(s,1H),7.71(d,J=8.0Hz,1H),7.58–7.43(m,2H),7.37(t, J=8.4Hz,2H),5.19(brs,1H),4.55(s,2H),4.23(s,2H),3.78(t,J=5.6Hz,2H),3.67(s,2H),3.25(t,J=5.6Hz,2H). 19F NMR (377MHz, DMSO-d6, ppm) δ: -59.59 (s, 3F), -61.25 (s, 3F), -112.77 (s, 1F). ESI-MS[M+H] + :526.0.
[0365] The synthesis methods for Examples 78-118 are the same as those for Example 76, and the synthesis methods for Examples 119-145 are the same as those for Example 77. Example 86 was obtained by reacting intermediate 76-2 with acetonitrile (1 mL) in a solution of 1 M hydrochloric acid (1 equiv.); Example 87 used n-butyllithium as a base; Example 90 was obtained by reacting intermediate 76-2 with acetonitrile (1 mL) in a solution of ammonia (≥28%, 0.5 mL). The terminal amino groups in Examples 82, 104-112, 135, 137, and 138 all underwent Boc protection and deprotection reaction steps. Commercially available aniline and carboxylic acid derivatives are not listed in the table.
[0366] Table 6: Examples 78-145
[0367] Example 146 N-(4-(4-acryloylpiperazin-1-yl)but-2-yn-1-yl)-2-(2,4-bis(trifluoromethyl)phenyl)-N-(4-fluorophenyl)acetamide
[0368] Example 146 Synthesis
[0369] Using Example 105 and acryloyl chloride as raw materials, the synthesis was carried out in accordance with the method of Example 67. 1 H NMR (400MHz, DMSO-d6, ppm) δ: 8.05 (d, J = 8.0Hz, 1H), 7.95 (s, 1H), 7.69 (d, J = 8.0Hz, 1H), 7.55–7.45 (m, 2H), 7.39 (t, J = 8.8Hz, 2H), 6. 80(dd,J=16.8,10.4Hz,1H),6.16(dd,J=16.8,2.0Hz,1H),5.75(dd,J=10.4,2.0Hz,1H),4.57(s,2H),4.10–3.58(m,8H),2.87(s,4H). 19F NMR (377MHz, DMSO-d6, ppm) δ: -59.53 (s, 3F), -61.24 (s, 3F), -112.65 (s, 1F). ESI-MS[M+H] + :556.1.
[0370] Example 147 8-(4-(4-(2-(2,4-di(trifluoromethyl)phenyl)-N-(4-fluorophenyl)acetamide)but-2-yn-1-yl)piperazin-1-yl)-8-oxooctanoic acid
[0371] Example 147 Synthesis
[0372] Using Example 105 and octanoic acid as raw materials, the synthesis was carried out with reference to the method of intermediate 76-2. 1 H NMR (400MHz, CDCl3, ppm) δ: 7.86 (s, 1H), 7.78 (d, J = 7.6Hz, 1H), 7.56–7.48 (m, 1H), 7.39–7.31 (m, 2H), 7.21 (t, J = 8.0Hz, 2H) ,4.49(s,2H),4.22–3.69(m,6H),3.64(s,2H),3.33–3.01(m,4H),2.32–2.30(m,4H),1.70–1.56(m,4H),1.42–1.29(m,4H). 19 F NMR (377MHz, CDCl3, ppm) δ: -60.76 (s, 3F), -62.87 (s, 3F), -110.54 (s, 1F). ESI-MS[M+H] + :658.2.
[0373] Example 148 2-(2-(2-(4-(4-(2-(2,4-di(trifluoromethyl)phenyl)-N-(4-fluorophenyl)acetamide)but-2-yn-1-yl)piperazin-1-yl)-2-oxoethoxy)ethoxy)acetic acid
[0374] Example 148 was synthesized using the method described in Example 147. 1 H NMR (400MHz, CDCl3, ppm) δ: 7.85 (s, 1H), 7.78 (d, J = 7.6Hz, 1H), 7.58–7.51 (m, 1H), 7 .41(s,2H),7.24–7.17(m,2H),4.67–3.78(m,12H),3.68(s,6H),3.51–3.03(m,4H). 19F NMR (377MHz, CDCl3, ppm) δ: -60.80 (s, 3F), -62.85 (s, 3F), -110.33 (s, 1F). ESI-MS[M+H] + :662.1.
[0375] Example 149: Methyl 4-(2-(2,4-di(trifluoromethyl)phenyl)-N-(4-fluorophenyl)acetamide)but-2-ynyl ester; Example 150: 4-(2-(2,4-di(trifluoromethyl)phenyl)-N-(4-fluorophenyl)acetamide)but-2-ynyl acid; and Example 151: 4-(2-(2,4-di(trifluoromethyl)phenyl)-N-(4-fluorophenyl)acetamide)-N-(2-(dimethylamino)ethyl)but-2-ynyl amide.
[0376] Synthetic route and method:
[0377] (1) Synthesis of intermediate 149-1
[0378] Methyl 4-hydroxy-2-butyrate (220 mg, 1.92 mmol) and triphenylphosphine (758 mg, 2.89 mmol) were dissolved in DCM (10 mL), and NBS (514 mg, 2.89 mmol) was added at 0 °C. The reaction was carried out at room temperature for 12 hours under TLC monitoring. After the reaction was completed, the mixture was concentrated and purified by column chromatography to obtain intermediate 149-1 (313 mg, 91% yield).
[0379] (2) Synthesis of intermediate 149-2
[0380] Intermediate 149-1 (283 mg, 1.60 mmol) and 4-fluoroaniline (177 mg, 1.60 mmol) were dissolved in DMF (15 mL), and KHCO3 (160 mg, 1.60 mmol) was added. The mixture was reacted at room temperature for 12 hours. TLC monitoring was performed. After the reaction was complete, H2O (50 mL) was added, and the mixture was extracted with ethyl acetate (50 mL × 3). The organic layer was washed with H2O (50 mL × 3), dried over anhydrous Na2SO4, filtered, concentrated, and purified by column chromatography to obtain intermediate 149-2 (308 mg, 80% purity).
[0381] (3) Synthesis of Example 149
[0382] Intermediate 149-2 (258 mg, 1.24 mmol), 2,4-bis(trifluoromethyl)phenylacetic acid (341 mg, 1.24 mmol), and DIPEA (804 mg, 6.22 mmol) were dissolved in THF (10 mL). T4P (2.24 g, 3.11 mmol, 50 wt% in EtOAc) was added at 0 °C, and the reaction was carried out at room temperature for 12 hours. The reaction was monitored by TLC. After completion, the mixture was concentrated and purified by prep-HPLC to obtain Example 149 (170 mg, 29% yield for two steps). 1 H NMR(400MHz,DMSO-d6,ppm)δ:8.05(d,J=8.4Hz,1H),7.95(s,1H),7.72(d,J=8 .0Hz,1H),7.56–7.46(m,2H),7.42(t,J=8.4Hz,2H),4.70(s,2H),3.71(s,5H). 19 F NMR (377MHz, DMSO-d6, ppm) δ: -59.60 (s, 3F), -61.25 (s, 3F), -112.52 (s, 1F). ESI-MS[M+H] + :462.0.
[0383] (4) Synthesis of Example 150
[0384] Example 149 (140 mg, 0.30 mmol) was dissolved in DCE (7 mL), and Me3SnOH (164 mg, 0.91 mmol) was added. The mixture was reacted at 80 °C for 2 hours. After the reaction was completed by TLC monitoring, the mixture was concentrated and purified by prep-HPLC to obtain Example 150 (130 mg, 93% yield). 1 H NMR (400MHz, DMSO-d6, ppm) δ: 13.72 (brs, 1H), 8.05 (d, J = 8.0Hz, 1H), 7.95 (s, 1H), 7.7 2(d,J=8.0Hz,1H),7.57–7.45(m,2H),7.42(t,J=8.8Hz,2H),4.64(s,2H),3.70(s,2H). 19 F NMR (377MHz, DMSO-d6, ppm) δ: -59.59 (s, 3F), -61.26 (s, 3F), -112.62 (s, 1F). ESI-MS[M+H] + :447.95.
[0385] (5) Synthesis of Example 151
[0386] Example 150 (24 mg, 53.4 μmol), N,N-dimethylethylenediamine (5.7 mg, 64 μmol), and DIPEA (20.7 mg, 160 μmol) were dissolved in DMF (1 mL), and HATU (24.3 mg, 64 μmol) was added at 0 °C. The reaction was carried out at room temperature for 1 hour. After the reaction was completed, the solution was concentrated and purified by prep-HPLC to obtain Example 151 (4.4 mg, 15% yield). 1 H NMR(400MHz,DMSO-d6,ppm)δ:8.52(s,1H),8.05(d,J=8.4Hz,1H),7.95(s,1H),7.71(d,J=8.0Hz,1H),7.56–7.50 (m,2H),7.41(t,J=8.8Hz,2H),4.62(s,2H),3.69(s,2H),3.19(d,J=6.0Hz,2H),2.45–2.39(m,2H),2.24(s,6H). 19 F NMR (377MHz, DMSO-d6, ppm) δ: -59.53 (s, 3F), -61.25 (s, 3F), -112.63 (s, 1F). ESI-MS[M+H] + :517.9.
[0387] Example 152 2-(2,4-Di(trifluoromethyl)phenyl)-N-(4-fluorophenyl)-N-(4-(4-methylpiperazin-1-yl)-4-oxobut-2-yn-1-yl)acetamide
[0388] Example 152 was synthesized according to Example 150. (23.5 mg, 79% yield). 1 H NMR (400MHz, CDCl3, ppm) δ: 7.87 (s, 1H), 7.80 (d, J = 8.0Hz, 1H), 7.48 (d, J = 8.0Hz, 1H), 7.36– 7.28(m,2H),7.21(t,J=8.4Hz,2H),4.86–4.03(m,4H),3.88–3.16(m,6H),2.92–2.50(m,5H). 19 F NMR (377MHz, CDCl3, ppm) δ: -60.72 (s, 3F), -62.92 (s, 3F), -110.33 (s, 1F). ESI-MS[M+H] + :529.8.
[0389] Example 153 2-(2,4-Di(trifluoromethyl)phenyl)-N-(4-fluorophenyl)-N-(4-(piperazin-1-yl)but-2-yn-1-yl-4,4-d2)acetamide
[0390] Synthetic route and method:
[0391] (1) Synthesis of intermediate 153-2
[0392] Intermediate 153-2 was synthesized using the method described in 149-2.
[0393] (2) Synthesis of intermediate 153-3
[0394] Intermediate 153-2 (100 mg, 0.247 mmol), deuterated paraformaldehyde (63.2 mg, 1.97 mmol), and tert-butylpiperazine carboxylate (231 mg, 1.23 mmol) were dissolved in 1,4-dioxane (4 mL), and Cu(OAc)₂ (22.4 mg, 0.123 mmol) was added. The reaction was carried out at 110 °C for 3 hours under nitrogen protection. After the reaction was completed, the mixture was concentrated and purified by prep-HPLC to obtain intermediate 153-3 (90.0 mg, 60% yield).
[0395] (3) Synthesis of Example 153
[0396] Intermediate 153-3 (80.0 mg, 0.132 mmol) was dissolved in DCM (3 mL). TFA (1 mL) was added at 0 °C, and the reaction was carried out at room temperature for 1 hour. After the reaction was completed by TLC monitoring, the solution was concentrated to obtain Example 153 (63.3 mg, 91% yield). 1 H NMR (400MHz, DMSO-d6, ppm) δ: 8.04 (d, J = 8.0 Hz, 1H), 7.94 (s, 1H), 7.69 (d, J = 8.0 Hz,1H),7.56–7.25(m,4H),4.52(s,2H),3.67(s,2H),3.14(s,4H),2.70(s,4H). 19 F NMR (377MHz, DMSO-d6, ppm) δ: -59.59 (s, 3F), -61.28 (s, 3F), -112.87 (s, 1H). ESI-MS[M+H] + :503.9.
[0397] Example 154 2-(2,4-Di(trifluoromethyl)phenyl)-N-(4-fluorophenyl)-N-(4-(piperazin-1-yl)but-2-yn-1-yl-1,1,4,4-d4)acetamide and Example 155 2-(2,4-Di(trifluoromethyl)phenyl)-N-(4-fluorophenyl)-N-(4-(piperazin-1-yl)but-2-yn-1-yl-1,1-d2)acetamide
[0398] Examples 154 and 155 were synthesized with reference to Examples 1 and 153.
[0399] Example 154: 1 H NMR (400MHz, CD3OD) δ: 8.26 (m, 2H), 7.99 (m, 1H), 7.87–7.80 (m, 2H), 7.64 (t, J = 8.6Hz, 2H), 4.09 (s, 2H), 3.66 (m, 8H). 19 F NMR (377MHz, DMSO-d6, ppm) δ: -62.06 (m, 3F), -64.38 (m, 3F), -113.87 (s, 1F). ESI-MS[M+H] + :506.2.
[0400] Example 155: 1 H NMR (400MHz, CD3OD) δ: 7.91 (m, 2H), 7.73–7.67 (m, 1H), 7.61–7.53 (m, 2H), 7.30 (t, J = 8.6Hz, 2H), 4.21 (s, 2H), 3.77 (s, 2H), 3.62 (s, 8H). 19 F NMR (377MHz, DMSO-d6, ppm) δ: -62.00 (m, 3F), -64.33 (m, 3F), -113.72 (s, 1F). ESI-MS[M+H] + :504.2.
[0401] Example 156 2-(2,4-Di(trifluoromethyl)phenyl)-N-(4-fluorophenyl)-N-(4-morpholinylbut-2-yn-1-yl-4,4-d2)acetamide
[0402] Example 156 was synthesized with reference to Example 153. 1H NMR(400MHz,DMSO-d6,ppm)δ:8.04(d,J=8.0Hz,1H),7.94(s,1H),7.70(d,J=8.0Hz,1H ),7.53-7.20(m,4H),4.74–4.28(m,2H),3.68(s,2H),3.59–3.47(m,4H),2.30(s,4H). 19 F NMR(377MHz, DMSO-d6,ppm)δ:-59.10–-59.75(m,3F),-60.90–-61.35(m,3F),-113.05(s,1F). ESI-MS[M+H] + :505.1.
[0403] Example 157 2-(2,4-Di(trifluoromethyl)phenyl)-N-(but-3-yn-2-yl)-N-(4-fluorophenyl)acetamide
[0404] Synthetic route and method:
[0405] (1) Synthesis of intermediate 157-1
[0406] Pd2(dba)3 (22.5 mg, 24.6 μmol), 1,1'-binaphthyl-2,2'-bis(diphenylphosphine) (24.5 mg, 39.3 μmol), and toluene (4 mL) were added to a sealed tube and stirred at room temperature for 0.5 h. Then (S)-1-methyl-2-propynylamine (81.5 mg, 1.18 mmol), 1-bromo-4-fluoroaniline (172.1 mg, 0.983 mmol), and sodium tert-butoxide (226.8 mg, 2.36 mmol) were added, and the reaction was carried out at 100 °C for 24 h under nitrogen protection. After the reaction was completed by TLC, ethyl acetate (10 mL) was added, the mixture was filtered and concentrated, and purified by column chromatography to give intermediate 157-1 (50 mg, 31% yield).
[0407] (2) Synthesis of intermediate 157-2
[0408] 2,4-bis(trifluoromethyl)phenylacetic acid (100 mg, 0.367 mmol) was dissolved in anhydrous DCM (5 mL), 1 drop of anhydrous DMF was added, and then thionyl chloride (268 μL, 0.367 mmol) was slowly added. The mixture was stirred at room temperature for 1 hour. After the reaction was completed by TLC, the solution was concentrated, and the crude product 157-2 was used directly for the next step of the reaction.
[0409] (3) Synthesis of Example 157
[0410] Anhydrous DCM (1 mL) solution of intermediate 157-1 (25 mg, 0.153 mmol) and triethylamine (15.5 mg, 0.153 mmol) were added to 157-2 (53.4 mg, 0.184 mmol), and the mixture was stirred at room temperature for 1 hour. After TLC monitoring, saturated sodium bicarbonate (1 mL) was added, followed by extraction with ethyl acetate (5 mL × 3). The mixture was washed with water (3 mL) and brine (3 mL), dried over anhydrous Na₂SO₄, filtered, concentrated, and purified by column chromatography to obtain Example 157 (9.5 mg, 14% yield). 1 H NMR (400MHz, CDCl3, ppm) δ: 7.92 (s, 1H), 7.81 (d, J = 8.4Hz, 1H), 7.68 (d, J = 8.1Hz, 1H), 7.41–7.33 (m, 2H) ,6.99(t,J=8.6Hz,2H),5.77(d,J=8.2Hz,1H),5.02(p,J=7.1Hz,1H),3.77(s,2H),1.46(d,J=6.8Hz,3H). ESI-MS[M+H] + :418.1.
[0411] Example 158 2-(2,4-Di(trifluoromethyl)phenyl)-N-(4-fluorophenyl)-N-(2-methylbut-3-yn-2-yl)acetamide
[0412] Example 158 was synthesized using the method described in Example 157. 1 H NMR (400MHz, CDCl3, ppm) δ: 7.92 (s, 1H), 7.79 (d, J = 8.2Hz, 1H), 7.67 (d, J = 8.1Hz, 1H ),7.40–7.32(m,2H),6.98(t,J=8.7Hz,2H),5.72(s,1H),3.73(s,2H),1.70(s,6H). ESI-MS[M+H] + :432.1.
[0413] Example 159 N-((3-aminobicyclo[1.1.1]pentan-1-yl)methyl)-2-(2,4-di(trifluoromethyl)phenyl)-N-(4-fluorophenyl)acetamide and Example 160 N-(3-((2-(2,4-di(trifluoromethyl)phenyl)-N-(4-fluorophenyl)acetamide)methyl)bicyclo[1.1.1]pentan-1-yl)-5-methyl-1,3,4-oxadiazole-2-carboxamide
[0414] Synthetic route and method:
[0415] (1) Synthesis of intermediate 159-1
[0416] A solution of oxaloyl chloride (41 μL, 0.47 mmol) in anhydrous DCM (1 mL) was cooled to -60 °C, and then a solution of DMSO (87 μL, 1.22 mmol) in DCM (0.2 mL) was added dropwise. The mixture was stirred at -60 °C for 15 minutes. Then, a solution of (3-(hydroxymethyl)bicyclo[1.1.1]pent-1-yl)carbamate tert-butyl (41 μL, 0.47 mmol) in DCM (0.5 mL) was added. The mixture was stirred at -60 °C for 30 minutes, and then triethylamine (41 μL, 0.47 mmol) was added. The mixture was stirred at this temperature for another 30 minutes. After slowly restoring to room temperature, the mixture was quenched with water (2 mL). The organic layer was separated, and the aqueous layer was extracted with DCM (2 mL × 2). The organic layers were combined and washed with ammonium bisulfate (1 M aq, 3 mL) and saturated brine (3 mL), respectively. The mixture was then dried over anhydrous Na₂SO₄. After filtration and concentration, the crude product 159-1 was used directly in the next reaction.
[0417] (2) Synthesis of intermediate 159-2
[0418] 159-1, acetic acid (22.7 mg, 0.379 mmol), and 4-fluoroaniline (84.2 mg, 0.757 mmol) were dissolved in methanol (15 mL) and stirred at room temperature for 1 hour. Then, sodium cyanoborohydride (23.8 mg, 0.379 mmol) was added at 0 °C, and the reaction was carried out at room temperature for 2 hours. The reaction was monitored by TLC. After completion, ethyl acetate (30 mL) was added, and the mixture was washed with NaOH (1N, 10 mL), H₂O (15 mL), and saturated brine (15 mL). The mixture was dried over anhydrous Na₂SO₄, filtered, concentrated, and purified by column chromatography to give intermediate 159-2 (79 mg, 54% yield for two steps).
[0419] (3) Synthesis of intermediate 159-3
[0420] 2,4-bis(trifluoromethyl)phenylacetic acid (100 mg, 0.367 mmol) was dissolved in anhydrous DCM (5 mL), 1 drop of anhydrous DMF was added, and then thionyl chloride (268 μL, 0.367 mmol) was slowly added. The mixture was stirred at room temperature for 1 hour. After the reaction was completed by TLC, the solution was concentrated, and the crude product (159-3) was used directly for the next step of the reaction.
[0421] (4) Synthesis of intermediate 159-4
[0422] Add 3 mL of anhydrous DCM solution (75 mg, 0.245 mmol) of 159-2 and triethylamine (49.5 mg, 0.490 mmol) to 159-3 and stir at room temperature for 15 hours. Monitor the reaction by TLC. After completion, extract with 1 mL of saturated sodium bicarbonate and 3 mL of ethyl acetate (5 mL × 3). Wash with 3 mL of water and 3 mL of brine. Dry the organic phase in anhydrous Na₂SO₄, filter, concentrate, and purify by column chromatography to obtain intermediate 159-4 (62.5 mg, 45% yield).
[0423] (5) Synthesis of Example 159
[0424] Intermediate 159-4 (20 mg, 35.7 μmol) was dissolved in DCM (2 mL) and TFA (345.8 mg, 3.03 mmol) was added. The mixture was reacted at room temperature for 0.5 h. After the reaction was complete, the mixture was concentrated and ethyl acetate / saturated NaHCO3 solution (v / v = 1 / 1, 4 mL) was added. The mixture was stirred vigorously for 0.5 h. The layers were separated, and the organic layer was washed with ethyl acetate (2 × 3 mL) and saturated brine (3 mL). The mixture was dried over anhydrous sodium sulfate, filtered, concentrated, and purified by prep-HPLC to obtain Example 159 (11.2 mg, 64% yield). 1 H NMR (600MHz, CDCl3, ppm) δ: 7.84 (s, 1H), 7.75 (d, J = 8.1Hz, 1H), 7.49 (d, J = 8.1Hz, 1H), 7.21 (dd, J=8.7,4.7Hz,2H),7.13(t,J=8.3Hz,2H),3.86(s,2H),3.59(s,2H),1.84(brs,2H),1.69(s,6H). ESI-MS[MH]:459.1.
