Oligonucleotide, oligonucleotide conjugate and composition, and use thereof

Abstract

The present disclosure provides a single-stranded oligonucleotide with the length of 16-30 nucleotides, and composition of the single-stranded oligonucleotide enables the single-stranded oligonucleotide to inhibit expression of a Lp(a) mRNA through a RNAi mechanism; each nucleotide in the single-strand oligonucleotide is a modified or unmodified nucleotide, in the single-strand oligonucleotide, at least one nucleotide being a nucleotide X and at least one nucleotide being a fluoro modified nucleotide; and in a 5' to 3' direction, at least 1 nucleotide X is located downstream from the 8th nucleotide in the single-stranded oligonucleotide and separated from the 8th nucleotide by 4-7 nucleotides. The present disclosure further provides a double-stranded oligonucleotide comprising the single-stranded oligonucleotide as an anti-sense strand, an oligonucleotide conjugate and a pharmaceutical composition.

Description

OLIGONUCLEOTIDE, OLIGONUCLEOTIDE CONJUGATE AND COMPOSITION,AND USE THEREOFTECHNICAL FIELDThe present disclosure relates to a single-stranded oligonucleotide, and further relates to a double-stranded oligonucleotide comprising the single-stranded oligonucleotide as an anti-sense strand, an oligonucleotide conjugate, a pharmaceutical composition, and use and preparation method thereof.BACKGROUNDLipoprotein (a) [Lp(a)] is a heterogeneous low density lipoprotein (LDL)-like particle, which contains a lipid core and an apolipoprotein B (apoB-100), and a unique component, which is namely an apolipoprotein (a) (apo(a)) attached to the apoB-100 via a disulfide bond. A Lp(a) (Apo(a)) mRNAis mainly expressed in liver, a main physiological function of Lp(a) is to prevent a blood clot in a blood vessel from dissolving, and the Lp(a) can promote the formation of atherosclerosis pathologically. The continuous increase of lipoprotein level is closely related to angina pectoris, myocardial infarction and cerebral hemorrhage, and is an independent risk factor for cerebral apoplexy and a coronary heart disease. The Lp(a) level in human body is genetically limited, and does not change significantly with diet, exercise or other lifestyle changes. The length of Lp(a) varies according to the number of existing Kringle KIV2 domains, and the expression of Lp(a) is negatively correlated with the number of existing domains. The analysis of Lp(a) level in many studies suggests that a high Lp(a) level is an independent risk factor for a cardiovascular disease, stroke and other related diseases (comprising atherosclerotic stenosis). If the expression of Lp(a) mRNA can be silenced from a gene level, it will undoubtedly be the most ideal treatment method. A small interfering RNA (siRNA) may inhibit or block the expression of any interested target gene in a sequence-specific way based on a mechanism of RNA interference (RNAi), thereby achieving the purpose of disease treatment.The stabilization modification and delivery system of the siRNA are two key technologies in the development of small RNA drugs. In drug development of oligonucleotides, comprising a single-stranded oligonucleotide and a double-stranded oligonucleotide, the improvement of modification to the oligonucleotide has never stopped. In the single-stranded oligonucleotide, such as ASO and ssRNAi, and in the double-stranded oligonucleotide, such as an anti-sense strand of siRNA, different types, positions and numbers of modification may significantly influence key properties of the oligonucleotide, such as a pharmacological activity, a stability and a long-termeffect. Although a large number of modification schemes for the oligonucleotide have been disclosed in the prior art, how to improve the modification to the oligonucleotide, especially the single-stranded oligonucleotide and the anti-sense strand of the double-stranded oligonucleotide, so as to obtain an oligonucleotide with a high activity, a high stability and / or a long-term effect, remains a research direction in this field.SUMMARYThe present disclosure provides a single-stranded oligonucleotide, a double-stranded oligonucleotide comprising the single-stranded oligonucleotide as an anti-sense strand and an oligonucleotide conjugate, all of which show good pharmaceutical activity and stability when targeting a Lp(a) mRNA.The present disclosure provides a single-stranded oligonucleotide, wherein the length of the single-stranded oligonucleotide is 16-30 nucleotides, and composition of the single-stranded oligonucleotide enables the single- stranded oligonucleotide to inhibit expression of Lp(a) mRNA through a RNAi mechanism; each nucleotide in the single-strand oligonucleotide is a modified or unmodified nucleotide, wherein, in the single-strand oligonucleotide, at least one nucleotide is a nucleotide X and at least one nucleotide is a fluoro modified nucleotide; and in a 5’ to 3’ direction, at least one nucleotide X is located downstream from the 8thnucleotide in the single-stranded oligonucleotide and separated from the 8thnucleotide by 4-7 nucleotides;in a 5’ to 3’ direction, in a case that a 14thnucleotide of the single-stranded oligonucleotide is the nucleotide X, and a 15thnucleotide and all subsequent nucleotides of the single-stranded oligonucleotide are the modified nucleotides, a 13thnucleotide of the single-stranded oligonucleotide is selected from one of an alkoxy modified nucleotide, an alkyl modified nucleotide, a substituted alkyl modified nucleotide, an amine modified nucleotide, a thermally destabilizing nucleotide and a BNA; andeach nucleotide X is a deoxynucleotide or the unmodified nucleotide.In another aspect, the present disclosure provides a double-stranded oligonucleotide, wherein the double-stranded oligonucleotide comprises a sense strand and an anti-sense strand, each nucleotide in the sense strand and the anti-sense strand is a modified or unmodified nucleotide, and the sense strand is at least partially reverse complementary to the anti-sense strand to form a double-stranded region, wherein, the anti-sense strand is the single-stranded oligonucleotide of the present disclosure.In another aspect, the present disclosure provides a double-stranded oligonucleotide, wherein the double-stranded oligonucleotide comprises a sense strand and an anti-sensestrand, each nucleotide in the sense strand and the anti-sense strand is independently a modified or unmodified nucleotide, and the sense strand is at least partially reverse complementary to the anti-sense strand to form a double-stranded region. At least 15, 16, 17, 18 or 19 contiguous nucleotides between unmodified equivalent sequences of the sense strand and the anti-sense strand and unmodified equivalent sequences of a sense strand and an anti-sense strand of any one of siRNA1-siRNA2 listed in Table 1 are consistent, and there are no more than 3 base differences, no more than 1 base difference, or no base difference.In another aspect, the present disclosure provides an oligonucleotide conjugate, wherein the oligonucleotide conjugate comprises an oligonucleotide group and a delivery group conjugated to the oligonucleotide group, the oligonucleotide group is a group formed by removing one or more atoms or atomic groups from the single-stranded oligonucleotide or the double-stranded oligonucleotide provided by the present disclosure.In another aspect, the present disclosure further provides a pharmaceutically acceptable salt of the single-stranded oligonucleotide of the present disclosure, the double-stranded oligonucleotide or the oligonucleotide conjugate of the present disclosure.In another aspect, the present disclosure further provides a pharmaceutical composition, wherein the pharmaceutical composition comprises one or more of the single-stranded oligonucleotide of the present disclosure, the double-stranded oligonucleotide and the oligonucleotide conjugate of the present disclosure, and the pharmaceutically acceptable salt, and a pharmaceutically acceptable excipient.In another aspect, the present disclosure further provides use of one or more of the single-stranded oligonucleotide, the double-stranded oligonucleotide, the oligonucleotide conjugate, the pharmaceutically acceptable salt and the pharmaceutical composition in the present disclosure in preparation of a medicament for treating and / or preventing a disease or symptom related to a level of the Lp(a) mRNA.In another aspect, the present disclosure further provides a method for treating and / or preventing a disease or symptom related to a level of a Lp(a) mRNA, wherein the method comprises administering one or more of the single-stranded oligonucleotide, the doublestranded oligonucleotide, the oligonucleotide conjugate, the pharmaceutically acceptable salt and the pharmaceutical composition in the present disclosure to a subject in need.In another aspect, the present disclosure further provides a method for inhibiting Lp(a) mRNA in a cell, wherein the method comprises contacting one or more of the single-stranded oligonucleotide, the double-stranded oligonucleotide, the oligonucleotide conjugate, the pharmaceutically acceptable salt and the pharmaceutical composition in the presentdisclosure with the cell.In another aspect, the present disclosure further provides one or more of the singlestranded oligonucleotide, the double-stranded oligonucleotide, the oligonucleotide conjugate, the pharmaceutically acceptable salt and the pharmaceutical composition in the present disclosure for use as a medicament.In another aspect, the present disclosure further provides a cell expressing a Lp(a) mRNA, wherein the cell comprises one or more of the single-stranded oligonucleotide, the double-stranded oligonucleotide, the oligonucleotide conjugate, the pharmaceutically acceptable salt and the pharmaceutical composition in the present disclosure.In addition, the present disclosure further provides a kit, wherein the kit comprises one or more of the single-stranded oligonucleotide, the double-stranded oligonucleotide, the oligonucleotide conjugate, the pharmaceutically acceptable salt and the pharmaceutical composition in the present disclosure.Incorporation by referenceAll publications, comprising patents, patent applications or non-patent literatures, mentioned in the specification are incorporated herein by reference to the same extent as if each separate publication is specifically and separately incorporated herein by reference.Beneficial effectsOne or more of the double-stranded oligonucleotide comprising the single-stranded oligonucleotide of the present disclosure as the anti-sense strand, the oligonucleotide conjugate and the pharmaceutical composition have a high regulation activity to a Lp(a) mRNA, such as having good stability and inhibitory activity against the Lp(a) mRNA in vitro and in vivo, thereby having a good application prospect.In in vitro experiments, both transfected and untransfected siRNA conjugates showed high inhibition rates in primary monkey liver cells. In particular, the transfected siRNA conjugate showed an inhibition rate of 81.4% at 50 nM and 90% at 1 nM; the untransfected siRNA conjugate showed an inhibition rate of 68.5% at 50 nM, which was higher than that of the reference conjugate.In in vivo experiments, during a whole experimental period of 141 days, an inhibition rate of the conjugate provided by the present disclosure to the Apo(a) protein remained at a high level all the time. At an administration dosage of 3 mg / kg, the inhibition rate of the conjugate against the Apo(a) protein was 49% or higher, and even at a low administration dosage of 1 mg / kg, the inhibition rate of the conjugate against the Apo(a) protein was still 49% or higher. Particularly, at the administration dosage of 3 mg / kg, the inhibition rate of conjugate 3 remained 85% or higherfrom day 8 to day 113, and the inhibition rate still remained 74% or higher on day 141. In a comparative experiment with the reference conjugate 3, the conjugate provided by the present disclosure showed good activity, stability and long-term effect in inhibiting an Apo(a) protein level in serum. At the administration dosage of 3 mg / kg, the inhibition rate of the reference conjugate 3 against the Apo(a) protein in serum was greatly fluctuated with time and significantly reduced in a later stage of the experiment, such as being reduced from 68.5% on day 57 to 44.2% on day 71 and then to 7.9% on day 86, which was less than 10% of a highest inhibition rate of 88.3%. However, the conjugate provided by the present disclosure showed a more stable and lasting inhibition effect, the inhibition rate was always maintained at 85% or higher, and a difference between a lowest inhibition rate of 85.1% and a highest inhibition rate of 93.6% i\was only less than 9%. In a comparative experiment with the reference conjugate 4, the conjugate provided by the present disclosure had good activity, stability and long-term effect in inhibiting the Apo(a) protein level in serum. At the administration dosage of 3 mg / kg, the inhibition rate of the reference conjugate 3 against the Apo(a) protein in serum was greatly fluctuated with time and significantly reduced in a later stage of the experiment, such as being reduced from 85.7% on day 29 to 45.7% on day 57 and then to 32.5% on day 86, which was only 1 / 3 of a highest inhibition rate of 96.4%. However, the conjugate provided by the present disclosure showed a more stable and lasting inhibition effect, the inhibition rate was always maintained at 84% or higher, and a difference between a lowest inhibition rate of 84.5% and a highest inhibition rate of 99.3% was only less than 15%. At the administration dosage of 1 mg / kg, the inhibition rate of the reference conjugate 3 against the Apo(a) protein in serum was also greatly fluctuated with time and significantly reduced in the later stage of the experiment. However, the conjugate provided by the present disclosure showed a more stable and lasting inhibition effect. The above results show that the conjugate of the present disclosure can efficiently maintain an excellent inhibition effect on the Lp(a) mRNA in an animal model for a long-term, and then continuously and efficiently inhibit an Apo(a) protein level in serum.Therefore, it is indicated that the conjugate of the present disclosure has a good regulation activity against the Lp(a) mRNA and / or the Lp(a) protein, shows a remarkable pharmaceutical activity in preparation of the medicament for treating and / or preventing the disease or symptom related to the expression of the Lp(a) mRNA, and has an excellent development prospect.DETAILED DESCRIPTION OF THE INVENTIONThe specific embodiments of the present disclosure are described in detail as below. It should be understood that the specific embodiments described herein are only for thepurpose of illustration and explanation of the present disclosure and are not intended to limit the present disclosure.In the present disclosure, a Lp(a) mRNA refers to a Lp(a) mRNA expressed in mammalian cells. In the present disclosure, the Lp(a) mRNA typically refers to a mRNA with a Genbank registration number of NM_005577.4. Further, unless otherwise specified, the term “Lp(a) gene” used in the present disclosure refers to a gene transcribing the Lp(a) mRNA above.DefinitionIn the context of the present disclosure, the expressions “complementary” and “reverse complementary” can be interchangeably used, and have well-known meanings to those skilled in the art, namely, in a double-stranded nucleic acid structure, bases in one strand and bases in the other strand form hydrogen bonds between base pairs in a complementary way to realize base pairing, thereby forming Watson-Crick base pairs. The “base pair” refers to two bases forming base pairing. In nucleic acid sequences, a purine base adenine (A) is always paired with a pyrimidine base thymine (T) in DNAs or uracil (U) in RNAs; and a purine base guanine (G) is always paired with a pyrimidine base cytosine (C). Each base pair comprises a purine and a pyrimidine. While adenines in one strand are always paired with thymines (or uracils) in another strand, and guanines are always paired with cytosines, these two strands are considered as being complementary to each other; and the sequence of a strand may be deduced from the sequence of its complementary strand. When the bases are modified, it is also considered that these modified bases can form complementary pairing as long as the above purine-pyrimidine pairing relationship (comprising, but being not limited to, a number and interaction intensity of hydrogen bonds between the bases) is not affected. Correspondingly, a “mispairing” or “base mispairing” in the art means that, between two single-stranded nucleic acids involved, the bases at corresponding positions are not presented in a manner of being complementarily paired; and when there is an abasic nucleotide at the corresponding position, it is also considered that the bases in the other strand form the mispairing.In the context, “at least partially reverse complementary”, “basically reverse complementary”, “substantially reverse complementary” and “completely reverse complementary” refer to base pairings between nucleotide sequences of two nucleic acid single strands in a singlestranded oligonucleotide and the Lp(a) mRNA, in the single-stranded oligonucleotide and a nucleotide sequence m, in a sense strand and an anti-sense strand of a double-stranded oligonucleotide, and in the anti-sense strand of the double- stranded oligonucleotide and the Lp(a) mRNA. Unless otherwise specified, the “at least partially reverse complementary” means that, ina hypothetically or actually formed double-stranded region, there are no more than 50% of base mispairings between two nucleotide sequences capable of forming the double-stranded region; the “substantially reverse complementary” means that, in the hypothetically or actually formed double-stranded region, there are no more than 3 base mispairings between two nucleotide sequences capable of forming the double-stranded region; the “substantially reverse complementary” means that, in the hypothetically or actually formed double-stranded region, there is no more than 1 base mispairing between two nucleotide sequences capable of forming the double-stranded region; and the “completely reverse complementary” means that, in the hypothetically or actually formed double-stranded region, there is no base mispairing between two nucleotide sequences capable of forming the double-stranded region. In the case of being “at least partially reverse complementary”, “basically reverse complementary”, “substantially reverse complementary” or “completely reverse complementary”, after annealing, two nucleotide sequences may form a double-stranded hybrid composed of the Watson-Crick base pairs.In the context of the present disclosure, the “double-stranded region” refers to a doublestranded structure formed between the shortest nucleotide sequences comprising all bases forming base pairs on each single strand in a hypothetically or actually formed double-stranded nucleic acid structure. Therefore, the double-stranded region is composed of all base pairs in the doublestranded nucleic acid structure and all base mispairings between the base pairs. In some embodiments, the double-stranded nucleic acid structure comprises the double-stranded region and one or more overhangs, and the overhang is composed of all nucleotides failed to form base pairings outside the double-stranded region in one or two single strands. In some embodiments, the double-stranded nucleic acid structure comprises only the double-stranded region.Lengths of two nucleotide sequences capable of forming the double-stranded region may be the same or different. In some embodiments, the double-stranded nucleic acid structure comprises only the double- stranded region, and in this case, the lengths of two nucleotide sequences forming the double-stranded nucleic acid structure are the same. The “at least partially reverse complementary” means that there are no more than 50% of base mispairings between two nucleotide sequences, the “substantially reverse complementary” means that there are no more than 3 base mispairings between two nucleotide sequences, the “substantially reverse complementary” means that there is no more than 1 base mispairing between two nucleotide sequences, and the “completely reverse complementary” means that there is no base mispairing between two nucleotide sequences. In some embodiments, the lengths of two nucleotide sequences forming the double-stranded nucleic acid structure are the same, the double-stranded nucleic acid structure comprises the double-stranded region and one overhang in each nucleotidesequence, and lengths of overhangs of two nucleotides are the same. In some embodiments, the lengths of two nucleotide sequences forming the double-stranded nucleic acid structure are different, and the double-stranded nucleic acid structure comprises the double-stranded region and one or two overhangs in the nucleotide sequence with a greater length. For example, in some embodiments, lengths of the sense strand and the anti-sense strand of the double-stranded oligonucleotide are different. For example, the double-stranded oligonucleotide is a siRNA, and in this case, the length of the sense strand is usually shorter, so that the sense strand is a shorter nucleotide sequence, and the length of the anti-sense strand is longer, so that the anti-sense strand is a longer nucleotide sequence. The double-stranded nucleic acid structure comprises the doublestranded region and one overhang in the anti-sense strand.In the context, “there are X contiguously consistent nucleotides between a nucleotide sequence A and a nucleotide sequence B, and the contiguously consistent nucleotides have no more than Y base differences or no base difference” means that there is a contiguous nucleotide sequence A’ with a length of X in the nucleotide sequence A, the nucleotide sequence A’ is contiguously consistent with a contiguous nucleotide sequence B’ with the same length of X in the nucleotide sequence B, and the nucleotide sequence A’ and the nucleotide sequence B’ have no more than Y base differences.In the context, “the nucleotide sequence A is basically reverse complementary, substantially reverse complementary or completely reverse complementary to the nucleotide sequence B in a length of X nucleotides” means that there is the contiguous nucleotide sequence A’ with the length of X in the nucleotide sequence A, and the nucleotide sequence A’ is basically reverse complementary, substantially reverse complementary or completely reverse complementary to the continuous nucleotide sequence B’ with the same length of X in the nucleotide sequence B.In the context, an “unmodified equivalent sequence” refers to an oligonucleotide sequence without any ribose ring modification, base modification and phosphate backbone modification compared with an original sequence as a basis of comparison. For example, an unmodified equivalent sequence of VPAmsCfsdTGmsUmia is ACUGUN, wherein N is A, C, G or U.Unless otherwise specified, in the context, when separately referring to the oligonucleotide and / or the oligonucleotide conjugate in the application or method provided by the present disclosure, comprising, but being not limited to, the oligonucleotide and / or the oligonucleotide conjugate expressed in any structural formula in the application or method provided by the present disclosure, it also refers to the pharmaceutically acceptable salt of the oligonucleotide and / or the conjugate according to the context.In the context, particularly in the description of the method for preparing the single-strandedoligonucleotide, the double-stranded oligonucleotide, the pharmaceutical composition or the oligonucleotide conjugate of the present disclosure, unless otherwise specified, the nucleoside monomer refers to, according to the kind and sequence of the nucleotides in the single-stranded oligonucleotide, double-stranded oligonucleotide or oligonucleotide conjugate to be prepared, unmodified or modified RNA phosphoramidites (the RNA phosphoramidites are also called as Nucleoside phosphoramidites elsewhere) used in solid-phase phosphoramidite synthesis. Solidphase phosphoramidite synthesis is a well-known method used in RNA synthesis to those skilled in the art. Each of nucleoside monomers used in the present disclosure can be commercially available.Various protecting groups, such as hydroxy protecting groups or amino protecting groups, may be used in the present disclosure. In the context, the protecting groups render chemical functional groups inert to specific reaction conditions, and may be attached to and removed from such functional groups in a molecule without substantially damaging the remainder of the molecule. Representative hydroxy protecting groups are disclosed in Tetrahedron 1992, 48, 2223-2311, written by Beaucage, et al., and also in GREEN’s Protective Groups in Organic Synthesis, Chapter 2, 5th edition, John Wiley & Sons Inc., New Jersey, 2014, written by Peter G. M. Wuts, each of which is hereby incorporated by reference in their entirety. In some embodiments, the protecting group is stable under basic conditions, but can be removed under acidic conditions. In some embodiments, non-exclusive examples of the hydroxy protecting groups used herein comprise dimethoxytrityl (DMT), monomethoxytrityl, 9-phenylxanthen-9-yl (Pixyl), and 9-(p-methoxyphenyl)xanthen-9-yl (Mox). In some embodiments, non-exclusive examples of the hydroxy protecting groups used herein comprise Tr (trityl), MMTr (4-methoxytrityl), DMTr (4,4’-dimethoxytrityl), and TMTr (4,4’,4”-trimethoxytrityl).The term “subject”, as used herein, refers to any animal, for example, mammal or marsupial. The subject of the present disclosure comprises, but is not limited to, human, non-human primate (for example, rhesus or other kinds of macaque), mouse, pig, horse, donkey, cow, rabbit, sheep, rat and any kind of poultry.As used herein, “treatment” refers to a method for obtaining advantageous or desired results, comprising, but being not limited to, a therapeutic benefit. The “therapeutic benefit” means eradication or improvement of potential disorder to be treated. Moreover, the therapeutic benefit is achieved by eradicating or improving one or more of physiological symptoms associated with the potential disorder, such that an improvement is observed in the subject, notwithstanding that the subject may still be afflicted with the potential disorder.As used herein, “prevention” refers to a method for obtaining advantageous or desired results,comprising, but being not limited to, a prophylactic benefit. For obtaining the “prophylactic benefit”, one or more of the single-stranded oligonucleotide, the double-stranded oligonucleotide, the pharmaceutical composition and the oligonucleotide conjugate may be administered to the subject at risk of developing a disease related to the Lp(a) mRNA, or to the subject reporting one or more physiological symptoms of the disease, even though the diagnosis of this disease may not have been made. In some embodiments, the “prevention” comprises interfering with the Lp(a) mRNA or Lp(a) protein level by administering one or more of the single-stranded oligonucleotide, the double-stranded oligonucleotide, the pharmaceutical composition and the oligonucleotide conjugate to the subjects at risk of developing the disease related to the Lp(a) mRNA, so as to reduce or eliminate the risk of the disease.Single-stranded oligonucleotide of the present disclosureThe present disclosure provides a single-stranded oligonucleotide, wherein the length of the single-stranded oligonucleotide is 16-30 nucleotides, and composition of the single-stranded oligonucleotide enables the single-stranded oligonucleotide to inhibit expression of the Lp(a) mRNA through a RNAi mechanism; each nucleotide in the single-strand oligonucleotide is a modified or unmodified nucleotide, wherein, in the single-strand oligonucleotide, at least one nucleotide is a nucleotide X and at least one nucleotide is a fluoro modified nucleotide; and in a 5’ to 3’ direction, at least one nucleotide X is located downstream from the 8thnucleotide in the single-stranded oligonucleotide and separated from the 8thnucleotide by 4-7 nucleotides;in a 5’ to 3’ direction, in a case that a 14thnucleotide of the single-stranded oligonucleotide is the nucleotide X, and a 15thnucleotide and all subsequent nucleotides of the single-stranded oligonucleotide are the modified nucleotides, a 13thnucleotide of the single-stranded oligonucleotide is selected from one of an alkoxy modified nucleotide, an alkyl modified nucleotide, a substituted alkyl modified nucleotide, an amine modified nucleotide, a thermally destabilizing nucleotide and a BNA; andeach nucleotide X is a deoxynucleotide or the unmodified nucleotide.In other words, it will be understood that said at least one nucleotide X is located downstream from the 8thnucleotide in a 5’ to 3’ direction in the single-stranded oligonucleotide and is a nucleotide selected from the group consisting of the 13th to 16th nucleotides in a 5’ to 3’ direction in the single-stranded oligonucleotide. In one embodiment, for example, the 14thnucleotide of the single-stranded oligonucleotide is said at least one nucleotide X. In this case, said at least one nucleotide X is separated from the 8thnucleotide by 5 nucleotides. In the present disclosure, a disease related to an expression level and / or protein level of the Lp(a) mRNA can be treated or prevented by regulating the expressionlevel of the Lp(a) mRNA and / or changing the protein level.It is unexpectedly found by the inventors that the single-stranded oligonucleotide, the double-stranded oligonucleotide comprising the single-stranded oligonucleotide as the antisense strand and the oligonucleotide conjugate in the present disclosure have a good stability and inhibitory activity against the Lp(a) mRNA in cells and / or the subject, thereby having a good application prospect.In order to play the role of RNAi, the length of the single-stranded oligonucleotide in the present disclosure is 16-30 nucleotides. In some embodiments, the length of the singlestranded oligonucleotide in the present disclosure is 17-28, 19-26 or 20-24 nucleotides. In some embodiments, the length of the single-stranded oligonucleotide in the present disclosure is 19, 21 or 23 nucleotides. In this case, the single-stranded oligonucleotide, the double-stranded oligonucleotide comprising the single-stranded oligonucleotide as the antisense strand and the oligonucleotide conjugate in the present disclosure have a better balance among synthesis cost, stability and RNAi activity.In the single-stranded oligonucleotide of the present disclosure, at least 1 nucleotide X is located downstream from the8thnucleotide in the single-stranded oligonucleotide and separated from the 8thnucleotide of the single-stranded oligonucleotide by 4-7 nucleotides; and in a 5’ to 3’ direction, in a case that a 14thnucleotide of the single-stranded oligonucleotide is the nucleotide X, and a 15thnucleotide and all subsequent nucleotides of the single-stranded oligonucleotide are the modified nucleotides, a 13thnucleotide of the single-stranded oligonucleotide is selected from one of an alkoxy modified nucleotide, an alkyl modified nucleotide, a substituted alkyl modified nucleotide, an amine modified nucleotide, a thermally destabilizing nucleotide and a BNA. It is particularly found by the inventors that the single-stranded oligonucleotide conjugate of the present disclosure can effectively maintain high inhibitory activities of the single-stranded oligonucleotide, the double-stranded oligonucleotide and the oligonucleotide conjugate against the Lp(a) mRNA while maintaining a stability. In some embodiments, in the single-stranded oligonucleotide, the number of the nucleotides X is 1-3, such as 1, 2 or 3. In some embodiments, in the singlestranded oligonucleotide, in a 5’ to 3’ direction, each nucleotide X is located downstream from the the 8thnucleotide in the single-stranded oligonucleotide; and in a 5’ to 3’ direction, each nucleotide X is separated from the 8thnucleotide in the single-stranded oligonucleotide by 3, 5, 7 or 10 nucleotides. In some embodiments, in the single-stranded oligonucleotide, each nucleotide X is located downstream from the the 8thnucleotide in the single-stranded oligonucleotide; and one of the nucleotides X is separated from the 8thnucleotide by 5nucleotides, which means that, in a 5’ to 3’ direction, the 14thnucleotide of the singlestranded oligonucleotide is the nucleotide X.In some embodiments, the single-stranded oligonucleotide only comprises one nucleotide X, and in a 5’ to 3’ direction, the nucleotide X is separated from the 8thnucleotide in the single-stranded oligonucleotide by 5 nucleotides. In some embodiments, the singlestranded oligonucleotide comprises two nucleotides X, and in a 5’ to 3’ direction, one nucleotide X is separated from the 8thnucleotide in the single-stranded oligonucleotide by 5 nucleotides and the other nucleotide X is separated from the 8thnucleotide in the singlestranded oligonucleotide by 3, 7 or 10 nucleotides. In some embodiments, in a 5’ to 3’ direction, 12thand 14thnucleotides, or 14thand 16thnucleotides, or 14thand 19thnucleotides in the single-stranded oligonucleotide are the nucleotides X.Each nucleotide X is independently selected from the deoxynucleotide or the unmodified nucleotide. In the context, the “unmodified nucleotide” refers to a ribonucleotide (RNA) with unmodified base and ribose, i.e., the nucleotide base is one of natural ribose bases (A, U, C, G and T), and a 2’ position of the nucleotide ribose is unprotected hydroxyl (2’ -OH). Accordingly, the “modified nucleotide” refers to a nucleotide with a modified base, a nucleotide in which the hydroxyl at the 2’ position of the nucleotide ribose is replaced by other atoms or groups, or a nucleotide analog. In some embodiments, in a 5’ to 3’ direction, the 14thnucleotide, or the 12thand 14thnucleotides in the singlestranded oligonucleotide are the deoxynucleotides, and the remaining nucleotides X are the unmodified nucleotides. In some embodiments, in a 5’ to 3’ direction, the 14thnucleotide in the single-stranded oligonucleotide is the deoxynucleotide, and each of the remaining nucleotides is the modified nucleotide.In some embodiments, the number of the modified nucleotides accounts for more than 50%, 70% or 85% of the number of all nucleotides in the single-stranded oligonucleotide of the present disclosure; or, the number of the unmodified nucleotides in the single-stranded oligonucleotide is no more than 5, 4, 3, 2 or 1. In some embodiments, the number of the unmodified nucleotides in the single-stranded oligonucleotide is 2 or 1. In some embodiments, each of all nucleotides in the single-stranded oligonucleotide is respectively independently the modified nucleotide.As mentioned above, the single-stranded oligonucleotide of the present disclosure further comprises the fluoro modified nucleotide while comprising the nucleotide X. In some embodiments, the number of the fluoro modified nucleotides in the single-stranded oligonucleotide is 2-7. In some embodiments, in a 5’ to 3’ direction, the fluoro modifiednucleotides refer to 1 or 2 of the 2ndand 12thnucleotides, 1 or 2 of the 5th-7thnucleotides, and 0-2 of the 16th- 19thnucleotides in the single-stranded oligonucleotide. In some embodiments, in a 5’ to 3’ direction, the fluoro modified nucleotides refer to 2-5 of 2nd, 5th, 6th, 7th, 12th, 16th, 18thand 19thnucleotides in the single-stranded oligonucleotide. In some embodiments, in a 5’ to 3’ direction, the fluoro modified nucleotides refer to the 2ndand 6thnucleotides in the single-stranded oligonucleotide. In some embodiments, in a 5’ to 3’ direction, the fluoro modified nucleotides refer to the 2nd, 6thand 16thnucleotides in the single-stranded oligonucleotide. In some embodiments, in a 5’ to 3’ direction, the fluoro modified nucleotides refer to the 2nd, 5th, 7th, 12thand 16thnucleotides in the single-stranded oligonucleotide. In some embodiments, in a 5’ to 3’ direction, the fluoro modified nucleotides refer to the 2nd, 7th, 12th, 16thand 19thnucleotides in the single-stranded oligonucleotide. In some embodiments, in a 5’ to 3’ direction, the fluoro modified nucleotides refer to the 2nd, 6th, 12th, 16thand 19thnucleotides in the single-stranded oligonucleotide.In some embodiments, in the single-stranded oligonucleotide, each modified nucleotide, except for the nucleotide X and the fluoro modified nucleotide, is independently selected from the alkoxy modified nucleotide, a substituted alkoxy modified nucleotide, the alkyl modified nucleotide, the substituted alkyl modified nucleotide, the amine modified nucleotide, the thermally destabilizing nucleotide and the BNA.In some embodiments, in the single-stranded oligonucleotide, the number of the substituted alkoxy modified nucleotides is no more than 3. In some embodiments, in the single-stranded oligonucleotide, the number of the substituted alkoxy modified nucleotides is no more than 2. In some embodiments, in the single-stranded oligonucleotide, the number of the substituted alkoxy modified nucleotides is 1. In some embodiments, in the singlestranded oligonucleotide, there is no substituted alkoxy modified nucleotide.In some embodiments, in the single-stranded oligonucleotide, each modified nucleotide, except for the nucleotide X and the fluoro modified nucleotide, is selected from the alkoxy modified nucleotide, the substituted alkoxy modified nucleotide or the thermally destabilizing nucleotide. In some embodiments, in the single-stranded oligonucleotide, the number of the thermally destabilizing nucleotides is 0-2. In some embodiments, in the single-stranded oligonucleotide, there is no thermally destabilizing nucleotide. In some embodiments, in the single-stranded oligonucleotide, the number of the thermally destabilizing nucleotides is no more than 2. In some embodiments, in the single-stranded oligonucleotide, the number of the thermally destabilizing nucleotides is 1 or 2. In someembodiments, in the single-stranded oligonucleotide, there is only one thermally destabilizing nucleotide. In some embodiments, each modified nucleotide, except for the nucleotide X, the fluoro modified nucleotide and the thermally destabilizing nucleotide, is selected from the alkoxy modified nucleotide or the substituted alkoxy modified nucleotide.In the context, the “thermally destabilizing nucleotide” refers to a nucleotide with a thermally destabilizing modification, and the thermally destabilizing modification refers to a modification that reduces a pyrolysis temperature of a double strand of an oligonucleotide with this modification by at least 0.5°C compared with that of a double strand of an oligonucleotide without the nucleotide modification at the corresponding position. An exemplary thermally destabilizing modification may refer to a thermally destabilizing modification described in paragraphs

