Uses of NAT10 in aspects of poor prognosis markers of cervical cancer and drugs for treating cervical cancer

Abstract

Provided in the present invention are the uses of NAT10 in aspects of poor prognosis markers of cervical cancer and drugs for treating cervical cancer, belonging to the technical field of the prevention and treatment of cervical cancer. The present invention provides the following four aspects of content: first, the use of NAT10 as a marker in the preparation of a product for evaluating the risk of cervical cancer and / or the risk of poor prognosis of cervical cancer; second, the use of a reagent for detecting the expression quantity of NAT10 in the preparation of a product for evaluating the risk of cervical cancer and / or the risk of poor prognosis of cervical cancer; third, the use of NAT10 or an encoding gene thereof as a target in the preparation of a product for preventing and treating cervical cancer and / or poor prognosis of cervical cancer; and fourth, the use of a NAT10 inhibitor in the preparation of a product for preventing and treating cervical cancer and / or poor prognosis of cervical cancer.

Description

Applications of NAT10 as a poor prognostic marker for cervical cancer and in cervical cancer treatment drugs Technical Field

[0001] This invention belongs to the field of cervical cancer prevention and treatment technology, specifically involving the application of NAT10 as a poor prognostic marker for cervical cancer and in drugs for treating cervical cancer. Background Technology

[0002] The incidence of cervical cancer is closely related to human papillomavirus (HPV) infection. Early-stage cervical cancer can be cured with radical surgery and adjuvant chemotherapy and radiotherapy. However, effective treatments are currently lacking for recurrent and metastatic cervical cancer. Adding bevacizumab to standard cisplatin-paclitaxel chemotherapy can improve the prognosis of cervical cancer patients, extending their survival by 17 months. Furthermore, various immunotherapies, such as anti-CTLA-4 / PD-L1, have also been used to treat cervical cancer. Despite these advances, effectively treating recurrent and metastatic cervical cancer remains a significant challenge. There is an urgent need to explore the mechanisms of cervical cancer development and progression, and to find effective drugs to inhibit its progression. N-acetyltransferase 10 (NAT10) is a nucleolar protein with acetyltransferase activity, catalyzing the acetylation of lysine residues in proteins and cytosine bases in RNA. Currently, there is no research in this field regarding the relationship between NAT10 and the early diagnosis, prognosis, and prevention of cervical cancer. Summary of the Invention

[0003] In view of this, the present invention provides the use of NAT10 as a biomarker in the preparation of products for assessing cervical cancer risk and / or the risk of poor prognosis in cervical cancer.

[0004] This invention also provides the application of a reagent for detecting NAT10 expression levels in the preparation of products for assessing cervical cancer risk and / or the risk of poor prognosis in cervical cancer.

[0005] This invention also provides the application of NAT10 or its encoding gene as a target in the preparation of products for the prevention and / or treatment of cervical cancer.

[0006] This invention also provides the application of NAT10 or its encoding gene as a target in the preparation of products for the prevention and / or treatment of poor prognosis in cervical cancer.

[0007] This invention also provides the use of NAT10 inhibitors in the preparation of products for the prevention and / or treatment of cervical cancer.

[0008] This invention also provides the use of NAT10 inhibitors in the preparation of products for the prevention and / or treatment of poor prognoses in cervical cancer.

[0009] The present invention also provides a drug that can prevent and treat cervical cancer and / or poor prognosis of cervical cancer, wherein the drug can inhibit the expression of the NAT10 gene or protein, or can inhibit the activity of the NAT10 protein. Attached Figure Description

[0010] Figure 1 shows the results of the close association between NAT10 and poor prognosis of cervical cancer. (A) and (B) show that NAT10 overexpression is closely related to poor disease-free survival (DFS) and overall survival in cervical cancer, respectively, according to the TCGA database. (C) shows the expression of NAT10 in cervical cancer tissue and adjacent normal tissue in cervical cancer tissue microarray. (D) shows that the expression level of NAT10 in cervical cancer tissue is higher than that in adjacent normal tissue, * indicates p < 0.05. (E) shows that high expression of NAT10 is associated with poor overall survival in cervical cancer patients. (F) shows that high expression of NAT10 is associated with poor DFS in cervical cancer patients.

