Peronospora resistance in spinacia oleracea

Abstract

The present invention relates to an allele designated alpha-WOLF 31 which confers resistance to at least one Peronospora effusa race, wherein the protein encoded by said allele is a CC-NBS-LRR protein that comprises in its amino acid sequence: a) the motif "MAEIGYSVC" at its N-terminus; and b) the motif "KWMCLR"; and wherein the protein has an amino acid sequence that in order of increased preference has at least 97% sequence similarity to SEQ ID NO: 11. The allele when present in a spinach plant confers complete resistance to at least Peronospora effusa race Pe:1, Pe:2, Pe:4, Pe:5, Pe:6, Pe:7, Pe:10, Pe:12, Pe:13, Pe:14, Pe:15, Pe:16, Pe:18, Pe:19, and Pe:20.

Description

[0001] PERONOSPORA RESISTANCE IN SPINACIA OLERACEA

[0002] The invention relates to an allele conferring resistance against downy mildew (Peronospora effusa), and plants comprising said allele. The invention further relates to progeny, seed, and plant parts such as leaves of said resistant plant; and the invention relates to propagation material suitable for producing said plant. The invention also relates to methods for identifying the allele and resistant plant, and to methods for selecting and producing the resistant plant.

[0003] Downy mildew (Peronospora effusa) is a major threat for spinach growers because it directly affects the harvested leaves. In spinach, downy mildew is caused by the oomycete Peronospora effusa (formerly known as Peronospora farinosa f. sp. spinaciae). Infection makes the leaves unsuitable for sale and consumption, as it manifests itself phenotypically as yellow lesions on the older leaves, and on the abaxial leaf surface a greyish fungal growth can be observed. The infection can spread very rapidly, and it can occur both in glasshouse cultivation and in soil cultivation. The optimal temperature for formation and germination of P. effusa spores is 9 to 12°C, and it is facilitated by a high relative humidity. When spores are deposited on a humid leaf surface they can readily germinate and infect the leaf. Fungal growth is optimal between 8 and 20°C and a relative humidity of >80%, and within 6 and 13 days after infection mycelium growth can be observed. Oospores of P. effusa can survive in the soil for up to 3 years, or as mycelium in seeds or living plants.

[0004] To date 20 pathogenic races of spinach downy mildew (Pe, formerly known as Pfs) have been officially identified and characterized, and many new candidates are observed in the field. The 20 officially recognized races of Peronospora effusa, are designated Pe:l to Pe:20 (Pe:l to Pe:17 were formerly known as Pfs:l to Pfs: 17; Irish et al. Phytopathol. Vol. 98 pg. 894-900, 2008; Plantum NL (Dutch association for breeding, tissue culture, production and trade of seed and young plants) press release, “Benoeming van Pfs: 14, een nieuwe fysio van valse meeldauw in spinazie”, September 19, 2012; Report Jim Correl (Univ. Arkansas) and Steven Koike (UC Cooperative Extension, Monterey County), “Race Pfs: 14 - Another new race of the spinach downy mildew pathogen”, September 18, 2012; Plantum NL press release, “Denomination of Pfs: 15, a new race of downy mildew in spinach”, September 2, 2014; Plantum NL press release, “Denomination of Pfs: 16, a new race of downy mildew in spinach, March 15, 2016; Plantum NL press release, Denomination of Pfs: 17, a new race of downy mildew in spinach”, April 16, 2018; Plantum NL press release, “Denomination of Pe: 18 and 19, two new races of downy mildew in spinach”, April 15, 2021, Denomination of Pe: 20, a new race of downy mildew in spinach”, May 13, 2024).

[0005] The officially recognized Pe races are publicly available from Naktuinbouw, Sotaweg 22, 2371 GD Roelofarendsveen, the Netherlands, or via prof. Jim Correll (University of Arkansas, https: / / cppsi.ucdavis.edU / sites / g / files / dgvnsk8206 / files / inline - files / Spinach_downy_mildew_Differentials_ver%20June%202021.pdf) .

[0006] Especially the latest identified Peronospora races can break the resistance of many spinach varieties that are currently used commercially worldwide, and they thus pose a serious threat to the productivity of the spinach industry. Therefore, it is crucial to stay at the forefront of developments in this field, as Peronospora continuously develops the ability to break the resistances that are present in commercial spinach varieties. For this reason, new resistance genes against downy mildew are very valuable assets, and they form an important research focus in breeding and particular in spinach and lettuce breeding. One of the main goals of spinach breeders is to rapidly develop spinach varieties with a resistance to as many Peronospora races as possible, including the latest identified races, before these races become wide-spread and pose a threat to the industry.