[0236] -

[0251] of the specification in the PCT publication WO2018 / 098328A1.In some embodiments, the thermally destabilizing nucleotide is one of an acyclic nucleotide or an isonucleotide.The acyclic nucleotide is a kind of nucleotide formed by opening a sugar ring of nucleotide. In some embodiments, the acyclic nucleotide may be an unlocked nucleic acid (UNA) or a glycol nucleic acid (GNA), wherein the UNA is as shown in Formula (15) and the GNA is as shown in Formula (16):Formula (15) Formula (16)In the above Formula (15) and Formula (16), R is selected from H, OH or alkoxy (O-alkyl), and Base represents a nucleic acid base, such as A, U, G, C or T.The isonucleotide refers to a compound formed by changing of a position of a base on a ribose ring of nucleotide. In some embodiments, the isonucleotide may be a compound formed by moving the base from a 1’ -position of the ribose ring to a 2’ -position or 3 ’-position of the ribose ring, as shown in Formula (17) or (18).In the compounds as shown in the above Formula (17) and Formula (18), Base represents a nucleic acid base, such as A, U, G, C or T; and R is selected from H, OH, F or the non-fluoro group above.Formula (17) Formula (18)In some embodiments, the thermally destabilizing nucleotide is selected from one of a GNA as shown in Formula (27A), a 2’-0Me abasic nucleotide as shown in Formula (27B), a 3’-0Me modified nucleotide as shown in Formula (27C), a 5’-Me modified nucleotide as shown in Formula (27D), a SNA as shown in Formula (27E), a hGNA as shown in Formula (27F), a hhGNA as shown in Formula (27G), a mGNA as shown in Formula (27H), a TNA as shown in Formula (27I), ah’GNAas shown in Formula (27J), a UNA as shown in Formula (27K), and a Hyp-spacer as shown in Formula (27L).Formula (27 A); Formula (27B); Formula (27C); Formula (27D);Formula (27E); Formula (27F); Formula (27G); Formula (27H);Formula (27I); Formula (27J); Formula (27K); Formula (27L).In the compounds as shown in the above Formula (27A)-Formula (27L), Base represents a nucleic acid base, such as A, U, G, C or T; and R27 is selected from H, OH, F, alkoxy, alkyl or alkoxy substituted alkyl. * means that the carbon atom has chirality, and the compound may be an R configuration, an S configuration, or a racemic mixture of the R configuration and the Sconfiguration. In some embodiments, each the thermally destabilizing nucleotide is independently the GNA as shown in Formula (27 A).In the context, the BNA refers to a constrained or inaccessible nucleotide. The BNA may contain a five-membered, six-membered or seven-membered bridged structure with a “fixed” C3’-endo sugar pucker. The bridge is usually incorporated into 2’- and 4’ -positions of the ribose to provide a 2’,4’-BNA nucleotide. In some embodiments, the BNA may be a LNA, an ENA, a cET BNA, and the like, wherein the LNA is as shown in Formula (12), the ENA is as shown in Formula (13) and the cET BNA is as shown in Formula (14), wherein Base represents a nucleic acid base, such as A, U, G, C or T:Formula (12) Formula (13) Formula (14).In some embodiments, for simplicity of synthesis, each alkoxy modified nucleotide is respectively independently a 2’-methoxy modified nucleotide (2’-0Me), and the 2’-methoxy modified nucleotide is as shown in Formula (8). In some embodiments, a 2’-amino modified nucleotide (2’-NH2) is as shown in Formula (9). In some embodiments, a 2’ -deoxynucleotide (DNA) is as shown in Formula (10):Formula (7) Formula (8) Formula (9) Formula (10)In the compounds as shown in the above Formula (7)-Formula (10), Base represents a nucleic acid base, such as A, U, G, C or T.In the context, the “fluoro modified nucleotide”, a “2’ -fluoro modified nucleotide”, a “nucleotide with 2’ -hydroxyl of a ribose group substituted by fluorine” and a “nucleotide with 2’-fluororibosyl” have the same meanings, all of which refer to compounds with the structure as shown in Formula (7) formed by substituting the 2’-hydroxyl of the nucleotide by fluorine. The “methoxy modified nucleotide”, the “2’ -methoxy modified nucleotide”, a “nucleotide with 2’-hydroxyl of ribose group substituted by methoxy” and a “nucleotide with 2’ -methoxyribosyl” have the same meanings, all of which refer to compounds with the structure as shown in Formula (8) formed by substituting the 2’ -hydroxyl of the ribose group of the nucleotide by methoxy.In some embodiments, the length of the single-stranded oligonucleotide of the present disclosure is 19-23 nucleotides, and in a 5’ to 3’ direction, the 14thnucleotide is the nucleotide X, 2 of the 5th-7thand 19thnucleotides, and the 2nd, 12thand 16thnucleotides are the fluoro modified nucleotides, the 3rdnucleotide is the alkoxy modified nucleotide or the substituted alkoxy modified nucleotide, the 5thnucleotide is the alkoxy modified nucleotide or the substituted alkoxy modified nucleotide when the 5thnucleotide is not the fluoro modified nucleotide, and each of the remaining nucleotides in the single-stranded oligonucleotide is the alkoxy modified nucleotide. In some embodiments, the length of the single-stranded oligonucleotide of the present disclosure is 19-23 nucleotides, and in a 5’ to 3’ direction, the 12thand 14thnucleotides are the nucleotides X, the 2nd, 7thand 16thnucleotides are the fluoro modified nucleotides, the 3rdor 5thnucleotide is the alkoxy modified nucleotide or the substituted alkoxy modified nucleotide, and each of the remaining nucleotides in the single-stranded oligonucleotide is the alkoxy modified nucleotide. In some embodiments, the length of the single-stranded oligonucleotide of the present disclosure is 19-23 nucleotides, and in a 5’ to 3’ direction, the 14thand 16thnucleotides are the nucleotides X, the 2ndand 6thnucleotides are the fluoro modified nucleotides, the 13thnucleotide is the substituted alkoxy modified nucleotide or the BNA, the 3rdor 5thnucleotide is the alkoxy modified nucleotide or the substituted alkoxy modified nucleotide; and in a 3’ to 5’ direction, 1 of the lst-2ndnucleotides of the single-stranded oligonucleotide is the thermally destabilizing nucleotide, and each of the remaining nucleotides in the single-stranded oligonucleotide is the alkoxy modified nucleotide. In some embodiments, the length of the single-stranded oligonucleotide of the present disclosure is 19-23 nucleotides, and in a 5’ to 3’ direction, one of the 16th- 19thnucleotides and the 14thnucleotide are the nucleotides X, the 2ndand 6thnucleotides are the fluoro modified nucleotides, the 16thnucleotide is the fluoro modified nucleotide when the 16thnucleotide is not the nucleotide X, the 13thnucleotide is the substituted alkoxy modified nucleotide or the BNA, and the 3rdor 5thnucleotide is the alkoxy modified nucleotide or the substituted alkoxy modified nucleotide; the 20thnucleotide is the alkoxy modified nucleotide or the thermally destabilizing nucleotide; and each of the remaining nucleotides in the single-stranded oligonucleotide is the alkoxy modified nucleotide. In some embodiments, the length of the single-stranded oligonucleotide of the present disclosure is 21 nucleotides, wherein the 16thor 19thnucleotide and the 14thnucleotide are the nucleotides X, wherein the 14thnucleotide is the deoxynucleotide or the unmodified nucleotide, and the 16thor 19thnucleotide is the unmodified nucleotide.In some embodiments, the length of the single-stranded oligonucleotide of the present disclosure is 21 nucleotides, and in a 5’ to 3’ direction, the 14thnucleotide is the deoxynucleotide, the 2nd, 5th, 7th, 12thand 16thnucleotides are the fluoro modified nucleotides, the 3rdnucleotide is the alkoxy modified nucleotide or the substituted alkoxy modified nucleotide, and each of the remaining nucleotides in the single-stranded oligonucleotide is the alkoxy modified nucleotide. In some embodiments, the length of the single-stranded oligonucleotide of the present disclosure is 21 nucleotides, and in a 5’ to 3’ direction, the 14thnucleotide is the deoxynucleotide, the 2nd, 7th, 12th, 16thand 19thnucleotides are the fluoro modified nucleotides, and each of the remaining nucleotides in the single-stranded oligonucleotide is the alkoxy modified nucleotide. In some embodiments, the length of the single-stranded oligonucleotide of the present disclosure is 21 nucleotides, and in a 5’ to 3’ direction, the 14thnucleotide is the deoxynucleotide, the 2nd, 6th, 12th, 16thand 19thnucleotides are the fluoro modified nucleotides, and each of the remaining nucleotides in the single-stranded oligonucleotide is the alkoxy modified nucleotide. In some embodiments, the length of the single-stranded oligonucleotide of the present disclosure is 21 nucleotides, and in a 5’ to 3’ direction, the 12thand 14thnucleotides are the deoxynucleotides, the 2nd, 7thand 16thnucleotides are the fluoro modified nucleotides, and each of the remaining nucleotides in the single-stranded oligonucleotide is the alkoxy modified nucleotide. In some embodiments, the length of the single-stranded oligonucleotide of the present disclosure is 21 nucleotides, and in a 5’ to 3’ direction, the 14thnucleotide is the deoxynucleotide, the 16thnucleotide is the unmodified nucleotide, the 2ndand 6thnucleotides are the fluoro modified nucleotides, and the 13thnucleotide is the substituted alkoxy modified nucleotide; and in a 3’ to 5’ direction, the 2ndnucleotide of the single-stranded oligonucleotide is the thermally destabilizing nucleotide, and each of the remaining nucleotides in the single-stranded oligonucleotide is the alkoxy modified nucleotide. In some embodiments, the length of the single-stranded oligonucleotide of the present disclosure is 21 nucleotides, and in a 5’ to 3’ direction, the 14thnucleotide is the deoxynucleotide, the 19thnucleotide is the unmodified nucleotide, the 2nd, 6thand 16thnucleotides are the fluoro modified nucleotides, the 13thnucleotide is the substituted alkoxy modified nucleotide, and each of the remaining nucleotides in the single-stranded oligonucleotide is the alkoxy modified nucleotide.In some embodiments, in the single-stranded oligonucleotide of the present disclosure, each nucleotide X refers to the deoxynucleotide. In some embodiments, in the single-stranded oligonucleotide of the present disclosure, each alkoxy modified nucleotide refers to the methoxymodified nucleotide. In some embodiments, in the single-stranded oligonucleotide of the present disclosure, each substituted alkoxy modified nucleotide refers to a 2’-O-methoxyethyl modified nucleotide. In some embodiments, in the single-stranded oligonucleotide of the present disclosure, each BNA refers to the LNA or the cET BNA. In some embodiments, in the single-stranded oligonucleotide of the present disclosure, each thermally destabilizing nucleotide refers to the GNA.In some embodiments, in the single-stranded oligonucleotide, each of at least 2 of linking groups between adjacent nucleotides is independently a phosphate ester group with modification group(s). In some embodiments, in the single-stranded oligonucleotide of the present disclosure, each of 1-4 of linking groups between adjacent nucleotides in lst-5thnucleotides at the 5’ terminal is independently a phosphate ester group with modification group(s). In some embodiments, in the single-stranded oligonucleotide of the present disclosure, each of 1-4 of linking groups between adjacent nucleotides in lst-5thnucleotides at the 3’ terminal is independently a phosphate ester group with modification group(s). In some embodiments, in the single-stranded oligonucleotide of the present disclosure, each of 2 linking groups between adjacent nucleotides in the lst-3rdnucleotides at the 5’ terminal and 4 linking groups between adjacent nucleotides in the lst-5thnucleotides at the 5’ terminal is independently a phosphate ester group with modification group(s). In some embodiments, in the single-stranded oligonucleotide of the present disclosure, each of 2 linking groups between adjacent nucleotides in the lst-3rdnucleotides at the 3’ terminal and 4 linking groups between adjacent nucleotides in the lst-5thnucleotides at the 3’ terminal is independently a phosphate ester group with modification group(s). In some embodiments, in the singlestranded oligonucleotide of the present disclosure, in the case that the unmodified nucleotide exists in the single-stranded oligonucleotide, each of 1 or 2 of two linking groups between each unmodified nucleotide and adjacent nucleotides is independently a phosphate ester group with modification group(s). The modified phosphate group may make the singlestranded oligonucleotide of the present disclosure better resist an action of exonuclease, thereby enhancing a stability of the oligonucleotide in a subject.In some embodiments, each of at least 2, or 2-6 of linking groups between adjacent nucleotides in the single-stranded oligonucleotide of the present disclosure is independently a phosphate ester group with modification group(s). In some embodiments, each of 2-6 of linking groups between adjacent nucleotides in the single-stranded oligonucleotide is independently a phosphate ester group with modification group(s). In some embodiments, each of 3 or 4 of linking groups between adjacent nucleotides in the single-strandedoligonucleotide is independently a phosphate ester group with modification group(s). In some embodiments, each of the linking groups between adjacent nucleotides in the lst-3rdnucleotides at the 5’ terminal of the single-stranded oligonucleotide and the linking groups between adjacent nucleotides in the lst-3rdnucleotides at the 3’ terminal of the singlestranded oligonucleotide is independently a phosphate ester group with modification group(s). In some embodiments, in the case that the unmodified nucleotide exists in the single-stranded oligonucleotide, each of 1 or 2 of two linking groups between each unmodified nucleotide and adjacent nucleotides is independently a phosphate ester group with modification group(s). In some embodiments, the phosphate ester group with modification group(s) is a phosphorothioate group having a structure as shown in Formula (28):s — P=OFormula (28).In some embodiments, a 5’ terminal nucleotide of the single-stranded oligonucleotide is a 5 ’-hydroxy nucleotide, a 5 ’-phosphate nucleotide or a 5 ’-phosphate analogue modified nucleotide, and the 5 ’-hydroxy nucleotide has a structure as shown in Formula (29); the 5’-phosphate nucleotide has a structure as shown in Formula (30); and the 5’-phosphate analogue modified nucleotide has one structure selected from structures as shown in Formula (31)-Formula (34):Formula (31) Formula (32) Formula (33) Formula (34);wherein, R is selected from one of H, OH, OCH3 and F; and Base represents a nucleic acid base, and is selected from A, U, C, G or T.In some embodiments, the 5 ’-phosphate nucleotide is a 5 ’-phosphate modified nucleotide as shown in Formula (30), and the 5’-phosphate analogue modified nucleotide is a 5’-(E)-vinylphosphonate (E-VP) modified nucleotide as shown in Formula (31), or a phosphorothioate modified nucleotide as shown in Formula (33). In some embodiments, the 5’ terminal nucleotide of the single-stranded oligonucleotide is the 5 ’-hydroxy nucleotide or the 5’-(E)-vinylphosphonate (E-VP) modified nucleotide. In some embodiments, the 5’ terminal nucleotide is the 5’-(E)-vinylphosphonate (E-VP) modified nucleotide, which can further increase one or more of a stability, a pharmacological activity in the subject and a long-term effect of the singlestranded oligonucleotide, the double-stranded oligonucleotide comprising the single-stranded oligonucleotide and the oligonucleotide conjugate of the present disclosure.In some embodiments, the length of the single-stranded oligonucleotide is 21 nucleotides, and in a 5’ to 3’ direction,the 14thnucleotide is the deoxynucleotide, the 2nd, 5th, 7th, 12thand 16thnucleotides are the fluoro modified nucleotides, the 3rdnucleotide is the methoxy modified nucleotide, and each of the remaining nucleotides in the single-stranded oligonucleotide is the methoxy modified nucleotide;the linking group between any two adjacent nucleotides in the lst-3rdnucleotides at the 5’ terminal and the linking group between any two adjacent nucleotides in the lst-3rdnucleotides at the 3’ terminal are the phosphorothioate groups; andthe 5’ terminal nucleotide is the 5’-hydroxy nucleotide as shown in Formula (29) or the 5’-(E)-vinylphosphate modified nucleotide as shown in Formula (31).As mentioned above, the composition of the single-stranded oligonucleotide of the present disclosure enables the single-stranded oligonucleotide to inhibit the expression of the Lp(a) mRNA through the RNAi mechanism. In some embodiments, the single-stranded oligonucleotide of the present disclosure is fully complementary to the Lp(a) mRNA. In the context of the present disclosure, the “fully complementary” means that the complementarity between the single-stranded oligonucleotide of the present disclosure and the Lp(a) mRNA is sufficient to enable the single-stranded oligonucleotide to reduce or eliminate production of protein encoded by the Lp(a) mRNA through the action of RNAi. In some embodiments, the “fully complementary” means that the single-stranded oligonucleotide of the present disclosure is basically reverse complementary, substantially reverse complementary or completely reverse complementary to the Lp(a) mRNA in a length of at least 16 nucleotides, such as a length of 16-25 nucleotides, a length of 18-23 nucleotides or a length of 19-21 nucleotides. In some embodiments, the single-stranded oligonucleotide of the present disclosure is completely reverse complementary to the Lp(a) mRNA.In some embodiments, two nucleotide sequences which are “fully complementary”may comprise inner regions which are completely reverse complementary (such as being completely reverse complementary in a length of at least 6, 8 or 10 nucleotides). In some embodiments, the single-stranded oligonucleotide of the present disclosure is completely reverse complementary to the Lp(a) mRNAin at least a seed region. The “seed region” refers to a region of nucleotides in 2nd-8thpositions of the single-stranded oligonucleotide of the present disclosure, and in this case, the single-stranded oligonucleotide of the present disclosure can better mediate the action of RNAi and inhibit the level of the Lp(a) mRNA.In some embodiments, the single-stranded oligonucleotide is basically reverse complementary, substantially reverse complementary or completely reverse complementary to a contiguous nucleotide sequence m in the Lp(a) mRNA; and the nucleotide sequence m is a contiguous nucleotide sequence in the Lp(a) mRNA, a length of the nucleotide sequence m is not greater than the length of the single-stranded oligonucleotide, and the length of the nucleotide sequence m is the same as the length of the single-stranded oligonucleotide or a difference between the two lengths is no more than 8 nucleotides, or the difference is 1-5 nucleotides. In some embodiments, the length of the nucleotide sequence m is at least 16 nucleotides, or 16-25 nucleotides, or 18-23 nucleotides, or 19-21 nucleotides. In some embodiments, the length of the single-stranded oligonucleotide is the same as the length of the nucleotide sequence m, and except for a terminal nucleotide, at least the nucleotide sequence of the single-stranded oligonucleotide is completely reverse complementary to the nucleotide sequence m. In this way, the single-stranded oligonucleotide of the present disclosure can further improve an inhibitory effect on the Lp(a) mRNA. In some embodiments, in a 5’ to 3’ direction, except for the 1stposition, the nucleotide sequence of the single-stranded oligonucleotide is completely reverse complementary to the nucleotide sequence m. In some embodiments, all nucleotides of the single-stranded oligonucleotide is completely reverse complementary to the nucleotide sequence m.In some embodiments, the single-stranded oligonucleotide of the present disclosure may be the following first or second single-stranded oligonucleotide, and each singlestranded oligonucleotide is described separately below.First single-stranded oligonucleotideIn some embodiments, the present disclosure provides the first single-stranded oligonucleotide, wherein the single-stranded oligonucleotide comprises a nucleotide sequence II, the nucleotide sequence II and a nucleotide sequence as shown in SEQ ID NO: 2 have the same length, and no more than 3 base differences:5’ - Z2UAACAAUAAGGAGCUGCC -3’ (SEQ ID NO: 2),wherein, Z2 is A or U, the nucleotide sequence II comprises a nucleotide Z’2 corresponding to the Z2 in position, and the Z’2 is the first nucleotide at the 5’ terminal of the single-stranded oligonucleotide. In one embodiment, the nucleotide sequence II thus comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 2 with no more than 3 base differences.In the context of the present disclosure, the “corresponding... in position” refers to locating in the same position in the nucleotide sequence from the same terminal of the nucleotide sequence, for example, the 1stnucleotide at the 5’ terminal of the nucleotide sequence II is the nucleotide corresponding to the 1stnucleotide as shown in SEQ ID NO: 2 in position.In some embodiment, each U in the nucleotide sequences of the single-stranded oligonucleotide, the double-stranded oligonucleotide and the oligonucleotide conjugate of the present disclosure may be optionally substituted by T. These base differences will not significantly reduce an inhibitory ability against the Lp(a) mRNA or improve an off-target effect of the singlestranded oligonucleotide, the double-stranded oligonucleotide or the oligonucleotide conjugate. The single-stranded oligonucleotide, double-stranded oligonucleotide and oligonucleotide conjugate with the base difference are also within the scope of protection of the present disclosure. In some embodiments, the nucleotide sequence II and the nucleotide sequence as shown in SEQ ID NO: 2 have no more than 1 base difference. In one embodiment, the nucleotide sequence II thus comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 2 with 1 base difference. In some embodiments, the base difference between the nucleotide sequence II and the nucleotide sequence as shown in SEQ ID NO: 2 may comprise a difference in the Z’2 position and / or a base difference in any other nucleotide position in the nucleotide sequence II. In some embodiments, the base difference between the nucleotide sequence II and the nucleotide sequence as shown in SEQ ID NO: 2 may comprise the base difference in the Z’2 position and / or a base difference in a nucleotide position adjacent to the Z’2. In some embodiments, there is no base difference between the nucleotide sequence II and the nucleotide sequence as shown in SEQ ID NO: 2. In one embodiment, the nucleotide sequence II thus comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 2 with no base difference.In some embodiments, the difference between the nucleotide sequence II and the nucleotide sequence as shown in SEQ ID NO: 2 comprises the difference in the Z’2 position, and the Z’2 is selected from U, G or C. In some embodiments, the base difference between the nucleotide sequence II and the nucleotide sequence as shown in SEQ ID NO: 2 is the difference in the Z’2position, and the Z’2 is selected from C, U or G.In some embodiments, the single-stranded oligonucleotide further comprises a nucleotide sequence IV, the nucleotide sequence IV is linked to a 3’ terminal of the nucleotide sequence II, the length of the nucleotide sequence IV is 1, 2, 3 or 4 nucleotides, each nucleotide in the nucleotide sequence IV is independently the non-fluoro modified nucleotide, the nucleotide sequence IV is substantially reverse complementary or completely reverse complementary to the Lp(a) mRNA, and each non-fluoro modified nucleotide is independently selected from one of a 2’-methoxy modified nucleotide, a 2’-alkyl modified nucleotide with 1-3 carbon atoms, a 2’-amino modified nucleotide, a 2’ -substituted amino modified nucleotide and the thermally destabilizing nucleotide. In some embodiments, the length of the nucleotide sequence IV is 2 nucleotides.In some embodiments, the length of the nucleotide sequence IV is 1 nucleotide, and a base of the nucleotide sequence IV is A; or, the length of the nucleotide sequence IV is 2 nucleotides, and in a 5’ to 3’ direction, a base composition of the nucleotide sequence IV is AC; or, the length of the nucleotide sequence IV is 3 nucleotides, and in a 5’ to 3’ direction, the base composition of the nucleotide sequence IV is ACA; or the length of the nucleotide sequence IV is 4 nucleotides, and in a 5’ to 3’ direction, the base composition of the nucleotide sequence IV is ACAG.In some embodiments, the single-stranded oligonucleotide further comprises a nucleotide sequence V, each nucleotide of the nucleotide sequence V is independently the non-fluoro modified nucleotide, the length of the nucleotide sequence V is 1 to 3 nucleotides, and the nucleotide sequence V is linked to the 3’ terminal of the nucleotide sequence IV or the nucleotide sequence II; and after the single-stranded oligonucleotide and a sense strand form a double-stranded oligonucleotide, the nucleotide sequence V forms a 3’ overhang of an anti-sense strand of the double-stranded oligonucleotide.In some embodiments, the length of the nucleotide sequence V is 2 nucleotides, and in a 5’ to 3’ direction, the nucleotide sequence V is 2 contiguous thymidine deoxynucleotides, 2 contiguous uridine nucleotides, or completely reverse complementary to the Lp(a) mRNA.In some embodiments, the nucleotide sequence V is linked to the 3’ terminal of the nucleotide sequence II, and in a 5’ to 3’ direction, a base composition of the nucleotide sequence V is selected from AC or UU.In some embodiments, the single-stranded oligonucleotide only comprises the nucleotide sequence II and the nucleotide sequence V, wherein the nucleotide sequence II is composed of SEQ ID NO: 2, and the base composition of the nucleotide sequence V is AC.Second single-stranded oligonucleotideIn some embodiments, the present disclosure provides the second single-stranded oligonucleotide, wherein the single-stranded oligonucleotide comprises a nucleotide sequence II, the nucleotide sequence II and a nucleotide sequence as shown in SEQ ID NO: 4 have the same length, and no more than 3 base differences:5’ - Z4CAGUAAUGAAGUAUGUGC -3’ (SEQ ID NO: 4),wherein, Z4 is A or U, the nucleotide sequence II comprises a nucleotide Z’4 corresponding to the Z4 in position, and the Z’4 is the first nucleotide at the 5’ terminal of the single-stranded oligonucleotide. In one embodiment, the nucleotide sequence II thus comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 4 with no more than 3 base differences.In some embodiments, the nucleotide sequence II and the nucleotide sequence as shown in SEQ ID NO: 4 have no more than 1 base difference. In one embodiment, the nucleotide sequence II thus comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 4 with 1 base difference. In some embodiments, the base difference between the nucleotide sequence II and the nucleotide sequence as shown in SEQ ID NO: 4 may comprise a difference in the Z’4 position and / or a base difference in any other nucleotide position in the nucleotide sequence II. In some embodiments, the base difference between the nucleotide sequence II and the nucleotide sequence as shown in SEQ ID NO: 4 may comprise the base difference in the Z’4 position and / or a base difference in a nucleotide position adjacent to the Z’4. In some embodiments, there is no base difference between the nucleotide sequence II and the nucleotide sequence as shown in SEQ ID NO: 4. In one embodiment, the nucleotide sequence II thus comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 4 with no base difference.In some embodiments, the difference between the nucleotide sequence II and the nucleotide sequence as shown in SEQ ID NO: 4 comprises the difference in the Z’4 position, and the Z’4 is selected from U, G or C. In some embodiments, the base difference between the nucleotide sequence II and the nucleotide sequence as shown in SEQ ID NO: 4 is the difference in the Z’4 position, and the Z’4 is selected from C, U or G.In some embodiments, the single-stranded oligonucleotide further comprises a nucleotide sequence IV, the nucleotide sequence IV is linked to a 3’ terminal of the nucleotide sequence II, the length of the nucleotide sequence IV is 1, 2, 3 or 4 nucleotides, each nucleotide in the nucleotide sequence IV is independently non-fluoro modified nucleotide, the nucleotide sequence IV is substantially reverse complementary or completely reverse complementary to the Lp(a)mRNA, and each non-fluoro modified nucleotide is independently selected from one of a 2’-methoxy modified nucleotide, a 2’-alkyl modified nucleotide with 1-3 carbon atoms, a 2’-amino modified nucleotide, a 2’ -substituted amino modified nucleotide and the thermally destabilizing nucleotide. In some embodiments, the length of the nucleotide sequence IV is 2 nucleotides.In some embodiments, the length of the nucleotide sequence IV is 1 nucleotide, and a base of the nucleotide sequence IV is C; or, the length of the nucleotide sequence IV is 2 nucleotides, and in a 5’ to 3’ direction, a base composition of the nucleotide sequence IV is CU; or, the length of the nucleotide sequence IV is 3 nucleotides, and in a 5’ to 3’ direction, the base composition of the nucleotide sequence IV is CUU; or the length of the nucleotide sequence IV is 4 nucleotides, and in a 5’ to 3’ direction, the base composition of the nucleotide sequence IV is CUUG.In some embodiments, the single-stranded oligonucleotide further comprises a nucleotide sequence V, each nucleotide of the nucleotide sequence V is independently the non-fluoro modified nucleotide, the length of the nucleotide sequence V is 1 to 3 nucleotides, and the nucleotide sequence V is linked to the 3’ terminal of the nucleotide sequence IV or the nucleotide sequence II; and after the single-stranded oligonucleotide and a sense strand form a double-stranded oligonucleotide, the nucleotide sequence V forms a 3’ overhang of an anti-sense strand of the double-stranded oligonucleotide.In some embodiments, the length of the nucleotide sequence V is 2 nucleotides, and in a 5’ to 3’ direction, the nucleotide sequence V is 2 contiguous thymidine deoxynucleotides, 2 contiguous uridine nucleotides, or completely reverse complementary to the Lp(a) mRNA.In some embodiments, the nucleotide sequence V is linked to the 3’ terminal of the nucleotide sequence II, and in a 5’ to 3’ direction, a base composition of the nucleotide sequence V is selected from CU or UU.In some embodiments, the single-stranded oligonucleotide only comprises the nucleotide sequence II and the nucleotide sequence V, wherein the nucleotide sequence II is composed of SEQ ID NO: 4, and the base composition of the nucleotide sequence V is CU.In some embodiments, the single-stranded oligonucleotide of the present disclosure may independently exert a pharmacological activity. In some embodiments, the singlestranded oligonucleotide of the present disclosure is an anti-sense oligonucleotide (ASO). In some embodiments, the single-stranded oligonucleotide of the present disclosure is a single-stranded RNAi (ssRNAi) compound. In some embodiments, the single-stranded oligonucleotide of the present disclosure exerts the pharmacological activity as a single strand (for example, an anti-sense strand) of the double-stranded oligonucleotide.In some embodiments, the single-stranded oligonucleotide of the present disclosure is an anti-sense strand possessed by a siRNA1 or a siRNA2 as shown in Table 1. In some embodiments, the single-stranded oligonucleotide of the present disclosure is an anti-sense strand possessed by a conjugate 1 or a conjugate 2 as shown in Table 2.Double-stranded oligonucleotide of the present disclosureThe present disclosure further provides a double-stranded oligonucleotide, wherein the double-stranded oligonucleotide comprises a sense strand and an anti-sense strand, each nucleotide in the sense strand is a modified or unmodified nucleotide, and the sense strand is at least partially reverse complementary to the anti-sense strand to form a double-stranded region, wherein, the anti-sense strand is the single-stranded oligonucleotide of the present disclosure above.In the double-stranded oligonucleotide of the present disclosure, each of the lengths of the sense strand and the anti-sense strand is 19-26 nucleotides. In some embodiments, the length of the anti-sense strand is not less than the length of the sense strand. In some embodiments, the length of the sense strand is 19-23 nucleotides. Therefore, a length ratio of the sense strand to the anti-sense strand of the double-stranded oligonucleotide of the present disclosure may be 19 / 19, 19 / 20, 19 / 21, 19 / 22, 19 / 23, 19 / 24, 20 / 20, 20 / 21, 20 / 22, 20 / 23, 20 / 24, 21 / 21, 21 / 22, 21 / 23, 21 / 24, 22 / 22, 22 / 23, 22 / 24, 22 / 25, 23 / 23, 23 / 24, 23 / 25 or 23 / 26. In some embodiments, for simplicity of synthesis, the length of the sense strand is 19-21 nucleotides, and the length of the anti-sense strand is 19-23 nucleotides. In some embodiments, the length of the sense strand is the same as the length of the anti-sense strand, and each of the lengths is 19, 20 or 21 nucleotides. In some embodiments, the length of the sense strand is 19 nucleotides, and the length of the anti-sense strand is 20-24 nucleotides. In some embodiments, the length of the sense strand is 20 nucleotides, and the length of the anti-sense strand is 21-24 nucleotides. In some embodiments, the length of the sense strand is 21 nucleotides, and the length of the anti-sense strand is 22-24 nucleotides. In some embodiments, the length of the sense strand is 19 nucleotides, and the length of the antisense strand is 21 nucleotides. In some embodiments, the length of the sense strand is 21 nucleotides, and the length of the anti-sense strand is 23 nucleotides.In some embodiments, in the sense strand of the double-stranded oligonucleotide of the present disclosure, in a 3’ to 5’ direction, 2-3 of 11th- 13thnucleotides of the sense strand are fluoro modified nucleotides, and a 1stnucleotide and / or last nucleotide of the sense strand is an alkoxy modified nucleotide or an inverted abasic deoxyribonucleotide (abbreviated as invab or ia, with a structure as shown in Formula (35)). In some embodiments, in