[0425] (6) Example 160 Synthesis
[0426] Example 159 (16.0 mg, 34.8 μmol) and ethyl 5-methyl-1,3,4-diazole-2-carboxylate (9.8 mg, 62.6 μmol) were dissolved in ethanol (0.4 mL) and reacted in a sealed flask at 78 °C for 24 hours under nitrogen protection. The reaction was monitored by TLC. After the reaction was stopped, the mixture was concentrated and purified by TLC to obtain Example 160 (7.1 mg, 32% yield). 1H NMR (600MHz, CDCl3, ppm) δ: 7.85 (d, J = 2.0Hz, 1H), 7.76 (d, J = 7.3Hz, 1H), 7.49 (d, J = 8.1Hz, 1H), 7.39 ( s,1H),7.26–7.22(m,2H),7.16(t,J=8.4Hz,2H),3.92(s,2H),3.60(s,2H),2.61(s,3H),2.10(s,6H). ESI-MS[M+H] + :571.2.
[0427] The synthesis methods of Examples 161-163 are the same as those of Example 159, and the synthesis methods of Examples 164-166 are the same as those of Example 160.
[0428] Table 7: Examples 161-166
[0429] Example 167 2-(2,4-Di(trifluoromethyl)phenyl)-N-(4-fluorophenyl)-N-((2-(2-(piperazin-1-yl)ethyl)-2-azaspiro[3.3]heptane-6-yl)methyl)acetamide, Example 168 2-(2,4-Di(trifluoromethyl)phenyl)-N-(4-fluorophenyl)-N-((2-(2-(4-methylpiperazin-1-yl)ethyl)-2-azaspiro[3.3]heptane-6-yl)methyl)acetamide, and Example 169 2-(2,4-Di(trifluoromethyl)phenyl)-N-(4-fluorophenyl)-N-((2-methyl-2-azaspiro[3.3]heptane-6-yl)methyl)acetamide
[0430] Synthetic route and method:
[0431] (1) Synthesis of intermediate 167-1
[0432] 6-Formyl-2-azaspiro[3.3]heptane-2-carboxylic acid tert-butyl ester (220 mg, 0.971 mmol) and 4-fluoroaniline (120 mg, 1.08 mmol) were dissolved in DCM (10 mL) and stirred at room temperature for 1 hour. Then, sodium triacetoxyborohydride (1.14 g, 5.40 mmol) was added at 0 °C, and the reaction was carried out at room temperature for 12 hours. After the reaction was completed by TLC monitoring, the solution was concentrated and purified by column chromatography to give intermediate 167-1 (300 mg, 96% yield).
[0433] (2) Synthesis of intermediate 167-2
[0434] Intermediate 167-1 (240 mg, 0.746 mmol), 2,4-bis(trifluoromethyl)phenylacetic acid (25.5 mg, 0.0933 mmol), and DIPEA (205 mg, 0.746 mmol) were dissolved in THF (16 mL). T4P (1.07 g, 50 wt.% in EtOAc) was added at 0 °C, and the mixture was stirred at room temperature for 2 hours. After the reaction was completed by TLC monitoring, the solution was concentrated and purified by column chromatography to give 171-2 (393 mg, 91% yield).
[0435] (3) Synthesis of intermediate 167-3
[0436] Intermediate 167-2 (85.0 mg, 0.147 mmol) was dissolved in DCM (2 mL), and TFA (0.5 mL) was added at 0 °C. The mixture was stirred at room temperature for 1 hour. After the reaction was completed by TLC monitoring, the solution was concentrated, and the crude product 167-3 was used directly for the next reaction.
[0437] (4) Synthesis of intermediate 167-4
[0438] A solution of oxaloyl chloride (5.48 g, 43.2 mmol) in anhydrous DCM (80 mL) was cooled to -78 °C, and then DMSO (6.08 g, 77.7 mmol) was added dropwise. The mixture was stirred at -78 °C for 0.5 h. Then, a solution of 1-BOC-4-(2-hydroxyethyl)-piperazine (5.00 g, 21.6 mmol) in DCM (20 mL) was added dropwise. After stirring at -78 °C for 0.5 h, triethylamine (17.9 g, 177 mmol) was added, and stirring continued at this temperature for another 1.5 h. After slowly restoring to room temperature, saturated NaHCO3 (150 mL) was added to quench the reaction. After separating the organic layer, the aqueous layer was extracted with DCM (100 mL × 3). The organic layers were combined and dried over anhydrous Na2SO4. The solution was filtered, concentrated, and separated by column chromatography to give 167-4 (2.78 g, 56% yield).
[0439] (5) Synthesis of intermediate 167-5
[0440] Intermediate 167-3 (123 mg, 0.258 mmol) and intermediate 167-4 (71 mg, 0.310 mmol) were dissolved in DCM (5 mL) and stirred at room temperature for 1 hour. Then, sodium triacetoxyborohydride (274 mg, 1.29 mmol) was added at 0 °C, and the reaction was carried out at room temperature for 12 hours. After the reaction was completed by TLC, the solution was concentrated and purified by column chromatography to obtain intermediate 167-5 (76.8 mg, 43% yield).
[0441] (6) Example 167 Synthesis
[0442] Example 167 used intermediate 167-5 (240 mg, 0.348 mmol) as the starting material and reacted according to the method of intermediate 167-3. After the reaction was completed, the mixture was concentrated and purified by prep-HPLC to obtain Example 167 (58.0 mg, 28% yield). 1 H NMR (400MHz, DMSO-d6, ppm) δ: 8.03 (d, J = 8.0Hz, 1H), 7.94 (s, 1H), 7.66 (d, J = 8.0Hz, 1H), 7.38 (d, J = 6.8Hz, 4H), 4.06 (s, 2H), 3.9 8(s,2H),3.66–3.61(m,4H),3.19(t,J=4.8Hz,2H),3.06(s,4H),2.55(s,4H),2.48–2.46(m,2H),2.28–2.15(m,3H),1.85(s,2H). ESI-MS[M+H] + :587.1.
[0443] (7) Synthesis of Examples 168 and 169
[0444] Examples 168 and 169 were synthesized using Example 167 (38.0 mg, 64.6 μmol) and intermediate 167-3 (68.0 mg, 142 μmol) as raw materials, respectively, following the method of intermediates 167-1 / 167-5. After the reaction was completed, the mixture was concentrated and purified by prep-HPLC to obtain Examples 168 and 169.
[0445] Example 168 (58.0 mg, 28% yield), 1 H NMR(400MHz,DMSO-d6,ppm)δ:8.03(d,J=8.0Hz,1H),7.93(s,1H),7.67(d,J=8.0Hz,1H),7.35(d,J =6.8Hz,4H),3.69–3.56(m,4H),3.02(s,2H),2.95(s,2H),2.38–1.95(m,18H),1.70–1.61(m,2H). ESI-MS[M+H] + :601.1.
[0446] Example 169 (51.0 mg, 69% yield), 1H NMR(400MHz,DMSO-d6,ppm)δ:8.03(d,J=8.0Hz,1H),7.94(s,1H),7.66(d,J=8.0Hz,1H),7.37(d,J=6.8Hz,4H),4.19–4.13(m,1H),4.0 8–4.02(m,1H),3.93–3.89(m,1H),3.85–3.82(m,1H),3.66–3.60(m,4H),2.73(d,J=4.8Hz,3H),2.29–2.12(m,3H),1.93–1.76(m,2H). ESI-MS[M+H] + :489.1.
[0447] The synthesis methods of Examples 170-245 are the same as those of Examples 167-169.
[0448] Table 8: Examples 170-245
[0449] Example 246 2-(2,4-Di(trifluoromethyl)phenyl)-N-(4-fluorophenyl)-N-((1-glycylazine-3-yl)methyl)acetamide
[0450] Synthetic route and method:
[0451] (1) Synthesis of intermediate 246-1
[0452] Example 163 (60.0 mg, 0.138 mmol), BOC-glycine (29.1 mg, 0.165 mmol), and DIPEA (71.1 mg, 0.550 mmol) were dissolved in DMF (2 mL). HATU (78.4 mg, 0.206 mmol) was added at 0 °C, and the reaction was carried out at room temperature for 1 hour. TLC monitoring was performed. After the reaction was complete, H2O (40 mL) was added, and the mixture was extracted with ethyl acetate (30 mL × 3). The organic layer was dried over anhydrous Na2SO4, filtered, concentrated, and purified by prep-HPLC to obtain intermediate 246-1 (48.9 mg, 60% yield).
[0453] (2) Synthesis of Example 246
[0454] Intermediate 246-1 (38.0 mg, 63.9 μmol) was dissolved in DCM (1.2 mL), and TFA (0.4 mL) was added at 0 °C. The mixture was stirred at room temperature for 1 hour. After the reaction was complete, the solution was concentrated and purified by prep-HPLC to obtain Example 246 (25.6 mg, 81% yield). 1 H NMR(400MHz,DMSO-d6,ppm)δ:8.04(d,J=8.0Hz,1H),7.96(d,J=6.8Hz,3H),7.67(d,J=8.0Hz,1H),7.47–7.34(m,4H),4.13(t,J= 8.4Hz,1H),4.03–3.89(m,2H),3.85(dd,J=13.6,7.2Hz,1H),3.79–3.73(m,1H),3.63(s,2H),3.54(d,J=4.0Hz,3H),2.76(s,1H). ESI-MS[M+H] + :491.9.
[0455] The synthesis methods of Examples 247-251 are the same as those of Example 246.
[0456] Table 9: Examples 247-251
[0457] Example 252 2-(2,4-Di(trifluoromethyl)phenyl)-N-((1-(cyclopropanecarbonyl)azacyclobutane-3-yl)methyl)-N-(4-fluorophenyl)acetamide
[0458] Synthetic route and method:
[0459] Example 252 Synthesis
[0460] Example 163 (25.0 mg, 57.6 μmol) was dissolved in anhydrous DCM (1 mL), and triethylamine (5.8 mg, 57.6 μmol) and cyclopropylformyl chloride (6.0 mg, 57.6 μmol) were added. The mixture was reacted at room temperature for 0.5 hours. After the reaction was completed, the mixture was concentrated and purified by TLC to obtain Example 252 (11.1 mg, 37% yield). 1H NMR (400MHz, CDCl3, ppm) δ: 7.85 (d, J=1.8Hz, 1H), 7.80–7.74 (m, 1H), 7.47 (d ,J=8.0Hz,1H),7.18(d,J=6.4Hz,4H),4.31–4.20(m,2H),4.04–3.91(m,2H),3 .73(dd,J=13.7,6.9Hz,1H),3.64–3.54(m,3H),2.87(tq,J=13.8,7.9,6.8Hz, 1H), 1.32 (ddd, J=8.0, 4.6, 3.3Hz, 1H), 0.95–0.89 (m, 2H), 0.74–0.68 (m, 2H). ESI-MS[M+H] + :503.2.
[0461] The synthesis methods of Examples 253-257 are the same as those of Example 252.
[0462] Table 10: Examples 253-257
[0463] Example 258 2-(2,4-Di(trifluoromethyl)phenyl)-N-(4-fluorophenyl)-N-((1-(2-hydroxyethyl)azacyclobutane-3-yl)methyl)acetamide
[0464] Synthetic route and method:
[0465] Example 258 Synthesis
[0466] Example 163 (80.0 mg, 0.183 mmol), 2-bromoethanol (22.9 mg, 0.183 mmol), and DIPEA (71.0 mg, 0.550 mmol) were dissolved in MeCN (3 mL) and reacted at 50 °C for 1 hour. The reaction was monitored by TLC. After completion, the solution was concentrated and purified by prep-HPLC to obtain Example 258 (56.9 mg, 55% yield). 1 H NMR(400MHz,DMSO-d6,ppm)δ:8.03(d,J=8.0Hz,1H),7.93(s,1H),7.67(d,J=8.0Hz,1H),7.43–7.30(m,4H),3.8 3(d,J=7.2Hz,2H),3.61(s,2H),3.35–3.24(m,4H),2.87(t,J=7.2Hz,2H),2.59–2.52(m,1H),2.49–2.46(m,2H). ESI-MS[M+H] + :479.1.
[0467] The synthesis methods of Examples 259-268 are the same as those of Example 258.
[0468] Table 11: Examples 259-268
[0469] Example 269 2-(2,4-Di(trifluoromethyl)phenyl)-N-(4-fluorophenyl)-N-((1-glycamide-azacyclobutane-3-yl)methyl)acetamide
[0470] Synthetic route and method:
[0471] (1) Synthesis of intermediate 269-1
[0472] Example 163 (300 mg, 0.687 mmol) and ethyl glyoxylate (140 mg, 0.687 mmol, 50 wt% in toluene) were dissolved in DCM (10 mL) and stirred at room temperature for 1 hour. Sodium triacetoxyborohydride (728 mg, 3.43 mmol) was added at 0 °C, and the reaction was carried out at room temperature for 12 hours. After the reaction was completed by TLC monitoring, the solution was concentrated and purified by column chromatography to give intermediate 269-1 (300 mg, 84% yield).
[0473] (2) Synthesis of intermediate 269-2
[0474] Intermediate 269-1 (270 mg, 0.517 mmol) and lithium hydroxide (61.9 mg, 2.58 mmol) were dissolved in MeOH (3.5 mL) and water (1.5 mL) and reacted at room temperature for 12 hours. After the reaction was completed, the mixture was concentrated and purified by prep-HPLC to give intermediate 269-2 (201 mg, 79% yield).
[0475] (3) Synthesis of Example 269
[0476] Intermediate 269-2 (40.0 mg, 80.9 μmol), dimethylamine (60.7 μL, 2 M in THF), and DIPEA (20.9 mg, 0.161 mmol) were dissolved in DMF (1 mL). HATU (36.9 mg, 97.0 μmol) was added at 0 °C, and the mixture was stirred at room temperature for 1 hour. The reaction was monitored by TLC. After completion, the mixture was concentrated and purified by prep-HPLC to obtain Example 269 (34.2 mg, 80% yield). 1H NMR(400MHz,DMSO-d6,ppm)δ:8.03(d,J=8.0Hz,1H),7.93(s,1H),7.67(d,J=8.0Hz,1H),7.44–7.31(m,4H),3.81(d ,J=7.2Hz,2H),3.60(s,2H),3.22(t,J=7.2Hz,2H),3.13(s,2H),2.87(s,3H),2.77–2.69(m,5H),2.46–2.44(m,1H). ESI-MS[M+H] + :520.1.
[0477] The synthesis methods of Examples 270-271 are the same as those of Example 269.
[0478] Table 12: Examples 270-271
[0479] Example 272 2-(2,4-Di(trifluoromethyl)phenyl)-N-(4-fluorophenyl)-N-((1-(2-oxo-2-(piperazin-1-yl)ethyl)azacyclobutane-3-yl)methyl)acetamide
[0480] Synthetic route and method:
[0481] (1) Synthesis of intermediate 272-1
[0482] Intermediate 269-2 (60.0 mg, 0.121 mmol), N-BOC-piperazine (34.1 mg, 0.182 mmol), and DIPEA (31.3 mg, 0.242 mmol) were dissolved in DMF (1 mL). HATU (55.3 mg, 0.145 mmol) was added at 0 °C, and the reaction was carried out at room temperature for 1 hour. The reaction was monitored by TLC. After completion, the solution was concentrated and purified by prep-HPLC to obtain intermediate 272-1 (52.0 mg, 65% yield).
[0483] (2) Synthesis of Example 272
[0484] Intermediate 272-1 (47.0 mg, 70.8 μmol) was dissolved in DCM (2 mL), and TFA (0.5 mL) was added at 0 °C. The reaction was carried out at room temperature for 0.5 hours. After TLC monitoring, the solution was concentrated and purified by prep-HPLC to obtain Example 272 (26.2 mg, 65% yield). 1H NMR(400MHz,DMSO-d6,ppm)δ:8.04(d,J=8.0Hz,1H),7.95(s,1H),7.67(d,J=8.0Hz,1H),7.55–7.30(m, 4H),4.34(s,2H),4.16–3.70(m,6H),3.63(s,4H),3.47(s,2H),3.16(s,2H),3.08(s,2H),2.99(s,1H). ESI-MS[M+H] + :560.9.
[0485] Example 273
[0486] 2-(2,4-Di(trifluoromethyl)phenyl)-N-(4-fluorophenyl)-N-(2-((1-(2-oxo-2-(pyrrolidone-1-yl)ethyl)piperidin-4-yl)oxo)ethyl)acetamide
[0487] Example 273 was synthesized using the raw materials from Example 270 and following the method of Example 272. 1 H NMR (400MHz, DMSO-d6, ppm) δ: 8.03 (d, J=8.0Hz, 1H), 7.93 (s, 1H), 7.68 (d, J=8.0Hz, 1H), 7.52–7.20 (m, 4H), 4.13 (s, 2H), 3.84–3.71 (m, 2H), 3.69–3. 42(m,6H),3.37(d,J=6.0Hz,4H),3.28(d,J=11.6Hz,1H),3.02(d,J=10.4H z, 2H), 2.05 (d, J = 14.0Hz, 1H), 1.97–1.75 (m, 6H), 1.65 (d, J = 11.2Hz, 1H). ESI-MS[M+H] + :604.3.
[0488] Example 274 2-(2,4-Di(trifluoromethyl)phenyl)-N-((1-(6-chloropyridazin-3-yl)azacyclobutane-3-yl)methyl)-N-(4-fluorophenyl)acetamide
[0489] Synthetic route and method:
[0490] Example 274 Synthesis
[0491] Example 163 (100 mg, 0.229 mmol), DIPEA (148 mg, 1.14 mmol), and 3,6-dichloropyridazine (102 mg, 0.687 mmol) were dissolved in DMA (2 mL) and microwave-stirred at 100 °C for 2 hours. TLC monitoring was performed. After the reaction was complete, the reaction solution was diluted with water (20 mL) and extracted with ethyl acetate (20 mL × 3). The organic phase was dried over anhydrous sodium sulfate, filtered, concentrated, and purified by column chromatography to obtain Example 274 (80 mg, 60% yield). 1 H NMR(400MHz,DMSO-d6,ppm)δ:8.04(d,J=8.0Hz,1H),7.95(s,1H),7.69(d,J=7.6Hz,1H) ,7.43(m,5H),6.84(d,J=9.2Hz,1H),4.07–3.95(m,4H),3.69–3.61(m,4H),2.89(m,1H). ESI-MS[M+H] + :546.9.
[0492] Example 275 N-(2-((1-(6-aminopyridazin-3-yl)piperidin-4-yl)oxy)ethyl)-2-(2,4-di(trifluoromethyl)phenyl)-N-(4-fluorophenyl)acetamide
[0493] Synthetic route and method:
[0494] Example 275 Synthesis
[0495] Example 184 (40 mg, 0.0809 mmol), potassium phosphate (34.4 mg, 0.162 mmol), and 6-iodopyridazine-3-amine (21.5 mg, 0.097 mmol) were dissolved in DMSO (1 mL). L-hydroxyproline (1.06 mg, 0.008 mmol) and cuprous iodide (3.08 mg, 0.0161 mmol) were added, and the mixture was stirred at 60 °C under nitrogen atmosphere for 12 hours. L-hydroxyproline (1.06 mg, 0.008 mmol) and cuprous iodide (3.08 mg, 0.0161 mmol) were then added to the mixture, and stirring continued at 60 °C under nitrogen atmosphere for another 12 hours. After the reaction was monitored by LCMS, the mixture was filtered and concentrated, and purified by prep-HPLC to obtain Example 275 (2.7 mg, 1.4% yield). 1H NMR(400MHz,DMSO-d6,ppm,TFA salt)δ:13.94(s,1H),8.07–7.86(m,5H),7.68(d,J=8.0Hz,1H),7.48–7.20(m,5H),3.76(d,J=5.2Hz, 2H),3.64(s,4H),3.52(t,J=5.2Hz,3H),3.19–3.08(m,2H),1.83(d,J=10.8Hz,2H),1.52–1.35(m,2H). ESI-MS[M+H] + :586.0.
[0496] Example 276 N-(2-((1-(5-aminopyrazin-2-yl)azacyclobutane-3-yl)oxy)ethyl)-2-(2,4-di(trifluoromethyl)phenyl)-N-(4-fluorophenyl)acetamide
[0497] Synthetic route and method:
[0498] (1) Synthesis of intermediate 276-1
[0499] Example 179 (100 mg, 0.214 mmol), 2-chloro-5-nitropyrazine (41.0 mg, 0.257 mmol), and triethylamine (43.3 mg, 0.428 mmol) were dissolved in DMF (3 mL) and reacted at 50 °C for 3 hours. After the reaction was complete, the solution was concentrated and purified by column chromatography to give intermediate 276-1 (107 mg, 85% yield).
[0500] (2) Example 276 Synthesis
[0501] Intermediate 276-1 (107 mg, 0.181 mmol) and Pd / C (17.4 mg, 10 wt.%) were dissolved in methanol (5 mL) and reacted at room temperature under a hydrogen atmosphere (15 Psi) for 1 hour. After the reaction was complete, the mixture was filtered, concentrated, and purified by column chromatography to obtain Example 276 (61 mg, 59% yield). 1H NMR(400MHz,DMSO-d6,ppm)δ:8.02(d,J=8.0Hz,1H),7.93(s,1H),7.69(d,J=8.0Hz,1H),7.51(d,J=1.6Hz,1H),7.47–7.37(m,2H ),7.37–7.25(m,3H),5.47(s,2H),4.36–4.25(m,1H),4.02–3.90(m,2H),3.78(t,J=5.6Hz,2H),3.64(s,2H),3.58–3.41(m,4H). ESI-MS[M+H] + :558.1.
[0502] Example 277 2-(2,4-Di(trifluoromethyl)phenyl)-N-(4-fluorophenyl)-N-((3-((2-(4-methylpiperazin-1-yl)ethyl)amino)bicyclo[1.1.1]pentan-1-yl)methyl)acetamide
[0503] Synthetic route and method:
[0504] (1) Synthesis of intermediate 277-1
[0505] Intermediate 277-1 was synthesized using the same method as intermediate 167-5 (the product contains 1% acetic acid).
[0506] (2) Synthesis of intermediate 277-2
[0507] Intermediate 277-1 (90 mg, 0.133 mmol, containing 1% acetic acid), trifluoroacetic anhydride (33.5 mg, 0.160 mmol), and DIPEA (51.6 mg, 0.400 mmol) were dissolved in DCM (5 mL) and reacted at room temperature for 1 hour. After the reaction was complete, the solution was concentrated and separated by column chromatography to obtain intermediate 277-2 (30 mg, 31% yield).
[0508] (3) Synthesis of intermediate 277-3
[0509] Intermediate 277-2 (30 mg, 41.8 μmol) was dissolved in DCM (2 mL), and TFA (0.5 mL) was added at 0 °C. The reaction was carried out at room temperature for 1 hour. After the reaction was completed by TLC monitoring, the solution was concentrated to obtain crude intermediate 277-3 (30 mg), which was directly used in the next step of the reaction.