[0011] Figure 2 shows that knocking down NAT10 expression can downregulate the proliferation, invasion, and metastasis of cervical cancer cells. (A) shows the expression of NAT10 in cervical cancer cell lines; (B) shows the knockout efficiency of NAT10 in Siha and Caski cells as verified by Western blot; (C) shows the knockout efficiency of NAT10 in Siha and Caski cells as verified by qRT-PCR; (D) shows the CCK-8 assay confirming that knocking down NAT10 expression in Siha and Caski cervical cancer cells can downregulate their proliferation; (E) shows the scratch assay confirming that knocking down NAT10 expression in Siha and Caski cervical cancer cells can reduce their migration ability; and (F) shows the transmembrane assay confirming that knocking down NAT10 expression in Siha and Caski cervical cancer cells... (G) Transmembrane assays show that knocking down NAT10 expression in cervical cancer cells Siha and Caski cells reduces their invasiveness; (H) A representative image of tumors in the chorioallantoic membrane of chicken embryos after knocking down NAT10 expression in Siha cells; (I) Knockout of NAT10 expression in Siha cells inhibits tumorigenicity of the chorioallantoic membrane of chicken embryos; Note: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001;

[0012] Figure 3 shows that upregulated NAT10 expression in SiHa NAT10 knockout cell lines and HeLa cells promotes the proliferation, migration, and invasion of cervical cancer. (A) Western blotting confirms NAT10 protein overexpression; (B) qRT-PCR shows the overexpression of NAT10 mRNA; (C) NAT10 overexpression promotes CCK-8 cell growth in SiHa NAT10 knockout cell lines and HeLa cells; (D) Wound healing assay assesses the effect of NAT10 overexpression on the migration of SiHa NAT10 knockout cell lines and HeLa cells; (E) Transmembrane assay detects the migration ability of SiHa NAT10 knockout cell lines and HeLa cells overexpressing NAT10; (F) Transmembrane assay detects the invasion ability of SiHa NAT10 knockout cell lines and HeLa cells overexpressing NAT10. Note: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

[0013] Figure 4 shows that the NAT10 inhibitor remodelin can inhibit the proliferation, migration, and invasion of cervical cancer cells. (A) shows the CCK-8 assay results of remodelin inhibiting the proliferation of cervical cancer cells (SiHa, CaSki, and C33A); (B) shows the wound healing assay results of remodelin reducing the migration ability of SiHa cells; (C) shows the wound healing assay results of remodelin reducing the migration ability of CaSki cells; (D) shows the wound healing assay results of remodelin reducing the migration ability of C33A cells; and (E) shows the transmembrane assay results of remodelin. (F) Remodelin reduces the migration ability of Siha cells; (G) Remodelin reduces the migration ability of CaSki cells by transmembrane assay; (H) Remodelin reduces the invasion ability of Siha cells by transmembrane assay; (I) Remodelin reduces the invasion ability of CaSki cells by transmembrane assay; (J) Remodelin reduces the invasion ability of C33A cells by transmembrane assay; Note: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001;

[0014] Figure 5 shows the results of Remodelin inhibiting the growth of cervical cancer in vivo. (A) Tumor images of nude mouse xenograft models treated with subcutaneous injection of SiHa cells and Remodelin or DMSO (control group); (B) Tumor weights of the Remodelin group (inhibitor group) and control group at the end of the experiment; (C) Tumor growth rates of the inhibitor group and control group during treatment; (D) Western blot results of vimentin and N-cadherin expression in each group; (E) Representative images of nude mouse sections stained with hematoxylin-eosin (HE) and immunohistochemical staining of the proliferation marker Ki-67 (Ki67), scale bar ×20, 100 μm; (F) Representative HE images of the lung, liver, spleen, and kidney in the inhibitor Remodelin or control group, scale bar ×20, 100 μm; Note: *p<0.05, ***p<0.001. Detailed Implementation

[0015] This invention provides the application of NAT10 as a biomarker in the preparation of products for assessing cervical cancer risk and / or the risk of poor prognosis in cervical cancer.