a 3’ to 5’ direction, the last nucleotide of the sense strand is the alkoxy modified nucleotide or the inverted abasicdeoxyribonucleotide. In some embodiments, in a 3’ to 5’ direction, the 1thnucleotide of the sense strand is the alkoxy modified nucleotide or the inverted abasic deoxyribonucleotide. In some embodiments,, except for the fluoro modified nucleotide and inverted abasic deoxyribonucleotide above, each of nucleotides of remaining positions in the sense strand is a non-fluoro modified nucleotide, and each non-fluoro modified nucleotide is independently selected from one of the alkoxy modified nucleotide, an alkyl modified nucleotide, an amine modified nucleotide and a thermally destabilizing nucleotide.Formula (35)In some embodiments, an oxygen atom directly linked to a ribose ring as shown in Formula (35) may be linked to a 3’ phosphate group of a penultimate nucleotide at the 3’ terminal of the sense strand. In some embodiments, the oxygen atom directly linked to the ribose ring as shown in Formula (35) may be linked to the 3’ phosphate group of the nucleotide at the 3’ terminal of the sense strand, and the oxygen atom linked to the ribose ring via methylene as shown in Formula (35) may be linked to a hydrogen atom, a hydroxy protecting group or a delivery group described below.In some embodiments, the oxygen atom linked to the ribose ring via the methylene as shown in Formula (35) may be linked to a 5’ phosphate group of a penultimate nucleotide at the 5’ terminal of the sense strand. In some embodiments, the oxygen atom linked to the ribose ring via the methylene as shown in Formula (35) is linked to a 5’ phosphate group of a penultimate nucleotide at the 5’ terminal of the sense strand, and the oxygen atom directly linked to the ribose ring as shown in Formula (35) may be linked to the hydrogen atom, the hydroxy protecting group or the delivery group described below.In some embodiments, in a 3’ to 5’ direction, the 11thand 13thnucleotides or the 11th- 13thnucleotides in the sense strand are the fluoro modified nucleotides, the 1stand / or last nucleotide is the alkoxy modified nucleotide or the inverted abasic deoxynucleotide, and each of the nucleotides of the remaining positions in the sense strand is the alkoxy modified nucleotide.In some embodiments, the sense strand comprises 19-21 nucleotides, and the anti-sense strand comprises 21-23 nucleotides; and in a 3’ to 5’ direction, the 11thand 13thnucleotides or the1 lth-13thnucleotides of the sense strand are the fluoro modified nucleotides, the 1stand / or last nucleotide of the sense strand is the alkoxy modified nucleotide or the inverted abasic deoxynucleotide, and each of the nucleotides of the remaining positions is the alkoxy modified nucleotide. In this case, the double-stranded oligonucleotide of the present disclosure has better stability and / or activity of forming a RISC complex through position matching of the modified nucleotides of the sense strand and the anti-sense strand, thereby showing stable and efficient inhibition activity against the Lp(a) mRNA. In some embodiments, each alkoxy modified nucleotide is a methoxy modified nucleotide.In some embodiments, in the sense strand, at least one of linking groups linking two adjacent nucleotides is a phosphate ester group with modification group(s), and the phosphate ester group with modification group(s) exists in at least one of positions between two adjacent nucleotides in 1stto 5thnucleotides at the 5’ terminal of the sense strand and between two adjacent nucleotides in 1stto 5thnucleotides at the 3’ terminal of the sense strand. In this case, the double-stranded oligonucleotide of the present disclosure achieves a good balance between exonuclease resistance and Lp(a) mRNA inhibition, thereby having a high inhibitory activity against the Lp(a) mRNA while improving the stability. In some embodiments, each of 1-4 of linking groups between adjacent nucleotides in the lst-5thnucleotides at the 5’ terminal of the sense strand, and / or 1-4 of linking groups between adjacent nucleotides in the lst-5thnucleotides at the 3’ terminal of the sense strand is independently a phosphate ester group with modification group(s). In some embodiments, each of all 4 linking groups between adjacent nucleotides in the lst-5thnucleotides at the 5’ terminal of the sense strand is independently a phosphate ester group with modification group(s). In some embodiments, each of all 4 linking groups between adjacent nucleotides in the lst-5thnucleotides at the 3’ terminal of the sense strand is independently a phosphate ester group with modification group(s). In some embodiments, the linking groups linking two adjacent nucleotides in the lst-3rd, lst-4thor lst-5thnucleotides at the 5’ terminal and / or the 3’ terminal of the sense strand are phosphate ester groups with modification group(s). In some embodiments, the linking groups between adjacent nucleotides in the lst-3rdnucleotides at the 5’ terminal of the sense strand are phosphate ester groups with modification group(s). The definition and selection range of the phosphate ester group with modification group(s) are the same as those of the phosphate ester group with modification group(s) described in the anti-sense strand of the present disclosure above. In some embodiments, each phosphate ester group with modification group(s) is a phosphorothioate group having a structure as shown in Formula (28).In some embodiments, the sense strand is a sense strand possessed by a siRNAl or a siRNA2 listed in Table 1. In some embodiments, the sense strand is a sense strand possessed by a conjugate1 or a conjugate 2 listed in Table 2.In some embodiments, the sense strand comprises 19-21 nucleotides, and the anti-sense strand comprises 21-23 nucleotides; and in the sense strand, in a 3’ to 5’ direction, the 11thand 13thnucleotides or the 11th- 13thnucleotides are the fluoro modified nucleotides, the 1stand / or last nucleotide of the sense strand is the alkoxy modified nucleotide or the inverted abasic deoxynucleotide, and each of the nucleotides of the remaining positions is the methoxy modified nucleotide. Each of 1-4 of linking groups between adjacent nucleotides in the lst-5thnucleotides at the 5’ terminal of the sense strand, and / or 1-4 of linking groups between adjacent nucleotides in the lst-5thnucleotides at the 3’ terminal of the sense strand is independently a phosphate ester group with modification group(s). In some embodiments, the linking group between every two adjacent nucleotides in the lst-2nd, lst-3rd, F * or lst-5thnucleotides at the 5’ terminal and / or the 3’ terminal of the sense strand is a phosphate ester group with modification group(s), and the linking groups between the remaining adjacent nucleotides in the sense strand are the phosphate groups. In some embodiments, the linking group between every two adjacent nucleotides in the lst-3rd, lst-4thor 1st- 5thnucleotides at the 5’ terminal of the sense strand is a phosphate ester group with modification group(s), and the linking groups between the remaining adjacent nucleotides in the sense strand are the phosphate groups. In some embodiments, the linking groups between two adjacent nucleotides in the lst-2nd, lst-3rd, lst-4thor lst-5thnucleotides at the 3’ terminal of the sense strand are phosphate ester groups with modification group(s), and the linking groups between the remaining adjacent nucleotides in the sense strand are the phosphate groups. In some embodiments, all of adjacent nucleotides in the sense strand are linked by the phosphate groups. In some embodiments, the phosphate ester group with modification group(s) is a phosphorothioate group having a structure as shown in Formula (28), and the alkoxy modified nucleotide is a 2’-methoxy modified nucleotide.In some embodiments, in the double-stranded oligonucleotide of the present disclosure, the sense strand comprises 19-21 nucleotides, and the anti-sense strand comprises 21-23 nucleotides; in the sense strand, in a 3’ to 5’ direction, the 11thand 13thnucleotides are the fluoro modified nucleotides, the 1stnucleotide is the inverted abasic deoxynucleotide, and each of the nucleotides of the remaining positions is the alkoxy modified nucleotide; and the linking groups between adjacent nucleotides in the lst-3rdnucleotides at the 5’ terminal of the sense strand and / or the linking groups between adjacent nucleotides in the lst-3rdnucleotides at the 3’ terminal of the sense strand are phosphate ester groups with modification group(s); in the anti-sense strand, in a 5’ to 3’ direction, a 14thnucleotide is the deoxynucleotide, the 2nd, 5th, 7th, 12thand 16thnucleotides are the fluoro modified nucleotides, the 3rdnucleotide is the alkoxy modified nucleotide or asubstituted alkoxy modified nucleotide, and each of the remaining nucleotides in the anti-sense strand is the alkoxy modified nucleotide; or, in the anti-sense strand, in a 5’ to 3’ direction, the 14thnucleotide is the deoxynucleotide, the 2nd, 7th, 12th, 16thand 19thnucleotides are the fluoro modified nucleotides, and each of the remaining nucleotides in the anti-sense strand is the alkoxy modified nucleotide; or, in the anti-sense strand, in a 5’ to 3’ direction, the 14thnucleotide is the deoxynucleotide, the 2nd, 6th, 12th, 16thand 19thnucleotides are the fluoro modified nucleotides, and each of the remaining nucleotides in the anti-sense strand is the alkoxy modified nucleotide; or, in the anti-sense strand, in a 5’ to 3’ direction, the 12thand 14thnucleotides are the deoxynucleotides, the 2nd, 7thand 16thnucleotides are the fluoro modified nucleotides, and each of the remaining nucleotides in the anti-sense strand is the alkoxy modified nucleotides; or, in the anti-sense strand, in a 5’ to 3’ direction, the 14thnucleotide is the deoxynucleotide, the 16thnucleotide is an unmodified nucleotide, the 13thnucleotide is the substituted alkoxy modified nucleotide, the 2ndand 6thnucleotides are the fluoro modified nucleotides, and in a 3’ to 5’ direction, the 2ndnucleotide of the anti-sense strand is the thermally destabilizing nucleotide, and each of the remaining nucleotides in the anti-sense strand is the alkoxy modified nucleotide; or, in the anti-sense strand, in a 5’ to 3’ direction, the 14thnucleotide is the deoxynucleotide, a 19thnucleotide is the unmodified nucleotide, the 2nd, 6thand 16thnucleotides are the fluoro modified nucleotides, the 13thnucleotide is the substituted alkoxy modified nucleotide, and each of the remaining nucleotides in the anti-sense strand is the alkoxy modified nucleotide; each of linking groups between two adjacent nucleotides in the lst-3rdnucleotides at the 5’ terminal of the antisense strand and linking groups between two adjacent nucleotides in the lst-3rdnucleotides at the 3’ terminal of the anti-sense strand is a phosphate ester group with modification group(s), and in a case that the unmodified nucleotide exists in the anti-sense strand, each of 1-2 of two linking groups between each unmodified nucleotide and adjacent nucleotides is a phosphate ester group with modification group(s); and a 5’ terminal nucleotide of the anti-sense strand is a 5’-hydroxy nucleotide as shown in Formula (29) or a 5’-(E)-vinylphosphate modified nucleotide as shown in Formula (31).In some embodiments, in the double-stranded oligonucleotide of the present disclosure, the sense strand comprises 19 nucleotides, and the anti-sense strand comprises 21 nucleotides; in the sense strand, in a 3’ to 5’ direction, the 11thand 13thnucleotides are the fluoro modified nucleotides, the 1stnucleotide is the inverted abasic deoxynucleotide, and each of the nucleotides of the remaining positions is the methoxy modified nucleotide; and the linking groups between adjacent nucleotides in the lst-3rdnucleotides at the 5’ terminal of the sense strand are the phosphorothioate groups; andin the anti-sense strand, in a 5’ to 3’ direction, the 14thnucleotide is the deoxynucleotide, the 2nd, 5th, 7th, 12thand 16thnucleotides are the fluoro modified nucleotides, and each of the remaining nucleotides in the anti-sense strand is the methoxy modified nucleotide; each of the linking groups between adjacent nucleotides in the lst-3rdnucleotides at the 5’ terminal of the anti-sense strand and the linking groups between adjacent nucleotides in the lst-3rdnucleotides at the 3’ terminal of the anti-sense strand is the phosphorothioate group; and the 5’ terminal nucleotide of the antisense strand is the 5’-hydroxy nucleotide as shown in Formula (29) or the 5’-(E)-vinylphosphate modified nucleotide as shown in Formula (31).By adopting the modification scheme above, the double-stranded oligonucleotide of the present disclosure can achieve a good balance between an expression regulation activity against the Lp(a) mRNA and an in-vivo stability. In the context of the present disclosure, the “modification scheme” refers to a combination of nucleotide ribose modification, phosphoric acid modification, 5’ terminal modification and / or base modification with different numbers, positions and types that are irrelevant or weakly related to specific sequences. In some embodiments, by adopting the modification scheme above, the double-stranded oligonucleotide of the present disclosure can maintain an excellent stability without significantly reducing an original pharmaceutical activity of the double-stranded oligonucleotide, thereby achieving the good balance between the expression regulation activity against the Lp(a) mRNA and the in-vivo stability. In some embodiments, the double- stranded oligonucleotide of the present disclosure is a siRNA. By adopting the modification scheme above, the double-stranded oligonucleotide of the present disclosure can maintain the excellent stability without significantly reducing an original RNAi activity of the siRNA, thereby achieving a good balance between the inhibitory activity against the Lp(a) mRNA and the in-vivo stability.In some embodiments, the double-stranded oligonucleotide of the present disclosure is composed of a substantially reverse complementary or completely reverse complementary double-stranded region, and 1 or 2 overhangs of the sense strand and / or 1 or 2 overhangs of the anti-sense strand. In some embodiments, the double-stranded oligonucleotide of the present disclosure is composed of the substantially reverse complementary or completely reverse complementary double-stranded region and 1 overhang of the anti-sense strand.In the context of the present disclosure, the “double-stranded region” refers to a doublestranded structure formed between the shortest nucleotide sequences comprising all bases forming base pairs on each single strand in a double-stranded nucleic acid structure. Therefore, the doublestranded region is composed of all base pairs in the double-stranded nucleic acid structure and all base mispairings between the base pairs. In some embodiments, the number of the basemispairings does not exceed 20%, 15%, 10% or 5% of a total number of the base pairs forming the double-stranded region. In some embodiments, the number of the base mispairings in the double-stranded region does not exceed 3, 2 or 1. In some embodiments, the double-stranded nucleic acid structure comprises the double-stranded region, and one or more overhangs composed of nucleotides failed to form base pairings on one or two single strands. In some embodiments, the double-stranded nucleic acid structure only comprises the double-stranded region.In some embodiments, the double-stranded region formed by the sense strand and the antisense strand comprises at least 16 base pairs. In some embodiments, the double-stranded region formed by the sense strand and the anti-sense strand comprises 16-23 base pairs. In some embodiments, the double-stranded region formed by the sense strand and the anti-sense strand comprises 18, 19, 20 or 21 base pairs. In the context of the present disclosure, each base pair forming the double-stranded region is independently complementary or mispaired. In some embodiments, the sense strand is substantially reverse complementary or completely reverse complementary to the anti-sense strand in the double-stranded region. In some embodiments, the sense strand of the double-stranded oligonucleotide of the present disclosure is substantially reverse complementary or completely reverse complementary to the anti-sense strand in all nucleotide lengths.In some embodiments, the sense strand is basically reverse complementary, substantially reverse complementary or completely reverse complementary to the anti-sense strand. In some embodiments, the sense strand is substantially reverse complementary or completely reverse complementary to the anti-sense strand in the double- stranded region. In some embodiments, in a 5’ to 3’ direction, except for 1stand last position, at least the nucleotide sequence of the sense strand is substantially reverse complementary or completely reverse complementary to the antisense strand. In some embodiments, in a 5’ to 3’ direction, except for the last position, the nucleotide sequence of the sense strand is completely reverse complementary to the anti-sense strand; or all nucleotides of the sense strand is completely reverse complementary to the antisense strand.In some embodiments, in the double-stranded oligonucleotide of the present disclosure, an unmodified equivalent sequence of the sense strand comprises a nucleotide sequence which has the same length as a nucleotide sequence m, and has no more than 3 base differences, no more than 1 base difference, or no base difference, and the definition and selection of the nucleotide sequence m are as mentioned above. In the context, there is the “base difference” between one nucleotide sequence and another nucleotide sequence, which means that, when the former iscompared with the latter, a base type of a nucleotide in the same position is changed. For example, when a base of one nucleotide in the latter is A, in the case that a base of a corresponding nucleotide in the same position in the former is U, C, G or T, it is considered that there is the base difference between the two nucleotide sequences in this position. When the base is modified, it is also considered that there is no base difference between the modified base and the original base as long as a purine-pyrimidine pairing relationship when forming the above double-stranded nucleic acid structure is not affected. In some embodiments, it is considered that there is no base difference between the U and the T. In some embodiments, it is considered that there is no base difference between the C and 5-methylcytosine (5mC). In some embodiments, when a nucleotide in an original position is substituted by an abasic nucleotide or an equivalent thereof, it may also be considered that there is the base difference in this position. When two nucleotide sequences are compared to determine the number of base differences, the nucleotide sequences are aligned by a method with a minimum number of base differences among all alignment methods, and the base difference is determined based on this alignment method. In this case, the “same position” refers to a corresponding position between two nucleotide sequences in this alignment method. For example, when lst-5thpositions of a nucleotide sequence A are aligned with 2nd-6thpositions of a nucleotide sequence B in the same direction, the number of base differences is minimum compared with other alignment methods, and then the “same position” means that the 1stposition of the nucleotide sequence A is aligned with the 2ndposition of the nucleotide sequence B, the 2ndposition of the nucleotide sequence A is aligned with the 3rdposition of the nucleotide sequence B, and so on.In some embodiments, the number of base differences between two nucleotide sequences with different lengths refers to the number of base differences calculated in a nucleotide sequence section from a first nucleotide with no base difference to a last nucleotide with no base difference in the alignment method with the minimum number of base differences. In some embodiments, the number of base differences between two nucleotide sequences with the same length refers to a total number of base differences between a 1stnucleotide to a last nucleotide of any nucleotide sequence and a 1stnucleotide to a last nucleotide of another nucleotide sequence in the same direction. In some embodiments, no base difference between two nucleotide sequences with different lengths refers to no base difference between a 1stnucleotide to a last nucleotide of a shorter nucleotide sequence and each nucleotide in the same position of another nucleotide in the same direction. In some embodiments, no base difference between two nucleotide sequences with the same length refers to no base difference between a 1stnucleotide to a last nucleotide of one nucleotide sequence and a 1stnucleotide to a last nucleotide of another nucleotide sequence in thesame direction.The double-stranded oligonucleotide of the present disclosure may be various doublestranded oligonucleotides that regulate the expression of the Lp(a) mRNA. In some embodiments, the double-stranded oligonucleotide is a double-stranded oligonucleotide that inhibits or downregulates the expression of the Lp(a) mRNA, such as a siRNA. In some embodiments, the double-stranded oligonucleotide of the present disclosure may be a double-stranded oligonucleotide that activates or upregulates the expression of the Lp(a) mRNA, such as a saRNA. In some embodiments, the double-stranded oligonucleotide is the siRNA.In some embodiments, the double-stranded oligonucleotide of the present disclosure may be one of the following first and second double-stranded oligonucleotides, and each double-stranded oligonucleotide is described separately below.First double-stranded oligonucleotideIn some embodiments, the present disclosure provides the first double-stranded oligonucleotide, the double-stranded oligonucleotide comprises a sense strand and an antisense strand, the sense strand comprises a nucleotide sequence I, and the nucleotide sequence I and a nucleotide sequence as shown in SEQ ID NO: 1 have the same length, and no more than 3 base differences; and the anti-sense strand comprises a nucleotide sequence II, and the nucleotide sequence II and a nucleotide sequence as shown in SEQ ID NO: 2 have the same length, and no more than 3 base differences:5’- GGCAGCUCCUUAUUGUUAZi -3’ (SEQ ID NO: 1);5’ - Z2UAACAAUAAGGAGCUGCC -3’ (SEQ ID NO: 2),wherein, Zi is U, A or the inverted abasic deoxynucleotide (ia), Z2 is A or U, the nucleotide sequence I comprises a nucleotide Z’i corresponding to the Zi in position, the nucleotide sequence II comprises a nucleotide Z’2 corresponding to the Z2 in position, and the Z’2 is the first nucleotide at the 5’ terminal of the anti-sense strand. Thus, in one embodiment, the nucleotide sequence I comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 1 with no more than 3 base differences and the nucleotide sequence II comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 2 with no more than 3 base differences.In some embodiments, the sense strand only comprises the nucleotide sequence I, and the anti-sense strand only comprises the nucleotide sequence II.In some embodiments, the nucleotide sequence I and the nucleotide sequence as shown in SEQ ID NO: 1 have no more than 1 base difference, and / or the nucleotide sequence II and the nucleotide sequence as shown in SEQ ID NO: 2 have no more than 1 base difference. Thus, in one embodiment, the nucleotide sequence I comprises or consists of the nucleotide sequence asshown in SEQ ID NO: 1 with 1 base difference and / or the nucleotide sequence II comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 2 with 1 base difference. The base difference between the nucleotide sequence I and the nucleotide sequence as shown in SEQ ID NO: 1 may comprise a difference in the Z’i position and / or a base difference in any other nucleotide position in the nucleotide sequence I.In some embodiments, the base difference between the nucleotide sequence I and the nucleotide sequence as shown in SEQ ID NO: 1 may comprise the base difference in the Z’i position and / or a base difference in a nucleotide position adjacent to the Z’i.In some embodiments, the base difference between the nucleotide sequence I and the nucleotide sequence as shown in SEQ ID NO: 1 is the base difference in the Z’i position, and preferably, the Z’i is the inverted abasic deoxynucleotide. In some embodiments, there is no base difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 1. Thus, in one embodiment, the nucleotide sequence I comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 1 with no base difference.In some embodiments, the difference between the nucleotide sequence II and the nucleotide sequence as shown in SEQ ID NO: 2 comprises a difference in the Z’2 position, and the Z’2 is selected from C, U or G. In some embodiments, the difference between the nucleotide sequence II and the nucleotide sequence as shown in SEQ ID NO: 2 is the difference in the Z’2 position, and the Z’2 is selected from C, U or G. In some embodiments, there is no base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 2. Thus, in one embodiment, the nucleotide sequence II comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 2 with no base difference.In some embodiments, in a 5’ to 3’ direction, nucleotides in 2nd- 19thpositions of the nucleotide sequence II are completely reverse complementary to the Lp(a) mRNA. In some embodiments, the nucleotide sequence II is completely reverse complementary to the nucleotide sequence I. In some embodiments, there is a base mispairing between a 2ndnucleotide in the nucleotide sequence II in a 5’ to 3’ direction and a 2ndnucleotide in the nucleotide sequence I in a 3’ to 5’ direction. By comprising this base mispairing, a high inhibitory activity against the Lp(a) mRNA is achieved while maintaining a low off-target effect.In some embodiments, the sense strand further comprises a nucleotide sequence III, the antisense strand further comprises a nucleotide sequence IV, the length of the nucleotide sequence III is 1, 2, 3 or 4 nucleotides, the length of the nucleotide sequence IV is the same as the length of the nucleotide sequence III, the nucleotide sequence IV is substantially reverse complementary or completely reverse complementary to the nucleotide sequence III, and the nucleotide sequence IIIis linked to the 5’ terminal of the nucleotide sequence I.In some embodiments, in a 5’ to 3’ direction, each of the lengths of the nucleotide sequence III and the nucleotide sequence IV is 1 nucleotide, a base of the nucleotide sequence III is U, and a base of the nucleotide sequence IV is C; and in this case, a length ratio of the sense strand to the anti-sense strand is 20 / 20. In some embodiments, each of the lengths of the nucleotide sequence III and the nucleotide sequence IV is 2 nucleotides, in a 5’ to 3’ direction, a base composition of the nucleotide sequence III is GU, and a base composition of the nucleotide sequence IV is AC; and in this case, the length ratio of the sense strand to the anti-sense strand is 21 / 21. In some embodiments, each of the lengths of the nucleotide sequence III and the nucleotide sequence IV is 3 nucleotides, in a 5’ to 3’ direction, the base composition of the nucleotide sequence III is UGU, and the base composition of the nucleotide sequence IV is ACA; and in this case, the length ratio of the sense strand to the anti-sense strand is 22 / 22. In some embodiments, each of the lengths of the nucleotide sequence III and the nucleotide sequence IV is 4 nucleotides, in a 5’ to 3’ direction, the base composition of the nucleotide sequence III is CUGU, and the base composition of the nucleotide sequence IV is ACAG; and in this case, the length ratio of the sense strand to the antisense strand is 23 / 23. In some embodiments, each of the lengths of the nucleotide sequence III and the nucleotide sequence IV is 2 nucleotides, in a 5’ to 3’ direction, the base composition of the nucleotide sequence III is GU, and the base composition of the nucleotide sequence IV is AC; and in this case, the length ratio of the sense strand to the anti-sense strand is 21 / 21.In some embodiments, the anti-sense strand further comprises a nucleotide sequence V, each nucleotide of the nucleotide sequence V is independently the non-fluoro modified nucleotide. Nucleotide sequence V is 1 to 3 nucleotides in length and is linked to the 3' terminal of the nucleotide sequence IV or the nucleotide sequence II, forming the 3' overhang of the anti-sense strand after the formation of the double-stranded oligonucleotide.In some embodiments, the length of the nucleotide sequence V is 2 nucleotides, and in a 5’ to 3’ direction, the nucleotide sequence V is 2 contiguous thymidine deoxynucleotides, 2 contiguous uridine nucleotides, or completely reverse complementary to the Lp(a) mRNA.In some embodiments, the nucleotide sequence V is linked to the 3’ terminal of the nucleotide sequence II, and in a 5’ to 3’ direction, a base composition of the nucleotide sequence V is selected from AC or UU.In some embodiments, the sense strand only comprises the nucleotide sequence I, and the anti-sense strand only comprises the nucleotide sequence II and the nucleotide sequence V. The nucleotide sequence II is composed of SEQ ID NO: 2, the nucleotide sequence I is composed of SEQ ID NO: 1, and the nucleotide sequence V is linked to the 3’ terminal of the nucleotidesequence II. Moreover, in a 5’ to 3’ direction, the base composition of the nucleotide sequence V is AC.Second double-stranded oligonucleotideIn some embodiments, the present disclosure provides the second double-stranded oligonucleotide, the double-stranded oligonucleotide comprises a sense strand and an antisense strand, the sense strand comprises a nucleotide sequence I, and the nucleotide sequence I and a nucleotide sequence as shown in SEQ ID NO: 3 have the same length, and no more than 3 base differences; and the anti-sense strand comprises a nucleotide sequence II, and the nucleotide sequence II and a nucleotide sequence as shown in SEQ ID NO: 4 have the same length, and no more than 3 base differences:5’- GCACAUACUUCAUUACUGZ3 -3’ (SEQ ID NO: 3);5’ - Z4CAGUAAUGAAGUAUGUGC -3’ (SEQ ID NO: 4),wherein, Z3 is U, A or the inverted abasic deoxynucleotide (ia), Z4 is A or U, the nucleotide sequence I comprises a nucleotide Z’3 corresponding to the Z3 in position, the nucleotide sequence II comprises a nucleotide Z’4 corresponding to the Z4 in position, and the Z’4 is the first nucleotide at the 5’ terminal of the anti-sense strand. Thus, in one embodiment, the nucleotide sequence I comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 3 with no more than 3 base differences and the nucleotide sequence II comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 4 with no more than 3 base differences.In some embodiments, the sense strand only comprises the nucleotide sequence I, and the anti-sense strand only comprises the nucleotide sequence II.In some embodiments, the nucleotide sequence I and the nucleotide sequence as shown in SEQ ID NO: 3 have no more than 1 base difference, and / or the nucleotide sequence II and the nucleotide sequence as shown in SEQ ID NO: 4 have no more than 1 base difference. Thus, in one embodiment, the nucleotide sequence I comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 3 with 1 base difference and / or the nucleotide sequence II comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 4 with 1 base difference. The base difference between the nucleotide sequence I and the nucleotide sequence as shown in SEQ ID NO: 3 may comprise a difference in the Z’3 position and / or a base difference in any other nucleotide position in the nucleotide sequence I.In some embodiments, the base difference between the nucleotide sequence I and the nucleotide sequence as shown in SEQ ID NO: 3 may comprise the base difference in the Z’3 position and / or a base difference in a nucleotide position adjacent to the Z’3.In some embodiments, the base difference between the nucleotide sequence I and thenucleotide sequence as shown in SEQ ID NO: 3 is the base difference in the Z’3 position, and preferably, the Z’3 is the inverted abasic deoxynucleotide. In some embodiments, there is no base difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 3. Thus, in one embodiment, the nucleotide sequence I comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 3 with no base difference.In some embodiments, the difference between the nucleotide sequence II and the nucleotide sequence as shown in SEQ ID NO: 4 comprises a difference in the Z’4 position, and the Z’4 is selected from C, U or G. In some embodiments, the difference between the nucleotide sequence II and the nucleotide sequence as shown in SEQ ID NO: 4 is the difference in the Z’4 position, and the Z’4 is selected from C, U or G. In some embodiments, there is no base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 4. Thus, in one embodiment, the nucleotide sequence II comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 4 with no base difference.In some embodiments, in a 5’ to 3’ direction, nucleotides in 2nd- 19thpositions of the nucleotide sequence II are completely reverse complementary to the Lp(a) mRNA. In some embodiments, the nucleotide sequence II is completely reverse complementary to the nucleotide sequence I. In some embodiments, there is a base mispairing between a 2ndnucleotide in the nucleotide sequence II in a 5’ to 3’ direction and a 2ndnucleotide in the nucleotide sequence I in a 3’ to 5’ direction. By comprising this base mispairing, a high inhibitory activity against the Lp(a) mRNA is achieved while maintaining a low off-target effect.In some embodiments, the sense strand further comprises a nucleotide sequence III, the antisense strand further comprises a nucleotide sequence IV, the length of the nucleotide sequence III is 1, 2, 3 or 4 nucleotides, the length of the nucleotide sequence IV is the same as the length of the nucleotide sequence III, the nucleotide sequence IV is substantially reverse complementary or completely reverse complementary to the nucleotide sequence III, and the nucleotide sequence III is linked to the 5’ terminal of the nucleotide sequence I.In some embodiments, in a 5’ to 3’ direction, each of the lengths of the nucleotide sequence III and the nucleotide sequence IV is 1 nucleotide, a base of the nucleotide sequence III