[0007] In commercial spinach varieties, resistance against downy mildew is usually caused by so-called R-genes. R-gene mediated resistance is based on the ability of a plant to recognize the invading pathogen. In many cases this recognition occurs after the pathogen has established the first phases of interaction and transferred a so called pathogenicity (or avirulence) factor into the plant cell. These pathogenicity factors interact with host components in order to establish conditions which are favorable for the pathogen to invade the host and thereby cause disease. When a plant is able to recognize the events triggered by the pathogenicity factors a resistance response can be initiated. In many different plant pathogen interaction systems such as the interaction of spinach with different downy mildew strains, the plant initiates these events only after specific recognition of the invading pathogen.

[0008] Co-evolution of plant and pathogen has led to an arms race in which a R-gene mediated resistance is sometimes overcome as a consequence of the capability of the pathogen to interact with and modify alternative host targets or the same targets in a different way, such that the recognition is lost and infection can be established successfully resulting in disease. In order to reestablish resistance in a plant, a new R-gene has to be introduced which is able to recognize the mode of action of an alternative pathogenicity factor.

[0009] Despite the fact that the durability of R-genes is relatively low, in spinach R-genes are still the predominant form of defense against downy mildew. This is mainly due to the fact that it is the only form of defense that gives absolute resistance. So far plant breeders have been very successful in generating downy mildew resistant spinach varieties by making use of resistance genes residing in the wild germplasm of the crop species. Even though R-genes are extensively used in spinach breeding, until several years ago not much was known about these R-genes.

[0010] The R-genes officially recognized in spinach are in fact all different alleles of the two tightly linked genes, the alpha- and the beta-WOLF genes (WO2018 / 060474; Kock et al.). This was also the first time that R-genes, or better R-alleles, were characterized at the molecular level, i.e. their nucleotide and amino acid sequence was determined. Although this provides the breeder with tools that increase the efficiency of detecting and selecting R-alleles, adequately responding to newly emerging downy mildew races is still crucial for developing commercially successful spinach varieties.

[0011] Therefore, it is the object of the invention to provide a new resistance allele of the alpha-WOLF gene and to provide molecular biological tools for identifying this new resistance allele. The variation observed between alleles of the alpha- and beta-WOLF genes that have been identified is enormous and not straightforward. Therefore, the resistance pattern that is conferred by a WOLF-allele cannot be predicted.

[0012] In the research leading to the present invention, a new allelic variant of the Alpha- WOLF gene as described in WO2018059651 was found. The aZp / za-WOLF gene encodes a protein that belongs to the CC-NBS-LRR family (Coiled Coil - Nucleotide Binding Site - Leucine-Rich Repeat).

[0013] In the context of this invention the term “allele” or “allelic variant” is used to designate a version of the gene that is linked to a specific phenotype, i.e. resistance profile. It was found that a spinach plant may carry one or two WOLF genes. Each of these two WOLF genes encompasses multiple alleles, each allele conferring a particular resistance profile.

[0014] The beta WOLF gene is located on scaffoldl2735 (sequence: GenBank: KQ143339.1), at position 213573-221884. In case the spinach plant also carries or only carries the alpha-WOLF gene, the alpha-WOLF gene is located at approximately the same location as where the beta-WOLF gene is located on scaffoldl2735 in the Viroflay genome assembly.

[0015] A genome assembly for spinach variety Viroflay - which is susceptible to all known pathogenic races of Peronospora effusa - is publicly available (Spinacia oleracea cultivar SynViroflay, whole genome shotgun sequencing project; Bioproject: PRJNA41497; GenBank: AYZV00000000.2; BioSample: SAMN02182572, see also Dohm et al, 2014, Nature 505: 546- 549). In this genome assembly for Viroflay, the beta-WOLF gene is located on scaffoldl2735 (sequence: GenBank: KQ143339.1), at position 213573-221884. The sequence covered by this interval comprises the entire genomic sequence of the beta- WOLF gene of Viroflay, plus 2000 basepairs sequence upstream from the gene, plus the sequence downstream from the gene, up to the locus of the neighbouring gene that is situated downstream from the WOLF gene. Spinach variety Viroflay only possesses a single WOLF gene, namely a beta- WOLF gene, but most other spinach lines harbor a single alpha-type WOLF gene at the same location in the genome. Other spinach lines harbor two WOLF genes at approximately the same location in the genome. In such cases, the two WOLF genes are positioned adjacent to each other. In most spinach lines that harbor two WOLF genes, one of said WOLF genes belongs to the alpha-type, and the other WOLF gene belongs to the beta-type. It was observed that this allelic variation in the WOLF locus is responsible for differences in resistance to pathogenic races of Peronospora ejfusa.