[0016] This invention also provides the application of a reagent for detecting NAT10 expression levels in the preparation of products for assessing cervical cancer risk and / or the risk of poor prognosis in cervical cancer.

[0017] In this invention, the product is a reagent in one embodiment and a kit in another embodiment.

[0018] This invention also provides the application of NAT10 or its encoding gene as a target in the preparation of products for the prevention and treatment of cervical cancer and / or the prevention and treatment of poor prognosis in cervical cancer.

[0019] This invention also provides the application of NAT10 inhibitors in the preparation of products for the prevention and treatment of cervical cancer and / or poor prognosis of cervical cancer.

[0020] In this invention, "prevention and treatment" means prevention and / or treatment. In one embodiment of this invention, the product is a drug.

[0021] In this invention, the NAT10 inhibitor is, in one embodiment, an shRNA targeting the NAT10 gene; in another embodiment, an siRNA targeting the NAT10 gene; in one embodiment, a reagent for inhibiting the transcriptional activity of the NAT10 gene; in one embodiment, a reagent for inhibiting the transcriptional level of NAT10 mRNA; in one embodiment, a reagent for promoting the degradation of NAT10 mRNA; in one embodiment, a reagent for specifically recognizing and cleaving the guide nucleic acid of the NAT10 gene to reduce the expression level of NAT10; in one embodiment, a reagent for partially or completely knocking out the NAT10 gene; and in one embodiment, a reagent for inhibiting the activity of the NAT10 protein.

[0022] In this invention, the nucleotide sequence of the shRNA is shown in SEQ ID NO.1 in one embodiment; the nucleotide sequence of the siRNA is shown in SEQ ID NO.2 in one embodiment; and the reagent for inhibiting the activity of NAT10 protein is Remodelin in one embodiment.

[0023] The present invention also provides a drug that can prevent and treat cervical cancer and / or poor prognosis of cervical cancer, wherein the drug can inhibit the expression of the NAT10 gene or protein, or can inhibit the activity of the NAT10 protein.

[0024] In one embodiment of the present invention, the drug comprises shRNA that inhibits the expression of the NAT10 gene; in another embodiment of the present invention, the drug comprises siRNA that inhibits the expression of the NAT10 gene. In one embodiment of the present invention, the nucleotide sequence of the shRNA is shown in SEQ ID NO.1; in another embodiment of the present invention, the nucleotide sequence of the siRNA is shown in SEQ ID NO.2.

[0025] In one embodiment of the present invention, the drug includes a reagent that inhibits the activity of the NAT10 protein; in one embodiment, the reagent that inhibits the activity of the NAT10 protein includes Remodelin.

[0026] In the medicament described in this invention, the dosage form of the medicament is, in one embodiment, an oral liquid, an injection, a tablet, a pill, a dispersant, a capsule, or a granule.

[0027] This invention is the first to propose that NAT10 is highly expressed in cervical cancer, and that this high expression is associated with poor prognosis in cervical cancer patients. Furthermore, this invention is the first to propose that interfering with, knocking down, or inhibiting NAT10 gene expression or NAT10 protein activity can inhibit the proliferation, invasion, and metastasis of cervical cancer cells, indicating that agents that interfere with or knock down NAT10 gene expression or inhibit NAT10 protein activity can be effective drugs for treating cervical cancer and / or improving its poor prognosis.

[0028] In one embodiment of the present invention, the NAT10 protein inhibitor Remodelin can effectively inhibit the proliferation, migration and invasion of cervical cancer cells in vitro, and can also inhibit the growth of cervical cancer cells in vivo.

[0029] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0030] Unless otherwise specified, the following embodiments are all conventional methods.

[0031] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0032] In the following examples, GraphPad Prism 9 software (GraphPad Software Inc.) was used for data processing, and data are expressed as mean ± standard deviation. Student's t-test and analysis of variance (ANOVA) were used to analyze differences between groups. The Kaplan-Meier method was used to analyze survival curves. Statistical significance was defined as p < 0.05.