is G, and a base of the nucleotide sequence IV is C; and in this case, a length ratio of the sense strand to the anti-sense strand is 20 / 20. In some embodiments, each of the lengths of the nucleotide sequence III and the nucleotide sequence IV is 2 nucleotides, in a 5’ to 3’ direction, a base composition of the nucleotide sequence III is AG, and a base composition of the nucleotide sequence IV is CU; and in this case, the length ratio of the sense strand to the anti-sense strand is 21 / 21. In some embodiments, each of the lengths of the nucleotide sequence III and the nucleotide sequence IVis 3 nucleotides, in a 5’ to 3’ direction, a base composition of the nucleotide sequence III is AAG, and a base composition of the nucleotide sequence IV is CUU; and in this case, the length ratio of the sense strand to the anti-sense strand is 22 / 22. In some embodiments, each of the lengths of the nucleotide sequence III and the nucleotide sequence IV is 4 nucleotides, in a 5’ to 3’ direction, the base composition of the nucleotide sequence III is CAAG, and the base composition of the nucleotide sequence IV is CUUG; and in this case, the length ratio of the sense strand to the antisense strand is 23 / 23. In some embodiments, each of the lengths of the nucleotide sequence III and the nucleotide sequence IV is 2 nucleotides, in a 5’ to 3’ direction, the base composition of the nucleotide sequence III is AG, and the base composition of the nucleotide sequence IV is CU; and in this case, the length ratio of the sense strand to the anti-sense strand is 21 / 21.In some embodiments, the anti-sense strand further comprises a nucleotide sequence V, each nucleotide of the nucleotide sequence V is independently the non-fluoro modified nucleotide. Nucleotide sequence V is 1 to 3 nucleotides in length and is linked to the 3' terminal of the nucleotide sequence IV or the nucleotide sequence II, forming the 3' overhang of the anti-sense strand after the formation of the double-stranded oligonucleotide.In some embodiments, the length of the nucleotide sequence V is 2 nucleotides, and in a 5’ to 3’ direction, the nucleotide sequence V is 2 contiguous thymidine deoxynucleotides, 2 contiguous uridine nucleotides, or completely reverse complementary to the Lp(a) mRNA.In some embodiments, the nucleotide sequence V is linked to the 3 ’ terminal of the nucleotide sequence II, and in a 5’ to 3’ direction, a base composition of the nucleotide sequence V is selected from CU or UU.In some embodiments, the sense strand only comprises the nucleotide sequence I, and the anti-sense strand only comprises the nucleotide sequence II and the nucleotide sequence V. The nucleotide sequence II is composed of SEQ ID NO: 4, the nucleotide sequence I is composed of SEQ ID NO: 3, and the nucleotide sequence V is linked to the 3’ terminal of the nucleotide sequence II. Moreover, in a 5’ to 3’ direction, the base composition of the nucleotide sequence V is CU.In some embodiments, the double-stranded oligonucleotide of the present disclosure is one of siRNA1-siRNA2 as shown in Table 1 below:Table 1. Sequences of siRNAs of the present disclosureSEQ IDsiRNA No. Sequence direction from 5’ to 3’NO5 GosGosCoAoGoCoUfCoCfUoUoAoUoUoGoUoUoAoia siRNA16 P1AosUfsAoAoCfAoAfUoAoAoGoGfAodGCoUfGoCoCosAosCo 7 GosCosAoCoAoUoAfCoUfUoCoAoUoUoAoCoUoGoia siRNA28 P1AosCfsAoGoUfAoAfUoGoAoAoGfUodAUoGfUoGoCosCosUowherein, capital letters C, G, U, A and T indicate the base composition of the nucleotides; a lowercase letter o indicates that one nucleotide adjacent to the left side of the letter o is the alkoxy modified nucleotide; a lowercase letter f indicates that one nucleotide adjacent to the left side of the letter f is the fluoro modified nucleotide; a lowercase letter s indicates that two nucleotides adjacent to the left and right sides of the letter are linked by the phosphorothioate group; a lowercase letter d indicates that one nucleotide adjacent to the right side of the letter is the deoxynucleotide; ia indicates the inversed abasic deoxynucleotide; and Pl indicates that one nucleotide adjacent to the right side of the letter is the 5 ’-phosphate nucleotide, the 5 ’-hydroxy nucleotide, the 5 ’-phosphorothioate modified nucleotide (Ps) or the 5’-(E)-vinylphosphate (5’-E-VP) modified nucleotide. In some embodiments, each alkoxy modified nucleotide is the 2’-methoxy modified nucleotide; and each Pl is independently the 5 ’-hydroxy nucleotide or the 5’-(E)-vinylphosphate (E-VP) modified nucleotide.In another aspect, the present disclosure provides a double-stranded oligonucleotide, wherein the double-stranded oligonucleotide comprises a sense strand and an anti-sense strand, each nucleotide in the sense strand and the anti-sense strand is independently a modified or unmodified nucleotide, and the sense strand is at least partially reverse complementary to the anti-sense strand to form a double-stranded region. At least 15 contiguous nucleotides between unmodified equivalent sequences of the sense strand and the anti-sense strand and unmodified equivalent sequences of a sense strand and an anti-sense strand of any one of siRNA1-siRNA2 listed in Table 1 are consistent, and there are no more than 3 base differences.In some embodiments, at least 15, 16, 17, 18 or 19 contiguous nucleotides between the unmodified equivalent sequences of the sense strand and the anti-sense strand and the unmodified equivalent sequences of the sense strand and the anti-sense strand of any one of siRNA1-siRNA2 listed in Table 1 are consistent, and there are no more than 3 base differences, no more than 1 base difference, or no base difference.In some embodiments, the unmodified equivalent sequences of the sense strand and the anti-sense strand and the unmodified equivalent sequences of the sense strand and the anti-sense strand of any one of siRNA1-siRNA2 listed in Table 1 have the same length, and respectively have no more than 3 base differences, no more than 1 base difference, or no base difference. In some embodiments, in a 5’ to 3’ direction, the unmodified equivalent sequence of the sense strand and the unmodified equivalent sequence of the sense strand of any one of siRNA1-siRNA2 listed in Table 1 have the same length, and have no more than 1 base difference or no base difference in at least 1st- 18thpositions; and the unmodified equivalent sequence of the anti-sense strand and the unmodified equivalent sequence of the anti-sense strand of the siRNA have the same length, and have no more than 1 base difference or no base difference in at least 2nd-21stpositions.In some embodiments, each of the sense strand and the anti-sense strand respectively independently comprises at least one modified nucleotide. In some embodiments, each of the sense strand and the anti-sense strand respectively independently adopts the modification scheme above. In some embodiments, the anti-sense strand adopts the same modification scheme as the single-stranded oligonucleotide of the present disclosure.The single-stranded oligonucleotide and / or the double- stranded oligonucleotide provided by the present disclosure may be obtained by a conventional oligonucleotide preparation method in the art (such as solid-phase synthesis and liquid-phase synthesis methods). The solid-phase synthesis has been provided with a commercialized and customized service. A modified nucleotide group may be introduced into the single-stranded oligonucleotide and / or the doublestranded oligonucleotide of the present disclosure by using a nucleoside monomer with corresponding modification, and a method for preparing the nucleoside monomer with corresponding modification and a method for introducing the modified nucleotide group into the single-stranded oligonucleotide and / or the double-stranded oligonucleotide are also well known to those skilled in the art. Each of nucleoside monomers with all modifications may be either commercially available or prepared by known methods.The single-stranded oligonucleotide and the double-stranded oligonucleotide provided by the present disclosure may be used alone, or form a pharmaceutical composition with a pharmaceutically acceptable carrier, or form an oligonucleotide conjugate by binding to a delivery group, or be used in any other suitable form. An effective amount of the single-stranded oligonucleotide, the double-stranded oligonucleotide, the pharmaceutical composition or the oligonucleotide conjugate is contacted with cells to regulate the expression of the Lp(a) mRNA, or the effective amount of the single-stranded oligonucleotide, the double-stranded oligonucleotide, the oligonucleotide conjugate or the pharmaceutical composition is given to a subject to regulate the expression of the Lp(a) mRNA, so as to treat pathological conditions ordiseases related to the expression level of the Lp(a) mRNA.Oligonucleotide conjugateIn another aspect, the present disclosure provides an oligonucleotide conjugate, wherein the oligonucleotide conjugate comprises an oligonucleotide group and a delivery group conjugated to the oligonucleotide group, the oligonucleotide group is independently a group formed by removing one or more atoms or atomic groups from the single-stranded oligonucleotide or the double-stranded oligonucleotide provided by the present disclosure. An oligonucleotide group, such as an siRNA group, is a chemical moiety formed by removing one or more atoms or groups of atoms from a single-stranded or double-stranded oligonucleotide (e.g., siRNA) molecule. Those skilled in the art will understand that the RNAi activity of the oligonucleotide group formed by such removal has at least the same or essentially the same RNAi function as the single-stranded or double-stranded oligonucleotide per se. In some embodiments, such removal of one or more atoms or atomic groups does not impair the inhibitory potency against the target mRNA or stability of the oligonucleotide (e.g., siRNA). In some embodiments, the oligonucleotide group is a group formed by removing one atom or atomic group (e.g., a hydrogen atom, a hydroxyl group, or a phosphate ester group) from a single-stranded or double-stranded oligonucleotide provided in the present disclosure. For example, the siRNA group may be a chemical moiety formed by removing a hydrogen atom from a phosphate ester bond in the siRNA, or a chemical moiety formed by removing a hydrogen atom from the 5' hydroxyl group of the 5' terminal nucleotide of the sense or antisense strand in the siRNA, or a chemical moiety formed by removing a hydrogen atom from the 3' hydroxyl group of the 3' terminal nucleotide of the sense or antisense strand in the siRNA.In the context of the present disclosure, unless otherwise stated, “conjugating” refers to two or more chemical moieties each with specific function being linked to each other via a covalent linkage. Correspondingly, a “conjugate” refers to a compound formed by covalent linkage of individual chemical moieties. Further, the “oligonucleotide conjugate” represents a compound formed by covalently linking one or more chemical moieties with specific functions to an oligonucleotide. The oligonucleotide conjugate should be understood according to the context as the generic term of a plurality of oligonucleotide conjugates or oligonucleotide conjugates as shown in certain chemical formulae. In the context of the present disclosure, a “conjugating molecule” should be understood as a specific compound capable of being conjugated to the oligonucleotide via reactions, thereby finally forming the oligonucleotide conjugate of the present disclosure.The delivery group is a group for delivering an oligonucleotide group into a cell expressing the Lp(a) mRNA. In some embodiments, the delivery group comprises a linking group and a pharmaceutically acceptable targeting group, and in addition, the oligonucleotide group, the linking group and the targeting group are sequentially covalently or noncovalently linked, and each targeting group is selected from a ligand capable of binding to a cell surface receptor or a group capable of increasing a compatibility with a tissue. In some embodiments, each targeting group independently targets one or more of central nervous system, liver, kidney, lung, muscle and eye. In some embodiments, the targeting group targets the liver. In some embodiments, at least one or each targeting group is independently selected from a ligand capable of binding to an asialoglycoprotein receptor on a mammalian hepatocyte surface.In some embodiments, there are 1-6 targeting groups. In some embodiments, there are 2-4 targeting groups. The oligonucleotide group may be non-covalently or covalently conjugated to the delivery group, for example, the oligonucleotide group may be covalently conjugated to the delivery group. The conjugating site between the oligonucleotide group and the delivery group may be at the 3’ terminal or 5’ terminal of the sense strand of the double-stranded oligonucleotide, or at the 5’ terminal of the anti-sense strand of the doublestranded oligonucleotide, or within the internal sequence of the double-stranded oligonucleotide. In some embodiments, the conjugating site between the oligonucleotide group and the delivery group is at the 3’ terminal of the sense strand of the double-stranded oligonucleotide.In some embodiments, the delivery group may be linked to any position of the nucleotide, such as a phosphate group, 2’-, 3’- or 5 ’-hydroxyl of a ribose or a base. When the delivery group is linked to the 3’ terminal or 5’ terminal of the single-stranded oligonucleotide or the double-stranded oligonucleotide, the delivery group is usually linked to an oxygen atom formed by removing a hydrogen atom from 3’- or 5 ’-hydroxyl of a nucleotide; and when the delivery group is linked to the internal sequence of the singlestranded oligonucleotide or the double-stranded oligonucleotide, the delivery group is usually linked to a phosphate group, a ribose ring or a base. In some embodiments, the delivery group may be linked to the 3 ’-hydroxyl of the nucleotide of the internal sequence of the single-stranded oligonucleotide or the double-stranded oligonucleotide, and in this case, the nucleotides are linked via a 2’ -5 ’-phosphate diester bond. Various linking methods may refer to the following non-patent documents: Muthiah Manoharan et.al, siRNA conjugates carrying sequentially assembled trivalent N-acetylgalactosamine linked throughnucleosides elicit robust gene silencing in vivo in hepatocytes. ACS Chemical biology, 2015, 10 (5): 1181-7. The disclosure is incorporated herein by reference in its entirety.In some embodiments, the single-stranded oligonucleotide or the double-stranded oligonucleotide may be linked to the delivery group via acid-labile or reducible chemical bonds, and these chemical bonds may be degraded under an acidic environment of a cell endosome, thereby converting the oligonucleotide group into the single-stranded oligonucleotide or the double-stranded oligonucleotide in a free state. For non-degradable conjugating modes, the delivery group may be linked to the sense strand of the doublestranded oligonucleotide in the oligonucleotide group, thereby minimizing the effect of conjugating on the activity of the oligonucleotide group.The targeting group may be linked to the oligonucleotide group via an appropriate linking group, and the appropriate linking group may be selected by those skilled in the art according to the specific type of the targeting group. The types of these linking groups and targeting groups and the linking modes with the oligonucleotide may be found in the disclosure of W02015006740A2, which is incorporated herein by reference in its entirety.In some embodiments, the targeting group may be a conventionally used ligand in the field of oligonucleotide administration, for example, the various ligands as described in W02009082607A2, which is incorporated herein by reference in its entirety.In some embodiments, at least one or each targeting group is selected from a ligand capable of binding to a cell surface receptor expressing the Lp(a) mRNA. In some embodiments, at least one or each targeting group is selected from small-molecule ligand groups capable of having affinity to an asialoglycoprotein receptor on a parenchymal hepatic cell surface. In some embodiments, at least one or each targeting group is selected from groups capable of increasing biocompatibility of the oligonucleotide conjugate in the central nervous system.In some embodiments, at least one or each targeting group is selected from a ligand capable of binding to a receptor on a mammalian parenchymal hepatocyte surface. In some embodiments, each targeting group is independently a ligand that has affinity to the asialoglycoprotein receptor on the mammalian hepatocyte surface. In some embodiments, each targeting group is independently asialoglycoprotein or asialo-sugar. In some embodiments, each targeting group is independently selected from one of groups formed by removing one atom or group from D-mannopyranose, L-mannopyranose, D-arabinose, D-xylofuranose, L-xylofuranose, D-glucose, L-glucose, D-galactose, L-galactose, a-D-mannofuranose, P-D-mannofuranose, a-D-mannopyranose, P-D-mannopyranose, a-D-glucopyranose, P-D-glucopyranose, a-D-glucofuranose, P-D-glucofuranose, a-D-fructofuranose, a-D-fructopyranose, a-D-galactopyranose, P-D-galactopyranose, a-D-galactofuranose, P-D-galactofuranose, glucosamine, sialic acid, galactosamine, N-acetylgalactosamine, N-trifluoroacetylgalactosamine, N-propionylgalactosamine, N-butyrylgalactosamine, N-isobutyrylgalactosamine, 2-amino-3-O-(R)-1-carboxyethyl]-2-deoxy-P-D-glucopyranose, 2-deoxy-2-(methylamino)-L-glucopyranose, 4,6-dideoxy-4-formamido-2,3-di-O-methyl-D-mannopyranose, 2-deoxy-2-sulfamino-D-glucopyranose, N-glycolyl-a-neuraminic acid, 5-thio-P-D-glucopyranose, methyl 2,3,4-tri-O-acetyl-l-thio-6-O-trityl-a-D-glucopyranoside, 4-thio-P-D-galactopyranose, ethyl 3,4,6,7-tetra-O-acetyl-2-deoxy-l,5-dithio-a-D-glucoheptopyranoside, 2,5-anhydro-D-allononitrile, ribose, D-ribose, D-4-thioribose, L-ribose, and L-4-thioribose. In some embodiments, at least one or each targeting group is a galactose group or an N-acetylgalactosamine group. In some embodiments, the oligonucleotide group can regulate the expression level of the Lp(a) mRNA in parenchymal hepatocytes.The delivery group in the oligonucleotide conjugate of the present disclosure may be various delivery groups known to those skilled in the field of oligonucleotide drugs.In some embodiments, the linking group in the oligonucleotide conjugate of the present disclosure has a structure as shown in Formula (301):■LA^LC-LB— {kAnn uw* Formula (301),wherein, k is an integer of 1-5, and represents a site where the group is covalently linked; and all of LAare linked to a same atom in Lc; or, each LAis independently linked to a different atom in the Lc.In some embodiments, the Lchas a structure as shown in -NH-C(H)n30i(CH2O-)k, wherein k is an integer of 1-3, n301=3-k; and the length of LBis 5-20 atoms. In some embodiments, each LAis independently a straight-chain alkylene group with a length of 5-20 carbon atoms, wherein one or more methylene groups are optionally substituted by any one or more selected from compositions composed of the following groups: C(O), NH, O, S, 1,2,3-triazolylidene and succinimidylidene.In some embodiments, the LAhas a structure containing amide bonds as shown in Formula (302), and the LBhas a structure as shown in Formula (303):ocHz q302Formula (302);wherein, each of nso2, q302 and P302 is respectively independently an integer of 2-6, and optionally, each of nso2, q302 and P302 is respectively independently 2 or 3; the n303 is an integer of 4-16, and optionally, the n303 is an integer of 8-12; and - -n-rvr represents a site where the group is covalently linked.In some embodiments, the linking group has a structure as shown in Formula (304) or Formula (305):Formula (304)Formula (305)In the linking group, each LAis respectively linked to one targeting group via an ether bond, which is linked via the ether bond formed by an oxygen atom of hydroxyl in the Lcmoiety and the Lcmoiety; and the LBis linked via an amido bond formed by carbonyl in Formula (303) anda nitrogen atom of amino in the Lcmoiety, and linked via a phosphate bond or a phosphorothioate bond formed by an oxygen atom in Formula (303) and an oxygen atom in the oligonucleotide group.In some embodiments, the oligonucleotide conjugate provided by the present disclosure has a structure as shown in Formula (305A):Formula (305 A)wherein, Nu represents the oligonucleotide group formed by the single-stranded oligonucleotide or the double-stranded oligonucleotide provided by the present disclosure.In some embodiments, the linking group in the oligonucleotide conjugate of the present disclosure has a structure as shown in Formula (306):wherein, moe is an integer of 0-3, each psoe is independently an integer of 1-6, and - -n-rvr represents a site where the group is covalently linked; the linking group is linked via an ether bond formed by an oxygen atom marked by * and the targeting group; and the linking group is linked via a phosphate bond or a phosphorothioate bond formed by at least one of oxygen atoms marked by # and the double-stranded oligonucleotide, and the remaining oxygen atoms marked by # are linked to hydrogen atoms to form hydroxyl, or linked to C1-C3 alkyl to form C1-C3 alkoxy.In some embodiments, the oligonucleotide conjugate of the present disclosure has a structure as shown in Formula (307):Formula (307),wherein, Nu represents the oligonucleotide group formed by the single-stranded oligonucleotide or the double-stranded oligonucleotide provided by the present disclosure.In some embodiments, the oligonucleotide conjugate of the present disclosure has a structure as shown in Formula (308):Ao AoIf1R308 If1I / l \ I IN — t-C-J - NH' I 'm308 J n308R308Formula (308),wherein,n308 is selected from an integer of 2-4;each m308 is independently selected from an integer of 2-5;each R308 is independently a hydrogen atom, methyl or ethyl, or two R308 linked to a same carbon atom form carbonyl together with the carbon atom; andone Ao is the oligonucleotide group, and the oligonucleotide group is a group formed by removing one atom or atomic group from the single-stranded oligonucleotide or the double-stranded oligonucleotide of the present disclosure; and all of the remaining Ao are the targeting groups, each targeting group is the same or different, and the definition and selection range of the targeting group are as mentioned above. In some embodiments, each targeting group is independently selected from one of ligands that have affinity to an asialoglycoprotein receptor on a mammalian parenchymal hepatic cell surface.Each Li is independently a divalent linking group with a length of 3-25 atoms; and -s sxsxs' represents a site where the group is covalently linked.In some embodiments, each Li is independently straight-chain alkylene with a length of 1-70 or 1-20 carbon atoms, wherein one or more carbon atoms are optionally substituted by any one or more selected from compositions composed of the following groups: C(O), NH, O, S, CH=N, S(O)2, OP(O)2, OP(O)(S), C2-Cio alkenylene, C2-Cio alkynylene, Ce-Cio arylene, C3-C18 heterocyclylene and C5-C10 heteroarylene; and moreover, the straight-chain alkylene may optionally have any one or more substituents in compositions composed of the following groups: C1-C10 alkyl, Ce-Cio aryl, C5-C10 heteroaryl, C1-C10 haloalkyl, -OC1-C10 alkyl, OC1-C10 alkylphenyl, -C1-C10 alkyl-OH, -OC1-C10 haloalkyl, -SC1-C10 alkyl, -SC1-C10 alkylphenyl, -Ci-C10 alkyl-SH, -SC1-C10 haloalkyl, halogen substituent, -OH, -SH, -NH2, -C1-C10 alkyl-NH2, -N(Ci-Cio alkyl)(Ci-Cio alkyl), -NH(Ci-Cio alkyl), N(Ci-Cio alkyl)(Ci-Cio alkylphenyl), NH(Ci-C10 alkylphenyl), cyano, nitro, -CO2H, -C(0)0(Ci-Cio alkyl), -CON(Ci-Cio alkyl)(Ci-Cio alkyl), -CONH(Ci-Cio alkyl), -CONH2, -NHC(0)(Ci-Cio alkyl), -NHC(O)(phenyl), -N(Ci-Cio alkyl)C(0)(Ci-Cio alkyl), -N(Ci-Cio alkyl)C(O)(phenyl), C(0)Ci-Cio alkyl, C(0)Ci-Cio alkylphenyl, C(0)Ci-Cio haloalkyl, -OC(0)Ci-Cio alkyl, -SO2(C1-C10alkyl), -SO2(phenyl), -SO2(C1-C10haloalkyl), -SO2NH2, -SO2NH(C1-C10alkyl), -SO2NH(phenyl), -NHSO2(C1-C10alkyl), -NHSO2(phenyl) and -NHSO2(C1-C10haloalkyl).As used herein, “alkyl” refers to straight chain and branched chain having the indicated number of carbon atoms, usually 1 to 20 carbon atoms, for example 1 to 10 carbon atoms, such as 1 to 8 or 1 to 6 carbon atoms. For example, Ci-Ce alkyl encompasses both of straight-chain alkyl and branched-chain alkyl of 1 to 6 carbon atoms. When naming an alkyl residue having a specific number of carbon atoms, all branched and straight chain forms having that number of carbon atoms are intended to be encompassed; thus, for example, “butyl” is meant to comprise n-butyl, sec-butyl, isobutyl and t-butyl; and “propyl” comprises n-propyl and isopropyl. Alkylene is a subset of alkyl, referring to the same residues as alkyl, but having two attachment positions.As used herein, “alkenyl” refers to an unsaturated branched-chain or straight-chain alkyl having at least one carbon-carbon double bond which is obtained by respectively removing one hydrogen molecule from two adjacent carbon atoms of the parent alkyl. The group may be in either cis or trans configuration of the double bond. Typical alkenyl groups comprise, but are not limited to, ethenyl; propenyl, such as prop-l-en-l-yl, prop-l-en-2-yl, prop-2-en-l-yl (allyl), and prop-2-en-2-yl; and butenyl, such as but-l-en-l-yl, but-l-en-2-yl, 2-methyl-prop-l-en-l-yl, but-2-en-l-yl, but-2-en-2-yl, buta-l,3-dien-l-yl, buta-l,3-dien-2-yl, and the like. In certain embodiments, an alkenyl group has 2 to 20 carbon atoms, and in other embodiments, 2 to 10, 2 to8, or 2 to 6 carbon atoms. Alkenylene is a subset of alkenyl, referring to the same residues as alkenyl, but having two attachment positions.As used herein, “alkynyl” refers to an unsaturated branched-chain or straight-chain alkyl having at least one carbon-carbon triple bond which is obtained by respectively removing two hydrogen molecules from two adjacent carbon atoms of the parent alkyl. Typical alkynyl groups comprise, but are not limited to, ethynyl; propynyls such as prop-l-yn-l-yl, and prop-2-yn-l-yl; and butynyls such as but-l-yn-l-yl, but-l-yn-3-yl, but-3-yn-l-yl, and the like. In certain embodiments, the alkynyl has 2 to 20 carbon atoms, and in other embodiments, 2 to 10, 2 to 8, or 2 to 6 carbon atoms. Alkynylene is a subset of alkynyl, referring to the same residues as alkynyl, but having two attachment positions.As used herein, “alkoxy” refers to alkyl of the indicated number of carbon atoms attached through an oxygen bridge, such as, methoxy, ethoxy, propoxy, isopropoxy, n-butoxy, sec-butoxy, tert-butoxy, pentyloxy, 2-pentyloxy, isopentyloxy, neopentyloxy, hexyloxy, 2-hexyloxy, 3-hexyloxy, 3 -methylpentyloxy, and the like. An alkoxy usually has 1 to 10, 1 to 8, 1 to 6, or 1 to 4 carbon atoms attached through an oxygen bridge.As used herein, “aryl” refers to a group derived from an aromatic monocyclic or multicyclic hydrocarbon ring system by removing a hydrogen atom from a ring carbon atom. The aromatic monocyclic or multicyclic hydrocarbon ring system contains only hydrogen and 6 to 18 carbon atoms, wherein at least one ring in the ring system is fully unsaturated, i.e., containing a cyclic, delocalized (4n+2)π-electron system in accordance with the Hückel theory. Aryl comprises, but is not limited to, phenyl, fluorenyl, naphthyl, and the like. Arylene is a subset of aryl, referring to the same residues as aryl, but having two attachment positions.“Heteroaryl” refers to a group derived from a 3- to 18-membered aromatic ring radical that comprises 2 to 17 carbon atoms and 1 to 6 heteroatoms selected from nitrogen, oxygen and sulfur. As used herein, the heteroaryl may be a monocyclic, bicyclic, tricyclic or tetracyclic ring system, wherein at least one ring in the ring system is fully unsaturated, i.e., containing a cyclic, delocalized (4n+2)π-electron system in accordance with the Hückel theory. The heteroaryl comprises fused or bridged ring systems. In some embodiments, the heteroatoms in the heteroaryl are oxidized heteroatoms. In some embodiments, the heteroaryl comprises one or more nitrogen atoms. In some embodiments, one or more of the nitrogen atoms in the heteroaryl are quaternized nitrogen atoms. The heteroaryl may be linked to the rest of the molecule through any atom of the ring. Examples of such heteroaryl comprise, but are not limited to, azepinyl, acridinyl, benzimidazolyl, benzindolyl, 1,3-benzodioxazolyl, benzofuranyl, benzoxazolyl, benzo[d]thiazolyl, benzothiadiazolyl, benzo[Z>][l,4]dioxepinyl, benzo[b][l,4]oxazinyl, 1,4-benzodioxanyl, benzonaphthofuranyl, benzoxazolyl, benzodi oxolyl, benzodioxinyl, benzopyranyl, benzopyranonyl, benzofuranyl, benzofuranonyl, benzothienyl, benzothieno[3,2-d]pyrimidinyl, benzotri azolyl, benzo[4,6]imidazo[l,2-a]pyridinyl, carbazolyl, cinnolinyl, cyclopenta[d]pyrimidinyl, 6,7-dihydro-5H-cyclopenta[4,5]thieno[2,3-d]pyrimidinyl, 5,6-dihydrobenzo[h]quinazolinyl, 5,6-dihydrobenzo[h]cinnolinyl, 6,7-dihydro-5H-benzo[6,7]cyclohepta[l,2-c]pyridazinyl, dibenzofuranyl, dibenzothienyl, furanyl, furanonyl, furo[3,2-c]pyridinyl, 5,6,7,8,9,10-hexahydrocyclooctafd] pyrimidinyl, 5,6,7,8,9,10-hexahydrocycloocta[d]pyridazinyl, 5,6,7,8,9,10-hexahydrocycloocta[d]pyridinyl, isothiazolyl, imidazolyl, indazolyl, indolyl, isoindolyl, indolinyl, isoindolinyl, isoquinolyl, indolizinyl, isoxazolyl, 5,8-methano-5,6,7,8-tetrahydroquinazolinyl, naphthyridinyl, 1,6-naphthyri dinonyl, oxadiazolyl, 2-oxoazepinyl, oxazolyl, oxiranyl, 5,6,6a,7,8,9,10,10a-octahydrobenzo[H]quinazolinyl, 1 -phenyl- 1 / / -pyrrolyl, phenazinyl, phenothiazinyl, phenoxazinyl, phthalazinyl, pteridinyl, purinyl, pyrrolyl, pyrazolyl, pyrazolo[3,4-d]pyrimidinyl, pyridinyl, pyrido[3,2-d]pyrimidinyl, pyrido[3,4-d]pyrimidinyl, pyrazinyl, pyrimidinyl, pyridazinyl, quinazolinyl, quinoxalinyl, quinolinyl, tetrahydroquinolinyl, 5, 6,7,8-tetrahydroquinazolinyl, 5,6,7,8-tetrahydrobenzo[4,5]thieno[2,3-d]pyrimidinyl, 6, 7,8,9-tetrahydro-5H-cyclohepta[4,5]thieno[2,3-d]pyrimidinyl, 5,6,7,8-tetrahydropyrido[4,5-c]pyridazinyl, thiazolyl, thiadiazolyl, triazolyl, tetrazolyl, triazinyl, thieno[2,3-d]pyrimidinyl, thieno[3,2-d]pyrimidinyl, thieno[2,3-c]pridinyl, and thiophenyl / thienyl.In the context, a “substituted” group is, for example, substituted alkyl, substituted alkoxy, substituted amino, a substituted aliphatic group, a substituted heteroaliphatic group, substituted acyl, substituted aryl or substituted heteroaryl. Unless otherwise specified, the “substituted” group refers to a group formed by substituting a hydrogen atom in the group by one or more substituents. For example, the “substituted alkoxy” refers to a group formed by substituting one or more hydrogen atoms in the alkoxy by substituents. It can be understood by those skilled in the art that a compound applicable to the present disclosure may contain various substituents, and so long as the introduction of the substituents will not affect the function of the present disclosure and can achieve the purpose of the present disclosure, the compound is applicable to the present disclosure. In some embodiments, the substituent is selected from a composition composed of the following groups: Ci-Cio alkyl, Ce-Cio aryl, C5-C10 heteroaryl, C1-C10 haloalkyl, -OC1-C10 alkyl, -OC1-C10 alkylphenyl, -C1-C10 alkyl-OH, -OC1-C10 haloalkyl, -SC1-C10 alkyl, -SC1-C10 alkylphenyl, -Ci-C10 alkyl-SH, -SC1-C10 haloalkyl, halogen substituent, -OH, -SH, -NH2, -C1-C10 alkyl-NH2, -N(Ci-Cio alkyl)(Ci-Cio alkyl), -NH(Ci-Cio alkyl), -N(Ci-Cio alkyl)(Ci-Cio alkylphenyl), -NH(Ci-C10 alkylphenyl), -CN, -NO2, -CO2H, -C(0)0(Ci-Cio alkyl), -CON(Ci-Cio alkyl)(Ci-Cio alkyl), -CONH(Ci-Cio alkyl), -CONH2, -NHC(0)(Ci-Cio alkyl), -NHC(O)(phenyl), -N(Ci-Cio alkyl)C(0)(Ci-Cio alkyl), -N(Ci-Cio alkyl)C(O)(phenyl), -C(0)Ci-Cio alkyl, -C(0)Ci-Cio alkylphenyl, -C(0)Ci-Cio haloalkyl, -OC(0)Ci-Cio alkyl, -SO2(C1-C10alkyl), -SO2(phenyl), -SO2(C1-C10haloalkyl), -SO2NH2, -SO2NH(C1-C10alkyl), -SO2NH(phenyl), -NHSO2(C1-C10alkyl), -NHSO2(phenyl) and -NHSO2(C1-C10haloalkyl). In some embodiments, the substituent is one of -C1-C3 alkyl, -Ce-Cs aryl, -O-C1-C3 alkyl, -O-(Ci-C3 alkyl)phenyl, halogen, -OH, -NH2, -CN and -NO2.Those skilled in the art will understand, with respect to any group containing one or more substituents, that such groups are not intended to introduce any substitution or substitution patterns that are sterically impractical, synthetically infeasible and / or inherently unstable.Those skilled in the art may understand that, Li is defined as a linking group formed by replacement or substitution starting from linear alkylene for convenience, but it may not be a linear group or be named differently, such as amine or alkenyl produced by the above replacement and / or substitution. Unless otherwise specified, in a chemical structural formula recorded in the present disclosure, a “length” of any group refers to the number of atoms excluded from hydrogen atoms in a longest atomic chain of the group; and in the calculation of the length of the group, when there are multiple linking modes between two atoms (for example, the two atoms belong to a same cyclic group, so that at least two atomic chains contain the two atoms), the length is calculated according to a shortest atomic chain between the two atoms. For example, a length of each of 1,4-cyclohexanediyl, 1,4-piperidinediyl, 1,4-phenylene and 1,4-piperazinediyl is calculated according to 4 atoms, while a length of 1,2-cyclopentadienyl is only calculated according to 2 atoms.Li covalently linked to Ao representing the oligonucleotide group is used to covalently link the oligonucleotide group to the targeting group, so that the oligonucleotide conjugate containing the oligonucleotide group enters cells expressing the mRNA through a targeting effect of the targeting group, without affecting level regulation to the Lp(a) mRNA by the oligonucleotide group entering the cells expressing the Lp(a) mRNA. Therefore, in some embodiments, the length of the Li covalently linked to the Ao representing the oligonucleotide group is 3-20 atoms, or 4-15 atoms, or 5-12 atoms. In some embodiments, the Li covalently linked to the Ao representing the oligonucleotide group is selected from linkage combinations of one or more of Al, A2, A4, A5, A10, A16, A18 and A19 with a phosphate group or a modified phosphate group:wherein, j 1 is an