[0510] (4) Synthesis of intermediate 277-4
[0511] Intermediate 277-3 (25.7 mg, 41.7 μmol) and paraformaldehyde (1.88 mg, 62.5 μmol) were dissolved in DCM (2 mL) and stirred at room temperature for 1 hour. Sodium triacetoxyborohydride (44.2 mg, 208 μmol) was added at 0 °C, and the reaction was continued at room temperature for 12 hours. After TLC monitoring, the mixture was concentrated and purified by prep-HPLC to obtain intermediate 277-4 (21.0 mg, 80% yield).
[0512] (5) Synthesis of Example 277
[0513] Hydrochloric acid (2 mL, 6 M) was added to intermediate 277-4 (17.0 mg, 27.0 μmol), and the reaction was carried out at 80 °C for 2 hours. After the reaction was completed by TLC monitoring, the mixture was concentrated and purified by prep-HPLC to obtain Example 277 (4.5 mg, 25% yield). 1 H NMR(400MHz,DMSO-d6,ppm)δ:8.03(d,J=8.0Hz,1H),7.93(s,1H),7.68(d,J=8.0Hz,1H),7.46(dd,J=8.8,5.2Hz,2H), 7.34(t,J=8.8Hz,2H),3.81(s,2H),3.67(s,2H),2.47(d,J=6.8Hz,2H),2.38–2.17(m,10H),2.12(s,3H),1.50(s,6H). ESI-MS[M+H] + :587.2.
[0514] Example 278 2-(2,4-Di(trifluoromethyl)phenyl)-N-(4-fluorophenyl)-N-((6-((2-(4-methylpiperazin-1-yl)ethyl)amino)spiro[3.3]heptane-2-yl)methyl)acetamide
[0515] Synthetic route and method:
[0516] (1) Synthesis of intermediate 278-4
[0517] Intermediate 278-1 was synthesized with reference to intermediate 167-5; intermediate 278-4 was synthesized with reference to intermediate 277-4 using intermediate 278-1 as the raw material.
[0518] (2) Synthesis of Example 278
[0519] Methanol (4 mL) and water (0.8 mL) were added to intermediate 278-4 (98.0 mg, 0.138 mmol) and potassium carbonate (38.0 mg, 0.275 mmol), and the mixture was reacted at room temperature for 12 hours. After the reaction was completed by TLC monitoring, the mixture was concentrated and purified by prep-HPLC to obtain Example 278 (20.7 mg, 24% yield). 1 H NMR (400MHz, DMSO-d6, ppm) δ: 8.03 (d, J = 8.0Hz, 1H), 7.93 (s, 1H), 7.67 (d, J = 8.0Hz, 1H), 7.35 (d, J = 6.8Hz, 4H), 3.71–3.53 (m, 4H), 2. 99–2.88(m,1H),2.44–2.14(m,14H),2.12(s,3H),2.08–2.02(m,1H),1.98(d,J=8.0Hz,1H),1.85(t,J=9.2Hz,1H),1.63-1.46(m,4H). ESI-MS[M+H] + :615.3.
[0520] Example 279
[0521] 4-(2-(2,4-bis(trifluoromethyl)phenyl)-N-(4-fluorophenyl)acetamide)-N-carbamoylbutyramide
[0522] Synthetic route and method:
[0523] (1) Synthesis of intermediate 279-1
[0524] Intermediate 279-1 was synthesized with reference to intermediate 167-2;
[0525] (2) Synthesis of intermediate 279-2
[0526] Intermediate 279-1 (170 mg, 0.363 mmol) was dissolved in a methanol / water mixture (2.8 mL / 1.2 mL), and lithium hydroxide (43.5 mg, 1.81 mmol) was added. The reaction was carried out at room temperature for 1 hour. After the reaction was completed, the solution was concentrated and purified by prep-HPLC to obtain intermediate 279-2 (124 mg, 75% yield).
[0527] (3) Synthesis of intermediate 279-3
[0528] Intermediate 279-2 (54 mg, 0.119 mmol), BOC-guanidine (28.6 mg, 0.178 mmol), and DIPEA (38.5 mg, 0.297 mmol) were dissolved in DMF (4 mL). HATU (54.3 mg, 0.143 mmol) was added at 0 °C, and the reaction was carried out at room temperature for 1 hour. The reaction was monitored by TLC. After completion, the solution was concentrated and purified by prep-HPLC to obtain intermediate 279-3 (60.0 mg, 85% yield).
[0529] (4) Synthesis of Example 279
[0530] Intermediate 279-3 (55.0 mg, 92.4 μmol) was added to HCl / ethyl acetate (4 M, 0.5 mL), and the reaction was carried out at room temperature for 12 hours. After the reaction was completed by TLC monitoring, the mixture was concentrated and purified by prep-HPLC to obtain Example 279 (21.5 mg, 46% yield). 1 H NMR (400MHz, DMSO-d6, ppm) δ: 11.71 (s, 1H), 8.44–8.08 (m, 4H), 8.03 (d, J = 8.0Hz, 1H), 7.93 (s, 1H), 7.73 (d, J = 8. 0Hz,1H),7.52–7.42(m,2H),7.38(t,J=8.8Hz,2H),3.71–3.60(m,4H),2.48–2.45(m,2H),1.70(p,J=6.8Hz,2H). ESI-MS[M+H] + :492.9.
[0531] Example 280 N-(2-(3-aminoazacyclobutane-1-yl)ethyl)-2-(2,4-di(trifluoromethyl)phenyl)-N-(4-fluorophenyl)acetamide
[0532] Synthetic route and method:
[0533] (1) Synthesis of intermediate 280-1
[0534] Intermediate 280-1 was synthesized with reference to intermediate 167-2;
[0535] (2) Synthesis of intermediate 280-2
[0536] Intermediate 280-1 (1.26 g, 2.5 mmol) was dissolved in ethanol (30 mL), and Pd / C (270 mg, 2.5 mmol) was added. The mixture was reacted at room temperature for 12 hours under 15 Psi hydrogen atmosphere. After the reaction was completed, the mixture was filtered and concentrated to obtain crude intermediate 280-2 (1.02 g), which was directly used in the next step of the reaction.
[0537] (3) Synthesis of intermediate 280-3
[0538] Intermediate 280-2 (200 mg, 0.486 mmol) was dissolved in DCM (6 mL), and Desmond oxidant (412 mg, 0.972 mmol) was added at 0 °C. The reaction was carried out at room temperature for 2 hours. After the reaction was completed, the mixture was filtered through diatomaceous earth, the filtrate was concentrated, and purified by column chromatography to obtain intermediate 280-3 (167 mg, 84% yield).
[0539] (4) Synthesis of Example 280
[0540] Example 280 was synthesized using intermediate 280-3 as a starting material, with reference to Example 167 (56.7 mg, 62% yield for two steps). 1 H NMR(400MHz,DMSO-d6,ppm)δ:8.04(d,J=8.0Hz,1H),7.94(s,1H),7.64(d,J=8.0Hz,1H), 7.54(dd,J=8.8,5.2Hz,2H),7.40(t,J=8.8Hz,2H),4.46–4.01(m,5H),3.99-3.48(m,6H). ESI-MS[M+H] + :464.1.
[0541] The synthesis methods of Examples 281-283 are the same as those of Example 280.
[0542] Table 14: Examples 281-283
[0543] Example 284 N-(2-(3-aminoazacyclobutane-1-yl)ethyl)-2-(2,4-di(trifluoromethyl)phenyl)-N-(4-fluorophenyl)acetamide
[0544] Synthetic route and method:
[0545] (1) Synthesis of intermediate 284-1
[0546] 4-(3-bromopropyl)piperazine-1-carboxylic acid tert-butyl ester (1.00 g, 3.24 mmol), 4-fluoroaniline (432 mg, 3.89 mmol), Cs₂CO₃ (3.13 g, 9.6 mmol), and NaI (486 mg, 3.24 mmol) were dissolved in DMF (10 mL) and reacted at room temperature for 12 hours. After TLC monitoring, the mixture was concentrated and purified by column chromatography to give intermediate 284-1 (473 mg, 43% yield).
[0547] (2) Example 284 Synthesis
[0548] Example 284 was synthesized using intermediate 284-1 as a starting material, following the method for intermediate 167-3 (105 mg, 83% yield for two steps). 1 H NMR(400MHz,DMSO-d6,ppm)δ:8.04(d,J=8.0Hz,1H),7.94(s,1H),7.67(d,J=8.0Hz,1H),7.51– 7.42(m,2H),7.38(t,J=8.8Hz,2H),3.68–3.63(m,4H),3.36–2.73(m,10H),1.80–1.64(m,2H). ESI-MS[M+H] + :491.8.
[0549] The synthesis methods of Examples 285-29 are the same as those of Example 284.
[0550] Table 15: Examples 285-29
[0551] Example 291 N-(3-(3-oxa-9-azaspiro[5.5]undecane-9-yl)propyl)-2-(2,4-di(trifluoromethyl)phenyl)-N-(4-fluorophenyl)acetamide
[0552] Synthetic route and method:
[0553] (1) Synthesis of intermediate 291-1
[0554] 4-Fluoroaniline (2.0 g, 18 mmol), 1,3-dibromopropane (3.63 g, 18 mmol), and potassium carbonate (7.46 g, 54 mmol) were dissolved in acetonitrile (10 mL), stirred at room temperature, and monitored by TLC. After the reaction was completed, the mixture was filtered, concentrated, and purified by column chromatography to obtain intermediate 291-1 (2.0 g, 8.62 mmol, 47% yield).
[0555] (2) Synthesis of intermediate 291-2
[0556] Intermediate 291-2 is synthesized using the same method as intermediates 1-5.
[0557] (2) Synthesis of Example 291
[0558] Example 291 was synthesized using intermediate 291-2 (50 mg, 0.1 mmol) as the starting material, following the method of intermediate 291-1, to obtain Example 291 (28 mg, 43% yield). 1 H NMR (600MHz, CDCl3, ppm) δ: 7.83 (s, 1H), 7.75 (dd, J=8.0, 1.9Hz, 1H), 7.48 (d, J=8.0Hz, 1H), 7.22 (dd, J=8.7, 4.7Hz, 2H), 7.15 (t, J=8.4Hz, 2H), 3.71 ( t,J=7.2Hz,2H),3.62(t,J=5.4Hz,4H),3.56(s,2H),2.52(dt,J=15.8,7.2H z, 6H), 1.83 (p, J = 7.5Hz, 2H), 1.62 (t, J = 5.7Hz, 4H), 1.47 (t, J = 5.4Hz, 4H). ESI-MS[M+H] + :561.3.
[0559] Example 292 N-(3-(7-oxa-2-azaspiro[3.5]nonane-2-yl)propyl)-2-(2,4-bis(trifluoromethyl)phenyl)-N-(4-fluorophenyl)acetamide
[0560] Example 292 was synthesized according to the method of Example 291, yielding Example 292 (30 mg, 49% yield). 1 H NMR (600MHz, CDCl3, ppm) δ: 7.84 (s, 1H), 7.75 (dd, J = 8.1, 2.0Hz, 1H), 7.46 (d, J = 8.0Hz, 1H), 7.23 (dd, J = 8.7, 4.7Hz, 2H) ,7.16(t,J=8.3Hz,2H),3.70(t,J=6.9Hz,2H),3.56(m,6H),3.39(s,4H),2.80(dd,J=9.5,6.3Hz,2H),1.81–1.69(m,6H). ESI-MS[M+H] + :533.3.
[0561] Example 293 2-(2,4-Di(trifluoromethyl)phenyl)-N-(4-fluorophenyl)-N-(3-(4-hydroxypiperidin-1-yl)propyl)acetamide
[0562] Synthetic route and method:
[0563] (1) Synthesis of intermediate 293-1
[0564] Intermediate 293-1 was synthesized using the same method as intermediate 284-2.
[0565] (2) Synthesis of Example 293
[0566] Intermediate 293-1 (33 mg, 53 μmol) was dissolved in THF (5 mL), and TBAF (23 μL, 80 μmol) was added. The mixture was stirred at room temperature for 6 hours, and LCMS showed that the starting material reacted completely. The reaction solution was quenched with saturated sodium chloride solution (10 mL) and extracted with ethyl acetate (10 mL × 3). The organic phases were combined, dried over anhydrous sodium sulfate, filtered and concentrated, and purified by prep-HPLC to obtain Example 293 (29 mg, 34% yield). 1 H NMR (400MHz, CDCl3, ppm) δ: 7.84 (s, 1H), 7.76 (d, J = 8.0 Hz, 1H), 7.50 (d, J = 8. 0Hz,1H),7.31–7.25(m,2H),7.17(t,J=8.3Hz,2H),3.84(s,1H),3.72(t,J=6. 9Hz,2H),3.58(s,2H),3.35–3.27(m,1H),2.98(s,2H),2.74–2.52(m,4H),2.0 4(t,J=10.2Hz,2H),2.01–1.85(m,3H),1.71–1.61(m,1H),1.53–1.39(m,1H). ESI-MS[M+H] + :507.2.
[0567] Example 294 2-(2,4-Di(trifluoromethyl)phenyl)-N-(3-(4-(3,3-dimethylureido)piperidin-1-yl)propyl)-N-(4-fluorophenyl)acetamide
[0568] Synthetic route and method:
[0569] Example 294 Synthesis
[0570] Example 285 (30 mg, 59.4 μmol) was dissolved in DCM (2 mL), and N,N'-disuccinimidyl carbonate (22.81 mg, 89.0 μmol) and triethylamine (24.02 mg, 237.4 μmol) were added. The mixture was stirred at room temperature for 1 hour, and the reaction was monitored by TLC. After the starting material had reacted completely, dimethylamine (2.68 mg, 59.4 μmol) was added, and the mixture was stirred at room temperature for 2 hours. After the reaction was completed, the mixture was concentrated and purified by TLC to obtain Example 294 (20.3 mg, 22% yield). 1 H NMR (400MHz, CDCl3, ppm) δ: 7.84 (s, 1H), 7.75 (d, J = 8.1Hz, 1H), 7.48 (d, J = 8.0Hz, 1H) ,7.29–7.25(m,2H),7.20–7.14(m,2H),4.35(d,J=7.7Hz,1H),3.72(t,J=7.1Hz,2H),3 .56(s,2H),3.14–3.04(m,2H),2.87(d,J=1.8Hz,6H),2.60(t,J=7.9Hz,2H),2.33(t, J=11.7Hz,2H),1.99(d,J=13.1Hz,2H),1.91(t,J=7.8Hz,2H),1.71(d,J=12.5Hz,2H). ESI-MS[M+H] + :577.3.
[0571] Example 295 2-(2,4-Di(trifluoromethyl)phenyl)-N-(2-((1-(2-(4-(3,3-dimethylureo)piperidin-1-yl)ethyl)azacyclobutane-3-yl)oxy)ethyl)-N-(4-fluorophenyl)acetamide
[0572] Example 295 was synthesized using Example 211 as the raw material, with reference to Example 294. 1 H NMR (400MHz, DMSO-d6, ppm) δ: 8.03 (d, J = 8.0 Hz, 1H), 7.93 (s, 1H), 7.69 (d, J = 8. 0Hz,1H),7.48–7.18(m,4H),5.87(d,J=7.6Hz,1H),3.99–3.87(m,1H),3.80–3. 47(m,4H),3.45–3.34(m,4H),2.82–2.61(m,10H),2.43(d,J=6.8Hz,3H),2.18( t,J=6.8Hz,2H),1.88(t,J=12.0Hz,2H),1.68–1.53(m,2H),1.45–1.30(m,2H). ESI-MS[M+H]+ :662.2.
[0573] Example 296 (4-(2-(2,4-di(trifluoromethyl)phenyl)-N-(4-fluorophenyl)acetamide)butyl)boronic acid
[0574] Synthetic route and method:
[0575] (1) Synthesis of intermediate 296-1
[0576] 2-(4-bromobutyl)-4,4,5,5-tetramethyl-1,3,2-dioxacycloborane (726 mg, 3.42 mmol) was dissolved in DMF (10 mL), and NaH (164 mg, 4.10 mmol) was added at 0 °C. The reaction was carried out at room temperature for 1 hour. After the reaction was completed by TLC, the solution was concentrated and purified by column chromatography to give intermediate 296-1 (720 mg, 53% yield).
[0577] (2) Synthesis of intermediate 296-2
[0578] Intermediate 296-1 (150 mg, 0.380 mmol) was dissolved in DCM (4 mL), and TFA (1 mL) was added at 0 °C. The reaction was carried out at room temperature for 1 hour. After the reaction was completed by TLC monitoring, the solution was concentrated to obtain crude intermediate 296-2 (112 mg), which was directly used in the next step of the reaction.
[0579] (3) Synthesis of intermediate 296-3
[0580] Intermediate 296-3 (136 mg, 65% yield) was synthesized using intermediate 296-2 as a starting material, following the method for intermediate 167-2.
[0581] (4) Synthesis of Example 296
[0582] Intermediate 296-3 (90 mg, 0.163 mmol) was dissolved in methanol (3 mL), potassium hydrogen fluoride (63.9 mg, 0.819 mmol) was added, and the mixture was stirred at room temperature for 1 hour. The reaction was monitored by TLC. After the reaction was complete, the mixture was concentrated and purified by prep-HPLC to obtain Example 296 (38.9 mg, 48% yield). 1 H NMR (400MHz, DMSO-d6, ppm) δ: 8.02 (d, J = 8.4Hz, 1H), 7.93 (s, 1H), 7.68 (d, J = 8.0Hz, 1H),7.43–7.33(m,4H),3.61–3.57(m,4H),1.41–1.23(m,4H),0.54(t,J=7.6Hz,2H). ESI-MS[M+H]+ :466.0.
[0583] Example 297 (3-(2-(2,4-di(trifluoromethyl)phenyl)-N-(4-fluorophenyl)acetamide)propyl)boronic acid
[0584] Example 297 was synthesized using the method described in Example 296. 1 H NMR(400MHz,DMSO-d6,ppm)δ:8.02(d,J=8.0Hz,1H),7.93(s,1H),7.68(d,J=8.0Hz,1H),7.52–7.2 8(m,6H),3.61(s,2H),3.58–3.48(t,J=7.6Hz,2H),1.56–1.35(m,2H),0.61–0.43(t,J=8.0Hz,2H). ESI-MS[M+H]+:452.0.
[0585] Example 298 6-(2-(2-(2,4-di(trifluoromethyl)phenyl)-N-(4-fluorophenyl)acetamide)ethoxy)-3-hydroxypyridazine 1-oxide
[0586] Synthetic route and method:
[0587] (1) Synthesis of intermediate 298-1
[0588] Benzyl alcohol (2.61 g, 24.1 mmol) was dissolved in THF (30 mL), and NaH (60% in oil, 960 mg, 24.1 mmol) was added at 0 °C. The mixture was stirred at room temperature for 1 hour. Then, 3,6-dichloropyridazine (3.00 g, 20.1 mmol) was added at 0 °C, and the reaction was carried out at room temperature for 2 hours. After the reaction was completed by TLC, the mixture was concentrated and purified by column chromatography to give intermediate 298-1 (4.02 g, 91% yield).
[0589] (2) Synthesis of intermediate 298-2
[0590] Ethylene glycol (5.09 g, 82.0 mmol) was dissolved in DMF (140 mL), and NaH (60% in oil, 980 mg, 24.6 mmol) was added at 0 °C. The mixture was stirred at room temperature for 1 hour. Then, intermediate 298-1 (3.62 g, 16.4 mmol) was added at 0 °C, and the reaction was carried out at 50 °C for 5 hours. The reaction was monitored by TLC. After completion, the mixture was diluted with water (300 mL), extracted with ethyl acetate (300 mL × 3), and the organic layers were combined. The mixture was dried over anhydrous sodium sulfate, filtered, concentrated, and purified by column chromatography to obtain intermediate 298-2 (1.22 g, ~70% purity).
[0591] (3) Synthesis of intermediate 298-3
[0592] Oxaloyl chloride (1.56 g, 12.3 mmol) was dissolved in DCM (20 mL), and DMSO (1.15 g, 14.7 mmol) was added with stirring at -78 °C. The mixture was stirred at -78 °C for 0.5 h. Intermediate 298-2 (1.00 g, 4.06 mmol, ~70% purity, in 4 mL DCM) was added at the same temperature, and the mixture was stirred for 0.5 h. Triethylamine (3.40 g, 33.6 mmol) was added at -78 °C, and the reaction was carried out at -78 °C for 1.5 h. After the reaction was completed by TLC, the mixture was diluted with water (50 mL), extracted with DCM (50 mL × 3), the organic layers were combined, dried over anhydrous sodium sulfate, filtered and concentrated, and purified by column chromatography to obtain intermediate 298-3 (445 mg, 64% yield).
[0593] (4) Synthesis of intermediate 298-5
[0594] Using intermediate 298-3 as a starting material, intermediate 298-5 (340 mg, two-step yield 70%) was synthesized by referring to the method of intermediate 167-2.
[0595] (5) Synthesis of intermediate 298-6
[0596] Intermediate 298-5 (310 mg, 0.520 mmol) was dissolved in DCE (10 mL), and m-CPBA (126 mg, 0.624 mmol) was added at 0 °C. The reaction was carried out at 30 °C for 12 hours. After the reaction was completed by TLC monitoring, the solution was concentrated and purified by column chromatography to obtain intermediate 298-6 (105 mg, 33% yield).
[0597] (6) Example 298 Synthesis
[0598] Intermediate 298-6 (90 mg, 0.147 mmol) was dissolved in DCM (5 mL), and BBr3 (147 mg, 0.588 mmol) was added dropwise at 0 °C. The reaction was carried out at room temperature for 3 hours. The reaction was monitored by TLC. After the reaction was completed, the reaction was quenched with methanol (1 mL), and saturated sodium bicarbonate (30 mL) was added. The mixture was extracted with DCM (30 mL × 3). The organic phases were combined, dried over anhydrous sodium sulfate, filtered, concentrated, and purified by prep-HPLC to obtain Example 298 (15.8 mg, 20% yield). 1H NMR(400MHz,DMSO-d6,ppm)δ:8.02(d,J=8.0Hz,1H),7.93(s,1H),7.73(d,J=8.0Hz,1H),7.61(dd,J=8.8,5.2 Hz,2H),7.40–7.26(m,3H),6.41(d,J=8.8Hz,1H),4.19(t,J=5.2Hz,2H),3.93(t,J=5.2Hz,2H),3.66(s,2H). ESI-MS[M+H] + :520.1.