[0033] Example 1

[0034] The expression levels of NAT10 were log-transformed from the Cancer Genome Atlas (TCGA) (https: / / portal.gdc.cancer.gov / ) in TPM format and included in subsequent analyses using R version 4.2.2. The expression levels of NAT10 were categorized into "low" and "high" groups using the "surv_categorize" function in the R package "survminer" (version 0.4.9).

[0035] Survival analysis of patients with cervical squamous cell carcinoma and cervical endogenous adenocarcinoma (CESC) was performed using "survminer" and the R package "survival" (version 3.4.0) with tumor expression data. The vertical axis represents survival rate and the horizontal axis represents survival time. The Benjamini-Hochberg method was used to adjust the p-value using multiple tests.

[0036] The results showed that in TCGA, overexpression of NAT10 was closely associated with disease-free survival and overall survival in CESC patients (Figure 1(A) and (B)).

[0037] To further investigate the expression of NAT10 in cervical cancer and its relationship with patient prognosis, a commercially available cervical cancer tissue microarray was used. NAT10 protein levels were detected by IHC. Specifically, the cervical cancer tissue microarray (HUteS136Su01, Shanghai Xinchao Biotechnology Co., Ltd., China) was dried, dewaxed, and hydrated, and then blocked with 5% bovine serum albumin (BSA; CCS30014.01; MRC, New York, USA). NAT10 expression was assessed using a NAT10 monoclonal antibody (1:100, SC-271770, Santa Cruz Biotechnology, CA, USA). The immunostaining intensity of NAT10 was measured using the H-score method. The cervical cancer tissue microarray included 110 cervical cancer tissue samples and 25 adjacent non-cervical cancer tissue samples. The results showed that the expression level of NAT10 protein in the nucleus and cytoplasm of cervical cancer cells was significantly higher than that in the nucleus and cytoplasm of adjacent normal tissues (see Figure 1(C)). The expression level of NAT10 in cervical cancer tissues was significantly higher than that in adjacent normal tissues (see Figure 1(D)).

[0038] Kaplan-Meier curves showed that patients with high NAT10 expression had lower overall survival (OS) and disease-free survival (DFS) (see (E) and (F) in Figure 1), suggesting that NAT10 plays a role in predicting poor prognosis in cervical cancer.

[0039] Example 2

[0040] NAT10 promotes the proliferation, migration, and invasion of cervical cancer cells.

[0041] To evaluate the functional role of NAT10 in cervical cancer, the expression of NAT10 was detected using four cervical cancer cell lines (SiHa, CaSki, C33A, and HeLa). The specific methods are as follows:

[0042] 2.1 Cell Culture and Reagents

[0043] Human cervical SiHa and CaSki cells were purchased from Procell Company (Wuhan, China). C33A and HeLa cells were donated by Professor Zhang Bingzhong. All cell lines were cultured in modified DMEM medium (Gibco, Grand Island, NY, USA) containing 10% fetal bovine serum (FBS; Procell, Wuhan, China) and 5% CO2.

[0044] 2.2 Cell proliferation assay

[0045] Cell proliferation was measured using a cell counting kit-8 (CCK-8, Dojindo, Japan). Cells were counted at 3 × 10⁻⁸ cells per cell line. 3 Cells were seeded into 96-well plates and cultured at different time points (0, 24, 48, 72, and 96 hours). After culturing with 10 μL of CCK-8 for 2 hours, the absorbance was recorded at a wavelength of 450 nm.

[0046] 2.3 Cell transfection and RNA interference

[0047] Lentiviral vectors containing short hairpin RNA (shRNA) and the NAT10 coding sequence were purchased from Genechem (Shanghai, China). The shRNA sequence of NAT10 is agggccctcctttcctataag (SEQ ID NO.1). The lentivirus was used to infect the cervical cancer SiHa cell line. NAT10 expression in CaSki cells was knocked out using Lipofectamine 3000 (Invitrogen, USA), with the siRNA being gcugugguguuauaagaaatt (SEQ ID NO.2).