integer of 2-10; and-s s\ss' represents a site where the group is covalently linked.In some embodiments, R2 is selected from linkage combinations of at least two of Al, A2, A4, A10 and Al 6 with the phosphate group or the modified phosphate group. In some embodiments, R2 is selected from the linkage combinations of at least two of Al, A2 and A10 with the phosphate group or the modified phosphate group.In some embodiments, Li covalently linked to Ao representing the double-stranded oligonucleotide group has a structure as shown in Formula (Bl), (B2), (B3) or (B4):wherein, KZVVV' represents a site where the group is covalently linked, and LBI and LB2 are the same or different, and independently selected from one or any combination of the following groups: -(CH2)qi-, -CH(OH)-, -CH(CH2OH)-, -NH-, -O-, -S-, 1,4-cyclohexanediyl, 1,4-piperidinediyl, 1,4-phenylene, 1,4-piperazinediyl and pyrrolidinediyl, wherein ql is an integer of 1-6, and each of lengths of the LBI and the LB2 is respectivelyindependently 1-20 atoms. In some embodiments, each of lengths of the LBI and the LB2 is respectively independently 1-10 atoms. In some embodiments, each of lengths of the LBI and the LB2 is respectively independently 1-6 atoms.LBS is selected from one of a phosphate group, a phosphorothioate group and a phosphorodithioate group, and covalently linked to the remaining oxygen atoms after removing one hydrogen atom from the 5 ’-hydroxyl of the ribose of the 5 ’-terminal nucleotide or the 3’-hydroxyl of the ribose of the 3 ’-terminal nucleotide in the sense strand or the anti-sense strand of the double-stranded oligonucleotide group. In some embodiments, the LB3 is the phosphate group, and covalently linked to the remaining oxygen atoms after removing one hydrogen atom from the 5’-hydroxyl of the ribose of the 5’-terminal nucleotide or the 3’-hydroxyl of the ribose of the 3’-terminal nucleotide in the sense strand of the double-stranded oligonucleotide group.In some embodiments, in the case that the oligonucleotide conjugate is prepared by a solid-phase synthesis process, the Li covalently linked to the Ao representing the oligonucleotide group needs to contain a linking site linked to N on a nitrogenous backbone, a linking site linked to the oligonucleotide group and a functional group capable of being linked to a solid-phase carrier. In some embodiments, the site linked to the N on the nitrogenous backbone in the Li covalently linked to the Ao representing the oligonucleotide group forms an amido bond with the N, and is covalently linked to the oligonucleotide group via a phosphate bond, and the functional group capable of being linked to the solid-phase carrier is hydroxyl or amino. In some embodiments, R2 is B5, B6, B5’ or B6’:(B5) (B6)(B5’) (B6’)wherein, -ru rvn represents a site where the group is linked via a covalent bond. A value range of q2 may be an integer of 1-10. In some embodiments, the q2 is an integer of 1-5.A function of Li covalently linked to Ao representing the targeting group is to make the targeting group in a proper spatial position, so that the targeting group better binds to a receptor, thereby specifically targeting and entering relevant cells or tissues. Therefore, each Li covalently linked to the Ao representing the targeting group may be used in the present disclosure as long as it has an appropriate length and its chemical properties will not significantly affect delivery. In some embodiments, each Li covalently linked to the Ao representing the targeting group is independently a divalent linking group with a length of 3-25 atoms. In some embodiments, the length of each Li covalently linked to the Ao representing the targeting group is independently 4-15 atoms. In some embodiments, the length of each Li covalently linked to the Ao representing the targeting group is 5-10 atoms. In some embodiments, the length of each Li covalently linked to the Ao representing the targeting group is the same.In some embodiments, each Li covalently linked to the Ao representing the targeting group is the same or different, and independently selected from group consisting of the groups represented by Formula (L3)-Formula (LI 8) and any linkage combination thereof:wherein, each j 1 is an integer of 2-10; each R’ is independently a hydrogen atom or Ci-C3 alkyl, and represents a site where the group is covalently linked.For simple synthesis and / or stable chemical properties, in some embodiments, each Li covalently linked to the Ao representing the targeting group is independently a linkage combination of at least two linking units, and each linking unit independently has a structure as shown in any one of Formula (L3)-Formula (L7). In some embodiments, each linking unit independently has the structure as shown in any one of Formula (L3), Formula (L4) and Formula (L7). For convenience of synthesis, in some embodiments, each Li covalently linked to the Ao representing the targeting group comprises carbonyl linked to the nitrogen atom as shown in Formula (308).In some embodiments, each Li covalently linked to the Ao representing the targeting group independently has a structure as shown in Formula (L20) or Formula (L21):wherein, j2 is an integer of 4-9, and j3 is 1 or 2. In some embodiments, the j2 is 5, 6 or 7, and the j3 is 1. In some embodiments, each Li covalently linked to the Ao representing the targeting group is the same.In the conjugate of the present disclosure, the number of the targeting groups and an interval between the targeting groups are those capable of providing an appropriate spatial configuration of multiple targeting groups. Therefore, n308 and each m308 are independently selected from an integer of 2-4. In some embodiments, the n308 is 3 or 4, so that the number of the targeting groups in the conjugate of the present disclosure is 3 or 4,and the targeting groups can better bind to a hepatocyte surface receptor. In some embodiments, the n308 is 3, and each m308 is independently 3 or 4.Those skilled in the art can understand that, when each R308 is independently a hydrogen atom, methyl or ethyl, the purpose of the present disclosure can be achieved without affecting a delivery effect of the oligonucleotide conjugate. In some embodiments, for convenience of synthesis, each R308 is the hydrogen atom.In the conjugate of the present disclosure, each targeting group is the same or different, and independently selected from a ligand group binding to a cell surface receptor. In some embodiments, at least one or each targeting group is a group capable of targeting liver. In some embodiments, at least one or each targeting group is one of ligands that can have affinity with a receptor on a mammalian parenchymal hepatocyte surface. In some embodiments, at least one or each targeting group is one of ligands that have affinity with an asialoglycoprotein receptor (ASGPR) on the mammalian parenchymal hepatocyte surface. In some embodiments, each targeting group is a galactose group or N-acetylgalactosamine group formed by removing one atom or group from galactose or N-acetylgalactosamine (GalNAc).In some embodiments, the oligonucleotide conjugate of the present disclosure has a structure as shown in Formula (403), (404), (405), (406), (407), (408), (409), (410), (411), (412), (413), (414), (415), (416), (417), (418), (419), (420), (421) or (422):Formula (403)Formula (404)Formula (405)Formula (406)Formula (407)Formula (408)Nu O=p I -OHFormula (409)Formula (410) NHNu NHAc O=P-OH l oN NHAc H Formula (411)Formula (412)Formula (414)5Formula (415)Formula (416)NHAc Formula (417)NHAc Formula (418)Formula (419) Formula (420)Formula (421)Formula (422)wherein, Nu represents the oligonucleotide group, such as the single-stranded oligonucleotide group or the double-stranded oligonucleotide group formed by the singlestranded oligonucleotide or the double-stranded oligonucleotide provided by the present disclosure. In some embodiments, the oligonucleotide group is the double-stranded oligonucleotide group, and a P atom as shown in the above structural formula is covalently linked to the 3 ’-terminal nucleotide of the sense strand of the double-stranded oligonucleotide group. In some embodiments, the 3 ’-terminal nucleotide of the sense strand of the double-stranded oligonucleotide group is the inverted abasic deoxyribonucleotide, and the P atom as shown in the above structural formula is covalently linked to the doublestranded oligonucleotide group by substituting a hydrogen atom linked to hydroxyl of a ribose ring via methylene in the inverted abasic deoxyribonucleotide at the 3’ terminal of the sense strand of the double-stranded oligonucleotide group represented by the Nu. In some embodiments, the P atom as shown in Formula (403)-Formula (422) is covalently linked to the remaining oxygen atoms after removing one hydrogen atom from 3 ’-hydroxyl of ribose in the 3 ’-terminal nucleotide of the sense strand of the double-stranded oligonucleotide group. In some embodiments, the P atom as shown in Formula (403)-Formula (422) is linked via a covalent bond to an oxygen atom linked to the ribose ring via methylene in the inverted abasic deoxyribonucleotide ia as shown in Formula (35) at the 3’ terminal of the sense strand of the siRNA represented by Nu, so as to be covalently linked to the sense strand of the siRNA.In some embodiments, the double-stranded oligonucleotide group contained in theoligonucleotide conjugate of the present disclosure may be a siRNA group formed by removing one atom or atomic group from the siRNA, and in this case, the oligonucleotide conjugate of the present disclosure is also called a siRNA conjugate. In some embodiments, the double-stranded oligonucleotide group contained in the oligonucleotide conjugate of the present disclosure may be a siRNA group formed by, for example, siRNAs listed in Table 1. The siRNA conjugate containing these siRNA groups show excellent stability and high inhibitory activity against the Lp(a) mRNA. In some embodiments, the oligonucleotide conjugate of the present disclosure is a conjugate 1 or a conjugate 2 listed in Table 2.An siRNA group is a chemical moiety formed by removing one or more atoms or groups of atoms from an siRNA molecule. Those skilled in the art will understand that the RNAi activity of the siRNA group formed by such removal has at least the same or essentially the same RNAi function as the siRNA per se. In some embodiments, such removal of one or more atoms or atomic groups does not impair the inhibitory potency against the target mRNA or stability of the siRNA. In some embodiments, the siRNA group is a group formed by removing one atom or atomic group (e.g., a hydrogen atom, a hydroxyl group, or a phosphate ester group) from an siRNA provided in the present disclosure. For example, the siRNA group may be a chemical moiety formed by removing a hydrogen atom from a phosphate ester bond in the siRNA, or a chemical moiety formed by removing a hydrogen atom from the 5' hydroxyl group of the 5' terminal nucleotide of the sense or antisense strand in the siRNA, or a chemical moiety formed by removing a hydrogen atom from the 3' hydroxyl group of the 3' terminal nucleotide of the sense or antisense strand in the siRNA.Preparation of oligonucleotide conjugate of the present disclosureThose skilled in the art may prepare the oligonucleotide conjugate of the present disclosure by various suitable methods. For example, when the nucleotide monomers are linked one by one according to the sequences and modification schemes of the sense strand and the anti-sense strand of the single-stranded oligonucleotide or the double-stranded oligonucleotide of the present disclosure by the solid-phase synthesis method, the delivery group may be introduced by a method described in detail in the prior art to synthesize the oligonucleotide conjugate of the present disclosure. For example, a method for preparing various oligonucleotide conjugates is described in detail in W02015006740A2. In the case that the double-stranded oligonucleotide is the siRNA, the oligonucleotide conjugate of the present disclosure may also be obtained by a method well known to those skilled in the art. For example, a method for preparing a structure as shown in Formula (305) is recorded in W02014025805A1, and a method for preparing a structure as shown in Formula (307) is described by Rajeev et al. in ChemBioChem 2015, 16, 903-908. Amethod forpreparing the oligonucleotide conjugate as shown in Formula (308) is also disclosed in detail in the Chinese patent application CN110959011 A. The contents of the above documents are incorporated herein by reference in their entirety.Pharmaceutically acceptable saltIn another aspect, the present disclosure further provides a pharmaceutically acceptable salt of the single-stranded oligonucleotide of the present disclosure, the double-stranded oligonucleotide of the present disclosure or the oligonucleotide conjugate. The pharmaceutically acceptable salt is known to those skilled in the art. By a form of salt formation, the pharmaceutically acceptable salt of the single-stranded oligonucleotide, the double-stranded oligonucleotide or the oligonucleotide conjugate of the present disclosure may show better solubility, bioavailability or stability than the single-stranded oligonucleotide, the double-stranded oligonucleotide or the oligonucleotide conjugate itself. In some embodiments, in the singlestranded oligonucleotide, the double-stranded oligonucleotide or the oligonucleotide conjugate of the present disclosure, every adjacent nucleotides are linked via a phosphate diester bond or a phosphorothioate diester bond, and an unbridged oxygen atom or sulfur atom in the phosphate diester bond or the phosphorothioate diester bond is negatively charged, which may exist in a form of hydroxyl or sulfhydryl, and hydrogen ions in the hydroxyl or the sulfhydryl may also be partially or completely substituted by cations. The cation may be any cation, such as a metal cation, an ammonium ion NH4+ or an organic ammonium cation. Further, there may also be a group capable of forming the salt in the delivery group, such as the phosphate group. In order to improve solubility and / or bioavailability, in some embodiments,, the pharmaceutically acceptable salt is a water-soluble salt of part or whole of the single-stranded oligonucleotide, the double-stranded oligonucleotide or the oligonucleotide conjugate. In some embodiments, the water-soluble salt may be an amine salt, an alkali metal salt or an alkaline earth metal salt. In some embodiments, the amine salt is selected from one or more of an ammonium salt, a methylamine salt, a tertiary amine salt and a quaternary ammonium salt, the alkali metal salt is selected from a potassium salt or a sodium salt, and the alkaline earth metal salt is selected from a magnesium salt or a calcium salt. In some embodiments, the tertiary amine salt is a triethylamine salt, a triisopropylamine salt or anN, N-diisopropylethylamine salt. In some embodiments, the pharmaceutically acceptable salt is a salt or partial salt of the single-stranded oligonucleotide, the double-stranded oligonucleotide or the oligonucleotide conjugate, and the salt is one or more of the methylamine salt, the triethylamine salt or the sodium salt. In some embodiments, the pharmaceutically acceptable salt of the single-stranded oligonucleotide, the double- stranded oligonucleotide or the oligonucleotide conjugate is a sodium salt or partial sodium salt of the single-stranded oligonucleotide, the double-stranded oligonucleotide or the oligonucleotide conjugate. In some embodiments, the pharmaceutically acceptable salt of the single-stranded oligonucleotide, the double-stranded oligonucleotide or the oligonucleotide conjugate is a mixture of the methylamine salt and the ammonium salt of the single-stranded oligonucleotide, the double-stranded oligonucleotide or the oligonucleotide conjugate.Pharmaceutical compositionIn another aspect, the present disclosure further provides a pharmaceutical composition, wherein the pharmaceutical composition contains one or more of the single-stranded oligonucleotide, the double-stranded oligonucleotide, the oligonucleotide conjugate and the pharmaceutically acceptable salt thereof provided by the present disclosure, and a pharmaceutically acceptable excipient.The pharmaceutically acceptable excipient is one or more of various components commonly used in the art, such as one or more of a solvent, a protectant, an osmotic pressure regulator and other pharmaceutically acceptable carriers.For example, when the pharmaceutical composition is an injection, the pharmaceutically acceptable excipient is the solvent, such as deionized water, water for injection, physiologicalsaline, ethanol, an ethanol aqueous solution or a pH buffer. The pH buffer may be a tris(hydroxymethyl)aminomethane hydrochloride buffer with a pH value of 7.5-8.5 and / or a phosphate buffer with a pH value of 5.5-8.5, for example, the pH buffer may be the phosphate buffer with the pH value of 5.5 -8.5.Amount of the solvent is regulated according to a required solution concentration, and a concentration of the oligonucleotide conjugate in the injection may be 0.01 mg / mL-20 mg / mL, 0.1 mg / mL-10 mg / mL / or 0.5 mg / mL-5 mg / mL based on the oligonucleotide group.The protectant may be at least one of inositol, sorbitol, sucrose, trehalose, mannose, maltose, lactose and glucose. Based on a total weight of the pharmaceutical composition, a content of the protectant may be 0.01-30 wt%.The osmotic pressure regulator may be sodium chloride and / or potassium chloride. A content of the osmotic pressure regulator enables an osmotic pressure of the pharmaceutical composition to be 200-700 milliosmoles per kilogram (mOsm / kg). According to the required osmotic pressure, those skilled in the art can easily determine the content of the osmotic pressure regulator. In some embodiments, a dosage of a formulation made of the pharmaceutical composition may be regulated due to different administration routes in an administration process.In some embodiments, the pharmaceutical composition may be a liquid formulation, such as an injection; or may be a freeze-dried powder for injection, which is mixed with a liquid ingredientto prepare the liquid formulation during administration. The administration routes of the liquid formulation comprise, but are not limited to, subcutaneous injection administration, intramuscular injection administration and intravenous injection administration, and the administration routes of the pharmaceutical composition also comprise, but are not limited to, pulmonary administration to lung, pulmonary administration through lung to other organ tissues (such as liver), oral administration, and the like. In some embodiments, the pharmaceutical composition is administered by subcutaneous injection.The other pharmaceutically acceptable carriers may be carriers conventionally used in the field of single-stranded oligonucleotide or double-stranded oligonucleotide administration, comprising, but being not limited to, one or more of magnetic nanoparticles (such as Fe3O4 or Fe2O3-based nanoparticles), carbon nanotubes, mesoporous silicon, calcium phosphate nanoparticles, polyethylenimine (PEI), polyamidoamine (PAMAM) dendrimer, poly(L-lysine) (PLL), chitosan, l,2-dioleoyl-3-trimethylammonium-propane (DOTAP), poly(D& L-lactic / glycolic acid) copolymer (PLGA), poly(2-aminoethyl ethylene phosphate) (PPEEA), poly(2-dimethylaminoethyl methacrylate) (PDMAEMA), and derivatives thereof.In some embodiments, in the pharmaceutical composition, there is no special requirement on contents of the single-stranded oligonucleotide or the double-stranded oligonucleotide and the pharmaceutically acceptable carrier. In some embodiments, a weight ratio of the single-stranded oligonucleotide or the double-stranded oligonucleotide to the pharmaceutically acceptable carrier may be 1: (1-500), and in some embodiments, the above weight ratio is 1: (1-50).In some embodiments, the pharmaceutical composition may be in a form of a liposome formulation. In some embodiments, the pharmaceutically acceptable carrier used in the liposome formulation comprises an amine-containing transfection compound (hereinafter also referred to as an organic amine), a helper lipid and / or a pegylated lipid. The organic amine, the helper lipid and the pegylated lipid may be respectively selected from one or more of the amine-containing transfection compounds or the pharmaceutically acceptable salts or derivatives thereof, the helper lipids and the pegylated lipids as described in CN103380113A (which is incorporated herein by reference in its entirety).In some embodiments, the organic amine may be a compound as shown in Formula (201) as described in the Chinese patent application CN103380113A or a pharmaceutically acceptable salt thereof:xFormula (201),wherein:X101 or X102 is independently O, S, N-A or C-A, wherein A is hydrogen or a C1-C20 hydrocarbon chain;Y101 orZioi is respectively independently C=O, C=S, S=O, CH-OH or SO2;each of R101, R102, R103, R104, Rios, Rioe and R107 is respectively independently hydrogen; a cyclic or acyclic, substituted or unsubstituted, and branched or straight aliphatic group; a cyclic or acyclic, substituted or unsubstituted, and branched or straight heteroaliphatic group; substituted or unsubstituted, and branched or straight acyl; substituted or unsubstituted, and branched or straight aryl, or substituted or unsubstituted, and branched or straight heteroaryl;x is an integer of 1-10;n is an integer of 1-3, m is an integer of 0-20, and p is 0 or 1, wherein if m=p=0, then R102 is hydrogen;and, if at least one of n or m is 2, then R103 and the nitrogen in Formula (201) form a structure as shown in Formula (202) or (203):rFormula (202), Formula (203); wherein, each of g, e and f is respectively independently an integer of 1-6, “HCC” represents a hydrocarbon chain, and each *N represents a nitrogen atom as shown in Formula (201).In some embodiments, the R103 is polyamine. In other embodiments, the R103 is ketal. In some embodiments, each of Rioi and R102 in the Formula (201) is independently any substituted or unsubstituted, and branched or straight alkyl or alkenyl, wherein the alkyl or alkenyl has 3 to about 20 carbon atoms, such as 8 to about 18 carbon atoms, and 0 to 4 double bonds, such as 0 to2 double bonds.In some embodiments, if each of n and m is independently 1-3, the R103 may be any one in the following Formula (204)-Formula (213):Formula (211),Formulawherein, in Formula (204)-Formula (213), each of g, e and f is respectively independently an integer of 1-6; each “HCC” represents a hydrocarbon chain, and each * represents a potential linking point of R103 to the nitrogen atom in Formula (201), wherein each H at any * position may be substituted to realize the linkage to the nitrogen atom in Formula (201).Those skilled in the art can obtain the compound as shown in Formula (201) by any reasonable method. In some embodiments, the compound as shown in Formula (201) may be prepared as described in the Chinese patent application CN103380113A.In some embodiments, the organic amine may be an organic amine as shown in Formula (214) and / or an organic amine as shown in Formula (215):the helper lipid is cholesterol, a cholesterol analogue and / or a cholesterol derivative; and the pegylated lipid is 1,2-dipalmitoyl-sn-glycero-3-phosphatidylethanolamine-N-[methoxy(polyethylene glycol)]-2000.In some embodiments, a molar ratio among the organic amine, the helper lipid and the pegylated lipid in the pharmaceutical composition is (19.7-80): (19.7-80): (0.3-50); for example, the molar ratio may be (50-70): (20-40): (3-20).In some embodiments, particles of the pharmaceutical composition formed by the singlestranded oligonucleotide or the double-stranded oligonucleotide of the present disclosure and the above amine-containing transfection reagent have an average diameter from about 30 nm to about 200 nm, typically from about 40 nm to about 135 nm, and more typically, the average diameter of the liposome particles is from about 50 nm to about 120 nm, from about 50 nm to about 100 nm, from about 60 nm to about 90 nm, or from about 70 nm to about 90 nm, for example, the average diameter of the liposome particles is about 30, 40, 50, 60, 70, 75, 80, 85, 90, 100, 110, 120, 130, 140, 150 or 160 nm.In some embodiments, in the pharmaceutical composition formed by the single-stranded oligonucleotide or the double-stranded oligonucleotide of the present disclosure and the above amine-containing transfection reagent, a weight ratio (weight / weight ratio) of the single-stranded oligonucleotide or the double-stranded oligonucleotide to total lipids (for example, the organic amines, helper lipids and / or pegylated lipids) ranges from about 1:1 to about 1: 50, from about 1: 1 to about 1: 30, from about 1: 3 to about 1: 20, from about 1:4 to about 1: 18, from about 1: 5 toabout 1: 17, from about 1: 5 to about 1: 15, from about 1: 5 to about 1: 12, from about 1: 6 to about 1: 12, or from about 1: 6 to about 1: 10. For example, the weight ratio of the single-stranded oligonucleotide or the double-stranded oligonucleotide of the present disclosure to total lipids is about 1: 5, 1: 6, 1: 7, 1: 8, 1: 9, 1: 10, 1: 11, 1: 12, 1: 13, 1: 14, 1: 15, 1: 16, 1: 17 or 1: 18.In some embodiments, various components of the pharmaceutical composition may exist independently when sold, and may exist in a form of liquid formulation when used. In some embodiments, the pharmaceutical composition formed by the single-stranded oligonucleotide or the double-stranded oligonucleotide provided by the present disclosure and the above pharmaceutically acceptable carrier may be prepared by various known methods, only by substituting existing single-stranded oligonucleotide or double-stranded oligonucleotide with the single-stranded oligonucleotide or the double-stranded oligonucleotide provided by the present disclosure; and in some embodiments, the pharmaceutical composition may be prepared by the following method.The organic amines, helper lipids and pegylated lipids are suspended in alcohol at the molar ratio as described above and mixed evenly to yield a lipid solution; and the alcohol is used in an amount such that the resultant lipid solution is present at a total mass concentration of 2-25 mg / mL, such as 8-18 mg / mL. The alcohol is a pharmaceutically acceptable alcohol, such as an alcohol that is in liquid form at about room temperature, for example, one or more of ethanol, propylene glycol, benzyl alcohol, glycerol, PEG 200, PEG 300 and PEG 400, such as the ethanol.The single-stranded oligonucleotide or the double-stranded oligonucleotide provided by the present disclosure is dissolved in a buffered salt solution to obtain a single-stranded oligonucleotide aqueous solution or a double-stranded oligonucleotide aqueous solution. The buffered salt solution has a concentration of 0.05-0.5 M, such as 0.1-0.2 M, the pH of the buffered salt solution is regulated to 4.0-5.5, such as 5.0-5.2, and the buffered salt solution is used in an amount such that the single-stranded oligonucleotide or the double-stranded oligonucleotide is present at a concentration less than 0.6 mg / mL, such as 0.2-0.4 mg / mL. The buffered salt is selected from one or more of soluble acetate and soluble citrate, such as sodium acetate and / or potassium acetate.The lipid solution and the single-stranded oligonucleotide or double-stranded oligonucleotide aqueous solution are mixed, and the product obtained after mixing is incubated at a temperature of 40-60°C for at least 2 minutes, such as 5-30 minutes, to produce an incubated lipid formulation. A volume ratio of the lipid solution to the single-stranded oligonucleotide or double-stranded oligonucleotide aqueous solution is 1: (2-5), such as 1: 4.The incubated liposome formulation is concentrated or diluted, purified to remove impurities,and then sterilized to obtain the pharmaceutical composition provided by the present disclosure, which has physicochemical parameters as follows: a pH value of 6.5-8, an encapsulation percentage not lower than 80%, a particle size of 40-200 nm, a polydispersity index not higher than 0.30, and an osmotic pressure of 250-400 mOsm / kg; for example, the physicochemical parameters may be as follows: a pH value of 7.2-7.6, an encapsulation percentage not lower than 90%, a particle size of 60-100 nm, a polydispersity index not higher than 0.20, and an osmotic pressure of 300-400 mOsm / kg.The concentration or dilution step may be performed before, after or simultaneously with the step of impurity removal. The method for removing impurities may be any one of various existing methods, such as ultrafiltration under 100 KDa by using a tangential flow system and a hollow fiber column, wherein an ultrafiltration exchange solution is a phosphate buffer solution (PBS) at pH 7.4. The method for sterilization may be any one of various existing methods, such as filtration sterilization on a 0.22 pm filter.Use of single-stranded oligonucleotide, double-stranded oligonucleotide, oligonucleotide conjugate, pharmaceutically acceptable salt and pharmaceutical composition in the present disclosureThe present disclosure further provides use of one or more of the single-stranded oligonucleotide of the present disclosure, the double-stranded oligonucleotide of the present disclosure, the oligonucleotide conjugate of the present disclosure, the pharmaceutically acceptable salt thereof, and the pharmaceutical composition of the present disclosure in preparation of a medicament for treating and / or preventing a disease or symptom related to a level of the Lp(a) mRNA. In some embodiments, the disease or symptom related to the level of the Lp(a) mRNA is a disease or symptom related to the Lp(a) protein; or, the disease or symptom related to the Lp(a) protein is a hepatogenic disease, inflammation, a cardiovascular and cerebrovascular disease, myocardial infarction or a metabolic disease; or, the cardiovascular and cerebrovascular disease is selected from hyperlipidemia, stroke, atherosclerosis, thrombosis, a coronary heart disease, cardiac apoplexy, cerebral apoplexy, heart failure, a lower extremity arterial disease, coronary artery stenosis, carotid artery stenosis, femoral artery stenosis or aortic valve stenosis.The present disclosure further provides a method for treating and / or preventing a disease or symptom related to a level of the Lp(a) mRNA, wherein the method comprises administering an effective amount of one or more of the single-stranded oligonucleotide, the double-stranded oligonucleotide, the oligonucleotide conjugate and the pharmaceutically acceptable salt thereof, and the pharmaceutical composition in the present disclosure to asubject in need.In addition, the present disclosure further provides a method for regulating an expression level of the Lp(a) mRNA in a cell, wherein the method comprises contacting an effective amount of one or more of the single-stranded oligonucleotide, the double-stranded oligonucleotide, the oligonucleotide conjugate and the pharmaceutically acceptable salt thereof, and the pharmaceutical composition in the present disclosure with the cell.As used herein, the term “administered / given” refers to placing one or more of the singlestranded oligonucleotide, the double-stranded oligonucleotide and the pharmaceutically acceptable salt thereof, the pharmaceutical composition and the oligonucleotide conjugate into the body of the subject by a method or way of at least partially locating the single-stranded oligonucleotide, the double-stranded oligonucleotide and the pharmaceutically acceptable salt thereof, the pharmaceutical composition and the oligonucleotide conjugate at a desired site to produce a desired effect. The administration routes suitable for the method of the present disclosure comprise local administration and systemic administration. In general, the local administration leads to a larger amount of delivery of one or more of the single-stranded oligonucleotide, the double-stranded oligonucleotide and the pharmaceutically acceptable salt thereof, the pharmaceutical composition, and the oligonucleotide conjugate and the pharmaceutically acceptable salt thereof to a specific site than that to entire body of the subject; while the systemic administration leads to delivery of one of more of the single-stranded oligonucleotide, the double-stranded oligonucleotide and the pharmaceutically acceptable salt thereof, the pharmaceutical composition and the oligonucleotide conjugate to substantially entire body of the subject.The drug may be administered to the subject by any suitable route known in the art, comprising, but being not limited to: oral or parenteral routes, such as intravenous administration, intramuscular administration, subcutaneous administration, transdermal administration, airway administration (aerosol), pulmonary administration, nasal administration, rectal administration and local administration (comprising oral administration and sublingual administration). An administration frequency may be once or multiple times every day, every week, every two weeks, every three weeks, every month or every year.A dosage of one or more of the single-stranded oligonucleotide, the double-stranded oligonucleotide, the oligonucleotide conjugate, the pharmaceutically acceptable salt and the pharmaceutical composition in the present disclosure may be a conventional dosage in the art, and the dosage may be determined according to various parameters, especially the age, weight and sex of the subject. Toxicity and efficacy may be determined by standard pharmaceuticalprocedures in cell culture or experimental animals, for example, LD50 (the lethal dose that causes 50% population death) and ED50 (the dose that can cause 50% of the maximum response intensity in a quantitative response, and that causes 50% of the experimental subjects to have a positive response in a qualitative response) are determined. The dose range for human may be derived based on the data obtained from cell culture analysis and animal studies.In some embodiments, the oligonucleotide provided by the present disclosure is the siRNA. When the siRNA, the pharmaceutical composition and / or the siRNA conjugate described in the present disclosure is administered, for example, for C57BL / 6J or C3H / HeNCrlVr mice, male or female, 6-12 weeks old and weighing 18-25 g, on the basis of an amount of siRNA in the siRNA, the pharmaceutical