[0599] Example 299 2-(2,4-bis(trifluoromethyl)phenyl)-N-(2-((1-carbamoylazine-3-yl)oxy)ethyl)-N-(4-fluorophenyl)acetamide
[0600] Synthetic route and method:
[0601] (1) Synthesis of intermediate 299-1
[0602] Example 179 (180 mg, 0.386 mmol) and DIPEA (199 mg, 1.54 mmol) were dissolved in acetonitrile (5 mL), and N,N'-di-BOC-1H-1-guanidinylpyrazole (145 mg, 0.463 mmol) was added dropwise. The reaction was carried out at 50 °C for 2 hours. After the reaction was completed by TLC monitoring, the solution was concentrated and purified by column chromatography to give intermediate 299-1 (103 mg, 38% yield).
[0603] (2) Synthesis of Example 299
[0604] Intermediate 299-1 (100 mg, 0.141 mmol) was dissolved in ethyl acetate (2 mL), and HCl / ethyl acetate (4 mL, 4 M) was added at 0 °C. The reaction was carried out at room temperature for 12 hours. After the reaction was completed, the mixture was lyophilized under reduced pressure to obtain Example 299 (67.5 mg, 93% yield). 1 H NMR(400MHz,DMSO-d6,ppm)δ:8.03(d,J=8.0Hz,1H),7.93(s,1H),7.69(d,J=8.0Hz,1H),7.45(dd,J=8.8,5.2Hz ,2H),7.39–7.30(m,5H),4.30(s,1H),4.26–4.15(m,2H),3.91–3.71(m,4H),3.65(s,2H),3.45(t,J=5.6Hz,2H). ESI-MS[M+H] + :506.9.
[0605] Example 300 4-(2-(2-(2,4-bis(trifluoromethyl)phenyl)-N-(4-fluorophenyl)acetamide)ethoxy)-N-ethylpiperidine-1-carboxamide
[0606] Synthetic route and method:
[0607] Example 300 Synthesis
[0608] Example 184 (30 mg, 60.7 μmol) was dissolved in DCM (2 mL), and ethyl isocyanate (43.1 mg, 0.607 mmol) was added at 0 °C. The reaction was carried out at 30 °C for 8 hours. After the reaction was completed, the mixture was concentrated and purified by prep-HPLC to obtain Example 300 (19.5 mg, 56% yield). 1 H NMR(400MHz,DMSO-d6,ppm)δ:8.03(d,J=8.0Hz,1H),7.94(s,1H),7.68(d,J=8.0Hz,1H),7.48–7.21(m,4H),3.75(t,J=5.6Hz,2H),3.67– 3.55(m,4H),3.50(m,2H),3.36(m,1H),3.02(q,J=7.2Hz,2H),2.92–2.82(m,2H),1.69(m,2H),1.27–1.16(m,2H),0.99(t,J=7.2Hz,3H). ESI-MS[M+H] + :564.2.
[0609] The synthesis methods of Examples 301-303 are the same as those of Example 300.
[0610] Table 16: Examples 301-303
[0611] Example 304 2-(2,4-Di(trifluoromethyl)phenyl)-N-(2-((1-(2-cyanoethyl)piperidin-4-yl)oxy)ethyl)-N-(4-fluorophenyl)acetamide
[0612] Synthetic route and method:
[0613] Example 304 Synthesis
[0614] Example 184 (150 mg, 0.303 mmol) and acrylonitrile were dissolved in ethanol (3 mL) and reacted at 80 °C for 12 hours. After the reaction was stopped by LCMS, the mixture was concentrated and purified by prep-HPLC to obtain Example 304 (34 mg, 20% yield). 1 H NMR(400MHz,DMSO-d6,ppm)δ:8.03(d,J=8.0Hz,1H),7.94(s,1H),7.68(d,J=8.0Hz,1H),7.49–7.25(m ,4H),3.78(s,2H),3.65(s,2H),3.51–3.27(m,7H),3.01(m,4H),2.16–1.86(m,2H),1.84–1.44(m,2H). ESI-MS[M+H] + :546.0.
[0615] Example 305 2-(2,4-Di(trifluoromethyl)phenyl)-N-(2-((1-(2-hydroxyethyl)piperidin-4-yl)oxy)ethyl)-N-(4-fluorophenyl)acetamide
[0616] Synthetic route and method:
[0617] (1) Synthesis of intermediate 305-1
[0618] Example 184 (30 mg, 57 μmol) was dissolved in acetonitrile (10 mL), and benzyl 2-bromoethyl ether (24 mg, 113 μmol) and DIPEA (30 μL, 170 μmol) were added. The reaction was carried out at 50 °C for 1 hour. TLC monitoring was performed. After the reaction was complete, water (200 mL) was added to quench the reaction, and the mixture was extracted with ethyl acetate (300 mL × 3). The organic phases were combined, dried over anhydrous sodium sulfate, filtered, concentrated, and purified by column chromatography to give intermediate 305-1 (20 mg, 56.3% yield).
[0619] (2) Synthesis of Example 305
[0620] 305-1 (20 mg, 32 μmol) was dissolved in methanol (5 mL), and Pd / C (10%, 17 mg, 160 μmol) was added. The reaction was carried out under hydrogen atmosphere for 16 hours. The reaction was monitored by TLC. After the reaction was completed, the mixture was filtered and concentrated, and then purified by Pre-HPLC to obtain Example 305 (3.7 mg, 21% yield). 1H NMR (600MHz, CDCl3, ppm) δ: 7.85 (s, 1H), 7.76 (d, J = 8.1Hz, 1H), 7.47 (d, J = 8.1Hz, 1H), 7.25 (s, 2H), 7.16 (t, J = 8.2Hz, 2H ),3.89–3.83(m,4H),3.60–3.54(m,5H),3.03–2.95(m,4H),2.88(d,J=5.0Hz,2H),2.13–2.06(m,2H),1.87–1.80(m,2H). ESI-MS[M+H] + :537.3.
[0621] Example 306 N-(2-((1-(2-aminoethyl)azacyclobutane-3-yl)oxy)ethyl)-2-(2,4-di(trifluoromethyl)phenyl)-N-(4-fluorophenyl)acetamide
[0622] Synthetic route and method:
[0623] (1) Synthesis of intermediate 306-1
[0624] Intermediate 306-1 was synthesized using Example 179 as the raw material and following the method of Example 258.
[0625] (2) Example 306 Synthesis
[0626] Intermediate 306-1 (111 mg, 0.219 mmol) was dissolved in methanol (5 mL), and Raney Ni (64.4 mg, 10 wt.% in water) was added. The reaction was carried out under hydrogen (15 Psi) for 3 hours. The reaction was monitored by LCMS. After the reaction was completed, the mixture was filtered and concentrated, and then purified by Pre-HPLC to obtain Example 306 (60 mg, 53% yield). 1 H NMR (600MHz, CDCl3, ppm) δ: 8.04 (d, J = 8.0 Hz, 1H), 7.99–7.77 (m, 3H), 7.67 (d, J = 8. 0Hz, 1H), 7.50–7.19 (m, 4H), 4.55–3.61 (m, 9H), 3.47 (d, J = 6.0Hz, 4H), 2.96 (s, 2H). ESI-MS[M+H] + :508.1.
[0627] Example 307 N-(2-(1-(2-amino-3,4-dioxocyclobut-1-en-1-yl)azacyclobutane-3-yl)ethyl)-2-(2,4-di(trifluoromethyl)phenyl)-N-(4-fluorophenyl)acetamide
[0628] Synthetic route and method:
[0629] (1) Synthesis of intermediate 307-1
[0630] Example 170 (200 mg, 0.444 mmol) and dimethyl squaric acid (94.7 mg, 0.666 μmol) were dissolved in methanol (3 mL) and reacted at room temperature for 12 hours. After the reaction was completed by TLC monitoring, the mixture was concentrated and separated by column chromatography to obtain intermediate 307-1 (170 mg, 80% yield).
[0631] (2) Synthesis of Example 307
[0632] Intermediate 307-1 (150 mg, 0.267 mmol) was dissolved in NH3 / methanol (7 mL, 7 M) and reacted at room temperature for 12 hours. After TLC monitoring, the filter cake was collected and dried to obtain Example 307 (95.8 mg, 63% yield). 1 H NMR (400MHz, DMSO-d6, ppm) δ: 8.03 (d, J = 8.0 Hz, 1H), 7.93 (s, 1H), 7.69 (d, J = 8.0 Hz,1H),7.58(s,2H),7.50–7.32(m,4H),4.37(t,J=8.8Hz,2H),3.97(dd,J=8.98 6.0Hz, 2H), 3.70-3.50 (m, 4H), 2.91–2.75 (m, 1H), 1.79 (dd, J = 14.4, 7.2Hz, 2H). ESI-MS[M+H] + :544.1.
[0633] The synthesis methods of Examples 308-312 are the same as those of Example 307.
[0634] Table 17: Examples 308-312
[0635] Example 313 (Z)-2-(2,4-di(trifluoromethyl)phenyl)-N-(4-fluorophenyl)-N-(4-(4-methylpiperazin-1-yl)but-2-en-1-yl)acetamide and Example 314 2-(2,4-di(trifluoromethyl)phenyl)-N-(4-fluorophenyl)-N-(4-(4-methylpiperazin-1-yl)butyl)acetamide
[0636] Synthetic route and method:
[0637] Synthesis of Examples 313 and 314
[0638] Example 116 (70 mg, 0.135 mmol) was dissolved in methanol (2 mL), and Lindlar catalyst (30 mg) was added. The reaction was carried out at room temperature for 6 hours under 15 Psi hydrogen atmosphere. After the reaction was completed, the mixture was filtered and concentrated, and purified by prep-HPLC to obtain Example 313 (15 mg, 21% yield) and Example 314 (8.8 mg, 11% yield).
[0639] Example 313, 1 H NMR(400MHz,DMSO-d6,ppm)δ:8.03(d,J=8.0Hz,1H),7.93(s,1H),7.70(d,J=8.0Hz,1H),7.43–7.31 (m,4H),5.50(s,2H),4.32(d,J=4.4Hz,2H),3.65(s,2H),2.73(d,J=4.4Hz,2H),2.29–1.98(m,11H). ESI-MS[M+H] + :518.3.
[0640] Example 314, 1 H NMR (400MHz, DMSO-d6, ppm) δ: 8.03 (d, J = 8.0 Hz, 1H), 7.93 (s, 1H), 7.68 (d, J = 8.0 Hz, 1H), 7.39 (m, 4H), 3.63 (s, 4H), 2.35–2.07 (m, 13H), 1.39 (s, 4H). ESI-MS[M+H] + :520.0.
[0641] Example 315 2-(2,4-Di(trifluoromethyl)phenyl)-N-(4-fluorophenyl)-N-(4-morpholinobutyl)acetamide
[0642] Synthetic route and method:
[0643] Example 315 Synthesis
[0644] Example 101 (83 mg, 0.164 mmol) was dissolved in methanol (2.5 mL), and Pd / C (10%, 40 mg) was added. The mixture was reacted at room temperature for 3 hours under 15 Psi hydrogen atmosphere. After the reaction was completed, the mixture was filtered, concentrated, and purified by column chromatography to obtain Example 315 (40.2 mg, 48% yield). 1H NMR(400MHz,DMSO-d6,ppm)δ:8.02(d,J=8.0Hz,1H),7.92(s,1H),7.68(d,J=8.0Hz,1H), 7.39(m,4H),3.63(s,4H),3.53(s,4H),3.31(s,2H),2.25(d,J=24.8Hz,4H),1.41(s,4H). ESI-MS[M+H] + :507.1.
[0645] The synthesis methods of Examples 316-317 are the same as those of Example 315.
[0646] Table 18: Examples 316-317
[0647] Example 318 N-(3-(5-aminopyrazin-2-yl)propyl)-2-(2,4-di(trifluoromethyl)phenyl)-N-(4-fluorophenyl)acetamide
[0648] Synthetic route and method:
[0649] (1) Synthesis of intermediate 318-1
[0650] 4-Fluoroaniline (4.67 g, 42 mmol) and potassium carbonate (11.6 g, 84 mmol) were dissolved in DMF (100 mL), and 3-bromopropyne (5.00 g, 42 mmol) was added at 0 °C. The reaction was carried out at room temperature for 12 hours. After the reaction was completed by LCMS, the solution was concentrated and purified by column chromatography to give intermediate 318-1 (3.85 g, 58% yield).
[0651] (2) Synthesis of intermediate 318-2
[0652] Intermediate 318-2 was synthesized using the same method as intermediate 76-2.
[0653] (3) Synthesis of intermediate 318-3
[0654] Intermediate 318-2 (220 mg, 0.543 mmol), DIPEA (140 mg, 1.08 mmol), 2-amino-5-iodopyrazine (114 mg, 0.651 mmol), cuprous iodide (20.7 mg, 0.108 mmol), and Pd(dppf)Cl2·DCM (44.3 mg, 54.2 μmol) were dissolved in THF (5 mL) and reacted at room temperature under a nitrogen atmosphere for 1 hour. After the reaction was complete, the mixture was filtered, concentrated, and purified by column chromatography to obtain intermediate 318-3 (152 mg, 56% yield).
[0655] (4) Synthesis of Example 318
[0656] Intermediate 318-3 (140 mg, 0.281 mmol) was dissolved in methanol (10 mL), and Pd / C (10% on Carbon, 15 mg) was added. The mixture was stirred at room temperature for 2 hours under 15 Psi hydrogen atmosphere. Then, Pd / C (10% on Carbon, 89.7 mg) was added again, and the mixture was stirred at room temperature for 12 hours under 15 Psi hydrogen atmosphere. After LCMS monitoring, the reaction was filtered and concentrated, and then purified by prep-HPLC to obtain Example 318 (47.2 mg, 33% yield). 1 H NMR (400MHz, DMSO-d6, ppm) δ: 8.03 (d, J = 8.0 Hz, 1H), 7.93 (s, 1H), 7.77 (d, J = 1.2 Hz, 1H), 7.73–7. 65(m,2H),7.48–7.24(m,4H),6.13(s,2H),3.64(d,J=8.8Hz,4H),2.47(s,2H),1.79–1.61(m,2H). ESI-MS[M+H] + :501.1.
[0657] Example 319 2-amino-5-(3-(2-(2,4-di(trifluoromethyl)phenyl)-N-(4-fluorophenyl)acetamide)propyl)pyrazine 1-oxide and Example 320 2-amino-5-(3-(2-(2,4-di(trifluoromethyl)phenyl)-N-(4-fluorophenyl)acetamide)propyl)pyrazine 1,4-dioxide
[0658] Synthetic route and method:
[0659] Examples 319 and 320
[0660] Example 318 (27.0 mg, 0.0537 mmol) was dissolved in DCM (1 mL), and m-CPBA (9.27 mg, 0.0537 mmol) was added at 0°C. The mixture was stirred at room temperature for 1 hour. m-CPBA (9.27 mg, 0.0537 mmol) was then added to the reaction mixture at 0°C, and the reaction was continued at room temperature for 11 hours. After LCMS monitoring, the mixture was concentrated and purified by prep-HPLC to obtain Example 319 (10.3 mg, 36% yield) and Example 320 (11.0 mg, 38% yield).
[0661] Example 319, 1H NMR (400MHz, DMSO-d6, ppm) δ: 8.02 (d, J = 1.2 Hz, 3H), 7.92 (s, 1H), 7.69 (d, J = 8.0 Hz, 1H), 7. 49–7.21(m,4H),6.74(s,2H),3.71-3.56(m,4H),2.53(d,J=2.4Hz,2H),1.83–1.63(m,2H). ESI-MS[M+H] + :517.1.
[0662] Example 320, 1 H NMR (400MHz, DMSO-d6, ppm) δ: 8.26 (s, 1H), 8.02 (d, J = 8.0Hz, 1H), 7.92 (s, 1H), 7.76 (s, 1H), 7.69 (d, J = 8.0Hz, 1H), 7.4 9(dd,J=8.8,5.2Hz,2H),7.36(t,J=8.8Hz,2H),6.87(s,2H),3.70–3.57(m,4H),2.62–2.54(m,2H),1.75–1.64(m,2H). ESI-MS[M+H] + :533.1.
[0663] Example 321 3-((4-(2-(2,4-di(trifluoromethyl)phenyl)-N-(4-fluorophenyl)acetamide)butyl)sulfonyl)pyridazine 1-oxide
[0664] Synthetic route and method:
[0665] (1) Synthesis of intermediate 321-1
[0666] Intermediate 321-1 was synthesized according to the method of Example 318.
[0667] (2) Synthesis of intermediate 321-2
[0668] Intermediate 321-1 (60.0 mg, 0.136 mmol) and triphenylphosphine (78.8 mg, 0.300 mmol) were dissolved in DCM (5 mL), and NBS (54.5 mg, 0.300 mmol) was added at 0 °C. The reaction was carried out at room temperature for 3 hours. After the reaction was completed, the solution was concentrated and purified by column chromatography to obtain intermediate 321-2 (80.0 mg, 99% yield).
[0669] (3) Synthesis of intermediate 321-3
[0670] Intermediate 321-2 (80.0 mg, 0.159 mmol) and potassium carbonate (43.9 mg, 0.318 mmol) were dissolved in DMF (30 mL), and pyridazine-3-thiol (35.7 mg, 0.318 mmol) was added. The reaction was carried out at room temperature for 2 hours. The reaction was monitored by LCMS. After completion, water (30 mL) was added, and the mixture was extracted with ethyl acetate (30 mL × 3). The organic phases were combined, dried over anhydrous sodium sulfate, filtered, concentrated, and purified by column chromatography to give intermediate 321-3 (76.0 mg, 72% yield).
[0671] (4) Synthesis of Example 321
[0672] Intermediate 321-3 (52.8 mg, 99.3 μmol) was dissolved in DCM (2 mL), and m-CPBA (136 mg, 0.792 mmol) was added. The mixture was stirred at room temperature for 48 hours. The reaction was monitored by LCMS. After completion, the mixture was diluted with water (10 mL), quenched with saturated sodium thiosulfate (0.5 mL), and extracted with ethyl acetate (20 mL × 3). The organic phases were combined, dried over anhydrous sodium sulfate, filtered, concentrated, and purified by column chromatography to obtain Example 321 (10.2 mg, 17% yield). 1 H NMR(400MHz,DMSO-d6,ppm)δ:8.55(d,J=6.4Hz,1H),8.15(dd,J=7.6,6.8Hz,1H),8.00(d,J=8.4Hz,1H),7.91( s,1H),7.74(d,J=8.0Hz,1H),7.65(d,J=8.0Hz,1H),7.36(m,4H),3.54–3.48(m,2H),1.63(m,2H),1.52(m,2H). ESI-MS[M+H] + :508.1.
[0673] Example 322 2-(2,4-Di(trifluoromethyl)phenyl)-N-(4-fluorophenyl)-N-(3-(4-hydroxypiperidin-4-yl)propyl)acetamide
[0674] Synthetic route and method:
[0675] (1) Synthesis of intermediate 322-1
[0676] Intermediate 318-1 (844 mg, 5.65 mmol) and potassium carbonate (1.56 g, 11.3 mmol) were dissolved in DMF (20 mL), and benzyl chloroformate (1.15 g, 6.78 mmol) was added at 0 °C. The reaction was carried out at room temperature for 2 hours. LCMS was used for monitoring. After the reaction was completed, the mixture was filtered, concentrated, and purified by column chromatography to obtain intermediate 322-1 (954.6 mg, 60% yield).
[0677] (2) Synthesis of intermediate 322-2
[0678] Intermediate 322-1 (430 mg, 1.52 mmol) was dissolved in THF (10 mL), and n-butyllithium (0.88 mL, 2.4 M in hexane) was added dropwise under a nitrogen atmosphere at -78 °C, with stirring at -78 °C for 0.5 h. N-Boc-4-piperidinone (495 mg, 2.47 mmol, in 5 mL THF) was then added dropwise at the same temperature, and the reaction was carried out at -78 °C for 2 h. The reaction was monitored by LCMS. After completion, the reaction was quenched with saturated ammonium chloride (20 mL), and extracted with ethyl acetate (30 mL × 3). The organic phases were combined, dried over anhydrous sodium sulfate, filtered, concentrated, and purified by column chromatography to give intermediate 322-2 (167.5 mg, 23% yield).
[0679] (3) Synthesis of intermediate 322-4
[0680] Intermediate 322-4 was synthesized according to the method of Example 318.
[0681] (4) Example 322 Synthesis
[0682] Intermediate 322-4 (62.0 mg, 101 mmol) was dissolved in DCM (4 mL), and TFA (1 mL) was added at 0 °C. The mixture was stirred at room temperature for 1 hour. After the reaction was completed, the solution was concentrated and purified by prep-HPLC to obtain Example 322 (38.8 mg, 75% yield). 1 H NMR (400MHz, DMSO-d6, ppm) δ: 8.37 (s, 1H), 8.19–7.98 (m, 2H), 7.94 (s, 1H), 7.67 (d, J = 8.0Hz, 1H), 7.47 –7.31(m,4H),4.55(s,1H),3.67–3.56(m,4H),3.11–2.94(m,4H),1.59–1.43(m,6H),1.40–1.32(m,2H). ESI-MS[M+H] + :506.9.
[0683] Example 323 2-(2,4-Di(trifluoromethyl)phenyl)-N-(4-fluorophenyl)-N-(3-(2-hydroxy-6-azaspiro[3,4]octane-2-yl)propyl)acetamide
[0684] Example 323 was synthesized using the method described in Example 322.
[0685] 1 H NMR (400MHz, DMSO-d6, ppm) δ: 8.61 (s, 2H), 8.03 (d, J = 8.4Hz, 1H), 7.94 (s, 1H), 7.68 (d, J = 8.0Hz, 1H), 7. 47–7.20(m,4H),4.82(s,1H),3.62(s,4H),3.14–3.01(m,4H),2.06–1.82(m,6H),1.43(d,J=8.0Hz,4H). ESI-MS[M+H] + :533.2.
[0686] Example 324 (E)-2-((4-(2-(2,4-di(trifluoromethyl)phenyl)-N-(4-fluorophenyl)acetamide)-2-methoxybut-2-en-1-yl)sulfonyl)acetic acid
[0687] Synthetic route and method:
[0688] (1) Synthesis of intermediate 324-1
[0689] Intermediate 324-1 was synthesized according to the method of Example 76.
[0690] (2) Example 324 Synthesis
[0691] Intermediate 324-1 (100 mg, 0.18 mmol) was dissolved in methanol (2 mL), and LiOH (8.64 mg, 0.36 mmol, in 4 mL H2O) was added dropwise at 0 °C. The reaction was carried out at room temperature for 1 hour. After the reaction was completed, the solution was concentrated and purified by prep-HPLC to obtain Example 324 (36 mg, 25% yield). 1H NMR (400MHz, CDCl3, ppm) δ: 8.03 (d, J = 8.0Hz, 1H), 7.93 (s, 1H), 7.70 (d, J = 8.0Hz, 1H), 7.43 (m, 2H), 7.35 ( m,2H),4.87(t,J=7.6Hz,1H),4.30(d,J=7.6Hz,2H),4.20(s,2H),4.12(s,2H),3.62(s,2H),3.47(s,3H). ESI-MS[M+H] + :572.1.