[0048] 2.4 Cell migration and cell invasion assays

[0049] Wound healing was used to assess cell migration ability. Simply put, a monolayer of cells was scratched with a pipette tip, and the wound width was captured at 0 and 24 hours using a Leica DMC4500 microscope (Leica, Wetzlar, Germany). Migration distance was analyzed using ImageJ software (National Institutes of Health, Bethesda, MD, USA).

[0050] Transwell experiments were conducted using an 8 μm chamber (Falcon, Corning, NY, USA). A total of 5 × 10⁻⁶ chambers were used. 4 Cells were suspended in DMEM containing 2% FBS and loaded into the upper chamber. The lower chamber was loaded with DMEM containing 20% ​​FBS. In the invasion assay, 50 μL of diluted Matrigel (BD Biosciences, Franklin Lakes, NJ, USA) was spread on the upper layer of each chamber. After 48 hours of culture, unmigrated cells were wiped off the inner surface of the upper layer of the chamber with a cotton swab. The chambers were fixed with 4% paraformaldehyde and stained with 0.1% methylene blue for 30 minutes. Images were acquired and analyzed using ImageJ software. Three independent experiments were performed.

[0051] 2.5 Western blot analysis

[0052] Total protein was extracted from cells and subjected to sodium dodecyl polyacrylamide gel electrophoresis (SDS-PAGE) (EpiZyme, Cambridge, MA, USA). The protein was then transferred to a polyvinylidene fluoride (PVDF) membrane (Millipore Sigma, Burlington, MA, USA). The PVDF membrane was then blocked with a rapid sealing buffer (NCM Biotechnology, Suzhou, China), cleaved to the predicted molecular weight, and incubated overnight at 4°C with NAT10 monoclonal antibody and GAPDH polyclonal antibody (1:20000; AP0063, Bioworld, Minneapolis, MN, USA). Horseradish peroxidase (HRP)-goat anti-rabbit antibody (1:5000, AP0063, Bioworld) or horseradish peroxidase-conjugated anti-mouse secondary antibody (1:5000, SA00001-1, Proteintech) was incubated at room temperature for 2 hours. Immunoblot analysis was performed using the Tanon 5200 multi-intelligent imaging system (ChampChemi610, Beijing Saijing Technology Co., Ltd.).

[0053] 2.6 qRT-PCR

[0054] Total RNA was extracted using TRIzol reagent (Thermo Fisher Scientific, Waltham, MA, USA). Then, using cDNA as a template, qPCR was performed using SYBR Premix Ex Taq (Yeasen Biotech) according to the manufacturer's instructions. All data were analyzed based on GAPDH expression. The primers designed for qPCR were as follows: GAPDH (forward): GGAGCGAGATCCCTCCAAAAT (SEQ ID NO.3), GAPDH (reverse): GGCTGTTGTCATACTTCTCATGG (SEQ ID NO.4); NAT10 (forward): ATAGCAGCCACAAACATTCGC (SEQ ID NO.5), NAT10 (reverse): ACACACATGCCGAAGGTATTG (SEQ ID NO.6).

[0055] 2.7 Chicken Embryo Chollal Allantoic Membrane (CAM) Test

[0056] The fertilized egg developed for 10 days. Then, the fertilized egg was placed on its side, and the shell was punctured on the top side of the air sac. After the air in the air sac was aspirated, the air sac was depressed to form the chicken embryo chorioallantoic membrane. Then, each chicken embryo chorioallantoic membrane was inoculated with 100 μL of cell suspension containing 1,000,000 cells. After culturing in a 37°C incubator for 6 days, the tumor was collected.

[0057] The results showed that NAT10 was expressed in all four cervical cancer cell lines (SiHa, CaSki, C33A and HeLa), and was overexpressed in CaSki and SiHa cells (see (A) in Figure 2).

[0058] To explore the biological function of reduced NAT10 expression in cervical cancer, NAT10 expression was knocked down in SiHa and CaSki cells using shRNA (ShNAT10) and siRNA (SiNAT10), respectively. The results showed that knockout of NAT10 significantly reduced both NAT10 mRNA and protein levels (see (B) and (C) in Figure 2).