composition and / or the siRNA conjugate: for the siRNA conjugate formed by the siRNA and a pharmaceutically acceptable conjugate molecule, the amount of the siRNA may be 0.001-100 mg / kg body weight; in some embodiments, the amount of the siRNA is 0.01-50 mg / kg body weight. In further embodiments, the amount of the siRNA is 0.05-20 mg / kg body weight. In still further embodiments, the amount of the siRNA is 0.1-15 mg / kg body weight In still further embodiments, the amount of the siRNA is 0.1-10 mg / kg body weight. When the siRNA, the pharmaceutical composition and / or the siRNA conjugate described in the present disclosure is administered, the above amount may be preferred.When the method provided by the present disclosure is used to inhibit the expression of the Lp(a) mRNA in the cell, the amount of the double-stranded oligonucleotide in the single-stranded oligonucleotide, the double-stranded oligonucleotide and the pharmaceutically acceptable salt thereof, the pharmaceutical composition and / or the oligonucleotide conjugate provided may be easily determined by those skilled in the art according to a desired effect. For example, in some embodiments, the oligonucleotide conjugate is the siRNA conjugate, and the amount of the siRNA in the siRNA conjugate provided is an amount sufficient to reduce the level of the Lp(a) mRNA, and result in an extracellular concentration of 1 pM to 1 pM, or 0.01 nM to 100 nM, or 0.05 nM to 50 nM or to about 5 nM at a surface of a target cell. An amount required to achieve this local concentration will vary with various factors, and the factors comprise a delivery method, a delivery site, the number of cell layers between the delivery site and the target cell or tissue, a case whether the delivery is local or systemic, and the like. The concentration at the delivery site may be significantly higher than that at the surface of the target cell or tissue.KitThe present disclosure provides a kit, wherein the kit contains one or more of the singlestranded oligonucleotide, the double-stranded oligonucleotide, the oligonucleotide conjugate and the pharmaceutically acceptable salt thereof, and the pharmaceutical composition provided by thepresent disclosure.In some embodiments, the kit as described herein may provide one or more of the singlestranded oligonucleotide, the double-stranded oligonucleotide, the oligonucleotide conjugate and the pharmaceutically acceptable salt thereof, and the pharmaceutical composition in the present disclosure in a container. In some embodiments, the kit as described herein may comprise a container for providing a pharmaceutically acceptable excipient. In some embodiments, the kit may further comprise other components, such as a stabilizer or a preservative. In some embodiments, the kit as described herein may comprise at least one other therapeutic agent in a container other than the container providing the single-stranded oligonucleotide, the doublestranded oligonucleotide and the pharmaceutically acceptable salt thereof, the pharmaceutical composition and / or the conjugate as described herein.In some embodiments, the kit may comprise an instruction for mixing one or more of the single-stranded oligonucleotide, the double-stranded oligonucleotide, the oligonucleotide conjugate and the pharmaceutically acceptable salt thereof, and the pharmaceutical composition in the present disclosure with the pharmaceutically acceptable carrier and / or excipient or other components (if any).In the kit of the present disclosure, one or more of the single-stranded oligonucleotide, the double-stranded oligonucleotide, the oligonucleotide conjugate, the pharmaceutically acceptable salt and the pharmaceutical composition, and the pharmaceutically acceptable excipient may be provided in any form, such as a liquid form, a dry form or a freeze-dried form. In some embodiments, one or more of the single-stranded oligonucleotide, the double-stranded oligonucleotide, the oligonucleotide conjugate, the pharmaceutically acceptable salt and the pharmaceutical composition, and the optional pharmaceutically acceptable excipient are substantially pure and / or sterile. In some embodiments, the kit of the present disclosure provides sterile water.The present disclosure will be further described hereinafter with reference to examples, but the present disclosure is not limited thereto in any respect.Without expecting limitations, the present disclosure is further described in detail hereinafter in the following embodiments and examples concerning exemplary embodiments in which the pharmaceutical composition, the oligonucleotide and / or the double-stranded oligonucleotide in the oligonucleotide conjugate of the present disclosure is the small interfering RNA (siRNA). In this case, the double-stranded oligonucleotide, the pharmaceutical composition and the oligonucleotide conjugate of the present disclosure are respectively the siRNA, the pharmaceutical composition containing the siRNA and the siRNA conjugate. In the context of thepresent disclosure, for convenience of description, the siRNA, the pharmaceutical composition containing the siRNA and the siRNA conjugate in these embodiments are also referred to as the siRNA of the present disclosure, the pharmaceutical composition of the present disclosure and the siRNA conjugate of the present disclosure, which does not mean that the double-stranded oligonucleotide of the present disclosure can only be the siRNA, and on the contrary, the doublestranded oligonucleotide may be other variants disclosed herein or known to those skilled in the art, such as a small activated RNA (saRNA). It is envisagable that, based on the detailed description of the siRNA, the pharmaceutical composition containing the siRNA and the siRNA conjugate, other double-stranded oligonucleotides will play a similar role when used alone or when forming the pharmaceutical composition and / or the oligonucleotide conjugate in the present disclosure.EXAMPLESUnless otherwise specified, all of the agents and culture media used in the following examples are commercially available, and all of the procedures used such as nucleic acid electrophoresis and real-time PCR are performed according to methods described in Molecular Cloning (Cold Spring Harbor Laboratory (1989)).Preparation Examples 1 and 2: Synthesis of siRNA conjugate provided by the present disclosure Conjugates 1-2 in Table 2 below were prepared according to the preparation method described in Preparation Example 13 of CN110959011 A, and the only difference was that a sense strand and an anti-sense strand of a siRNA in each siRNA conjugate were respectively as shown in Table 2. When a nucleotide sequence had sequences of the sense strand and the anti-sense strand of the siRNA in the conjugates 1-2 numbered in Table 2 below, nucleoside phosphoramidite monomers were linked one by one to synthesize the sense strand and the anti-sense strand of the siRNA conjugate. After synthesis, desalination and purification were performed by centrifugal ultrafiltration with a 3K(MWCO) ultrafiltration tube.The conjugates 1-2 were mixtures of a methylamine salt and an ammonium salt of a compound with a structure as shown in Formula (403), wherein a P atom as shown in Formula (403) was covalently linked via a covalent bond to an oxygen atom linked to a ribose ring via methylene in an inverted abasic deoxynucleotide (ia) as shown in Formula (35) at a 3’ terminal of the sense strand of the siRNA represented by Nu, so as to be covalently linked to the sense strand of the siRNA. Moreover, the siRNA contained in the siRNA conjugate has a siRNA sequence corresponding to the conjugates 1-2 in Table 2.Formula (403)Each siRNA conjugate was diluted to a concentration of 0.2 mg / mL (on the basis of an amount of siRNA) with ultra-pure water (Milli-Q ultra-pure water meter, electrical resistivity 18.2 MQ*cm (25°C)), and then subjected to molecular weight detection by Liquid Chromatography-Mass Spectrometry (LC-MS, purchased from Waters Company, model: LCT Premier). Regarding the conjugate 1: a theoretical value of the sense strand was 7359.306 and a measured value of the sense strand was 7356.81, and a theoretical value of the anti-sense strand was 7070.757 and a measured value of the anti-sense strand was 7068.35. Regarding the conjugate 2: a theoretical value of the sense strand was 7326.324 and a measured value of the sense strand was 7323.86, and a theoretical value of the anti-sense strand was 7065.682 and a measured value the anti-sense strand was 7063.22. Since the measured values were consistent with the theoretical values, it was indicated that the conjugates 1-2 contained double-stranded nucleic acid sequences in object design.Table 2. siRNA sequences in siRNA conjugatesPreparation Conjugate SEQ ID Sequence direction from 5’ to 3’example No. No. NO GmsGmsCmAmGmCmUfCmCfUmUmASense strand 9 Preparation mUmUmGmUmUmAmiaConjugate 1Example 1 Anti-sense VPAmsUfsAmAmCfAmAfUmAmAmG10 strand mGfAmdGCmUfGmCmCmsAmsCm GmsCmsAmCmAmUmAfCmUfUmCmASense strand 11 Preparation mUmUmAmCmUmGmiaConjugate 2Example 2 Anti-sense VPAmsCfsAmGmUfAmAfUmGmAmA12 strand mGfUmdAUmGfUmGmCmsCmsUm GmsGmsCmAmGmCmUfCmCfUmUmAmUmSense strand 9 Preparation UmGmUmUmAmiaConjugate 3Example 3 Anti-sense VPAm sUf s Am Am Cf Am AfUm Am Am Gm Gf A10 strand mdGCmUfGmCmCmsAmsCmGm s Cm s Am Cm AmUm AfCmUfUm Cm AmUmSense strand 11 Preparation UmAmCmUmGmiaConjugate 4Example 4 Anti-sense VPAm s Cfs Am GmUf Am AfUm Gm Am Am GfU12 strand mdAUmGfUmGmCmsCmsUm CmsCmsCmUmAmUmUfCfUfCmCmU Comparative Sense strand 13 Reference mUmCmUmUmCmGmCmPreparationconjugate 1 Anti-sense GmsCfsGmAmAmGfAmAmGmGmAm Example 1 14 strand GmAmAfUmAfGmGmGmsAmsUm UmsUmsCmUmCmCmGfAfAfCmGmU Comparative Sense strand 15 Reference mGmUmCmAmCmGmUmPreparationconjugate 2 Anti-sense AmsCfsGmUmGmAfCmAmCmGmUmU Example 2 16strand mCmGfGmAfGmAmAmsCmsUmwherein, capital letters C, G, U and A indicate the base composition of the nucleotides; a lowercase letter m indicates that one nucleotide represented by the capital letter adjacent to the left side of the letter m is a 2’ -methoxy modified nucleotide; a lowercase letter f indicates that one nucleotide represented by the capital letter adjacent to the left side of the letter f is a 2 ’-fluoro modified nucleotide; a lowercase letter s indicates that two nucleotides represented by the capital letters adjacent to the left and right sides of the letter are linked by a phosphorothioate group; a lowercase letter d indicates that one nucleotide represented by the capital letter adjacent to the right side of the letter is a deoxynucleotide; a letter combination VP indicates that one nucleotide represented by the capital letter adjacent to the right side of the letter combination is a 5 ’-(E)-vinylphosphate (E-VP) modified nucleotide; and ia indicates the inversed abasic deoxynucleotide.Comparative Preparation Examples 1 and 2: Synthesis of reference conjugates 1-2 According to the same method as in Preparation Example 1, the reference conjugates 1-2 in Table 2 were prepared by solid-phase synthesis. The reference conjugates 1-2 were mixtures of a methylamine salt and an ammonium salt of a compound with a structure as shown in Formula(403), wherein a conjugating group was linked to a 3’ position of ribose in a nucleotide at a 3’ terminal of a sense strand of a siRNA represented by Nu. Moreover, the siRNA contained in the reference siRNA conjugates 1-2 had a siRNA sequence corresponding to the reference conjugates 1-2 in Table 2.Preparation Examples 3 and 4: Synthesis of siRNA conjugates 3-4 provided by the present disclosureAccording to the same method as in Preparation Example 1, the conjugates 3-4 were prepared by solid-phase synthesis. The difference was that: after the synthesis, the conjugates 3-4 were subjected to ion purification with a self-packed column having a sourcel5Q strong anion exchange filler, and then subjected to desalting purification with a pre-packed column having HiPrep 26 / 10 Desalting. The conjugates 3-4 were sodium salts of a compound with a structure as shown in Formula (403). The conjugate 3 and the conjugate 1 had the same sense strand and antisense strand sequences of the siRNA as shown in Table 2, and the same structure as shown in Formula (403); and the conjugate 4 and the conjugate 2 had the same sense strand and anti-sense strand sequences of the siRNA as shown in Table 2, and the same structure as shown in Formula (403).Comparative Preparation Examples 3: Synthesis of reference conjugate 3 According to the same method as in Preparation Example 1, by taking a phosphoramidite intermediate (CAS: 2130036-52-9) as shown in Formula (404b) as a raw material, the reference conjugate 3 was prepared by solid-phase synthesis.o Formula (404b)After the synthesis, the conjugate was subjected to ion purification with a self-packed column having a sourcel5Q strong anion exchange filler, and then subjected to desalting purification with a pre-packed column having HiPrep 26 / 10 Desalting.The reference conjugate 3 was a sodium salt of a compound with a structure as shown in Formula (404a),Formula (404a)wherein, a conjugating group in Formula (404a) was linked to a 5’ position of ribose in a nucleotide at a 5’ terminal of an anti-sense strand of a siRNA represented by Nu, the Nu represents the siRNA contained in the reference conjugate 3, and the sense strand and the anti-sense strand of the siRNA had sequences as shown in SEQ ID NO: 21 and SEQ ID NO: 22 respectively. CmsAmGmCmCmCmCmUmUfAfUfUmGmUmUmAmUmAmCmGmsia (SEQ ID NO: 21); UmsCfsGmUfAmUfAmAmCmAmAmUfAmAfGmGfGmGfCmsUfsGm (SEQ ID NO: 22).The synthesized siRNA conjugate was diluted to a concentration of 0.2 mg / mL (on the basis of an amount of siRNA) with ultra-pure water (Milli-Q ultra-pure water meter, electrical resistivity 18.2 MQ*cm (25°C)), and then subjected to molecular weight detection by Liquid Chromatography -Mass Spectrometry (LC-MS, purchased from Agilent Company, model: 1290-6135B). According to results, a theoretical value of the sense strand was 8416.123 and a measured value of the sense strand was 8415.23, and a theoretical value of the anti-sense strand was 7022.651 and a measured value of the anti-sense strand was 7021.67. Since the measured values were consistent with the theoretical values, it was indicated that the synthesized reference conjugate 3 contained a double-stranded nucleic acid sequence and a conjugate structure in object design. The reference conjugate 3 was a known siRNA conjugate targeting Lp(a).Comparative Preparation Examples 4: Synthesis of reference conjugate 4 According to the same method as in Preparation Example 1, the reference conjugate 4 was prepared. The only difference was that: the sense strand and the anti-sense strand of the siRNA contained in the reference conjugate 4 had sequences as shown in SEQ ID NO: 23 and SEQ ID NO: 24 respectively, which were specifically as follows:UmsUmGmCmCmAmAmGfCfUfUfGmGmUmCmAmUmCmUmAmGmCmAmGmCmCmGm (A-GalNAc)(A-GalNAc)(A-GalNAc)GmGmCmUmGmCm(SEQ ID NO: 23);(MePhosphonate-40- Um)sAfsGfsAfUfGmAfCmCmAfAmGmCmUfUmGmGmCmAmAmsGmsGm(SEQ ID NO: 24).wherein, nucleotides modified in 28th, 29thand 30thpositions at the 5’ terminal of the sense strand were A-GalNAc, and a structure of the A-GalNAc was as shown in Formula (405a). By taking commercially available phosphoramidite as shown in Formula (405b) as a raw material, the sense strand was prepared by linking corresponding RNA phosphoramidites one by one according to the sequence as shown in SEQ ID NO: 23 through solid-phase synthesis.Formula (405a) wherein, n xr represented a site where the group was linked via a covalent bond;The modified nucleotide used in the 1stposition of the 5' terminal of the anti-sense strand was MePhosphonate-4O-mU (or called 5 ’-methoxyphosphonate-4’ -oxy-2’ -O-methyluri dine), and had a structure as shown in Formula (406a). By taking commercially available phosphoramidite as shown in Formula (406b) as a raw material, the anti-sense strand was also prepared through solid-phase synthesis.Formula (406b), wherein, n xr represented a site where the group was linked via a covalent bond.After the synthesis, the conjugate was subjected to ion purification with a self-packed column having a sourcel5Q strong anion exchange filler, and then subjected to desalting purification with a pre-packed column having HiPrep 26 / 10 Desalting, so as to obtain the sodium salt of the reference conjugate 4. According to the same method as in Preparation Example 1, molecular weight detection was carried out, and results were as follows: a theoretical value of the sense strand was 13217.132 and a measured value of the sense strand was 13216.62, and a theoretical value of the anti-sense strand was 7503.006 and a measured value of the anti-sense strand was 7502.67. Since the measured values were consistent with the theoretical values, it was indicated that the synthesized reference conjugate 4 contained a double-stranded nucleic acid sequence and a conjugate structure in object design.Experimental Example 1: In-vitro inhibitory activity of conjugate of the present disclosure Experimental Example 1-1: Inhibitory activity of transfected siRNA conjugate in monkey primary hepatocytesIn this example, the conjugates prepared in the preparation examples were transfected into the monkey primary hepatocytes with a Lipofectamine™ 2000 transfection reagent, and final concentrations of each conjugate were 50 nM and 1 nM (on the basis of an amount of siRNA). Each conjugate was transfected into cells in 2 wells, and cells without treatment by any conjugate were used as blank control. After the transfection for 24 hours, a RNA of the cells was harvested, and an expression quantity of LPA mRNA of a target gene in the monkey primary hepatocytes transfected with each conjugate was detected by a real-time fluorescence quantitative PCR method, which was specifically operated as follows.The monkey primary hepatocytes were purchased from Milecell Biotechnologies (article number: CCH-100YS-PQ), and according to supporting media and reagents provided by thecompany, cell thawing was carried out according to the instruction. 120 mL of thawing medium (article number: HTS-R-120) was preheated at 37°C, a cell-containing cryovial was placed in water bath at 37°C and gently shaken until the cells were melted into some ice crystals, a cell liquid was poured into the preheated thawing medium, the cryovial was rinsed, and a cell suspension was mixed evenly. The cell suspension was centrifuged at room temperature and 800 rpm for 5 minutes, a supernatant was discarded, 20 mL of plating medium (article number: HPM-R-120) was added to resuspend the cells, and the cells were counted and then plated.The cells were diluted to 1 x 105cells / mL (counted as viable cells) with the plating medium, and 1 mL of cell liquid was added into each hole of a 12-well plate, shaken evenly and placed in an incubator containing 5% CO2 / 95% air at 37°C for culture. After cell adherence overnight, the plating medium was sucked and discarded, and 1 mL of maintenance medium (article number: HMM-R-120) was added into each well, and placed in an incubator containing 5% CO2 / 95% air at 37°C for transfection.For each conjugate to be tested, a conjugate stock solution of 10 pM (on the basis of an amount of siRNA in the conjugate) was prepared with 1*PBS.Preparation of 2A solution: the above conjugate stock solution was diluted into conjugate working solutions of 0.6 pM and 0.012 pM with an Opti-MEM medium, and each 2A solution was 100 pL.Preparation of 2B solution: each 2B solution contained 2 pL of Lipofectamine™ 2000 (purchased from Thermo Fisher Company, article number: 11668-019) and 98 pL of Opti-MEM medium. The mixture was mixed evenly, and then allowed to stand at room temperature for 5 minutes.For each conjugate to be tested, one part of 2B solution and one part of 2A solution were mixed respectively, and the mixture was incubated at room temperature for 20 minutes to obtain a transfection complex 2X. 2 parts of each transfection complex were prepared and used to transfect the cells in two wells. The culture wells (both of which were the above culture cells containing the monkey primary hepatocytes and 1 mL of maintenance medium, the same below) were added with the transfection complex 2X of each conjugate respectively and mixed evenly according to an addition amount of 200 pL / well to obtain transfection mixtures with final concentrations of 50 nM and 1 nM (on the basis of an amount of siRNA), which were recorded as a test group.200 pL of Opti-MEM medium was used as a blank transfection mixture 2X’. 2 parts of each2X’ were prepared and added into the cells in two wells. The other two culture wells were added with 1 part of blank transfection mixture 2X’ respectively according to an addition amount of 200 pL / well to obtain transfection mixtures without the conjugate, which were recorded as a blank control group.The 12-well plate was placed in an incubator containing 5% CO2 / 95% air and continuously cultured at 37°C for 24 hours. After ending the culture, a total RNA in the cells was extracted with TRIZOL (purchased from SIGMA, article number: T9424) by the method as described in the instruction.0.25 pg of total RNA was taken for the cells in each well respectively, and the extracted total RNA was reversely transcribed into a cDNA by using a Reverse Transcription System reverse transcription kit (purchased from Promega, article number: A3500) according to the instruction to obtain a cDNA-containing solution, wherein GoldenstarTM Oligo (dT)17 was selected as a primer, and 20 pL of reverse transcription reaction system was prepared according to reverse transcription operation steps in the kit instruction, so as to reversely transcribe the total RNA of the cells in each well. Conditions of reverse transcription: the reverse transcription reaction system was incubated at 70°C for 10 minutes, then incubated at 42°C for 30 minutes, and finally incubated at 95°C for 5 minutes, and after the reaction, the reverse transcription reaction system was added with 80 pL of DEPC water to obtain the cDNA-containing solution.5 pL of the above cDNA-containing solution was taken for each reverse transcription reaction system as a template respectively, and 20 pL of qPCR reaction system was prepared with a reagent provided by a TaqMan Fast Advanced Master MIX (2x) kit (purchased from Thermo Fisher, article number: 4444556), wherein sequences of PCR primers for amplifying a target gene Lp(a) and a reference gene cfl-actin were as shown in Table 3, and a final concentration of each primer was 0.25 pM. Each qPCR reaction system was placed on an ABI StepOnePlus Real-Time PCR instrument, and amplified by a three-step method through an amplification procedure of predenaturing at 50°C for 20 seconds, denaturing at 95 °C for 20 seconds, then denaturing at 95 °C for 1 second and annealing / extending at 60°C for 20 seconds, and then repeating the above denaturing and annealing / extending process for 40 times in total, so as to obtain a product W containing the amplified target gene Lp(a) and reference gene cfl-actin. Ct values of the target gene Lp(a) and the reference gene c-flactin were obtained.A comparative Ct(AACt) method was used to perform relative quantitative calculation on the target gene Lp(a) in each test group, and the calculation method was as follows:A ACt (Cttarget gene of test group “ Ctreference gene of test group) “ (Cttarget gene of blank control group “ Ctreference gene of blank control group ) meanRelative expression level = 2-ΔΔCt× 100%mRNA inhibition rate = (blank control group 2-ΔΔCtmean - test group 2-ΔΔCt) / blank control group 2-ΔΔCtmean × 100%Results were as shown in Table 4.Table 3. Sequences of detection primersName of gene Type of primer Nucleotide sequence (5’— >3 ’) SEQ ID NO.Forward primer GTGTCCTCGCAACGTCCA 17 cLp(a)Reverse primer GACCCCGGGGCTTTG 18 Forward primer AAGGCCAACCGCGAGAAG 19cflactinReverse primer AGAGGCGTACAGGGACAGCA 20 Table 4. Inhibition rate of transfected siRNA against Lp(a) mRNA in monkey primary hepatocytesConjugate No. Inhibition rate50 nM 1 nMConjugate 1 81.4% 90.0%Reference conjugate 1 -0.14%Experimental Example 1 and 2: Inhibitory activity of siRNA conjugate in monkey primary hepatocytesThe inhibitory activity of the siRNA conjugate in the monkey primary hepatocytes was detected by the method in the Experimental Example 1-1, and the difference was that the siRNA conjugate in this experimental example was not transfected with the Lipofectamine™ 2000. Experimental results were as shown in Table 5.Table 5. Inhibition rate of untransfected siRNA conjugate against Lp(a) mRNA in monkey primary hepatocytesConjugate No. Inhibition rate50 nM 1 nMConjugate 1 68.5% 24.4%Reference conjugate 2 0It could be seen from Table 4 and Table 5 that both of the transfected siRNA conjugate and the untransfected siRNA conjugate showed high inhibition rates against the Lp(a) mRNA in the monkey primary hepatocytes. Particularly, the inhibition rate of the transfected siRNA conjugate was 81.4% at 50 nM and 90% at 1 nM. The inhibition rate of the untransfected siRNA conjugate was 68.5% at 50 nM.Experimental Example 2: In vivo inhibitory activity of conjugate of the present disclosure The prepared conjugate 3 and conjugate 4 were dissolved into 5.0 mg / mL working solutions with PBS respectively, and then diluted into 0.6 mg / mL and 0.2 mg / mL injections.25 mice (strain: LPApAlb-hLPA-Tg, grade: SPF; sex: male, age: 12-14 weeks, weight: 25±5 g, purchased from Shanghai Model Organisms Center, Inc.) were randomly divided into 5 groups according to 5 mice / group, which were recorded as a test group 1 of 3 mg / kg, a test group 1 of 1 mg / kg, a test group 2 of 3 mg / kg, a test group 2 of 1 mg / kg and a blank control group, each mouse in each test group was administered with an injection of the conjugate 3 or conjugate 4 at a concentration of 0.6 mg / mL or 0.2 mg / mL by subcutaneous abdominal injection according to an injection volume of 5 mL / kg of mouse body weight, and corresponding administration dosages were 3 mg / kg and 1 mg / kg respectively. The mice in the blank control group were administered with a PBS solution according to an administration volume of 5 mL / kg of mouse body weight.An administration time point was taken as day 1, and blood in the mice was collected before administration, on day 8, day 15, day 29, day 43, day 57, day 71, day 86, day 113 and day 141 after administration (the blood collection for the test group 1 of 1 mg / kg and the test group 2 of 1 mg / kg only lasted until day 71). Expression quantities of Apo(a) protein in serums of the mice in the test groups and the blank control group were detected by a Human Lipoprotein A ELISA Kit (article number ab212165) of Abeam according to operations in the instruction, and decrease rates of the expression quantities of the Apo(a) protein in the serums of the mice were obtained by normalizing the quantity of the Apo(a) protein in the serums of the mice before administration and the quantity of the Apo(a) protein in the serum of the mice before administration being calculated as 100%. At different time points after administration, the inhibition rate of Apo(a) protein expression in mice serum is: inhibition rate of Apo(a) protein expression = (1 - Apo(a) protein quantity after administration / Apo(a) protein quantity before administration) x 100%.Results were as shown in Table 6.Table 6. Expression levels of Apo(a) protein of siRNA conjugates in miceInhibition rate %Days Conjugate 3 Conjugate 43 mg / kg 1 mg / kg 3 mg / kg 1 mg / kgDay 8 94.86±1.1 77.32±11.0 81.8±4.82 59.08±7.5 Day 15 93.58±1.2 79.08±6.1 86.62±1.8 65.54±6.0 Day 29 92.68±1.5 79.00±4.2 84.94±2.9 64.34±7.4 Day 43 89.72±3.1 67.92±12.9 75.52±4.8 49.30±20.2Day 57 90.30±1.7 58.48±18.0 78.94±5.9 62.98±12.3Day 71 87.96±2.7 65.30±18.0 69.94±8.5 57.64±10.6Day 86 85.12±2.0 64.12±6.9Day 113 87.88±2.3 65.32±20.9Day 141 74.45±3.449.08±18.4It could be seen from Table 6 that, during a whole experimental period, inhibition rates of the conjugate 3 and the conjugate 4 to the Apo(a) protein remained at a high level all the time. At an administration dosage of 3 mg / kg, the inhibition rate of the conjugate to the Apo(a) protein was 49% or higher, and even at a low administration dosage of 1 mg / kg, the inhibition rate of the conjugate to the Apo(a) protein was still 49% or higher. Particularly, at the administration dosage of 3 mg / kg, the inhibition rate of the conjugate 3 was 85% or higher all the time from day 8 to day 113, and the inhibition rate still remained 74% or higher on day 141. The above results showed that the conjugate of the present disclosure could efficiently maintain an excellent inhibition effect on the Lp(a) mRNA in an animal model for a long term, and then continuously and efficiently inhibit the Apo(a) protein level in serum.Experimental Example 3: In vivo activity test of siRNA conjugates in miceIn this experimental example, in vivo inhibitory effects of the conjugates of the present disclosure in mice were investigated.The same mice and experimental conditions as in Experimental Example 2 were used, with 5 mice in each group. The only difference was that the test conjugates were changed to the conjugate 3 and the reference conjugate 3 at the corresponding administration dosage of 3 mg / kg. An administration time point was taken as day 1, and blood in the mice was collected before administration, on day 8, day 15, day 29, day 43, day 57, day 71 and day 86 after administration. Inhibition rates of expression quantities of Apo(a) protein in serums of the mice were detected by the same detection method as in Experimental Example 2. Results were as shown in Table 8.Table 8. Expression levels of Apo(a) protein of siRNA conjugate and reference conjugate in miceInhibition rate%DaysConjugate 3 Reference conjugate 3Day 8 81.7Day 15 93.6 88.3Day 29 92.7 83.5Day 43 89.7 75.7Day 57 90.3 68.5Day 71 88.0 44.2Day 86 85.1 7.9It could be obviously seen from the experimental data in Table 8 that, during a whole experimental period, compared with the reference conjugate 3, the conjugate 3 showed better activity, stability and long-term effect in inhibiting the Apo(a) protein level in serum. At the administration dosage of 3 mg / kg, the inhibition rate of the reference conjugate 3 against the Apo(a) protein in serum was greatly fluctuated with time and significantly reduced in a later stage of the experiment, such as being reduced from 68.5% on day 57 to 44.2% on day 71 and then to 7.9% on day 86, which was less than 10% of a highest inhibition rate of 88.3%. However, the conjugate 3 showed a more stable and lasting inhibition effect, the inhibition rate was always maintained above 85%, and a difference between a lowest inhibition rate of 85.1% and a highest inhibition rate of 93.6% was only less than 9%. These results clearly showed that, compared with the reference conjugate 3, the conjugate 3 had a stronger, more stable and longer-lasting ability to inhibit the Apo(a) protein level in serum in an animal.Experimental Example 4: In vivo activity test of siRNA conjugates in miceIn this experimental example, in vivo inhibitory effects of the conjugates of the present disclosure in mice were investigated.The same mice and experimental conditions as in Experimental Example 2 were used, with 5 mice in each group. The only difference was that the test conjugates were changed to the conjugate 3 and the reference conjugate 4 at the corresponding administration dosages of 3 mg / kg and 1 mg / kg respectively. An administration time point was taken as day 1, and blood in the mice was collected before administration, on day 15, day 29, day 57 and day 86 after administration. Inhibition rates of expression quantities of Apo(a) protein in serums of the mice were detected by the same detection method as in Experimental Example 2. Results were as shown in Table 9.Table 9. Expression levels of Apo(a) protein of siRNA conjugate and reference conjugate in miceInhibition rate%Days Conjugate 3 Reference conjugate 43 mg / kg 1 mg / kg 3 mg / kg 1 mg / kgDay 15 99.3 94.5 96.4 77.3 Day 29 96.9 91.4 85.7 49.9 Day 57 92.9 74.1 45.7 30.8Day 86 84.5 65.0 32.5 20.6It could be obviously seen from the experimental data in Table 9 that, during a whole experimental period, compared with the reference conjugate 4, the conjugate 3 had better activity, stability and long-term effect in inhibiting the Apo(a) protein level in serum. At the administration dosage of 3 mg / kg, the inhibition rate of the reference conjugate 3 to the Apo(a) protein in serum was greatly fluctuated with time and significantly reduced in a later stage of the experiment, such as being reduced from 85.7% on day 29 to 45.7% on day 57 and then to 32.5% on day 86, which was only 1 / 3 of a highest inhibition rate of 96.4%. However, the conjugate 3 showed a more stable and lasting inhibition effect, the inhibition rate was always maintained 84% or higher, and a difference between a lowest inhibition rate of 84.5% and a highest inhibition rate of 99.3% was only less than 15%. At the administration dosage of 1 mg / kg, the inhibition rate of the reference conjugate 3 to the Apo(a) protein in serum was also greatly fluctuated with time and significantly reduced in the later stage of the experiment. However, the conjugate 3 showed a more stable and lasting inhibition effect. These experiment results clearly verified that, the conjugate 3 had a stronger, more stable and longer-lasting ability to inhibit the Apo(a) protein level in serum in an animal.Some embodiments of the present disclosure are described in detail above, but the present disclosure is not limited to the specific details in the above embodiments. Within the technical concept of the present disclosure, the technical solutions of the present disclosure may have many simple modifications, and these simple modifications all belong to the scope of protection of the present disclosure.In addition, it should be noted that the specific technical features described in the above embodiments can be combined in any suitable way without contradiction. In order to avoid unnecessary repetition, various possible combinations are not explained separately in the present disclosure.In addition, different embodiments of the present disclosure can be combined at will, as long as the combination does not violate the idea of the present disclosure, and the combination should also be regarded as the content disclosed by the present disclosure.