[0692] Synthetic from non-commercial raw materials
[0693] Intermediate 27-1
[0694] Synthetic route and method:
[0695] (1) Synthesis of intermediate 27-1-1
[0696] Methyl 3-(tert-butoxycarbonylamino)cyclobutanecarboxylate (500 mg, 2.18 mmol) was dissolved in DCM (99.8%, dried over molecular sieve) (5 mL). DIBAL-H (465 mg, 3.27 mmol, 3 mL) was added dropwise at -78 °C, and the reaction was carried out at -78 °C for 2 hours. After the reaction was stopped by TLC monitoring, water (3 mL) and 15% NaOH aqueous solution (3 mL) were added, followed by the addition of water (3 mL). The solid was filtered off, and the mixture was extracted with ethyl acetate (10 mL). The organic phases were combined and directly evaporated to dryness to give intermediate 27-1-1 (481 mg, 88% yield, 80% purity).
[0697] (2) Synthesis of intermediate 27-1
[0698] Intermediate 27-1-1 (360 mg, 1.81 mmol) was dissolved in MeOH (10 mL), potassium carbonate (499 mg, 3.61 mmol) was added at 0 °C, followed by slow dropwise addition of dimethyl (1-diazo-2-oxopropyl)phosphonate (347 mg, 1.81 mmol). The reaction was carried out at 0 °C for 4 hours under TLC monitoring. After the reaction was stopped, saturated ammonium chloride solution (20 mL) and ethyl acetate (20 mL) were added for extraction. The organic phases were combined, dried over anhydrous sodium sulfate, filtered, concentrated, and purified by column chromatography to obtain 27-1 (270 mg, 76% yield).
[0699] The synthesis method of intermediate 28-1 is the same as that of intermediate 27-1.
[0700] Intermediate 29-1
[0701] Synthetic route and method:
[0702] (1) Synthesis of intermediate 29-1-1
[0703] Trimethylsilylacetylene (1.20 g, 13 mmol) and n-butyllithium (5.18 mL, 13 mmol) were dissolved in THF (20 mL), and stirred at -40 °C for 1 hour under nitrogen protection. 1-tert-butoxycarbonyl-3-pyrrolidone (2.04 g, 11 mmol) was added, and the mixture was stirred at room temperature for 12 hours. The reaction was monitored by TLC, quenched with citric acid solution (50 mL), and extracted with ethyl acetate (50 mL × 3). The organic phases were combined, dried over anhydrous sodium sulfate, filtered, concentrated, and purified by column chromatography to give intermediate 29-1-1 (2.00 g, 65% yield).
[0704] (2) Synthesis of intermediate 29-1
[0705] Intermediate 29-1-1 (2.00 g, 7 mmol) was dissolved in methanol (10 mL), and potassium carbonate (2.93 g, 21 mmol) was added. The mixture was stirred at room temperature for 5 hours. The reaction was monitored by TLC. After the reaction was stopped, water (100 mL) was added, and the mixture was extracted with ethyl acetate (100 mL × 3). The organic phases were combined, dried over anhydrous sodium sulfate, filtered, concentrated, and purified by column chromatography to give intermediate 29-1 (1.00 g, 67% yield).
[0706] The synthesis methods for intermediates 30-1, 32-1 and 33-1 are the same as those for intermediate 29-1.
[0707] Intermediate 162-1
[0708] Synthetic route and method:
[0709] (1) Synthesis of intermediate 162-1-1
[0710] At 0 °C, triethylamine (23.8 mg, 0.235 mmol), HOBT (31.8 mg, 0.235 mmol), and EDCI (45.0 mg, 0.235 mmol) were added to a DMF (1 mL) solution of 6-(BOC-amino)spiro[3.3]heptane-2-carboxylic acid (50 mg, 0.196 mmol) and dimethylhydroxylamine hydrochloride (22.9 mg, 0.235 mmol) and reacted at room temperature for 16 hours. The reaction was monitored by TLC. After stopping the reaction, ethyl acetate (10 mL) was added, followed by washing with 10% citric acid (5 mL), 5% sodium bicarbonate (5 mL), and saturated brine (5 mL), respectively. The organic phase was dried over anhydrous magnesium sulfate, filtered, concentrated, and purified by column chromatography to give intermediate 162-1-1 (52 mg, 89% yield).
[0711] (2) Synthesis of intermediate 162-1
[0712] Intermediate 162-1-1 (52 mg, 0.174 mmol) was dissolved in diethyl ether (1 mL), and lithium aluminum hydride (13.2 mg, 0.348 mmol) was added at 0 °C. The mixture was stirred at room temperature for 20 minutes. The reaction was monitored by TLC. After the reaction was stopped, 0.5 N ammonium bisulfate (2 mL) was added, and the mixture was extracted with ethyl acetate (2 mL × 3). The organic phases were combined and washed with 10% citric acid (2 mL), 5% sodium bicarbonate (2 mL), and saturated brine (2 mL), respectively. The organic phases were dried over anhydrous magnesium sulfate, filtered, concentrated, and used directly in the next reaction step.
[0713] Intermediate 171-1
[0714] Synthetic routes and methods
[0715] 3-(3-hydroxypropyl)azacyclobutane-1-carboxylic acid tert-butyl ester (100 mg, 0.462 mmol) was dissolved in DCM (3.0 mL), and Dys-Martin oxidant (235 mg, 0.554 mmol) was added at 0 °C. The mixture was stirred at room temperature for 3 hours. After the reaction was completed by TLC, the solution was concentrated and purified by column chromatography to give intermediate 171-1 (82.0 mg, 76.9% yield).
[0716] The synthesis methods for intermediates 178-1, 184-1 and 186-1 are the same as those for intermediate 171-1.
[0717] Intermediate 174-1
[0718] Synthetic route and method:
[0719] Ethyl 7-BOC-5,6,7,8-tetrahydroimidazolo[1,2-A]pyrazine-2-carboxylate (1.00 g, 3.37 mmol) was dissolved in tetrahydrofuran (40 mL), and DIBAL-H (6.8 mL, 1 M toluene solution) was added at -78 °C. The mixture was stirred for 1 hour. The reaction was monitored by TLC and LCMS. After the reaction was complete, the mixture was allowed to return to room temperature, and Na₂SO₄·10H₂O was added until no more gas was generated. Anhydrous sodium sulfate was added, and the mixture was filtered. The filtrate was concentrated to give the crude product (1.03 g, 23% purity), which was used directly in the next reaction.
[0720] Intermediate 179-1
[0721] Synthetic route and method:
[0722] (1) Synthesis of intermediate 179-1-1
[0723] N-Boc-3-hydroxyazacyclobutane (5.00 g, 0.0287 mol) was dissolved in DMSO (25 mL), followed by the addition of ethylene oxide (14.4 mL, 0.043 mol) and potassium hydroxide (1.93 g, 0.034 mol). The reaction was carried out at 30 °C for 12 hours. The reaction was monitored by TLC. After the reaction was completed, the reaction solution was diluted with water (100 mL) and extracted with ethyl acetate (50 mL × 3). The organic phases were combined, dried over anhydrous sodium sulfate, filtered, concentrated, and purified by column chromatography to give intermediate 179-1-1 (870 mg, 14% yield).
[0724] (2) Synthesis of intermediate 179-1
[0725] Oxaloyl chloride (1.17 g, 0.00920 mol) was dissolved in DCM (20 mL), and DMSO (0.720 g, 9.20 mmol) was added at -78 °C, followed by stirring for 15 minutes. Intermediate 179-1-1 (1.00 g, 4.60 mmol) was added at the same temperature, and the mixture was stirred at -78 °C for 1 hour. Then, triethylamine (2.33 g, 23 mmol) was added, and the mixture was stirred for another 0.5 hours after returning to room temperature. TLC was performed, and the mixture was diluted with water (30 mL), extracted with DCM (20 mL × 3), dried over anhydrous sodium sulfate, filtered, and concentrated. The crude product 179-1 was used directly in the next reaction.
[0726] The synthesis methods for intermediates 182-1 and 196-1 are the same as those for intermediate 179-1.
[0727] Intermediate 183-1
[0728] Synthetic route and method:
[0729] (1) Synthesis of intermediate 183-1-1
[0730] N-Boc-4-hydroxy-proline methyl ester (2.00 g, 8.12 mmol) and allyl tert-butyl carbonate (2.57 g, 16.2 mmol) were dissolved in THF (30 mL), and DPPB (692 mg, 1.62 mmol) and Pd2(dba)3 (743 mg, 0.812 mmol) were added. The mixture was stirred at room temperature for 0.5 h, and then reacted at 75 °C for 2 h. After the reaction was monitored by LCMS, the mixture was concentrated and purified by column chromatography to give intermediate 183-1-1 (2.30 g, 99% yield).
[0731] (2) Synthesis of intermediate 183-1
[0732] Intermediate 183-1-1 (1.00 g, 3.49 mmol) was dissolved in 1,4-dioxane (12 mL) and water (8 mL), and potassium osmium tetroxide dihydrate (64.3 mg, 0.174 mmol) and sodium periodate (1.49 g, 6.98 mmol) were added. The mixture was stirred at room temperature for 1 hour. The reaction was monitored by TLC. After completion, the mixture was diluted with water (50 mL), extracted with DCM (50 mL × 3), and the organic phases were combined, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated. Intermediate 183-1 (494 mg, 49% yield) was purified by column chromatography.
[0733] Intermediate 185-1
[0734] Synthetic route and method:
[0735] (1) Synthesis of intermediate 185-1-1
[0736] 3-Aminocyclobutanol hydrochloride (1.00 g, 23.0 mmol) was dissolved in tetrahydrofuran (48 mL), and triethylamine (6.98 g, 69 mmol) was added dropwise at 0 °C, with stirring at 0 °C for 10 minutes. A solution of BOC2O (5.52 g, 25.3 mmol) in tetrahydrofuran (8 mL) was added dropwise at 0 °C, and the mixture was stirred at room temperature for 12 hours. The reaction was monitored by TLC. After completion, the solution was concentrated, diluted with water (50 mL), extracted with ethyl acetate (40 mL × 3), and the organic phases were combined, dried over anhydrous sodium sulfate, filtered, concentrated, and purified by column chromatography to give intermediate 185-1-1 (2.05 g, 47% yield).
[0737] (2) Synthesis of intermediate 185-1-2
[0738] Intermediate 185-1-1 (1.00 g, 5.3 mmol) and ethyl diazonate (670 mg, 5.8 mmol) were dissolved in DCM (15 mL). Rhodium acetate (230 mg, 0.5 mmol) was added at 0 °C, and the mixture was stirred at room temperature under N2 atmosphere for 12 hours. The reaction was monitored by TLC. After the reaction was completed, the mixture was concentrated and purified by column chromatography to give intermediate 185-1-2 (562 mg, 40% yield).
[0739] (3) Synthesis of intermediate 185-1-3
[0740] Intermediate 2 (562 mg, 2.05 mmol) was dissolved in methanol (2 mL) and tetrahydrofuran (10 mL), and lithium borohydride (224 mg, 10.3 mmol) was added at 0 °C. The mixture was stirred at room temperature for 12 hours. After the reaction was completed, the mixture was diluted with water (40 mL), extracted with ethyl acetate (50 mL × 3), and the organic phases were combined, dried over anhydrous sodium sulfate, filtered, concentrated, and purified by column chromatography to obtain intermediate 3 (497 mg, 99% yield).
[0741] (4) Synthesis of intermediate 185-1
[0742] Intermediate 185-1 was synthesized using intermediate 185-1-3 as a starting material, following the method of intermediate 179-1. The crude product obtained was directly used in the next reaction step.
[0743] The synthesis methods for intermediates 187-1, 190-1, 191-1 and 194-1 are the same as those for intermediate 185-1.
[0744] Intermediate 188-1
[0745] Synthetic route and method:
[0746] (1) Synthesis of intermediate 188-1-1
[0747] 1-BOC-4-piperidinoxyacetic acid (900 mg, 3.45 mmol), dimethylhydroxylamine hydrochloride (505 mg, 5.18 mmol), and DIEA (1.78 g, 13.8 mmol) were dissolved in tetrahydrofuran (18 mL), and T4P (4.98 g, 50 wt.% ethyl acetate solution) was added dropwise at room temperature. The mixture was stirred at room temperature for 12 hours. The reaction was monitored by LCMS. After completion, the mixture was diluted with water (50 mL) and extracted with ethyl acetate (50 mL × 2). The organic phases were combined, dried over anhydrous sodium sulfate, filtered, and concentrated to give crude product 188-1-1 (1.43 g), which was used directly in the next step.
[0748] (2) Synthesis of intermediate 188-1
[0749] Intermediate 188-1-1 (1.43 g, 4.71 mmol) was dissolved in tetrahydrofuran (30 mL), and methyl magnesium bromide (1.88 mL, 3 M diethyl ether solution) was added dropwise at -78 °C. The mixture was stirred at -78 °C for 1 hour, then raised to 0 °C and stirred for another 1 hour. The reaction was monitored by LC-MS. After completion, the reaction was quenched with saturated ammonium chloride aqueous solution (50 mL) and extracted with ethyl acetate (50 mL × 3). The organic phases were combined, dried over anhydrous sodium sulfate, filtered, and concentrated to obtain crude product 188-1 (972 mg), which was used directly in the next reaction.
[0750] Intermediate 189-1
[0751] Synthetic route and method:
[0752] (1) Synthesis of intermediate 189-1-1
[0753] At 0 °C, NaH (3.95 g, 98.8 mmol, 60% in oil) was added to a solution of N-Boc-4-hydroxypiperidine (5.00 g, 24.7 mmol) in 1,4-dioxane (60 mL), and the mixture was stirred at 0 °C for 0.5 h. Then, 2-bromopropionic acid (3.78 g, 24.7 mmol) was added, and the reaction was carried out at 60 °C for 12 h. The reaction was monitored by LCMS. After the reaction was stopped, the mixture was concentrated, diluted with water (100 mL), and extracted with ethyl acetate (100 mL × 5). The organic phases were combined, dried over anhydrous sodium sulfate, filtered, and concentrated to give crude product 189-1-1 (4.20 g, 59% yield).
[0754] (2) Synthesis of intermediate 189-1-2
[0755] At 0 °C, isobutyl chloroformate (180 mg, 1.32 mmol) was added to a THF (6.0 mL) solution of intermediate 189-1-1 (330 mg, 1.20 mmol) and triethylamine (146 mg, 1.44 mmol), and the mixture was stirred at room temperature for 1 hour. The solid was filtered off, and an aqueous solution of sodium borohydride (136 mg, 3.60 mmol, 6.0 mL) was added at 0 °C. The mixture was stirred at room temperature for 3 hours. After the reaction was stopped by TLC monitoring, the solution was concentrated and purified by column chromatography to give intermediate 189-1-2 (230 mg, 70% yield).
[0756] (3) Synthesis of intermediate 189-1
[0757] Intermediate 189-1 was synthesized using intermediate 189-1-2 as a starting material, following the method of intermediate 187-1. The crude product was directly used in the next reaction step.
[0758] Intermediate 192-1
[0759] Synthetic route and method:
[0760] (1) Synthesis of intermediate 192-1-1
[0761] At 0 °C, NaH (1.76 g, 44.1 mmol, 60% in oil) was added to a DMF (60 mL) solution of tetrahydropyran-4-ol (3.00 g, 29.4 mmol), and the mixture was stirred at 0 °C for 0.5 h. Then, 2-(2-bromoethoxy)tetrahydropyran (9.22 g, 44.1 mmol) was added at the same temperature, and the reaction was carried out at 60 °C for 16 h. The reaction was monitored by TLC. After stopping the reaction, the mixture was diluted with water (20 mL) and extracted with ethyl acetate (150 mL × 3). The organic phases were combined, dried over anhydrous sodium sulfate, filtered, concentrated, and purified by column chromatography to give intermediate 192-1-1 (2.40 g, 34% yield).
[0762] (2) Synthesis of intermediate 192-1-2
[0763] HCl (5.0 mL, in MeOH, 4 M) was added to a DCM (15 mL) solution of intermediate 192-1-1 (2.20 g, 9.60 mmol), and the mixture was stirred at room temperature for 1 hour. After the reaction was stopped by TLC monitoring, the crude intermediate 192-1-2 (1.50 g, 96% yield) was concentrated and used directly in the next step of the reaction.
[0764] (3) Synthesis of intermediate 192-1
[0765] Intermediate 192-1 was synthesized from intermediate 192-1-2 using the same method as intermediate 171-1. The crude product was purified by column chromatography to obtain intermediate 192-1 (100 mg, 30% yield).
[0766] Intermediate 197-1
[0767] Synthetic route and method:
[0768] (1) Synthesis of intermediate 197-1-1
[0769] Ethyl imidazole-2-carboxylate (4.50 g, 32.1 mmol) was dissolved in THF (100 mL), and DHP (27.0 g, 32.1 mmol) and TsOH (1.22 g, 6.42 mmol) were added. The mixture was stirred at 60 °C for 12 hours. After the reaction was completed by LCMS, the solution was concentrated and purified by column chromatography to give intermediate 197-1-1 (6.30 g, 83% yield).
[0770] (2) Synthesis of intermediate 197-1-2
[0771] Intermediate 197-1-1 (5.30 g, 23.6 mmol) was dissolved in THF (120 mL), and lithium aluminum hydride solution (35.4 mL, 1 M) was added at 0 °C. The mixture was stirred at room temperature for 2 hours. The reaction was monitored by LCMS. After completion, the mixture was quenched with ice water, filtered, and the filtrate was concentrated under reduced pressure to obtain the crude product. Column chromatography purification yielded intermediate 197-1-2 (3.68 g, 81% yield).
[0772] (3) Synthesis of intermediates 197-1-3 and 197-1
[0773] Intermediate 197-1-3 is synthesized using the method of intermediate 179-1, and intermediate 197-1 is synthesized using the method of 171-1.
[0774] Intermediate 204-1
[0775] Synthetic route and method:
[0776] (1) Synthesis of intermediate 204-1-1
[0777] Piperidine (1.00 g, 11.7 mmol), potassium carbonate (3.23 g, 23.4 mmol), and 2-bromo-1,1-dimethoxyethane (1.98 g, 11.7 mmol) were dissolved in DMF (20 mL) and stirred at room temperature for 16 hours. The reaction was monitored by TLC. After the reaction was stopped, the solution was diluted with water (50 mL) and extracted with ethyl acetate (80 mL × 3). The organic phases were combined, dried over anhydrous sodium sulfate, filtered, concentrated, and purified by column chromatography to give intermediate 204-1-1 (750 mg, 35% yield).
[0778] (2) Synthesis of intermediate 204-1
[0779] Intermediate 204-1-1 (200 mg, 1.15 mmol) was dissolved in concentrated hydrochloric acid (1.0 mL) and stirred at 100 °C for 2 hours. After stopping the reaction by LCMS, the solution was diluted with water (20 mL), and the pH was adjusted to 10 by adding saturated sodium carbonate aqueous solution (5.0 mL). The solution was extracted with ethyl acetate (30 mL × 3). The organic phases were combined, dried over anhydrous sodium sulfate, filtered, and concentrated to obtain crude product 204-1 (52.0 mg, 34% yield), which was used directly in the next reaction.
[0780] The synthesis methods for intermediates 205-1 and 210-1 are the same as those for intermediate 204-1.
[0781] Intermediate 211-1
[0782] Synthetic route and method:
[0783] (1) Synthesis of intermediate 211-1-1
[0784] 4-tert-Butoxycarbonylaminopiperidine (4.00 g, 19.9 mmol) and potassium carbonate (3.58 g, 25.8 mmol) were dissolved in DMF (40 mL), and 2-bromoethanol (2.74 g, 21.8 mmol) was added. The mixture was reacted at room temperature for 12 hours. After the reaction was stopped by TLC monitoring, the solution was concentrated and purified by column chromatography to give intermediate 211-1-1 (2.27 g, 46% yield).
[0785] (2) Synthesis of intermediate 211-1
[0786] Intermediate 211-1 was synthesized from intermediate 211-1-1 using the same method as intermediate 179-1, and purified by column chromatography to obtain intermediate 211-1 (195 mg, 98% yield).
[0787] The synthesis method of intermediate 240-1 is the same as that of intermediate 211-1.
[0788] Intermediate 250-1
[0789] Synthetic route and method:
[0790] (1) Synthesis of intermediate 250-1-1
[0791] DL-malic acid (2.00 g, 14.9 mmol) and 2,2-dimethoxypropane (5.43 g, 52.1 mmol) were added to toluene (20 mL) and reacted at 110 °C for 6 hours. After the reaction was stopped by TLC, the mixture was concentrated and purified by column chromatography to give intermediate 250-1-1 (2.10 g, 81% yield).
[0792] (2) Synthesis of intermediate 250-1-2
[0793] Intermediate 250-1-1 (500 mg, 2.87 mmol) and potassium carbonate (794 mg, 5.74 mmol) were dissolved in DMF (20 mL), and iodomethane (612 mg, 4.307 mmol) was added at 0 °C. The reaction was carried out at room temperature for 12 hours. After the reaction was stopped by TLC monitoring, the mixture was diluted with water (70 mL), extracted with ethyl acetate (40 mL × 3), dried over anhydrous sodium sulfate, filtered and concentrated, and purified by column chromatography to give intermediate 250-1-2 (454 mg, 84% yield).
[0794] (3) Synthesis of intermediate 250-1
[0795] Intermediate 250-1-2 (100 mg, 0.531 mmol) was dissolved in a mixed solution of acetic acid / H2O / THF (1:1:1, 1.5 mL) and reacted at 40 °C for 12 hours. After the reaction was stopped by TLC monitoring, intermediate 250-1 (72.2 mg, 92% yield) was lyophilized.
[0796] Intermediate 285-1
[0797] Synthetic route and method:
[0798] tert-butyl N-(4-piperidinyl)carbamate (2 g, 9.99 mmol) and 1,3-dibromopropane (2.42 g, 11.98 mmol, 1.22 mL) were dissolved in DMF (20 mL). NaI (149.68 mg, 0.999 mmol) and potassium carbonate (4.14 g, 29.96 mmol) were added, and the mixture was reacted overnight at room temperature. After TLC monitoring, the reaction was stopped, and ethyl acetate (30 mL) was added. The mixture was extracted with water (20 mL × 3). After the aqueous phase was evaporated to dryness, 20 mL of ethyl acetate and 5 mL of methanol were added. The mixture was sonicated to dissolve the solid, and the solid was filtered off. The filtrate was evaporated to dryness to give intermediate 285-1 (362 mg, 11% yield).