[0016] The difference between an allele of an alpha- WOLF gene and an allele of a beta- WOLF gene lies in the presence of specific conserved amino acid motifs in the encoded protein sequence. As mentioned above, all WOLF proteins possess - from N- to C-terminus - the following domains that are generally known in the art: a coiled coil domain (RX-CC-like, cdl4798), an NBS domain (also referred to as “NB-ARC domain”, pfam00931; van der Biezen & Jones, 1998, Curr. Biol. 8: R226-R228), and leucine -rich repeats (IPR032675) which encompass the LRR domain. In addition, all WOLF proteins comprise in their amino acid sequence the motif “MAEIGYSVC” (SEQ ID NO: 1) at the N-terminus. In addition to this, all alpha-WOLF proteins comprise the motif “KWMCLR” (SEQ ID NO: 2) in their amino acid sequence, whereas all beta- WOLF proteins comprise the motif “HVGCVVDR” (SEQ ID NO: 3) in their amino acid sequence.

[0017] The present invention provides a new downy mildew resistance conferring allele of the alpha-WOLF gene, herein referred to as the ‘allele of the invention’ or alpha-WOLF 31 allele, encoding a protein which confers resistance to Peronospora effusa when expressed in a spinach plant.

[0018] In the research that led to this invention two different splice variants of the allele of the invention were observed. The coding sequence of splice variant 1 comprises a nucleotide sequence according to SEQ ID NO: 10. The coding sequence of splice variant 2 comprises a nucleotide sequence according to SEQ ID NO: 14. The protein encoded by SEQ ID NO: 10 comprises an amino acid sequence having a sequence according to SEQ ID NO: 11. The protein encoded by SEQ ID NO: 14 comprises an amino acid sequence having a sequence according to SEQ ID NO: 15. The LRR domains of both splice variants comprise a coding sequence according to SEQ ID NO: 12, which encodes an amino acid comprising SEQ ID NO: 13.

[0019] The alpha-WOLF 31 allele encodes a CC-NBS-LRR protein which confers resistance to Peronospora effusa races Pe:l, Pe:2, Pe:4, Pe:5, Pe:6, Pe:7, Pe:10, Pe:12, Pe:13, Pe:14, Pe:15, Pe:16, Pe:18, Pe:19, and Pe:20 when expressed in a spinach plant, and wherein the protein comprises in its amino acid sequence the motif “MAEIGYSVC” at its N-terminus, and the motif “KWMCLR”; and wherein said allele comprises: a) a nucleotide sequence comprising a coding sequence that in order of increased preference has at least 97.0%, 97.5%, 98.0%, 98.5%, 99.0%, 99.5%, 100% sequence identity to SEQ ID NO: 10 or SEQ ID NO: 14, or b) a nucleotide sequence encoding a protein which has an amino acid sequence that in order of increased preference has at least 97.0%, 97.5%, 98.0%, 98.5%, 99.0%, 99.5%, 100% sequence similarity to SEQ ID NO: 11 or SEQ ID NO: 15, or c) a nucleotide sequence encoding an LRR domain which nucleotide sequence in order of increased preference has at least 96.0%, 96.5%, 97.0%, 97.5%, 98.0%, 98.5%, 99.0%, 99.5%, 100% sequence identity to SEQ ID NO: 12, or d) a nucleotide sequence encoding an LRR domain which has an amino acid sequence that in order of increased preference has at least 96.0%, 96.5%, 97.0%, 97.5%, 98.0%, 98.5%, 99.0%, 99.5%, 100% sequence similarity to SEQ ID NO: 13.

[0020] Optionally, the alpha-WOLF 31 allele further comprises an additional motif in its amino acid sequence, namely “DQEDEGEDN” (SEQ ID NO: 4).

[0021] The allele of the invention is a nucleic acid, in particular a nucleic acid molecule, more in particular an isolated nucleic acid molecule.

[0022] The allele of the invention encodes a CC-NBS-LRR protein, wherein the protein comprises in its amino acid sequence the motif “MAEIGYSVC” at its N-terminus, and the motif “KWMCLR”, and wherein the allele comprises a coding sequence that in order in order of increased preference has at least 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, 100% sequence identity to SEQ ID NO: 10 or SEQ ID NO: 14.

[0023] Preferably, the allele of the invention encodes a CC-NBS-LRR protein, wherein the protein comprises in its amino acid sequence the motif “MAEIGYSVC” at its N-terminus, and the motif “KWMCLR”, and wherein the allele comprises a coding sequence that in order in order of increased preference has at least 97.0% sequence identity to SEQ ID NO: 10 or SEQ ID NO: 14.