Claims

Claims1. A single-stranded oligonucleotide, wherein the single-stranded oligonucleotide has a length of 16-30 nucleotides and can inhibit the expression of Lp(a) mRNA by the mechanism of RNA interference (RNAi); whereineach nucleotide in the single-strand oligonucleotide independently of one another is a modified or an unmodified nucleotide; and wherein in the single-strand oligonucleotide,at least one nucleotide is a nucleotide X,at least one nucleotide is a fluoro modified nucleotide; andin a 5’ to 3’ direction, said at least one nucleotide X is located downstream from the 8thnucleotide in the single- stranded oligonucleotide and is separated from the 8thnucleotide by 4-7 nucleotides; andin a 5’ to 3’ direction, if the 14thnucleotide of the single-stranded oligonucleotide is said at least one nucleotide X and each of the 15thnucleotide and all the subsequent nucleotides in the singlestranded oligonucleotide independently of one another is a modified nucleotide, the 13thnucleotide of the single-stranded oligonucleotide is selected from the group consisting of an alkoxy modified nucleotide, an alkyl modified nucleotide, a substituted alkyl modified nucleotide, an amine modified nucleotide, a thermally destabilizing nucleotide and a BNA; andeach nucleotide X is a deoxynucleotide or an unmodified nucleotide.

2. The single-stranded oligonucleotide according to claim 1, wherein the length of the singlestranded oligonucleotide is 17-28, 19-26 or 20-24 nucleotides; or the length of the single-stranded oligonucleotide is 19, 21 or 23 nucleotides.

3. The single-stranded oligonucleotide according to claim 1 or 2, wherein the number of the nucleotides X is 1-3, such as 1-2, such as 1.

4. The single-stranded oligonucleotide according to any one of claims 1-3, wherein in a 5’ to 3’ direction, each nucleotide X is located downstream from the 8thnucleotide in the singlestranded oligonucleotide; and in a 5’ to 3’ direction, any nucleotide X is separated from the 8thnucleotide in the single-stranded oligonucleotide by 3, 5, 7 or 10 nucleotides; or in a 5’ to 3’ direction, one of the nucleotides X is separated from the 8thnucleotide by 5 nucleotides.

5. The single-stranded oligonucleotide according to claim 4, wherein the single-stranded oligonucleotide only comprises one nucleotide X, and in a 5’ to 3’ direction, the nucleotide X isseparated from the 8thnucleotide in the single-stranded oligonucleotide by 5 nucleotides;or the single-stranded oligonucleotide comprises two nucleotides X, and in a 5 ’ to 3 ’ direction, one nucleotide X is separated from the 8thnucleotide in the single-stranded oligonucleotide by 5 nucleotides and the other nucleotide X is separated from the 8thnucleotide in the single-stranded oligonucleotide by 3, 7 or 10 nucleotides.

6. The single-stranded oligonucleotide according to any one of claims 1-5, wherein the number of the modified nucleotides in the single-stranded oligonucleotide is more than 50%, such as more than 70%, such as more than 85%, of the number of all nucleotides in the single-stranded oligonucleotide; and / or the number of the unmodified nucleotides in the single-stranded oligonucleotide is no more than 5, 4, 3, 2 or 1; and / or all nucleotides in the single-stranded oligonucleotide are modified nucleotides.

7. The single-stranded oligonucleotide according to any one of claims 1-6, wherein the number of the fluoro modified nucleotides is 2-7, such as 2-5, such as 3.

8. The single-stranded oligonucleotide according to any one of claims 1-7, wherein in a 5’ to 3’ direction, the fluoro modified nucleotides are one or more nucleotides, such as 2-7 nucleotides, such as 2-5, such 3 nucleotides, selected from the group consisting of the 2nd, 5th, 6th, 7th, 12th, 16th, 18thand 19thnucleotides in the single-stranded oligonucleotide;or in a 5’ to 3’ direction, the fluoro modified nucleotides are one or two nucleotides selected from the group consisting of the 2ndand 12thnucleotides, one or two nucleotides selected from the group consisting of the 5th- 7thnucleotides, and 0-2 nucleotides selected from the group consisting of the 16th- 19thnucleotides, in the single-stranded oligonucleotide.

9. The single-stranded oligonucleotide according to any one of claims 1-8, wherein in a 5’ to 3’ direction, the fluoro modified nucleotides are one or more nucleotides, or all nucleotides, selected from the group consisting of the 2ndand 6thnucleotides; or the group consisting of the 2nd, 6thand 16thnucleotides; or the group consisting of the 2nd, 5th, 7th, 12thand 16thnucleotides; or the group consisting of the 2nd, 7th, 12th, 16thand 19thnucleotides; or the group consisting of the 2nd, 6th, 12th, 16thand 19thnucleotides, in the single- stranded oligonucleotide.

10. The single-stranded oligonucleotide according to any one of claims 1-9, wherein in the single-stranded oligonucleotide, each modified nucleotide, except for the nucleotides X and thefluoro modified nucleotides, is independently selected from the group consisting of an alkoxy modified nucleotide, a substituted alkoxy modified nucleotide, an alkyl modified nucleotide, a substituted alkyl modified nucleotide, an amine modified nucleotide, a thermally destabilizing nucleotide and a BNA; such as the group consisting of an alkoxy modified nucleotide and a substituted alkoxy modified nucleotide.

11. The single-stranded oligonucleotide according to any one of claims 1-10, wherein the single-stranded oligonucleotide does not comprise thermally destabilizing nucleotides; or the number of the thermally destabilizing nucleotides in the single-stranded oligonucleotide is 1 or 2, wherein optionally, each modified nucleotide, except for the nucleotides X, the fluoro modified nucleotides and the thermally destabilizing nucleotides, is independently selected from an alkoxy modified nucleotide or a substituted alkoxy modified nucleotide.

12. The single-stranded oligonucleotide according to any one of claims 1-11, wherein the length of the single-stranded oligonucleotide is 19-23 nucleotides, and / orin a 5’ to 3’ direction, the 14thnucleotide is nucleotide X, two of the 5th- 7thand 19thnucleotides, and the 2nd, 12thand 16thnucleotides are fluoro modified nucleotides, the 3rdnucleotide is an alkoxy modified nucleotide or a substituted alkoxy modified nucleotide, the 5thnucleotide is an alkoxy modified nucleotide or a substituted alkoxy modified nucleotide when the 5thnucleotide is not a fluoro modified nucleotide, and each of the remaining nucleotides in the single-stranded oligonucleotide is an alkoxy modified nucleotide; orin a 5’ to 3’ direction, the 12thand 14thnucleotides are nucleotides X, the 2nd, 7thand 16thnucleotides are fluoro modified nucleotides, the 3rdor 5thnucleotide is an alkoxy modified nucleotide or a substituted alkoxy modified nucleotide, and each of the remaining nucleotides in the single-stranded oligonucleotide is an alkoxy modified nucleotide; orin a 5’ to 3’ direction, the 14thand 16thnucleotides are nucleotides X, the 2ndand 6thnucleotides are fluoro modified nucleotides, the 13thnucleotide is a substituted alkoxy modified nucleotide or a BNA, the 3rdor 5thnucleotide is an alkoxy modified nucleotide or a substituted alkoxy modified nucleotide; and in a 3’ to 5’ direction, one of the lst-2ndnucleotides of the singlestranded oligonucleotide is a thermally destabilizing nucleotide, and each of the remaining nucleotides in the single-stranded oligonucleotide is an alkoxy modified nucleotide; orin a 5’ to 3’ direction, one of the 16th- 19thnucleotides and the 14thnucleotide are nucleotides X, the 2ndand 6thnucleotides are fluoro modified nucleotides, the 16thnucleotide is a fluoro modified nucleotide when the 16thnucleotide is not nucleotide X, the 13thnucleotide is asubstituted alkoxy modified nucleotide or a BNA, and the 3rdor 5thnucleotide is an alkoxy modified nucleotide or a substituted alkoxy modified nucleotide; the 20thnucleotide is an alkoxy modified nucleotide or a thermally destabilizing nucleotide; and each of the remaining nucleotides in the single-stranded oligonucleotide is an alkoxy modified nucleotide.

13. The single-stranded oligonucleotide according to any one of claims 1-12, wherein the length of the single-stranded oligonucleotide is 21 nucleotides, and / orin a 5’ to 3’ direction, the 14thnucleotide is nucleotide X and is a deoxynucleotide, the 2nd, 5th, 7th, 12thand 16thnucleotides are fluoro modified nucleotides, the 3rdnucleotide is an alkoxy modified nucleotide or a substituted alkoxy modified nucleotide, and each of the remaining nucleotides in the single-stranded oligonucleotide is an alkoxy modified nucleotide; orin a 5’ to 3’ direction, the 14thnucleotide is nucleotide X and is a deoxynucleotide, the 2nd, 7th, 12th16thand 19thnucleotides are fluoro modified nucleotides, and each of the remaining nucleotides in the single-stranded oligonucleotide is an alkoxy modified nucleotide; orin a 5’ to 3’ direction, the 14thnucleotide is a deoxynucleotide, the 2nd, 6th, 12th16thand 19thnucleotides are fluoro modified nucleotides, and each of the remaining nucleotides in the singlestranded oligonucleotide is an alkoxy modified nucleotide; orin a 5’ to 3’ direction, the 12thand 14thnucleotides are nucleotides X and are deoxynucleotides, the 2nd, 7thand 16thnucleotides are fluoro modified nucleotides, and each of the remaining nucleotides in the single-stranded oligonucleotide is an alkoxy modified nucleotide; orin a 5’ to 3’ direction, the 14thnucleotide is nucleotide X and is a deoxynucleotide, the 16thnucleotide is an unmodified nucleotide, the 2ndand 6thnucleotides are fluoro modified nucleotides, the 13thnucleotide is a substituted alkoxy modified nucleotide; the 2ndnucleotide is a thermally destabilizing nucleotide, and each of the remaining nucleotides in the single-stranded oligonucleotide is an alkoxy modified nucleotide; orin a 5’ to 3’ direction, the 14thnucleotide is nucleotide X and is a deoxynucleotide, the 19thnucleotide is an unmodified nucleotide, the 2nd, 6thand 16thnucleotides are fluoro modified nucleotides, the 13thnucleotide is a substituted alkoxy modified nucleotide, and each of the remaining nucleotides in the single-stranded oligonucleotide is an alkoxy modified nucleotide.

14. The single-stranded oligonucleotide according to any one of claims 1-13, wherein each alkoxy modified nucleotide is a methoxy modified nucleotide; and / oreach substituted alkoxy modified nucleotide is a 2’-O-methoxyethyl modified nucleotide;and / oreach BNA is a LNA or a cET BNA; and / oreach thermally destabilizing nucleotide is a GNA.

15. The single-stranded oligonucleotide according to any one of claims 1-14, wherein at least 2 of the linking groups linking adjacent nucleotides in the single-stranded oligonucleotide are each independently phosphate ester groups with modification group(s).

16. The single-stranded oligonucleotide according to any one of claims 1-15, wherein 1 to 4, such as all 4, of the linking groups linking adjacent nucleotides between the 1stand 5thnucleotides at the 5’ terminal of the single-stranded oligonucleotide, and / or 1 to 4, such as all 4, of the linking groups linking adjacent nucleotides between the 1stand 5thnucleotides at the 3’ terminal of the single-stranded oligonucleotide, are each independently phosphate ester groups with modification group(s); and / orif the single-stranded oligonucleotide comprises unmodified nucleotides, then one or both of the two linking groups linking each of the unmodified nucleotides and adjacent nucleotides thereof are each independently phosphate ester groups with modification group(s); and / or2-6, such as 4, of the linking groups linking adjacent nucleotides in the single-stranded oligonucleotide are each independently phosphate ester groups with modification group(s).

17. The single-stranded oligonucleotide according to any one of claims 1-16, wherein one or more, such as each, of the linking groups linking adjacent nucleotides between the 1stand 3rdnucleotides at the 5’ terminal of the single-stranded oligonucleotide, and / or one or more, such as each, of the linking groups linking adjacent nucleotides between the 1stand 3rdnucleotides at the 3’ terminal of the single-stranded oligonucleotide, are each independently phosphate ester groups with modification group(s); and / orif the single- stranded oligonucleotide comprises unmodified nucleotides, then one or both of the two linking groups linking each of the unmodified nucleotides and adjacent nucleotides thereof are each independently phosphate ester groups with modification group(s).