[0059] CCK-8 assays showed that silencing NAT10 significantly reduced the proliferation of SiHa and CaSki cells (see Figure 2, (D)). Wound healing assays indicated that downregulating NAT10 expression slowed wound healing in these cells (see Figure 2, (E)). Transmembrane assays also showed that silencing NAT10 reduced the migration and invasion abilities of SiHa and CaSki cells (see Figure 2, (F) and (G)). Subsequently, it was found that downregulating NAT10 expression inhibited the proliferation of cervical cancer cells in CAMs (see Figure 2, (H) and (I)).

[0060] Next, NAT10 was overexpressed in the SiHa NAT10 knockout cell line (ShNAT10 cell line) and HeLa cell line using a lentiviral method to explore the oncogenic effect of NAT10. After transfection with OE lentivirus, the mRNA and protein levels of NAT10 in the SiHa-ShNAT10 and HeLa OE cell lines were significantly increased (see Figure 3(A) and (B)). CCK-8 assay showed that the proliferation capacity of cells was significantly enhanced after NAT10 overexpression (see Figure 3(C)). Furthermore, NAT10 overexpression also promoted wound healing in SiHa and HeLa cells (see Figure 3(D)). In transmembrane experiments, NAT10 overexpression significantly promoted the migration and invasion of SiHa and HeLa cells (see Figure 3(E) and (F)).

[0061] All the above in vitro experimental results indicate that NAT10 is an oncogene for cervical cancer.

[0062] Example 3

[0063] The NAT10 inhibitor remodelin was able to inhibit the proliferation and metastasis of cervical cancer cells in vitro and in vivo (CCK-8 assay, cell migration and cell invasion assays were the same as in Example 2).

[0064] In the cell migration and cell invasion assays, the difference from 2.4 of Example 2 was the addition of dimethyl sulfoxide (DMSO) or the NAT10 inhibitor Remodelin (Selleck, China) to the upper cavity; otherwise, the assays were the same as in 2.4 of Example 2.

[0065] In the CCK-8 experiment, SiHa, CaSki, and C33A cells in the logarithmic growth phase were seeded at 3000 cells / well in 96-well plates. After 24 hours, the cells were randomly divided into two groups (n>3): a DMSO solvent control group and a Remodelin group. The control group received 50 μM Remodelin and a complete culture medium containing an equal volume of DMSO. At 0 h, 24 h, 48 h, 72 h, and 96 h, cells were incubated with 10% CCK-8 medium and their OD values ​​(450 mmHg) were measured after two hours of incubation. The CCK-8 experiment showed that Remodelin significantly inhibited the proliferation of SiHa, CaSki, and C33A cells (see Figure 4(A)). Compared with the control group, Remodelin significantly weakened the wound healing ability of SiHa, CaSki, and C33A cells (see Figure 4(B), (C), and (D)). Transmembrane experiments showed that Remodelin reduced the migration and invasion abilities of SiHa, CaSki, and C33A cells (see (E), (F), (G), (H), (I), and (J) in Figure 4).

[0066] These results further confirm that NAT10 can serve as a therapeutic target for cervical cancer, and that the remodeling protein Remodelin is a therapeutic agent that can inhibit the progression of cervical cancer.

[0067] Example 4

[0068] BALB / c naked xenograft model

[0069] All animal experiments were conducted in accordance with the regulations of the Animal Experimentation Ethics Committee of Zhujiang Hospital (Guangzhou, China). Female mice (BALB / c, 5-6 weeks old, 16-19 g) were housed under pathogen-free conditions. Twelve mice were subcutaneously injected with SiHa cells (2 × 10⁻⁶ cells) into the right axilla. 6Each mouse was treated with 100 μL PBS. Ten mice developed tumors. They were randomly divided into two groups. When the tumor volume reached 50–100 mm, the mice were intraperitoneally injected every three days with either Remodelin (5 mg / kg) or DMSO (solvent control group). After 18 days of treatment, all mice were sacrificed, and the tumors were dissected and weighed. The remaining IHC detection methods were the same as in Example 1; the Western blot analysis method was the same as in 2.5 of Example 2, except that: the PVDF membrane was then blocked with a rapid sealing solution (NCM Biotechnology Co., Ltd., Suzhou, China), cut according to the predicted molecular weight, and incubated overnight at 4°C with vimentin polyclonal antibody (1:1000, 10366-1-AP, Proteintech), N-cadherin polyclonal antibody (1:1000, YT2988, Immunoway), and GAPDH polyclonal antibody (1:20000; AP0063, Bioworld, Minneapolis, MN, USA), and the rest were the same as in 2.5 of Example 2.