[0799] Example: Compound enzyme activity test:
[0800] 1. Experimental objective:
[0801] The purpose of this experiment was to test the ability of the compound of this invention to inhibit the activity of the Polθ polymerase domain. DNA templates and primers were mixed in a 1:1 ratio and heated at 95°C for 5 minutes in annealing buffer, followed by slow cooling to room temperature to obtain substrate DNA. Polθ polymerase was then incubated with the substrate DNA and the compound for 20 minutes. dNTPs were added to initiate the reaction, and the reaction was terminated. Excitation and emission wavelengths of 480 / 520 nm were selected on a full-function microplate reader (SynergyNeo2) to read the data. The IC50 values were obtained by four-parameter fitting of the data. 50 The values were used to determine the inhibitory activity of the compound against Polθ polymerase.
[0802] 2. Experimental Materials and Equipment
[0803] 1) Materials
[0804] Primer: GACGCGAAGG (Shanghai Sangon Biotech)
[0805] Template: CCTTCCTCCCGTGTCTTGTAGTGTCTTGTAGTGTCTTGTACCTTCCCGTCA (Shanghai Sangon Biotech)
[0806] 2) Reagents, manufacturers and product numbers
[0807] Tris HCl pH 7.5, Shanghai Bio-tech, #B548124-0005
[0808] NaCl, Shanghai Sangon Biotech, #A501218-0001
[0809] MgCl2, Sigma-Aldrich, #M1028-100ML
[0810] Glycerol, Sigma-Aldrich, #G5516
[0811] Triton-X100, Sigma-Aldrich, #1001128254
[0812] BSA, Sigma-Aldrich, #v900933-100G
[0813] DTT, Diamond, #A100281-0005
[0814] PicoGreen, invitrogen, #P7589
[0815] 3) Consumables and their part numbers
[0816] Assay plate: 384-well plate, Greiner, #784076
[0817] Compound plate: 384-well full-skirted plate, Axygen, #PCR-384-C
[0818] 4) Equipment and Model
[0819] Liquid Handler, Bravo
[0820] Full function microhole plate detector,SynergyNeo2
[0821] Pipettes: Eppendorf, 3125000010, 3123000225
[0822] Centrifuge: Eppendorf, 5810R
[0823] Ultrapure water system: Milli-Q Direct 16
[0824] Refrigerators: Meiling, YC-725L, DW-YL450
[0825] 3. Experimental Procedure
[0826] 1) The Polθ polymerase fragment (1819-2590) was expressed in E. coli and the target protein with a purity of >90% was obtained. After aliquoting, it was stored in a -80℃ freezer for later use.
[0827] 2) The reaction was carried out in a buffer system (25mM Tris-HCl pH 7.5, 12.5mM NaCl, 0.5mM MgCl2, 5% glycerol, 0.01% Triton-X100, 0.01% BSA, 1mM DTT) and terminated in TE buffer (10mM Tris-HCl, 1mM EDTA, pH 7.5).
[0828] 3) DNA substrate: Mix template 5′-CCTTCCTCCCGTGTCTTGTAGTGTCTTGTAGTGTCTTGTACCTTCCCGTCA-3′ with primer 5′-GACGGGAAGG-3′ in an equimolar ratio, heat in annealing buffer (10mM Tris, pH 7.5-8.0, 50mM NaCl) at 95°C for 5 minutes, and then slowly cool to room temperature.
[0829] 4) Experimental Procedure
[0830] The compound was dissolved in DMSO to a concentration of 10 mM. The compound was serially diluted 3-fold to select 11 test concentrations. 1.2 μL of the compound was taken with Bravo and added to a 384-well compound dilution plate (Axygen, #PCR-384-C) containing 28.8 μL of reaction buffer. 1.2 μL of DMSO was added to the positive control and negative control wells. The highest concentration of the compound in the reaction system was 10 μM, and the content of DMSO in the reaction system was 1%. Using Bravo, 5 μL of Polθ protein, DNA substrate, and the compound were sequentially added to a reaction plate (greiner, #784076) (final concentration of Polθ protein: 1.5 nM; final concentration of DNA substrate: 50 nM). The plate was incubated at room temperature for 20 minutes. Then, 5 μL of dNTP (final concentration: 40 μM) was added, and the plate was incubated at 30°C for 45 minutes. Finally, 5 μL of 5× PicoGreen diluted in TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 7.5) was added to the reaction wells (final concentration of PicoGreen: 1×). The reaction was terminated by shaking and incubating at room temperature for 10 minutes. After incubation, the reaction signal was measured and recorded at 480 / 520 nm using a full-function microhole plate detector. The IC50 of the compound was also recorded. 50 The value is determined by a four-parameter fitting equation.
[0831] 4. Experimental Results:
[0832] Table 19: Inhibitory activity of the compounds in the examples against Polθ polymerase (IC50) 50 ) (POLQ IC 50 A≤100nM; 100nM<B≤1μΜ;C> 1μM)
[0833] Example: Cell proliferation inhibition activity test of the compound:
[0834] 1. Experimental objective:
[0835] The purpose of this experiment was to test the inhibitory activity of the compound of this invention against the DLD1 BRCA2 KO tumor cell model, which is defective in homologous recombination. Using a colony formation assay, five concentrations of the compound of this invention were tested in 6-well plates to assess their inhibitory activity against the proliferation of DLD1 BRCA2 KO cells. After 14 days of culture, crystal violet staining was performed, followed by dissolution of the crystal violet with 10% acetic acid. Data were then read at a wavelength of 570 nm using a SynergyNeo2 microplate reader. The IC50 value was obtained by four-parameter fitting, thus determining the inhibitory activity of the compound against the proliferation of DLD1 BRCA2 KO cells.
[0836] 2. Experimental Materials and Equipment
[0837] 1) Materials
[0838] Cell lines: DLD1 BRCA2 KO (Meisen CTCC)
[0839] 2) Reagents, manufacturers and product numbers
[0840] Culture medium: RPMI 1640 (Gibco, #11875093) + 10% FBS (Gibco, #10099-141C) + 1% antibiotics (Gibco, #15140122)
[0841] Pancreatic enzyme: Gibco, #25200-056
[0842] DMSO: Sigma, #D8418-50ML
[0843] 10% Formaldehyde: Sangon Biotech, #E672001-0500
[0844] Crystal Violet: Diamond, #A100528-0025
[0845] Methanol: BBI, #A601617-0500
[0846] Acetic acid: Greagent, #G73562B
[0847] 3) Consumables and their part numbers
[0848] Six-well plate: Thermo Scientific, #140675
[0849] Sterile pipette tips: Axygen, #T-300-RS, #T-200-YRS, #T-1000-BRS
[0850] Pipettes: Corning Costar, #4488
[0851] 15mL centrifuge tube: Thermo, #339650
[0852] 96-well plate: Corning Costar, ##3599
[0853] 4) Equipment and Model
[0854] Cell incubator: Thermo, HERAcell vios 160i
[0855] Full function microhole plate detector,SynergyNeo2
[0856] Pipettes: Eppendorf, 3125000010, 3123000225
[0857] Centrifuge: Eppendorf, L500-A
[0858] Refrigerator: Haier, HYCD-290
[0859] 3. Experimental Procedure
[0860] 1) The DLD1 BRCA2 KO cell line was cultured in RPMI 1640 (10% FBS + 1% P / S) to the logarithmic growth phase. The cells were then digested with 0.25% trypsin and resuspended in culture medium to 1500 cells per milliliter. 2 mL of cell suspension was seeded into each well of a six-well plate and incubated overnight (24 hours) at 37°C in a 5% CO2 incubator.
[0861] 2) Five stock solutions of the compound (1000×) were obtained by diluting the compound three-fold sequentially with DMSO. Then, 2 μL of each stock solution was added to one of the five wells, leaving 2 μL of DMSO in the last well as a control. The culture medium and compounds were changed every three days in the same manner, and the culture was carried out for a total of 14 days.
[0862] 3) On day 14, aspirate the culture medium from the six-well plate, add 1 mL of 10% neutral formalin solution, and fix at room temperature for 10 minutes; remove the fixative, add 1 mL of 0.05% crystal violet (20% methanol), and stain at room temperature for 15 minutes; remove the staining solution, wash the plate with tap water, and invert the plate to air dry; add 1 mL of 10% acetic acid solution to each well, shake well until the crystal violet is completely dissolved, transfer 100 μL to a 96-well plate, measure the absorbance at 590 nm, and calculate the EC50 using Graphpad Prism 9. The experimental results are shown in Table 20.
[0863] Table 20 (EC 50(DLD1-BRCA2-KO) A≤300nM; 300nM<B≤2.5μΜ;C> 2.5μM)
[0864] The preferred embodiments of the present invention have been described in detail above; however, the present invention is not limited thereto. Within the scope of the inventive concept, various simple modifications can be made to the technical solutions of the present invention, including combinations of various technical features in any other suitable manner. These simple modifications and combinations should also be considered as the content disclosed in the present invention and are all within the protection scope of the present invention.
Claims
1. A compound having the structure shown in Formula I, or an enantiomer, diastereomer, racemate, tautomer, stereoisomer, geometric isomer, nitride, deuterated product, metabolite, or pharmaceutically acceptable salt, ester, solvate, hydrate, isotopically labeled compound, or prodrug thereof. in, A is selected from: R a R b R c R e Each is independently selected from -LBE, R d Selected from hydrogen, deuterium, alkyl, cycloalkyl, heteroalkyl, -OR 15 The alkyl, cycloalkyl, or heteroalkyl groups are each optionally and independently substituted by one or more substituents R'. L is selected from single bond, alkylene, cycloalkylene, spirocycloalkylene, bridged cycloalkylene, heterocycloalkylene, -C(=O)- or any combination thereof, wherein each of the alkylene, cycloalkylene, spirocycloalkylene, bridged cycloalkylene, and heterocycloalkylene is independently and optionally substituted by one or more substituents R'; B is selected from single bond, alkylene, cycloalkylene, spirocyclic, bridged cycloalkyl, heterocyclic, cycloalkenyl, -NR 13 -、-C(=O)NR 13 -, -O-, -C(=O)-, -S-, -S(=O)2-, -S(=O)-, -C(=O)- or any combination thereof, wherein the alkylene, cycloalkylene, spirocycloalkylene, bridged cycloalkylene, heterocycloalkylene, and cycloalkenylene are each optionally and independently replaced by one or more substituents R'. E is selected from hydrogen, alkyl, alkylsilyl, cycloalkyl, spirocyclic, bridged cyclic, heterocyclic, alkenyl, cycloalkenyl, aryl, heteroaryl, ureyl, amino, cyano, -NR 13 R 14 -C(=O)NR 13 R 14 -OR 15 -C(=O)R 16 -C(=O)OR 16 -R 17 C(=O)OR 16 -SR 18 -S(=O)R 19 -S(=O)2R 19 -C(=O)(CH2) p C(=O)OR 16 -C(=O)(CH2OCH2) p C(=O)OR 16 -B(OH)2, wherein the alkyl, alkylsilyl, cycloalkyl, spirocyclic, bridged cyclic, heterocyclic, alkenyl, cycloalkenyl, aryl, heteroaryl, ureyl, amino, and cyano groups are each independently and optionally substituted by one or more substituents R'. R 13 and R 14 Each group is independently selected from hydrogen, hydroxyl, alkyl, alkoxy, cycloalkyl, heterocyclic, cycloalkenyl, ureido, and -C(=O)R. 16 -C(=O)OR 16 -R 17 C(=O)OR 16 -S(=O)2R 19 -C(=O)NR 22 R 23 The alkyl, alkoxy, cycloalkyl, heterocyclic, and cycloalkenyl groups are each optionally and independently substituted by one or more substituents R'. R 15 The group is selected from hydrogen, alkyl, cycloalkyl, aryl, heteroaryl, alkenyl, and heterocyclic groups, wherein the alkyl, aryl, heteroaryl, alkenyl, and heterocyclic groups are optionally substituted by one or more substituents R'; R 16 Selected from hydrogen, alkyl, cycloalkyl, heterocyclic, aryl, heteroaryl, alkenyl, -NR 22 R 23 The alkyl, cycloalkyl, heterocyclic, heteroaryl, and alkenyl groups are each optionally and independently substituted by one or more substituents R'. R 17 Selected from hydrogen and alkylene groups; the alkylene group is optionally substituted with one or more substituents R'; R 18 Selected from hydrogen, alkyl, cyano, aryl, heteroaryl, -C(=O)R 16 -C(=O)OR 16 The alkyl, cyano, aryl, and heteroaryl groups are each optionally and independently substituted by one or more substituents R'. R 19 Selected from hydrogen, alkyl, cycloalkyl, aryl, heteroaryl, -NR 22 R 23 The alkyl, cycloalkyl, aryl, and heteroaryl groups are optionally substituted by one or more substituents R'; R 22 R 23 Each is independently selected from hydrogen, alkyl, ureyl, aryl, and heteroaryl, wherein the alkyl, ureyl, aryl, and heteroaryl groups are optionally substituted by one or more substituents R'; R 1 R 2 R 3 R 4 R 5 R 6 R 7 R 8 R 9 R 10 R 11 Each of the following is independently selected from hydrogen, deuterium, halogen, amino, hydroxyl, mercapto, alkyl, cycloalkyl, aryl, heteroaryl, heterocyclic, and heteroalkyl, wherein each of the alkyl, cycloalkyl, aryl, heteroaryl, heterocyclic, and heteroalkyl groups is optionally independently substituted by one or more substituents R'. Optional, R 1 and R 5 A cycloalkyl, heterocyclic, aryl, or heteroaryl group is formed by linking at any adjacent position, wherein each of the cycloalkyl, heterocyclic, aryl, or heteroaryl group is optionally and independently substituted by one or more substituents R'. Optional, R 7 and R 8 A cycloalkyl, heterocyclic, aryl, or heteroaryl group is formed by linking at any adjacent position, wherein each of the cycloalkyl, heterocyclic, aryl, or heteroaryl group is optionally and independently substituted by one or more substituents R'. R' is selected from deuterium, halogen, hydroxyl, C1-C10 alkyl, C3-C10 cycloalkyl, and one or more substituted C1-C10 alkyl, C1-C10 alkoxy, amino, C1-C10 alkylamino, carboxyl, C1-C10 alkylcarboxyl, C2-C10 heterocyclic, C6-C10 aryl, C1-C10 heteroaryl, and hydroxyl, halogen, cyano, amino, carboxyl, amide, and oxo groups. One or more substituted C2-C10 heterocyclic groups selected from C1-C10 alkyl and C1-C10 alkoxy groups; one or more substituted C6-C10 aryl groups selected from hydroxyl, halogen, cyano, amino, carboxyl, amide, oxo, C1-C10 alkyl and C1-C10 alkoxy groups; and one or more substituted C1-C10 heteroaryl and oxo groups selected from hydroxyl, halogen, cyano, amino, carboxyl, amide, oxo, C1-C10 alkyl and C1-C10 alkoxy groups. Z is selected from single bond, -(CH2) n -, -NH-, -NHC(=O)-, -OP(=O)-, -OP(=O)O-, -P(=O)-, -P(=O)2-, -O-, -S-, -S(=O)-, -S(=O)2-, -Se- and any combination thereof; preferably single bonds, -(CH2) n -、-NH-、-O-; X and Y are each independently selected from C and C, respectively. 12 C (=O), N; R 12 The group is selected from hydrogen, deuterium, halogen, amino, hydroxyl, mercapto, alkyl, cycloalkyl, aryl, heteroaryl, heterocyclic, and heteroalkyl, wherein each of the alkyl, cycloalkyl, aryl, heteroaryl, heterocyclic, and heteroalkyl groups is optionally and independently substituted by one or more substituents R'. W is selected from -O-, -S-, -NR 24 -、-CR 20 R 21 -、-C(=O)-,R 20 R 21 and R 24 Each is independently selected from hydrogen, deuterium, and alkyl groups. U is selected from O and S; preferably O; m and p are each independently selected from integers from 0 to 10, preferably integers from 0 to 5; n is an integer between 1 and 5.
2. The compound according to claim 1, characterized in that, Formula I is shown as formula I-1, I-2 or I-3. A, W, U, R 1 R 2 R 3 R 4 R 5 R 6 R 7 R 8 R 9 R 10 R 11 Define the same formula as I; R 12 The group is selected from hydrogen, deuterium, halogen, amino, hydroxyl, mercapto, alkyl, cycloalkyl, aryl, heteroaryl, heterocyclic, and heteroalkyl, wherein each of the alkyl, cycloalkyl, aryl, heteroaryl, heterocyclic, and heteroalkyl groups is optionally and independently substituted by one or more substituents R'. R' is selected from deuterium, halogen, hydroxyl, C1-C10 alkyl, C3-C10 cycloalkyl, and one or more substituted C1-C10 alkyl, C1-C10 alkoxy, amino, C1-C10 alkylamino, carboxyl, C1-C10 alkylcarboxyl, C2-C10 heterocyclic, C6-C10 aryl, C1-C10 heteroaryl, and hydroxyl, halogen, cyano, amino, carboxyl, amide, and oxo groups. One or more substituted C2-C10 heterocyclic groups selected from C1-C10 alkyl and C1-C10 alkoxy groups, C6-C10 aryl groups selected from hydroxyl, halogen, cyano, amino, carboxyl, amide, oxo, C1-C10 alkyl and C1-C10 alkoxy groups, and C1-C10 heteroaryl and oxo groups selected from hydroxyl, halogen, cyano, amino, carboxyl, amide, oxo, C1-C10 alkyl and C1-C10 alkoxy groups.
3. The compound according to claim 1 or 2, characterized in that, L is selected from single bonds, C1-C30 alkylene groups, C3-C30 cycloalkylene groups, C3-C30 spirocyclic groups, C5-C30 bridged cycloalkyl groups, C2-C30 heterocyclic groups, -C(=O)-, or any combination thereof; each of the alkylene groups, cycloalkylene groups, spirocyclic groups, bridged cycloalkyl groups, and heterocyclic groups is independently and optionally substituted by one or more, preferably 1-3, substituents R'; B is selected from single bond, C1-C30 alkylene group, C3-C30 cycloalkylene group, C3-C30 spirocyclic group, C5-C30 bridged cyclic group, C2-C30 heterocyclic group, C3-C30 cycloalkenyl group, -NR 13 -、-C(=O)NR 13 -, -O-, -C(=O)-, -S, -S(=O)2-, -S(=O)- or any combination thereof, wherein the alkylene, cycloalkylene, spirocycloalkylene, bridged cycloalkylene, heterocycloalkylene, and cycloalkenylene are each independently and optionally substituted by one or more, preferably 1-3, substituents R'. E is selected from hydrogen, C1-C30 alkyl, C1-C30 alkylsilyl, C3-C30 cycloalkyl, C3-C30 spirocyclic, C5-C30 bridged cyclic, C2-C30 heterocyclic, C2-C30 alkenyl, C3-C30 cycloalkenyl, C6-C30 aryl, C1-C30 heteroaryl, ureyl, amino, cyano, -NR 13 R 14 -C(=O)NR 13 R 14 -OR 15 -C(=O)R 16 -C(=O)OR 16 -R 17 C(=O)OR 16 -SR 18 -S(=O)R 19 -S(=O)2R 19 -C(=O)(CH2) p C(=O)OR 16 -C(=O)(CH2OCH2) p C(=O)OR 16 -B(OH)2, wherein the alkyl, alkylsilyl, cycloalkyl, spirocyclic, bridged cyclic, heterocyclic, alkenyl, cycloalkenyl, aryl, heteroaryl, ureyl, amino, and cyano groups are each independently and optionally substituted by one or more, preferably 1 to 3, substituents R'. R 13 and R 14 Each is independently selected from hydrogen, hydroxyl, C1-C30 alkyl, C1-C30 alkoxy, C1-C30 cycloalkyl, C2-C30 heterocyclic, C3-C30 cycloalkenyl, urea, -C(=O)R 16 -C(=O)OR 16 -R 17 C(=O)OR 16 -S(=O)2R 19 -C(=O)NR 22 R 23 The alkyl, alkoxy, cycloalkyl, heterocyclic, cycloalkenyl, and ureidyl groups are each optionally and independently substituted by one or more, preferably 1-3, substituents R'. R 15 The group is selected from hydrogen, C1-C30 alkyl, C3-C30 cycloalkyl, C6-C30 aryl, C1-C30 heteroaryl, C2-C30 alkenyl, and C2-C30 heterocyclic, wherein the alkyl, cycloalkyl, aryl, heteroaryl, alkenyl, and heterocyclic groups are optionally substituted by one or more, preferably 1-3, substituents R'. R 16 Selected from hydrogen, C1-C30 alkyl, C3-C30 cycloalkyl, C2-C30 heterocyclic, C6-C30 aryl, C1-C30 heteroaryl, C2-C30 alkenyl, -NR 22 R 23 The alkyl, cycloalkyl, heterocyclic, heteroaryl, and alkenyl groups are each optionally and independently substituted by one or more, preferably 1-3, substituents R'. R 17 Selected from hydrogen, C1-C30 alkylene groups, wherein the alkylene group is optionally substituted by one or more, preferably 1-3, substituents R'; R 18 Selected from hydrogen, C1-C30 alkyl, cyano, C6-C30 aryl, C1-C30 heteroaryl, -C(=O)R 16 -C(=O)OR 16 The alkyl, cyano, aryl, and heteroaryl groups are each optionally and independently replaced by one or more, preferably 1-3, substituents R'. R 19 Selected from hydrogen, C1-C30 alkyl, C3-C30 cycloalkyl, C6-C30 aryl, C1-C30 heteroaryl, -NR 22 R 23 The alkyl, cycloalkyl, aryl, and heteroaryl groups are optionally substituted by one or more, preferably 1-3, substituents R'; R 22 R 23 Each is independently selected from hydrogen, C1-C30 alkyl, urea, C6-C30 aryl, and C1-C30 heteroaryl, wherein the alkyl, urea, aryl, and heteroaryl groups are optionally substituted by one or more, preferably 1-3, substituents R'; R' is selected from deuterium, halogen, hydroxyl, C1-C5 alkyl, C3-C8 cycloalkyl, C1-C8 alkyl group, C1-C8 alkoxy group, amino group, C1-C8 alkylamino group, carboxyl group, C1-C8 alkylcarboxyl group, C2-C6 heterocyclic group, C6-C10 aryl group, C1-C6 heteroaryl group, and C1-C6 heteroaryl group. One or more substituted C2-C8 heterocyclic groups selected from 1-C8 alkyl and C1-C8 alkoxy groups; one or more substituted C6-C10 aryl groups selected from hydroxyl, halogen, cyano, amino, carboxyl, amide, oxo, C1-C8 alkyl and C1-C8 alkoxy groups; and one or more substituted C1-C10 heteroaryl and oxo groups selected from hydroxyl, halogen, cyano, amino, carboxyl, amide, oxo, C1-C8 alkyl and C1-C8 alkoxy groups.