18. The single-stranded oligonucleotide according to any one of claims 15-17, wherein each of the phosphate ester groups with modification group(s) is independently a phosphorothioate group having a structure as shown in Formula (28):Formula (28).

19. The single-stranded oligonucleotide according to any one of claim 1-18, wherein the 5’ terminal nucleotide of the single-stranded oligonucleotide is a 5 ’-hydroxy nucleotide, a 5 ’-phosphate nucleotide or a 5 ’-phosphate analogue modified nucleotide; wherein the 5’-hydroxy nucleotide has a structure as shown in Formula (29); the 5’-phosphate nucleotide has a structure as shown in Formula (30); and the 5 ’-phosphate analogue modified nucleotide is one selected from the nucleotides as shown in Formulae (31)- (34):Formula (31) Formula (32) Formula (33) Formula (34);wherein, R is selected from one of H, OH, OCH3and F; and Base is a nucleic acid base selected from A, U, C, G and T.

20. The single-stranded oligonucleotide according to any one of claims 1-19, wherein the length of the single-stranded oligonucleotide is 21 nucleotides, and / orin a 5’ to 3’ direction in the single-stranded oligonucleotide, the 14thnucleotide is nucleotide X and is a deoxynucleotide, the 2nd, 5th, 7th, 12thand 16thnucleotides are fluoro modified nucleotides, the 3rdnucleotide is a methoxy modified nucleotide, and each of the remaining nucleotides in the single-stranded oligonucleotide is a methoxy modified nucleotide; and / orthe linking groups linking any two adjacent nucleotides between the 1stand 3rdnucleotides at the 5’ terminal of the single-stranded oligonucleotide and the linking groups linking any two adjacent nucleotides between the 1stand 3rdnucleotides at the 3’ terminal of the single-stranded oligonucleotide are phosphorothioate groups; and / orthe 5’ terminal nucleotide is a 5 ’-hydroxy nucleotide as shown in Formula (29) or a 5’-(E)-vinylphosphate modified nucleotide as shown in Formula (31).

21. The single-stranded oligonucleotide according to any one of claims 1-20, wherein the single-stranded oligonucleotide is reverse complementary to a nucleotide sequence m, which is a contiguous nucleotide sequence segment in the Lp(a) mRNA, with no more than 3, such as no more than 2, such as 1, base mismatch(es); or the single-stranded oligonucleotide is completely reverse complementary to said contiguous nucleotide sequence m in Lp(a) mRNA without any base mismatch;wherein optionally,the length of the nucleotide sequence m is not greater than the length of the single-stranded oligonucleotide, and the nucleotide sequence m and the single-stranded oligonucleotide have an equal length, or have a length difference of 1-5 nucleotides or no more than 8 nucleotides; and / orthe length of the nucleotide sequence m is at least 16 nucleotides, 16-25 nucleotides, 18-23 nucleotides, or 19-21 nucleotides; and / orthe length of the single-stranded oligonucleotide is the same as the length of the nucleotide sequence m, and the single-stranded oligonucleotide, except for the terminal nucleotides at position 1, 1-3 or 1-5 at the 5’ terminal (in a 5’ to 3’ direction) and / or the 3’ terminal (in a 3’ to 5’ direction), is completely reverse complementary to the nucleotide sequence m; and / or the single-stranded oligonucleotide, except for the nucleotide at position 1 (in a 5’ to 3’ direction), is reverse complementary to the nucleotide sequence m with 1 base mismatch; or the single-stranded oligonucleotide, except for the nucleotide at position 1 (in a 5’ to 3’ direction), is completely reverse complementary to the nucleotide sequence m; or the singlestranded oligonucleotide is completely reverse complementary to the nucleotide sequence m.

22. The single-stranded oligonucleotide according to any one of claims 1-21, wherein the single-stranded oligonucleotide comprises a nucleotide sequence II, and the nucleotide sequence II is one of the sequences as shown in i) and ii) below:i) the nucleotide sequence II and a nucleotide sequence as shown in SEQ ID NO: 2 have the same length, and no more than 3 base differences:5’-Z2UAACAAUAAGGAGCUGCC -3’ (SEQ ID NO: 2),wherein, Z2is A or U, the nucleotide sequence II comprises a nucleotide Z’2at theposition corresponding to the Z2, and the Z’2 is a first nucleotide at the 5’ terminal of the single-stranded oligonucleotide sequence;ii) the nucleotide sequence II and a nucleotide sequence as shown in SEQ ID NO: 4 have the same length, and no more than 3 base differences:5’-Z4CAGUAAUGAAGUAUGUGC -3’ (SEQ ID NO: 4),wherein, Z4is A or U, the nucleotide sequence II comprises a nucleotide Z’4at the position corresponding to the Z4, and the Z’4is the first nucleotide at the 5’ terminal of the single-stranded oligonucleotide sequence.

23. The single-stranded oligonucleotide according to claim 21, wherein the nucleotide sequence II and the nucleotide sequence as shown in SEQ ID NO: 2 have no more than 1 base difference;or the nucleotide sequence II and the nucleotide sequence as shown in SEQ ID NO: 4 have no more than 1 base difference;or the nucleotide sequence II and the nucleotide sequence as shown in SEQ ID NO: 2 have no base difference;or the nucleotide sequence II and the nucleotide sequence as shown in SEQ ID NO: 4 have no base difference.

24. The single-stranded oligonucleotide according to claim 22 or 23, wherein the singlestranded oligonucleotide further comprises a nucleotide sequence IV, wherein the nucleotide sequence IV is linked to the 3’ terminal of the nucleotide sequence II, the length of the nucleotide sequence IV is 1, 2, 3 or 4 nucleotides, such as 2 nucleotides; each nucleotide in the nucleotide sequence IV is independently a non-fluoro modified nucleotide, the nucleotide sequence IV is reverse complementary to the Lp(a) mRNA with 1 base mismatch or is completely reverse complementary to the Lp(a) mRNA; each of the non-fluoro modified nucleotides is independently selected from the group consisting of a 2’-methoxy modified nucleotide, a 2’-alkyl modified nucleotide with 1-3 carbon atoms, a 2’ -amino modified nucleotide, a 2’ -substituted amino modified nucleotide and a thermally destabilizing nucleotide; and / orthe length of the nucleotide sequence IV is 2 nucleotides.

25. The single-stranded oligonucleotide according to any one of claim 22-24, wherein the single-stranded oligonucleotide further comprises a nucleotide sequence V,wherein each nucleotide of the nucleotide sequence V is independently a non-fluoro modifiednucleotide, the length of the nucleotide sequence V is 1, 2 or 3 nucleotides, such as 2 nucleotides, and the nucleotide sequence V is linked to the 3’ terminal of the nucleotide sequence IV or the nucleotide sequence II; wherein upon formation of a double-stranded oligonucleotide between the single-stranded oligonucleotide and a sense strand, the single-stranded oligonucleotide is the antisense strand and the nucleotide sequence V forms a 3’ overhanging terminal of the anti-sense strand of the double-stranded oligonucleotide; and / orthe length of the nucleotide sequence V is 2 nucleotides, and in a 5’ to 3’ direction, the nucleotide sequence V comprises 2 contiguous thymidine deoxynucleotides or 2 contiguous uridine nucleotides, or is completely reverse complementary to the Lp(a) mRNA; or wherein the single-stranded oligonucleotide comprises or consists of a nucleotide sequence as defined by the anti-sense strand of any one of siRNAl and siRNA2 as shown in Table 1; or the single-stranded oligonucleotide comprises or consists of a nucleotide sequence as defined by the anti-sense strand of any one of conjugate 1 and conjugate 2 as shown in Table 2.

26. A double-stranded oligonucleotide compring a sense strand and an anti-sense strand, wherein each nucleotide in the sense strand is a modified or an unmodified nucleotide, and the sense strand is at least partially reverse complementary to the anti-sense strand to form a doublestranded region, and wherein, the anti-sense strand is the single-stranded oligonucleotide according to any one of claims 1-25.

27. The double-stranded oligonucleotide according to claim 26, wherein the length of the sense strand is 19-23 nucleotides; and / orthe length of the sense strand is the same as the length of the anti-sense strand, and each of the lengths is 19, 20 or 21 nucleotides; orthe length of the sense strand is 19 nucleotides, and the length of the anti-sense strand is 20-24 nucleotides; orthe length of the sense strand is 20 nucleotides, and the length of the anti-sense strand is 21-24 nucleotides; orthe length of the sense strand is 21 nucleotides, and the length of the anti-sense strand is 22-24 nucleotides; orthe length of the sense strand is 19 nucleotides, and the length of the anti-sense strand is 21 nucleotides; orthe length of the sense strand is 21 nucleotides, and the length of the anti-sense strand is 23 nucleotides.

28. The double-stranded oligonucleotide according to claim 26 or 27, wherein, in a 3’ to 5’ direction, 2 to 3 nucleotides of the 11thto 13thnucleotides in the sense strand are fluoro modified nucleotides, the 1stand / or the last nucleotide is an alkoxy modified nucleotide or an inverted abasic deoxynucleotide, and each of the nucleotides at the remaining positions in the sense strand independently of one another are non-fluoro modified nucleotides, and each of the non-fluoro modified nucleotides is independently selected from the group consisting of an alkoxy modified nucleotide, an alkyl modified nucleotide, an amine modified nucleotide and a thermally destabilizing nucleotide.

29. The double-stranded oligonucleotide according to claim 28, wherein, in a 3’ to 5’ direction, the 11thand 13thnucleotides or the 11thto 13thnucleotides in the sense strand are fluoro modified nucleotides, the 1stand / or the last nucleotide is an alkoxy modified nucleotide or an inverted abasic deoxynucleotide, and each of the nucleotides at the remaining positions in the sense strand independently of one another are alkoxy modified nucleotides.

30. The double-stranded oligonucleotide according to claim 28 or 29, wherein each alkoxy modified nucleotide independently of one another is a methoxy modified nucleotide.

31. The double-stranded oligonucleotide according to any one of claims 26-30, wherein, in the sense strand, at least one of the linking groups linking two adjacent nucleotides is a phosphate ester group with modification group(s), and the phosphate ester group with modication group(s) is present at at least one position between two adjacent nucleotides within the 1stto the 5thnucleotides at the 5’ terminal of the sense strand and / or between two adjacent nucleotides within the 1stto the 5thnucleotides at the 3’ terminal of the sense strand.

32. The double-stranded oligonucleotide according to claim 31, wherein 1 to 4, such as all 4, of the linking groups linking any two adjacent nucleotides between the 1stand the 5thnucleotides at the 5’ terminal of the sense strand, and / or 1 to 4, such as all 4, of the linking groups linking any two adjacent nucleotides between the 1stand 5thnucleotides at the 3’ terminal of the sense strand are each independently a phosphate ester group with modification group(s); and / or wherein each of the phosphate ester groups with modification group(s) is independently a phosphorothioate group having the structure as shown in Formula (28); and / orwherein the sense strand comprises or consists of a nucleotide sequence as defined by thesense strand of any one of siRNA1 and siRNA2 listed in Table 1; and / orwherein the sense strand comprises or consists of a nucleotide sequence as defined by the sense strand of any one of conjugate 1 and conjugate 2 listed in Table 2.

33. The double-stranded oligonucleotide according to any one of claims 26-32, wherein the sense strand comprises 19-21 nucleotides, and the anti-sense strand comprises 21-23 nucleotides; and / orin the sense strand, in a 3’ to 5’ direction, the 11thand 13thnucleotides or the 11thto 13thnucleotides are fluoro modified nucleotides, the 1stand / or the last nucleotide is an alkoxy modified nucleotide or an inverted abasic deoxynucleotide, and each of the nucleotides at the remaining positions indepently of one another are alkoxy modified nucleotides; and / or1 to 4, such as all 4, of the linking groups linking adjacent nucleotides between the 1stand the 5thnucleotides at the 5’ terminal of the sense strand, and / or 1 to 4, such as all 4, of the linking groups linking adjacent nucleotides between the 1stand the 5thnucleotides at the 3’ terminal of the sense strand are each indepently phosphorothioate groups.

34. The double-stranded oligonucleotide according to any one of claims 26-33, wherein the sense strand comprises 19-21 nucleotides, and the anti-sense strand comprises 21-23 nucleotides; and / orin the sense strand, in a 3’ to 5’ direction, the 11thand 13thnucleotides are fluoro modified nucleotides, the 1stnucleotide is an inverted abasic deoxynucleotide, and each of the nucleotides at the remaining positions indepently of one another are alkoxy modified nucleotides; and the linking groups linking adjacent nucleotides between the 1stand the 3rdnucleotides at the 5’ terminal of the sense strand and / or the linking groups linking adjacent nucleotides between the 1stand the 3rdnucleotides at the 3’ terminal of the sense strand are each independently phosphate ester groups with modification group(s); and / orin the anti-sense strand, in a 5’ to 3’ direction, the 14thnucleotide is nucleotide X and is a deoxynucleotide, the 2nd, 5th, 7th, 12thand 16thnucleotides are fluoro modified nucleotides, the 3rdnucleotide is an alkoxy modified nucleotide or a substituted alkoxy modified nucleotide, and each of the remaining nucleotides in the anti-sense strand independently of one another are alkoxy modified nucleotides; or in the anti-sense strand, in a 5’ to 3’ direction, the 14thnucleotide is nucleotide X and is a deoxynucleotide, the 2nd, 7th, 12th, 16thand 19thnucleotides are fluoro modified nucleotides, and each of the remaining nucleotides in the anti-sense strand independently of one another are alkoxy modified nucleotides; or in the anti-sense strand, in a 5’ to 3’ direction,the 14thnucleotide is nucleotide X and is a deoxynucleotide, the 2nd, 6th, 12th, 16thand 19thnucleotides are fluoro modified nucleotides, and each of the remaining nucleotides in the antisense strand independently of one another are alkoxy modified nucleotides; or in the anti-sense strand, in a 5’ to 3’ direction, the 12thand 14thnucleotides are nucleotides X and are deoxynucleotides, the 2nd, 7thand 16thnucleotides are fluoro modified nucleotides, and each of the remaining nucleotides in the anti-sense strand independently of one another are alkoxy modified nucleotides; or in the anti-sense strand, in a 5’ to 3’ direction, the 14thnucleotide is nucleotide X and is a deoxynucleotide, the 16thnucleotide is an unmodified nucleotide, the 13thnucleotide is a substituted alkoxy modified nucleotide, the 2ndand 6thnucleotides are fluoro modified nucleotides, the 2ndnucleotide is a thermally destabilizing nucleotide, and each of the remaining nucleotides in the anti-sense strand independently of one another are alkoxy modified nucleotides; or in the anti-sense strand, in a 5’ to 3’ direction, the 14thnucleotide is nucleotide X and is a deoxynucleotide, the 19thnucleotide is an unmodified nucleotide, the 2nd, 6thand 16thnucleotides are fluoro modified nucleotides, the 13thnucleotide is a substituted alkoxy modified nucleotide, and each of the remaining nucleotides in the anti-sense strand independently of one another are alkoxy modified nucleotides; and / orone or more, such as all, of the linking groups linking two adjacent nucleotides between the 1stand the 3rdnucleotides at the 5’ terminal of the anti-sense strand and one or more, such as all, of the linking groups linking two adjacent nucleotides between the 1stand 3rdnucleotides at the 3’ terminal of the anti-sense strand independently of one another are phosphate ester groups with modification group(s), and if the anti-sense strand comprises unmodified nucleotides, one or both of the two linking groups linking the unmodified nucleotides and adjacent nucleotides thereof are independently of one another phosphate ester groups with modification group(s); and / orthe 5’ terminal nucleotide of the anti-sense strand is a 5 ’-hydroxy nucleotide as shown in Formula (29), or a 5’-phosphate nucleotide as shown in Formula (30) or a 5’-(E)-vinylphosphate modified nucleotide as shown in Formula (31).

35. The double-stranded oligonucleotide according to any one of claims 26-34, wherein the sense strand comprises 19 nucleotides, and the anti-sense strand comprises 21 nucleotides; and / or in the sense strand, in a 3’ to 5’ direction, the 11thand the 13thnucleotides are fluoro modified nucleotides, the 1stnucleotide is an inverted abasic deoxynucleotide, and each of the remaining nucleotides in the sense strand independently of one another are methoxy modified nucleotides; and one or more, such as all, of the linking groups linking adjacent nucleotides between the 1stand the 3rdnucleotides at the 5’ terminal of the sense strand are phosphorothioate groups; in the anti-sense strand, in a 5’ to 3’ direction, the 14thnucleotide is nucleotide X and is a deoxynucleotide, the 2nd, 5th, 7th, 12thand 16thnucleotides are fluoro modified nucleotides, and each of the remaining nucleotides in the anti-sense strand independently of one another are methoxy modified nucleotides; and one or more, such as all, of the linking groups linking adjacent nucleotides between the 1stand the 3rdnucleotides at the 5’ terminal of the anti-sense strand and one or more, such as all, of the linking groups linking adjacent nucleotides between the 1stand the 3rdnucleotides at the 3’ terminal of the anti-sense strand independently of one another are phosphorothioate groups; and / orthe 5’ terminal nucleotide of the anti-sense strand is a 5 ’-hydroxy nucleotide as shown in Formula (29) or a 5’-(E)-vinylphosphate modified nucleotide as shown in Formula (31).

36. The double-stranded oligonucleotide according to any one of claims 26-35, wherein the sense strand is reverse complementary to the anti-sense strand with no more than 3, such as no more than 2, such as 1, base mismatch(es); or the sense strand is completely reverse complementary to the antisense strand without any base mismatch; orthe nucleotide sequence of the sense strand except for the 1stnucleotide and the last nucleotide (in a 5’ to 3’ direction) is reverse complementary with 1 base mismatch to the antisense strand or is completely reverse complementary to the anti-sense strand; orthe nucleotide sequence of the sense strand except for the last nucleotide (in a 5’ to 3’ direction) is completely reverse complementary to the anti-sense strand; and / orthe sense strand comprises a nucleotide sequence which has the same length as the nucleotide sequence m with no more than 3 base differences, no more than 1 base difference, or no base difference; wherein the nucleotide sequence m is said contiguous nucleotide sequence segment in the Lp(a) mRNA; and / or the length of the nucleotide sequence m is at least 16 nucleotides, 16-25 nucleotides, 18-23 nucleotides, or 19-21 nucleotides.

37. The double-stranded oligonucleotide according to any one of claims 26-36, wherein the double-stranded oligonucleotide is an siRNA.

38. The double-stranded oligonucleotide according to any one of claims 26-37, wherein the sense strand comprises a nucleotide sequence I, the anti-sense strand comprises the nucleotide sequence II, and the double-stranded oligonucleotide is selected from one group of sequences as shown in i) and ii) below:i) the nucleotide sequence I and a nucleotide sequence as shown in SEQ ID NO: 1 havethe same length, and no more than 3 base differences; and the nucleotide sequence II and a nucleotide sequence as shown in SEQ ID NO: 2 have the same length, and no more than 3 base differences:5’- GGCAGCUCCUUAUUGUUAZi -3’ (SEQ ID NO: 1);5’ - Z2UAACAAUAAGGAGCUGCC -3’ (SEQ ID NO: 2),wherein, Zi is U, A or an inverted abasic deoxynucleotide, Z2 is A or U, the nucleotide sequence I comprises a nucleotide Z’i at the position corresponding toZi, the nucleotide sequence II comprises a nucleotide Z’2 at the position corresponding to Z2, and Z’2 is the first nucleotide at the 5’ terminal of the anti-sense strand;ii) the nucleotide sequence I and a nucleotide sequence as shown in SEQ ID NO: 3 have the same length, and no more than 3 base differences; and the nucleotide sequence II and a nucleotide sequence as shown in SEQ ID NO: 4 have the same length, and no more than 3 base differences:5’- GCACAUACUUCAUUACUGZ3 -3’ (SEQ ID NO: 3);5’ - Z4CAGUAAUGAAGUAUGUGC -3’ (SEQ ID NO: 4),wherein, Z3 is U, A or an inverted abasic deoxynucleotide, Z4 is A or U, the nucleotide sequence I comprises a nucleotide Z’3 at the position corresponding to Z3, the nucleotide sequence II comprises a nucleotide Z’4 at the position corresponding to Z4, and Z’4 is the first nucleotide at the 5’ terminal of the anti-sense strand.

39. The double-stranded oligonucleotide according to claim 38, wherein the nucleotide sequence I and the nucleotide sequence as shown in SEQ ID NO: 1 or 3 have no more than 1 base difference; and the nucleotide sequence II and the nucleotide sequence as shown in SEQ ID NO: 2 or 4 have no more than 1 base difference.

40. The double-stranded oligonucleotide according to claim 38 or 39, wherein the doublestranded oligonucleotide is any one of the double-stranded oligonucleotides shown by siRNAl or siRNA2 in Table 1.

41. An oligonucleotide conjugate comprising an oligonucleotide group and a delivery group conjugated to the oligonucleotide group, wherein the oligonucleotide group is independently a group formed by removing one or more atoms or atomic groups from the single-stranded oligonucleotide according to any one of claims 1-25 or the double-stranded oligonucleotide according to any one of claims 26-40.

42. The oligonucleotide conjugate according to claim 41, wherein the delivery group comprises a linking group and at least one pharmaceutically acceptable targeting group, and the oligonucleotide group, the linking group and said at least one targeting group are sequentially covalently or noncovalently linked, wherein said at least one targeting group is independently selected from a ligand capable of binding to a cell surface receptor and a group capable of increasing the compatibility with a tissue, such as liver tissue; and / orthe oligonucleotide group in the oligonucleotide conjugate is an siRNA group formed from the siRNAs listed in Table 1; and / orthe oligonucleotide conjugate has a structure as shown in Formula (403):Formula (403)in Formula (403), Nu is an oligonucleotide group; such as the oligonucleotide group formed by removing one or more atoms or atomic groups from the double-stranded oligonucleotide group according to any one of claims 26-40, wherein the P atom is covalently linked to the 3’ terminal nucleotide of the sense strand of the double-stranded oligonucleotide group; or, the 3’ terminal nucleotide of the sense strand of the doublestranded oligonucleotide group is an inverted abasic deoxynucleotide, and the P atom is covalently linked to the double- stranded oligonucleotide group by substituting a hydrogen atom in the hydroxyl in the 3’ terminal inverted abasic deoxyribonucleotide of the sense strand of the double-stranded oligonucleotide group, wherein the hydroxyl is linked to the ribose ring via a methylene group; and / orthe oligonucleotide conjugate is the conjugate 1 or the conjugate 2 as listed in Table 2.

43. A pharmaceutically acceptable salt of the single-stranded oligonucleotide according to any one of claims 1-25, the double-stranded oligonucleotide according to any one ofclaims 26-40 or the oligonucleotide conjugate according to claim 41 or 42;wherein optionally, the pharmaceutically acceptable salt is a partial or completely water-soluble salt of the single-stranded oligonucleotide, the double-stranded oligonucleotide or the oligonucleotide conjugate;wherein the water-soluble salt is optionally one or more of an amine salt, an alkali metal salt or an alkaline earth metal salt;wherein the amine salt is optionally selected from one or more of an ammonium salt, a methylamine salt, a tertiary amine salt and a quaternary ammonium salt, and / or the alkali metal salt is optionally one or more selected from a potassium salt and a sodium salt, and / or the alkaline earth metal salt is optionally one or more selected from a calcium salt and a magnesium salt;wherein the tertiary amine salt is optionally one or more selected from a tri ethylamine salt, a triisopropylamine salt and an N, N-diisopropylethylamine salt;wherein optionally, the pharmaceutically acceptable salt is a salt or partial salt of the single-stranded oligonucleotide, the double-stranded oligonucleotide or the oligonucleotide conjugate, wherein the salt is optionally one or more selected from a methylamine salt, a triethylamine salt and a sodium salt.

44. A pharmaceutical composition comprising one or more of the single-stranded oligonucleotide according to any one of claims 1-25, the double-stranded oligonucleotide according to any one of claims 26-40, the oligonucleotide conjugate according to claim 41 or 42 and the pharmaceutically acceptable salt according to claim 43; and a pharmaceutically acceptable excipient;wherein optionally, the pharmaceutically acceptable excipient is one or more of selected from a solvent, a protectant, an osmotic pressure regulator and other pharmaceutically acceptable carriers;wherein the solvent is optionally one or more selected from deionized water, water for injection, a pH buffer, physiological saline, ethanol and ethanol aqueous solution.

45. Use of one or more of the single-stranded oligonucleotide according to any one of claims 1-25, the double-stranded oligonucleotide according to any one of claims 26-40, the oligonucleotide conjugate according to claim 41 or 42, the pharmaceutically acceptable salt according to claim 43 and the pharmaceutical composition according to claim 44, in the manufacture of a medicament for treating and / or preventing a disease or a symptomassociated with the expression level of the Lp(a) mRNA.

46. The use according to claim 45, wherein the disease or the symptom associated with the expression level of the Lp(a) mRNA is a disease or a symptom associated with the Lp(a) protein;wherein, optionally, the disease or the symptom associated with the Lp(a) protein is selected from the group consisting of a hepatogenic disease, inflammation, a cardiovascular and cerebrovascular disease, myocardial infarction and a metabolic disease; wherein, optionally, the cardiovascular and cerebrovascular disease is selected from the group consisting of hyperlipidemia, stroke, atherosclerosis, thrombosis, a coronary heart disease, cardiac apoplexy, cerebral apoplexy, heart failure, a lower extremity arterial disease, coronary artery stenosis, carotid artery stenosis, femoral artery stenosis and aortic valve stenosis.

47. A method for treating and / or preventing a disease or a symptom associated with the expression level of Lp(a) mRNA, wherein the method comprises administering an effective amount of one or more of the single-stranded oligonucleotide according to any one of claims 1-25, the double-stranded oligonucleotide according to any one of claims 26-40, the oligonucleotide conjugate according to claim 41 or 42, the pharmaceutically acceptable salt according to claim 43 and the pharmaceutical composition according to claim 44, to a subject in need thereof.

48. The method according to claim 47, wherein the disease or the symptom associated with the expression level of the Lp(a) mRNA is a disease or a symptom associated with the Lp(a) protein; wherein, optionally, the disease or the symptom associated with the Lp(a) protein is selected from the group consisting of a hepatogenic disease, inflammation, a cardiovascular and cerebrovascular disease, myocardial infarction and a metabolic disease; wherein, optionally, the cardiovascular and cerebrovascular disease is one or more selected from the group consisting of hyperlipidemia, stroke, atherosclerosis, thrombosis, a coronary heart disease, cardiac apoplexy, cerebral apoplexy, heart failure, a lower extremity arterial disease, coronary artery stenosis, carotid artery stenosis, femoral artery stenosis and aortic valve stenosis.49 A method for regulating the expression level of Lp(a) mRNA in a cell, wherein the method comprises contacting the cell with an effective amount of one or more of the single-stranded oligonucleotide according to any one of claims 1-25, the double-stranded oligonucleotide according to any one of claims 26-40, the oligonucleotide conjugate according to claim 41 or 42, the pharmaceutically acceptable salt according to claim 43 and the pharmaceutical composition according to claim 44.

50. One or more of the single-stranded oligonucleotide according to any one of claims 1-25, the double-stranded oligonucleotide according to any one of claims 26-40, the oligonucleotide conjugate according to claim 41 or 42, the pharmaceutically acceptable salt according to claim 43 and the pharmaceutical composition according to claim 44, for use as a medicament.

51. One or more of the single-stranded oligonucleotide according to any one of claims 1-25, the double-stranded oligonucleotide according to any one of claims 26-40, the oligonucleotide conjugate according to claim 41 or 42, the pharmaceutically acceptable salt according to claim 43 and the pharmaceutical composition according to claim 44, for use in the treatment and / or prevention of a disease or a symptom associated with the expression level of the Lp(a) mRNA, such as a disease or a symptom associated with the Lp(a) protein, wherein, optionally, the disease or the symptom associated with the Lp(a) protein is selected from the group consisting of a hepatogenic disease, inflammation, a cardiovascular and cerebrovascular disease, myocardial infarction and a metabolic disease, wherein, optionally, the cardiovascular and cerebrovascular disease is one or more selected from the group consisting of hyperlipidemia, stroke, atherosclerosis, thrombosis, a coronary heart disease, cardiac apoplexy, cerebral apoplexy, heart failure, a lower extremity arterial disease, coronary artery stenosis, carotid artery stenosis, femoral artery stenosis and aortic valve stenosis.

52. A cell expressing Lp(a) mRNA and comprising one or more of the single-stranded oligonucleotide according to any one of claims 1-25, the double-stranded oligonucleotide according to any one of claims 26-40, the oligonucleotide conjugate according to claim 41 or 42, the pharmaceutically acceptable salt according to claim 43 and the pharmaceutical composition according to claim 44.

53. A kit comprising one or more of the single-stranded oligonucleotide according to any one of claims 1-25, the double-stranded oligonucleotide according to any one of claims26-40, the oligonucleotide conjugate according to claim 41 or 42, the pharmaceutically acceptable salt according to claim 43 and the pharmaceutical composition according to claim 44; and an optional instructions for use.

Images