[0070] In a nude mouse subcutaneous tumor transplantation model, Remodelin significantly inhibited cervical tumor growth and reduced its weight (see Figure 5(A), (B), and (C)). Western blot analysis showed that the inhibitor Remodelin significantly reduced the levels of N-adhesion and vimentin (see Figure 5(D)), indicating that Remodelin inhibited epithelial-mesenchymal transition (EMT) within cervical cancer tumors. IHC analysis showed that Ki67 expression (reflecting tumor proliferation) was reduced after Remodelin treatment (see Figure 5(E)). More importantly, Remodelin treatment had minimal impact on organ damage in mice (see Figure 5(F)), indicating that the use of the inhibitor Remodelin to treat cervical cancer is safe.

[0071] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. Application of NAT10 as a biomarker in the preparation of products for assessing cervical cancer risk and / or the risk of poor prognosis in cervical cancer.

2. The use of a reagent for detecting NAT10 expression levels in the preparation of products for assessing cervical cancer risk and / or the risk of poor prognosis in cervical cancer.

3. Use according to claim 1 or claim 2, characterised in that, The types of products include reagents or kits.

4. Application of NAT10 or its encoding gene as a target in the preparation of products for the prevention and / or treatment of cervical cancer.

5. Application of NAT10 or its encoding gene as a target in the preparation of products for the prevention and / or treatment of poor prognosis in cervical cancer.

6. Application of NAT10 inhibitors in the preparation of products for the prevention and / or treatment of cervical cancer.

7. Application of NAT10 inhibitors in the preparation of products for the prevention and / or treatment of poor prognoses in cervical cancer.

8. Use according to any one of claims 4 to 7, characterized in that, The products include pharmaceuticals.

9. Use according to claim 6 or claim 7, characterised in that, The NAT10 inhibitors include any one of the following: (1) shRNA targeting the NAT10 gene; (2) siRNA targeting the NAT10 gene; (3) reagents that inhibit the transcriptional activity of the NAT10 gene; (4) reagents that inhibit the transcriptional level of NAT10 mRNA; (5) reagents that promote the degradation of NAT10 mRNA; (6) reagents that specifically recognize and cleave the guide nucleic acid of the NAT10 gene to reduce the expression level of NAT10; (7) reagents for partially or completely knocking out the NAT10 gene; and (8) reagents that inhibit the activity of the NAT10 protein.

10. Use according to claim 9, characterized in that, The nucleotide sequence of the shRNA is shown in SEQ ID NO.

1.

11. Use according to claim 9, characterized in that, The nucleotide sequence of the siRNA is shown in SEQ ID NO.

2.

12. The use according to claim 9, characterized in that, Reagents that inhibit NAT10 protein activity include Remodelin.

13. An agent capable of preventing and / or treating cervical cancer and / or poor prognosis of cervical cancer, characterized by, The drug can inhibit the expression of the NAT10 gene or protein, or can inhibit the activity of the NAT10 protein.

14. The medicament according to claim 13, characterized in that, The drug includes shRNA and / or siRNA that inhibit the expression of the NAT10 gene.

15. The medicament according to claim 14, characterized in that, The nucleotide sequence of the shRNA is shown in SEQ ID NO.

1.

16. The medicament according to claim 14, characterized in that, The nucleotide sequence of the siRNA is shown in SEQ ID NO.

2.

17. The medicament according to claim 13, characterized in that, The drug includes a reagent that inhibits the activity of the NAT10 protein.

18. The medicament according to claim 17, characterized in that, The reagents used to inhibit NAT10 protein activity include Remodelin.

19. The medicament according to claim 13, characterized in that, The dosage forms of the drug include oral liquid, injection, tablet, pill, dispersant, capsule or granule.

Images