4. The compound according to any one of claims 1-3, characterized in that, A is R a Selected from LBE L is selected from single bonds, C1-C10 alkylene groups, C3-C10 cycloalkylene groups, C2-C10 heterocyclic groups, -C(=O)-, or any combination thereof; each of the alkylene groups, cycloalkylene groups, and heterocyclic groups is independently and optionally substituted by one or more substituents R'; B is selected from single bond, C1-C10 alkylene, C3-C10 cycloalkylene, C2-C10 heterocyclic, C3-C10 cycloalkenyl, -O-, -S-, -S(=O)2-, -S(=O)-, -NR 13 -、-C(=O)NR 13 -, -C(=O)- or any combination thereof, wherein the alkylene, cycloalkylene, heterocyclic, and cycloalkenyl groups are each optionally and independently substituted by one or more substituents R'; E is selected from hydrogen, cyano, C1-C10 alkyl, C1-C10 alkylsilyl, C3-C10 cycloalkyl, C3-C10 spirocyclic, C5-C10 bridged cyclic, C2-C10 heterocyclic, C2-C10 alkenyl, C3-C10 cycloalkenyl, -NR 13 R 14 -C(=O)NR 13 R 14 -OR 15 -C(=O)R 16 -C(=O)OR 16 -SR 18 -S(=O)2R 19 C6-C10 aryl, C1-C10 heteroaryl, -C(=O)(CH2) p C(=O)OR 16 -C(=O)(CH2O CH2) p C(=O)OR 16 The alkyl, alkylsilyl, cycloalkyl, spirocyclic, bridged cyclic, heterocyclic, alkenyl, cycloalkenyl, aryl, and heteroaryl groups are each optionally and independently substituted by one or more substituents R'. R 13 and R 14 Each is independently selected from hydrogen, hydroxyl, C1-C10 alkyl, -C(=O)R 16 -R 17 C(=O)OR 16 -C(=O)NR 22 R 23 Urea group, wherein the alkyl group is optionally substituted with one or more substituents R'; R 15 The group is selected from hydrogen, C1-C10 alkyl, C6-C10 aryl, C1-C10 heteroaryl, and C2-C10 alkenyl, wherein each of the alkyl, aryl, heteroaryl, and alkenyl groups is independently and optionally substituted by one or more substituents R'. R 16 Selected from hydrogen, C1-C10 alkyl, C2-C10 heterocyclic, C1-C10 heteroaryl, C2-C10 alkenyl, -NR 22 R 23 The alkyl, heterocyclic, and heteroaryl groups are each optionally and independently substituted by one or more substituents R'; R 17 Selected from hydrogen, C1-C10 alkylene groups, wherein the alkylene group is optionally substituted with one or more substituents R'; R 18 Selected from hydrogen, cyano, C1-C10 alkyl, -C(=O)R 16 -C(=O)OR 16 C6-C10 aryl, C1-C20 heteroaryl, wherein each of the alkyl, aryl, and heteroaryl groups is optionally and independently substituted by one or more substituents R'; R 19 The group is selected from hydrogen, C1-C10 alkyl, C6-C10 aryl, and C1-C10 heteroaryl, wherein each alkyl, aryl, and heteroaryl group is independently and optionally substituted by one or more substituents R'. R 22 R 23 Each is independently selected from hydrogen and C1-C10 alkyl groups, wherein the alkyl group is optionally substituted by one or more substituents R'; R' is selected from deuterium, fluorine, chlorine, C1-C5 alkyl, C3-C6 cycloalkyl, C1-C5 alkyl, C1-C5 alkoxy, amino, C1-C5 alkylamino, carboxyl, C1-C5 alkylcarboxyl, C2-C6 heterocyclic, C6-C10 aryl, C1-C10 heteroaryl, and C1-C5 alkylamine, carboxyl, alkylcarboxyl, oxoyl, and C1-C5 alkylamine. One or more substituted C2-C6 heterocyclic groups selected from alkyl, C1-C5 alkoxy, C6-C10 aryl groups selected from hydroxyl, halogen, cyano, amino, carboxyl, amide, oxo, C1-C5 alkyl, C1-C5 alkoxy, and C1-C10 heteroaryl and oxo groups selected from hydroxyl, halogen, cyano, amino, carboxyl, amide, oxo, C1-C5 alkyl, C1-C5 alkoxy; Preferably, when L and B are both single bonds and E is hydrogen, in formula I, R 10 R 11 Not both hydrogen; or When E is selected from C6-C10 aryl or C1-C10 heteroaryl, L and B are not both single bonds; or When B is selected from -NR 13 -, E is selected from -C(=O)R 16 And R 16 When selected from C1-C5 alkyl groups, L is not methylene, or When R 16 When selected from C1-C10 heteroaryl groups, B is not -NR. 13 -,or When R 16 When selected from C1-C10 heteroaryl groups, B is -NR. 13 -, L is not a C1-C10 alkylene group; Preferably, L is selected from a single bond, B is selected from a single bond, and E is selected from hydrogen, C1-C5 alkyl, C1-C5 alkylsilyl, C3-C6 cycloalkyl, C5-C8 spirocyclic, C3-C6 heterocyclic, -C(=O)OR 16 -C(=O)R 16 R 16 The group is selected from hydrogen, C1-C5 alkyl, or C2-C6 heterocyclic groups, wherein each of the alkyl, alkylsilyl, cycloalkyl, spirocyclic, or heterocyclic groups is independently and optionally substituted by one to three C1-C5 alkyl, C1-C5 alkoxy, amino, C1-C5 alkylamino, carboxyl, C1-C5 alkylcarboxyl, C2-C6 heterocyclic, C6-C10 aryl, C1-C10 heteroaryl, or hydroxyl-substituted groups. The C2-C6 heterocyclic group substituted with one or more of the following: hydroxyl, halogen, cyano, amino, carboxyl, amide, oxo, C1-C5 alkyl, C1-C5 alkoxy; the C6-C10 aryl group substituted with one or more of the following: hydroxyl, halogen, cyano, amino, carboxyl, amide, oxo, C1-C5 alkyl, C1-C5 alkoxy; and the C1-C10 heteroaryl and oxo group substituted with one or more of the following: hydroxyl, halogen, cyano, amino, carboxyl, amide, oxo, C1-C5 alkyl, C1-C5 alkoxy. Preferably, L is selected from single bonds, B is selected from single bonds, and E is selected from hydrogen, methyl, ethyl, propyl, isopropyl, butyl, pentyl, trimethylsilyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, piperidinyl, tetrahydropyrrolyl, azirrobutyl, oxacyclobutyl, -C(=O)OR 16 -C(=O)R 16 , R 16 Selected from hydrogen, methyl, methylpiperazinyl, wherein the aforementioned methyl, ethyl, propyl, isopropyl, butyl, pentyl, trimethylsilyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, piperidinyl, tetrahydropyrrolyl, azacyclobutyl, and oxacyclobutyl are each independently and optionally substituted by 1 to 3 substituents selected from deuterium, fluorine, chlorine, hydroxyl, amino, carboxyl, methyl, ethyl, propyl, isopropyl, methoxy, cyclopropyl, and cyclobutyl; and / or L is selected from a single bond, B is selected from a C1-C5 alkylene group, and E is selected from a C2-C6 heterocyclic group, a C5-C6 bridged cyclic group, or -NR. 13 R 14 -SR 18 -S(=O)2R 19 -OR 15 R 13 and R 14 Each is independently selected from hydrogen, hydroxyl, C1-C5 alkyl, R 15 Selected from C1-C5 alkyl, C1-C10 heteroaryl, R 18 Selected from hydrogen, cyano, C1-C5 alkyl, C6-C10 aryl, C1-C10 heteroaryl; R 19 The group is selected from hydrogen, C1-C5 alkyl, C6-C10 aryl, and C1-C10 heteroaryl, wherein each of the alkylene, heterocyclic, bridged cyclic, alkyl, alkenyl, heteroaryl, and aryl groups is independently and optionally substituted by one to three C1-C5 alkyl, C1-C5 alkoxy, amino, C1-C5 alkylamino, carboxyl, C1-C5 alkylcarboxyl, C2-C6 heterocyclic, C6-C10 aryl, and C1-C10 heteroaryl groups selected from deuterium, halogen, C1-C5 alkyl, C3-C6 cycloalkyl, hydroxyl, halogen, cyano, amino, carboxyl, and amide groups. The aryl group, a C2-C6 heterocyclic group substituted with one or more of hydroxyl, halogen, cyano, amino, carboxyl, amide, oxo, C1-C5 alkyl, and C1-C5 alkoxy, a C6-C10 aryl group substituted with one or more of hydroxyl, halogen, cyano, amino, carboxyl, amide, oxo, C1-C5 alkyl, and C1-C5 alkoxy, and a C1-C10 heteroaryl and oxo group substituted with one or more of hydroxyl, halogen, cyano, amino, carboxyl, amide, oxo, C1-C5 alkyl, and C1-C5 alkoxy; Preferably, L is selected from a single bond, B is selected from C1-C3 alkylene or deuterated C1-C3 alkylene, and E is selected from morpholino, aziridine, piperidinyl, piperazine, -NR 13 R 14 -SR 18 -S(=O)2R 19 -OR 15 , R 13 and R 14 Each is independently selected from hydrogen, hydroxyl, C1-C3 alkyl, R 15 Selected from benzotriazolyl, pyridyltriazolyl, C1-C3 alkyl, R 18 Selected from hydrogen, cyano, C1-C3 alkyl, phenyl, imidazolyl, R 19 The group is selected from hydrogen, C1-C3 alkyl, phenyl, thienyl, imidazolyl, benzothiazolyl, pyridyl, pyrazinyl, pyrimidinyl, and pyridazinyl, wherein each of the following groups is independently and optionally substituted by 1 to 3 substituents selected from deuterium, fluorine, chlorine, hydroxyl, amino, methyl, cyano, and amide. L is selected from a single bond, B is selected from C(=O)-, C3-C6 cycloalkylene groups, and E is selected from C2-C6 heterocyclic groups, C5-C6 bridged cyclic groups, and -NR groups. 13 R 14 -S(=O)2R 19 R 13 and R 14 Each is independently selected from hydrogen and C1-C5 alkyl groups. Preferably, B is selected from -C(=O)-, cyclobutylene, cyclopentylene, and cyclohexylene, and E is selected from -NR. 13 R 14 R 13 and R 14 Each is independently selected from hydrogen and methyl. L is selected from a single bond, B is selected from a C2-C6 heterocyclic group, and E is selected from C1-C5 alkyl, C3-C6 cycloalkyl, C3-C6 cycloalkenyl, and C2-C6 heterocyclic groups. Each of the heterocyclic groups, alkyl, cycloalkyl, cycloalkenyl, and heterocyclic groups is independently and optionally substituted by 1-3 substituents selected from deuterium, fluorine, chlorine, hydroxyl, amino, methyl, and methoxy. Preferably, L is selected from a single bond; B is selected from tetrahydropyrrolyl, piperidinyl, and aziridine, wherein the tetrahydropyrrolyl, piperidinyl, and aziridine are substituted with 1-3 hydroxyl groups; E is selected from cyclopropyl and cyclobutenyl, wherein the cyclopropyl and cyclobutenyl are each optionally and independently substituted with a substituent selected from oxo, amino, methoxy, and dimethylamino groups. L is selected from C1-C5 alkylene groups, and B is selected from -NR. 13 -、-S-、-S(=O)2-、-S(=O-、-O-、C2-C6 heterocyclic group, E is selected from hydrogen, C1-C5 alkyl, -C(=O)R 16 -S(=O)2R 19 R 13 Selected from hydrogen, C1-C5 alkyl, R 16 Selected from hydrogen, C1-C5 alkyl, -NR 22 R 23 R 19 Selected from hydrogen, C1-C5 alkyl, R 22 R 23 Each is independently selected from hydrogen, and each of the alkyl and heterocyclic groups is optionally independently substituted by 1 to 3 substituents selected from deuterium, fluorine, chlorine, hydroxyl, amino, methyl, methoxy, oxo, phenyl, carboxyl, and dimethylamino; or L is selected from C1-C5 alkylene groups, B is selected from C2-C6 heterocyclic groups, and E is selected from -OR groups. 15 -C(=O)R 16 -C(=O)(CH2) p C(=O)OR 16 -C(=O)(CH2OCH2) p C(=O)OR 16 C1-C5 alkyl, R 15 Selected from hydrogen, C1-C5 alkyl, R 16 The group is selected from hydrogen, C1-C5 alkyl, and C2-C5 alkenyl, wherein each of the alkylene, heterocyclic, alkyl, and alkenyl groups is independently and optionally substituted by 1-3 substituents selected from deuterium, fluorine, chlorine, hydroxyl, amino, methyl, methoxy, oxo, phenyl, carboxyl, and dimethylamino; or L is selected from C3-C6 heterocyclic groups, B is selected from C3-C6 cycloalkylene groups, C1-C5 alkylene groups, and E is selected from C2-C6 heterocyclic groups, -NR groups. 13 R 14 -C(=O)OR 16 R 13 and R 14 Each is independently selected from hydrogen, C1-C5 alkyl, -R 17 C(=O)OR 16 R 16 Selected from hydrogen, C1-C5 alkyl, R 17 The group is selected from hydrogen and C1-C5 alkylene groups, wherein each of the heterocyclic group, cycloalkenyl group, alkylene group, heterocyclic group, and alkyl group is independently and optionally substituted by 1-3 substituents selected from deuterium, fluorine, chlorine, hydroxyl, amino, C1-C3 alkyl, C1-C3 alkoxy, C3-C5 cycloalkyl, oxo, phenyl, carboxyl, and dimethylamino. Preferably, L is selected from piperidinyl, B is selected from cyclobuteneyl, methylene, ethylene, and E is selected from piperidinyl, -NR 13 R 14 -C(=O)OR 16 R 13 and R 14 Each is independently selected from hydrogen, methyl, ethyl, -R 17 C(=O)OR 16 R 16 Selected from hydrogen, C1-C3 alkyl, R 17 The group is selected from hydrogen and C1-C3 alkylene groups; each of the piperidinyl, cyclobuteneyl, methylene, ethylene, piperidinyl, methyl, and ethyl groups is independently and optionally substituted by 1-3 substituents selected from deuterium, fluorine, chlorine, hydroxyl, amino, C1-C3 alkyl, C1-C3 alkoxy, C3-C5 cycloalkyl, oxo, phenyl, carboxyl, and dimethylamino groups.
5. The compound according to any one of claims 1-3, characterized in that, A is R b and R e Each was independently selected from LBE. L is selected from a single bond, a C1-C20 alkylene group, or any combination thereof; the alkylene group is optionally substituted by one or more substituents R'; B is selected from single bonds, C1-C20 alkylene groups, C2-C10 heterocyclic groups, -S(=O)2-, -O-, or any combination thereof, wherein the alkylene group or heterocyclic group is optionally substituted by one or more substituents R'; E is selected from hydrogen, cyano, C1-C20 alkyl, C2-C20 heterocyclic, -OR 15 Or any combination thereof; R 15 Selected from hydrogen and C1-C10 alkyl groups; the alkyl or heterocyclic group may optionally be substituted by one or more substituents R'; R' is selected from deuterium, halogen, hydroxyl, C1-C10 alkyl, C3-C10 cycloalkyl, and one or more substituted C1-C10 alkyl, C1-C10 alkoxy, amino, C1-C10 alkylamino, carboxyl, C1-C10 alkylcarboxyl, C2-C10 heterocyclic, C6-C10 aryl, C1-C10 heteroaryl, and hydroxyl, halogen, cyano, amino, carboxyl, amide, and oxo groups. One or more substituted C2-C10 heterocyclic groups selected from C1-C10 alkyl and C1-C10 alkoxy groups; one or more substituted C6-C10 aryl groups selected from hydroxyl, halogen, cyano, amino, carboxyl, amide, oxo, C1-C10 alkyl and C1-C10 alkoxy groups; and one or more substituted C1-C10 heteroaryl and oxo groups selected from hydroxyl, halogen, cyano, amino, carboxyl, amide, oxo, C1-C10 alkyl and C1-C10 alkoxy groups. Preferably, L is selected from a single bond, a C1-C10 alkylene group, or any combination thereof; the alkylene group is optionally substituted by one or more substituents R'; B is selected from single bonds, C1-C10 alkylene groups, C2-C6 heterocyclic groups, -S(=O)2-, -O-, or any combination thereof; the alkylene groups or heterocyclic groups are optionally substituted by one or more substituents R'; E is selected from hydrogen, cyano, C1-C5 alkyl, C2-C6 heterocyclic group, or -OR. 15 Or any combination thereof, R 15 Selected from hydrogen and C1-C5 alkyl groups; R' is selected from deuterium, halogen, hydroxyl, C1-C5 alkyl, C1-C10 alkoxy, amino, C1-C10 alkylamino, carboxyl, C1-C10 alkylcarboxyl, oxo group; preferably, L is selected from single bond, methylene; B is selected from single bond, methylene, -S(=O)2-, piperazine; E is selected from hydrogen, C1-C5 alkyl, C1-C5 alkyl substituted with carboxyl, -OR 15 ;R 15 Selected from hydrogen and C1-C5 alkyl groups; Preferably, L is selected from a single bond or a methylene group, B is selected from a single bond, a methylene group, -S(=O)2- or a piperazine group, and E is selected from a methyl group or a carboxyl-substituted methyl group; and / or L is selected from methylene, B is selected from -S(=O)2-, E is selected from carboxyl-substituted methyl groups; and / or L is selected from single bonds, B is selected from single bonds, E is selected from hydrogen, -OR 15 R 15 Selected from methyl; Preferably, R b and R e Each is independently selected from the following groups: hydrogen 6. The compound according to any one of claims 1-3, characterized in that, A is selected from Z is selected from -(CH2) n -, -NH-, -NHC(=O)-, -OP(=O)-, -OP(=O)O-, -P(=O)-, -P(=O)2-, -O-, -S-, -S(=O)-, -S(=O)2- and any combination thereof; preferably -(CH2). n -, -NH-, -O- or any combination thereof; m is an integer from 1 to 5; n is an integer from 1 to 5; R d Selected from the following groups: hydrogen, deuterium, C1-C30 alkyl, C3-C10 cycloalkyl, C1-C30 heteroalkyl, -OR 15 The alkyl, cycloalkyl, or heteroalkyl groups are each optionally and independently substituted by one or more substituents R'. R' is selected from deuterium, halogen, hydroxyl, C1-C10 alkyl, C3-C10 cycloalkyl, and one or more substituted C1-C10 alkyl, C1-C10 alkoxy, amino, C1-C10 alkylamino, carboxyl, C1-C10 alkylcarboxyl, C2-C10 heterocyclic, C6-C10 aryl, C1-C10 heteroaryl, and hydroxyl, halogen, cyano, amino, carboxyl, amide, and oxo groups. One or more substituted C2-C10 heterocyclic groups selected from C1-C10 alkyl and C1-C10 alkoxy groups; one or more substituted C6-C10 aryl groups selected from hydroxyl, halogen, cyano, amino, carboxyl, amide, oxo, C1-C10 alkyl and C1-C10 alkoxy groups; and one or more substituted C1-C10 heteroaryl and oxo groups selected from hydroxyl, halogen, cyano, amino, carboxyl, amide, oxo, C1-C10 alkyl and C1-C10 alkoxy groups. Preferably, R d Selected from the following groups: hydrogen, deuterium, C1-C10 alkyl, C3-C10 cycloalkyl, C1-C10 heteroalkyl, -OR 15 R 15 Selected from hydrogen, C1-C5 alkyl, and C3-C10 cycloalkyl; each of the alkyl, cycloalkyl, or heteroalkyl groups is optionally and independently substituted by one or more substituents R'; Preferably, R d Selected from the following groups: hydrogen, deuterium, C1-C5 alkyl, C3-C6 cycloalkyl, C1-C5 heteroalkyl, -OR 15 R 15 Selected from hydrogen, C1-C3 alkyl, and C3-C6 cycloalkyl; each of the alkyl, cycloalkyl, or heteroalkyl groups is optionally and independently substituted by one or more substituents R'; Preferably, R d Selected from the following groups: hydrogen, methyl, ethyl, propyl, isopropyl, butyl, pentyl; R c Selected from LBE, where L is selected from a single bond, C2-C20 subheterocyclic group; the subheterocyclic group is optionally substituted by one or more substituents R'; B is selected from single bonds, C1-C20 alkylene groups, C2-C20 heterocyclic groups, C3-C20 cycloalkylene groups, and C3-C20 spirocyclic groups; each of the alkylene groups, cycloalkylene groups, spirocyclic groups, and heterocyclic groups is independently and optionally substituted by one or more substituents R'. E is selected from hydrogen, C1-C20 alkyl, C3-C20 cycloalkyl, C3-C20 spirocyclic, C2-C20 heterocyclic, C3-C20 cycloalkenyl, -NR 13 R 14 -C(=O)NR 13 R 14 -OR 15 -C(=O)R 16 -C(=O)OR 16 -S(=O)2R 19 C6-C20 aryl, C1-C20 heteroaryl, ureyl; wherein the alkyl, cycloalkyl, spirocyclic, heterocyclic, and cycloalkenyl groups are each optionally and independently substituted by one or more substituents R'; R 13 and R 14 Each is independently selected from hydrogen, C1-C20 alkyl, C3-C20 cycloalkenyl, -C(=O)R 16 The alkyl and cycloalkenyl groups are each optionally and independently substituted by one or more substituents R'. R 15 Selected from C1-C20 alkyl groups and C2-C20 heterocyclic groups; each of the alkyl and heterocyclic groups is optionally and independently substituted by one or more substituents R'; R 16 Selected from hydrogen, C1-C20 alkyl, C2-C20 heterocyclic, and C1-C20 heteroaryl; each of the alkyl, heterocyclic, and heteroaryl groups is optionally and independently substituted by one or more substituents R'; R 19 Selected from C1-C20 alkyl groups, -NR 22 R 23 The alkyl group is optionally substituted with one or more substituents R'. R 22 R 23 Each is independently selected from hydrogen and C1-C20 alkyl groups, wherein the alkyl group is optionally substituted by one or more substituents R'; R' is selected from deuterium, halogen, hydroxyl, C1-C10 alkyl, C3-C10 cycloalkyl, and one or more substituted C1-C10 alkyl, C1-C10 alkoxy, amino, C1-C10 alkylamino, carboxyl, C1-C10 alkylcarboxyl, C2-C10 heterocyclic, C6-C10 aryl, C1-C10 heteroaryl, and hydroxyl, halogen, cyano, amino, carboxyl, amide, and oxo groups. One or more substituted C2-C10 heterocyclic groups selected from C1-C10 alkyl and C1-C10 alkoxy groups; one or more substituted C6-C10 aryl groups selected from hydroxyl, halogen, cyano, amino, carboxyl, amide, oxo, C1-C10 alkyl and C1-C10 alkoxy groups; and one or more substituted C1-C10 heteroaryl and oxo groups selected from hydroxyl, halogen, cyano, amino, carboxyl, amide, oxo, C1-C10 alkyl and C1-C10 alkoxy groups. Preferably, L is selected from a single bond, B is selected from a single bond, and E is selected from hydrogen, C1-C5 alkyl, C3-C6 cycloalkyl, C3-C6 cycloalkenyl, C6-C10 aryl, C2-C6 heterocyclic, and C3-C10 spirocyclic; each of the alkyl, cycloalkyl, cycloalkenyl, aryl, heteroaryl, heterocyclic, and spirocyclic groups is independently and optionally substituted by 1-3 C1-C5 alkyl, C1-C5 alkoxy, amino, C1-C5 alkylamino, carboxyl, C1-C5 alkylcarboxyl, and C2-C5 alkylcarboxyl groups selected from deuterium, fluorine, chlorine, C1-C5 alkyl, C3-C6 cycloalkyl, hydroxyl, halogen, cyano, amino, carboxyl, and amide groups. -C6 heterocyclic group, C6-C10 aryl group, C1-C10 heteroaryl group, C2-C6 heterocyclic group substituted with one or more of hydroxyl, halogen, cyano, amino, carboxyl, amide, oxo, C1-C5 alkyl, C1-C5 alkoxy group, C6-C10 aryl group substituted with one or more of hydroxyl, halogen, cyano, amino, carboxyl, amide, oxo, C1-C5 alkyl, C1-C5 alkoxy group, C1-C10 heteroaryl group substituted with one or more of hydroxyl, halogen, cyano, amino, carboxyl, amide, oxo, C1-C5 alkyl, C1-C5 alkoxy group, and oxo group; Preferably, L is selected from a single bond, B is selected from a single bond, and E is selected from hydrogen, C1-C3 alkyl, azacyclobutane, tetrahydropyrrolyl, piperidinyl, cyclobutyl, cyclopentyl, cyclohexyl, tetrahydropyranyl, etc. The alkyl, azacyclobutane, tetrahydropyrrolyl, piperidinyl, cyclobutyl, cyclopentyl, cyclohexyl, and tetrahydropyranyl groups are each independently substituted by 1 to 3 substituents selected from deuterium, halogen, cyano, amino, methyl, methoxy, phenyl, and hydroxyl groups; L is selected from a single bond, B is selected from C1-C5 alkylene groups, and E is selected from C1-C10 heteroaryl groups, -OR 15 -C(=O)NR 13 R 14 -NR 13 R 14 R 13 and R 14 Each is independently selected from hydrogen, C3-C6 cycloalkenyl, -C(=O)R 16 R 15 Selected from C2-C6 heterocyclic groups, R 16 Selected from hydrogen, the alkylene, heteroaryl, cycloalkenyl, and heterocyclic groups are each optionally substituted by one to three C1-C5 alkyl, C1-C5 alkoxy, amino, C1-C5 alkylamino, carboxyl, C1-C5 alkylcarboxyl, C2-C6 heterocyclic, C6-C10 aryl, C1-C10 heteroaryl, or substituted by one or more of the following: deuterium, fluorine, chlorine, C1-C5 alkyl, C3-C6 cycloalkyl, hydroxyl, halogen, cyano, amino, carboxyl, and amide. One or more substituted C2-C6 heterocyclic groups selected from carboxyl, amide, oxo, C1-C5 alkyl, and C1-C5 alkoxy groups; one or more substituted C6-C10 aryl groups selected from hydroxyl, halogen, cyano, amino, carboxyl, amide, oxo, C1-C5 alkyl, and C1-C5 alkoxy groups; and one or more substituted C1-C10 heteroaryl and oxo groups selected from hydroxyl, halogen, cyano, amino, carboxyl, amide, oxo, C1-C5 alkyl, and C1-C5 alkoxy groups. Preferably, L is selected from a single bond, B is selected from a C1-C3 alkylene group, and E is selected from an imidazolium group or a -C(=O)NR group. 13 R 14 -OR 15 R 13 and R 14 Each is independently selected from hydrogen, R 15 Selected from nitrogen-containing heterocyclic butyl groups; L is selected from a single bond, B is selected from C2-C6 heterocyclic group, C3-C6 cycloalkyl group, C3-C10 spirocyclic group, and E is selected from C3-C6 cycloalkenyl group, C1-C5 alkyl group, and -C(=O)R group. 16 -C(=O)OR 16 -C(=O)NR 13 R 14 -NR 13 R 14 -S(=O)2R 19 Urea, C1-C10 heteroaryl, C2-C6 heterocyclic, C3-C6 cycloalkyl, R 13 and R 14 Each is independently selected from hydrogen, C1-C5 alkyl, R 16 Selected from hydrogen, C1-C5 alkyl, R 19 Selected from -NR 22 R 23 R 22 R 23 Each group is independently selected from hydrogen and C1-C5 alkyl groups. The heterocyclic group, cycloalkyl group, spirocyclic group, cycloalkenyl group, alkyl group, heteroaryl group, cycloalkyl group, and heterocyclic group are each optionally substituted with one to three C1-C5 alkyl groups, C1-C5 alkoxy groups, amino groups, C1-C5 alkylamino groups, carboxyl groups, C1-C5 alkylcarboxyl groups, C2-C6 heterocyclic groups, C6-C10 aryl groups, and C1-C10 heteroaryl groups selected from hydroxyl, halogen, cyano, amino, carboxyl, and amide groups. The C2-C6 heterocyclic group substituted with one or more of hydroxyl, halogen, cyano, amino, carboxyl, amide, oxo, C1-C5 alkyl, and C1-C5 alkoxy; the C6-C10 aryl group substituted with one or more of hydroxyl, halogen, cyano, amino, carboxyl, amide, oxo, C1-C5 alkyl, and C1-C5 alkoxy; and the C1-C10 heteroaryl and oxo group substituted with one or more of hydroxyl, halogen, cyano, amino, carboxyl, amide, oxo, C1-C5 alkyl, and C1-C5 alkoxy. Preferably, L is selected from a single bond, B is selected from azacyclobutyl, piperidinyl, and cyclopentyl, and E is selected from piperidinyl, C1-C3 alkyl, cyclobutenyl, amide, ureyl, pyrazinyl, pyridazinyl, cyclobutyl, cyclopentyl, cyclohexyl, azacyclobutyl, pyranyl, sulfide cyclopentyl, pyrroleyl, oxacyclobutyl, morpholinyl, and -C(=O)R 16 -C(=O)OR 16 -C(=O)NR 13 R 14 -NR 13 R 14 -S(=O)2R 19 R 13 and R 14 Each is independently selected from hydrogen, C1-C3 alkyl, R 16 Selected from hydrogen, C1-C3 alkyl, R 19 Selected from -NR 22 R 23 R 22 R 23 Selected from hydrogen, C1-C3 alkyl, L is selected from C2-C6 heterocyclic groups, B is selected from C1-C5 alkylene groups, and E is selected from -C(=O)R. 16 -C(=O)OR 16 -C(=O)NR 13 R 14 C2-C6 heterocyclic groups, -NR 13 R 14 R 13 and R 14 Each is independently selected from hydrogen, C1-C5 alkyl, R 16 The group is selected from hydrogen, C2-C6 heterocyclic groups, and C1-C5 alkyl groups; preferably, L is selected from azapyrocyclic butyl, B is selected from C1-C3 alkylene groups, and E is selected from piperazinyl, morpholinyl, piperidinyl, and -NR. 13 R 14 R 13 and R 14 Each is independently selected from hydrogen and C1-C3 alkyl groups.
7. The compound according to any one of claims 1-3, characterized in that, A is selected from Z represents a single bond, R d Selected from hydrogen; m is 0; R c Selected from -LBE; L is selected from single bonds, C3-C20 subspirocyclic groups, C5-C20 subbridged cyclic groups, and C2-C20 subheterocyclic groups; each of the subspirocyclic groups, subbridged cyclic groups, and subheterocyclic groups is independently and optionally substituted by one or more substituents R'; B is selected from single bond, -C(=O)-, C1-C20 alkylene, C3-C20 cycloalkylene, C3-C20 spirocyclic, C5-C20 bridged cyclic, C2-C20 heterocyclic, -NR 13 -, -O-, -S-, -S(=O)2-, -C(=O)NR 13 - Each of the alkylene group, cycloalkylene group, spirocycloalkylene group, bridged cycloalkylene group, and heterocycloalkylene group is independently and optionally substituted by one or more substituents R'; E is selected from hydrogen, C2-C20 alkyl, C3-C20 cycloalkyl, C3-C20 spirocyclic, C5-C20 bridged cyclocyclic, C2-C20 heterocyclic, C3-C20 cycloalkenyl, C2-C20 alkenyl, C1-C20 heteroaryl, -NR 13 R 14 -C(=O)NR 13 R 14 -OR 15 -C(=O)R 16 -C(=O)OR 16 -S(=O)2R 19 C6-C30 aryl, C1-C20 heteroaryl, -B(OH)2, ureyl, amino, wherein the alkyl, cycloalkyl, spirocyclic, bridged cyclic, heterocyclic, cycloalkenyl, alkenyl, heteroaryl, aryl, ureyl, and amino groups are each independently and optionally substituted by one or more substituents R'. R 13 and R 14 Each is independently selected from hydrogen, C1-C20 alkyl, C3-C20 cycloalkenyl, -C(=O)R 16 Urea group, wherein the alkyl, cycloalkenyl, and ureidyl groups are each optionally and independently replaced by one or more substituents R'; R 15 Selected from hydrogen and C1-C20 alkyl groups, wherein the alkyl group is optionally substituted by one or more substituents R'; R 16 Selected from hydrogen, C1-C20 alkyl, C3-C20 cycloalkyl, C6-C20 aryl, C1-C20 heteroaryl, C2-C20 heterocyclic, -NR 22 R 23 The alkyl, cycloalkyl, aryl, heteroaryl, and heterocyclic groups are each optionally and independently replaced by one or more substituents R'; R 18 Selected from hydrogen, C1-C20 alkyl, -C(=O)R 16 , cyano, -C(=O)OR 16 The alkyl group is optionally substituted with one or more substituents R'; R 19 Selected from hydrogen, C1-C20 alkyl, C3-C20 cycloalkyl, C6-C20 aryl, C1-C20 heteroaryl, -NR 22 R 23 The alkyl, cycloalkyl, aryl, and heteroaryl groups are each optionally and independently replaced by one or more substituents R'. R 22 R 23 The group is selected from hydrogen, C1-C20 alkyl, and ureido, wherein each alkyl and ureido group is optionally substituted by one or more substituents R' independently; R' is selected from deuterium, halogen, hydroxyl, C1-C10 alkyl, C3-C10 cycloalkyl, and one or more substituted C1-C10 alkyl, C1-C10 alkoxy, amino, C1-C10 alkylamino, carboxyl, C1-C10 alkylcarboxyl, C2-C10 heterocyclic, C6-C10 aryl, C1-C10 heteroaryl, and hydroxyl, halogen, cyano, amino, carboxyl, amide, and oxo groups. One or more substituted C2-C10 heterocyclic groups selected from C1-C10 alkyl and C1-C10 alkoxy groups; one or more substituted C6-C10 aryl groups selected from hydroxyl, halogen, cyano, amino, carboxyl, amide, oxo, C1-C10 alkyl and C1-C10 alkoxy groups; and one or more substituted C1-C10 heteroaryl and oxo groups selected from hydroxyl, halogen, cyano, amino, carboxyl, amide, oxo, C1-C10 alkyl and C1-C10 alkoxy groups. Preferably, L is selected from a single bond, B is selected from a single bond, and E is selected from hydrogen, amino, C2-C5 alkyl, -B(OH)2, C5-C6 bridged cycloalkyl, C3-C10 spirocycloalkyl, C3-C10 cycloalkyl, C2-C6 heterocycloalkyl, C2-C5 alkenyl, C1-C10 heteroaryl, -C(=O)R 16 -S(=O)R 19 R 16 Selected from -NR 22 R 23 R 22 R 23 Selected from hydrogen, C1-C5 alkyl, urea, R 19 Selected from C1-C10 heteroaryl groups, Preferably, L is selected from single bonds, B is selected from single bonds, and E is selected from hydrogen, amino, ethyl, propyl, isopropyl, butyl, pentyl, tetrahydroimidazolylpyrazinyl, azacyclic butyl, piperazinyl, piperidinyl, morpholinyl, -B(OH)2, cyclohexyl, pyrazinyl, -C(=O)R 16 -S(=O)R 19 , R 16 Selected from -NR 22 R 23 R 22 R 23 Selected from hydrogen, C1-C3 alkyl, R 19 Selected from pyridazinyl, L is selected from a single bond; B is selected from C5-C6 subbridged cycloyl group, C3-C10 subspirocycloyl group, C2-C6 subheterocycloyl group, -C(=O)- group; E is selected from C1-C5 alkyl group, C1-C10 heteroaryl group, C2-C6 heterocyclic group, C3-C6 cycloalkenyl group, -NR group. 13 R 14 -C(=O)R 16 -S(=O)2R 19 R 13 and R 14 Each is independently selected from hydrogen, C1-C5 alkyl, urea, -C(=O)R 16 R 16 Selected from C1-C5 alkyl, C3-C6 cycloalkyl, C2-C6 heterocyclic, and C1-C10 heteroaryl groups, R 19 Selected from hydrogen, C1-C5 alkyl, C3-C6 cycloalkyl, C6-C10 aryl, L is selected from single bonds, B is selected from C5-C6 subbridged cyclic group, C3-C10 subspirocyclic group, C2-C6 subheterocyclic group, -C(=O)-, E is selected from pyridazinyl, morpholinyl, cyclobutenyl, -NR 13 R 14 -C(=O)R 16 -S(=O)2R 19 R 13 and R 14 Each is independently selected from hydrogen, C1-C3 alkyl, urea, -C(=O)R 16 R 16 Selected from C1-C3 alkyl, cyclopropyl, pyrrole, and oxadiazolyl groups, R 19 Selected from hydrogen, cyclopropyl, and phenyl. L is selected from C3-C10 subspirocyclic groups and C5-C6 subbridged cyclic groups, and B is selected from -NR 13 - C1-C5 alkylene, -C(=O)-, E is selected from C1-C5 alkyl, C2-C6 heterocyclic, C1-C10 heteroaryl, C3-C6 cycloalkenyl, -C(=O)R 16 R 13 Selected from hydrogen, C1-C5 alkyl, R 16 Selected from C1-C5 alkyl and C1-C10 heteroaryl groups; Preferably, E is selected from C1-C3 alkyl, piperazine, -C(=O)R 16 R 16 Selected from oxadiazole group; L is selected from C5-C6 bridging cycloalkanes and C3-C10 spirocycloalkanes, and B is selected from C1-C5 alkylene groups and -NR groups. 13 -, -CO-, E is selected from C1-C5 alkyl, C2-C6 heterocyclic, C(=O)R 16 ;R 13 Selected from hydrogen, C1-C5 alkyl, R 16 Selected from C1-C5 alkyl and C1-C10 heteroaryl groups; each of the bridged cycloyl group, spirocycloyl group, and alkyl group is independently and optionally substituted by 1-3 C2-C6 heterocyclic groups, C2-C6 heterocyclic groups, and oxo groups selected from deuterium, fluorine, chlorine, C1-C5 alkyl, carboxyl, C1-C5 alkylcarboxyl, hydroxyl, halogen, cyano, amino, C1-C5 alkyl, and C1-C5 alkoxy groups; Preferably, L is selected from B is selected from C1-C5 alkylene groups, -NR 13 -, -CO-, E are selected from C1-C5 alkyl, piperazine, C1-C5 alkyl substituted with piperazine, C(=O)R 16 ;R 13 Selected from hydrogen, C1-C5 alkyl, R 16 Selected from C1-C3 alkyl and oxadiazolyl groups; L is selected from C2-C6 heterocyclic groups, B is selected from C1-C5 alkylene groups, and E is selected from C2-C6 heterocyclic groups, C1-C10 heteroaryl groups, and -OR groups. 15 -C(=O)R 16 -C(=O)NR 13 R 14 R 13 and R 14 Each is independently selected from hydrogen, C1-C5 alkyl, R 15 Selected from hydrogen, C1-C5 alkyl, R 16 The group is selected from hydrogen, C2-C6 heterocyclic groups, preferably, L is selected from C2-C6 heterocyclic groups, B is selected from C1-C5 alkylene groups, and E is selected from piperazinyl, piperidinyl, pyranyl, morpholinyl, imidazolyl, pyrroleyl, -OR 15 -C(=O)R 16 -C(=O)NR 13 R 14 R 13 and R 14 Each is independently selected from hydrogen, C1-C3 alkyl, R 15 Selected from hydrogen, C1-C3 alkyl, R 16 Selected from hydrogen and piperazine group.
8. The compound according to any one of claims 1-7, characterized in that, R 1 R 2 R 3 R 4 R 5 R 6 R 7 R 8 R 9 R 10 R 11 R 12 Each is independently selected from hydrogen, deuterium, halogen, amino, hydroxyl, mercapto, C1-C20 alkyl, C1-C20 heteroalkyl, C3-C20 cycloalkyl, C6-C20 aryl, C1-C20 heteroaryl, and C2-C20 heterocyclic groups. The alkyl, cycloalkyl, aryl, heteroaryl, heterocyclic, and heteroalkyl groups are each optionally and independently substituted by one to three C1-C10 alkyl, C1-C10 alkoxy, amino, C1-C10 alkylamino, carboxyl, C1-C10 alkylcarboxyl, C2-C10 heterocyclic, C6-C10 aryl, C1-C10 heteroaryl, or substituted by one or more of the following: deuterium, halogen, hydroxyl, C1-C10 alkyl, C3-C10 cycloalkyl, hydroxyl, halogen, cyano, amino, carboxyl, amide, and oxo. The C2-C10 heterocyclic group substituted with one or more of amino, carboxyl, amide, oxo, C1-C10 alkyl, and C1-C10 alkoxy groups; the C6-C10 aryl group substituted with one or more of hydroxyl, halogen, cyano, amino, carboxyl, amide, oxo, C1-C10 alkyl, and C1-C10 alkoxy groups; and the C1-C10 heteroaryl and oxo groups substituted with one or more of hydroxyl, halogen, cyano, amino, carboxyl, amide, oxo, C1-C10 alkyl, and C1-C10 alkoxy groups. Preferably, R 1 R 2 R 3 R 4 R 5 R 6 R 7 R 8 R 9 R 10 R 11 R 12 Each is independently selected from hydrogen, deuterium, halogen, amino, C1-C10 alkyl, C1-C10 heteroalkyl, C3-C10 cycloalkyl, C6-C10 aryl, C1-C10 heteroaryl, and C2-C10 heterocyclic groups. Preferably, R 1 R 5 cycloalkyl, heterocyclic, aryl, or heteroaryl groups can be formed by connecting them at any adjacent position; Optional, R 7 and R 8 A cycloalkyl, heterocyclic, aryl, or heteroaryl group is formed by linking at any adjacent position, wherein each of the cycloalkyl, heterocyclic, aryl, or heteroaryl group is optionally and independently substituted by one or more substituents R'. Preferably, R 1 R 2 R 3 R 4 R 5 R 6 R 7 R 8 R 9 R 10 R 11 Each is independently selected from hydrogen, deuterium, fluorine, trifluoromethyl, methoxy, cyclopropyl, And / or, R 12 Selected from hydrogen, deuterium, fluorine, chlorine, methyl, ethyl, propyl, and isopropyl.
9. The compound according to any one of claims 1-8, characterized in that, W is selected from -O-, -S-, -NR 24 -、-CR 20 R 21 -C(=O)-, R 20 R 21 and R 24 Each is independently selected from hydrogen, deuterium, and C1-C30 alkyl groups, preferably R. 20 R 21 and R 24 Each is independently selected from hydrogen, deuterium, and C1-C10 alkyl groups, preferably R. 20 R 21 and R 24 Each is independently selected from hydrogen and C1-C5 alkyl groups. Preferably, R 20 R 21 and R 24 Each is independently selected from hydrogen and methyl; Preferably, W is selected from methylene.
10. The compound according to any one of claims 1-9, characterized in that, R a R b R c R e Selected from the following groups: hydrogen, 11. The compound according to any one of claims 1-10, characterized in that, R a R b R c R e Each is independently selected from the following groups:
12. The compound according to any one of claims 1-10, characterized in that, R a R b R c R e Each is independently selected from the following groups: Hydrogen, amino, methyl, -B(OH)2 13. The compound according to any one of claims 1-10, characterized in that, R a R b R c R e Each is independently selected from the following groups: Hydrogen, amino, methyl, -B(OH)2 14. The compound according to any one of claims 1-13, characterized in that, The compounds are selected from the compounds listed in the table below:
15. A pharmaceutical composition comprising the compound of any one of claims 1-14 or its enantiomers, diastereomers, racemates, tautomers, stereoisomers, geometric isomers, nitrides, deuterated derivatives, metabolites or pharmaceutically acceptable salts, esters, solvates, hydrates, isotopically labeled compounds or prodrugs, and pharmaceutically acceptable excipients.
16. The use of any compound of claims 1-14 or an enantiomer, diastereomer, racemate, tautomer, stereoisomer, geometric isomer, nitride, deuterated product, metabolite or a pharmaceutically acceptable salt, ester, solvate, hydrate, isotopically labeled compound or prodrug or pharmaceutical composition of claim 15 in the preparation of a drug for inhibiting Polθ overexpression or an antitumor drug; Preferably, the tumor includes one or more of breast cancer, ovarian cancer, pancreatic cancer, prostate cancer, esophageal cancer, and lung cancer.