[0024] In a preferred embodiment, the allele of the invention encodes a CC-NBS-LRR protein, wherein the protein comprises in its amino acid sequence the motif “MAEIGYSVC” at its N-terminus, and the motif “KWMCLR”, and wherein the allele comprises a coding sequence according to SEQ ID NO: 10.

[0025] In another preferred embodiment, the allele of the invention encodes a CC-NBS-LRR protein, wherein the protein comprises in its amino acid sequence the motif “MAEIGYSVC” at its N-terminus, and the motif “KWMCLR”, and wherein the allele comprises a coding sequence according to SEQ ID NO: 14.

[0026] The allele of the invention encodes a CC-NBS-LRR protein, wherein the protein comprises in its amino acid sequence the motif “MAEIGYSVC” at its N-terminus, and the motif “KWMCLR”, and wherein the allele comprises a nucleotide sequence encoding a protein which has an amino acid sequence that in order of increased preference has at least 97.0%, 97.5%, 98.0%, 98.5%, 99.0%, 99.5%, 100% sequence similarity to SEQ ID NO: 11 or SEQ ID NO: 15.

[0027] Preferably, the allele of the invention encodes a CC-NBS-LRR protein, wherein the protein comprises in its amino acid sequence the motif “MAEIGYSVC” at its N-terminus, and the motif “KWMCLR”, and wherein the allele comprises a nucleotide sequence encoding a protein which has an amino acid sequence that in order of increased preference has at least 97.0% sequence similarity to SEQ ID NO: 11 or SEQ ID NO: 15.

[0028] In a preferred embodiment, the allele of the invention encodes a CC-NBS-LRR protein, wherein the protein comprises in its amino acid sequence the motif “MAEIGYSVC” at its N-terminus, and the motif “KWMCLR”, and wherein the allele comprises a nucleotide sequence encoding a protein having an amino acid sequence according to SEQ ID NO: 11.

[0029] In another preferred embodiment, the allele of the invention encodes a CC-NBS-LRR protein, wherein the protein comprises in its amino acid sequence the motif “MAEIGYSVC” at its N-terminus, and the motif “KWMCLR”, and wherein the allele comprises a nucleotide sequence encoding a protein having an amino acid sequence according to SEQ ID NO: 15.

[0030] The allele of the invention encodes a CC-NBS-LRR protein, wherein the protein comprises in its amino acid sequence the motif “MAEIGYSVC” at its N-terminus, and the motif “KWMCLR”, and wherein the allele comprises a nucleotide sequence encoding an LRR domain which nucleotide sequence in order of increased preference has at least 96.0%, 96.5%, 97.0%, 97.5%, 98.0%, 98.5%, 99.0%, 99.5%, 100% sequence identity to SEQ ID NO: 12.

[0031] Preferably, the allele of the invention encodes a CC-NBS-LRR protein, wherein the protein comprises in its amino acid sequence the motif “MAEIGYSVC” at its N-terminus, and the motif “KWMCLR”, and wherein the allele comprises a nucleotide sequence encoding an LRR domain which nucleotide sequence in order of increased preference has at least 96.0% sequence identity to SEQ ID NO: 12.

[0032] In a preferred embodiment, the allele of the invention encodes a CC-NBS-LRR protein, wherein the protein comprises in its amino acid sequence the motif “MAEIGYSVC” at its N-terminus, and the motif “KWMCLR”, and wherein the allele comprises a nucleotide sequence encoding an LRR domain which has a nucleotide sequence according to SEQ ID NO: 12.

[0033] The allele of the invention encodes a CC-NBS-LRR protein, wherein the protein comprises in its amino acid sequence the motif “MAEIGYSVC” at its N-terminus, and the motif “KWMCLR”, and wherein the allele comprises a nucleotide sequence encoding an LRR domain which has an amino acid sequence that in order of increased preference has at least 96.0%, 96.5%, 97.0%, 97.5%, 98.0%, 98.5%, 99.0%, 99.5%, 100% sequence similarity to SEQ ID NO: 13.

[0034] Preferably, the allele of the invention encodes a CC-NBS-LRR protein, wherein the protein comprises in its amino acid sequence the motif “MAEIGYSVC” at its N-terminus, and the motif “KWMCLR”, and wherein the allele comprises a nucleotide sequence encoding an LRR domain which has an amino acid sequence that in order of increased preference has at least 96% sequence similarity to SEQ ID NO: 13.

[0035] In a preferred embodiment, the allele of the invention encodes a CC-NBS-LRR protein, wherein the protein comprises in its amino acid sequence the motif “MAEIGYSVC” at its N-terminus, and the motif “KWMCLR”, and wherein the allele comprises a nucleotide sequence encoding an LRR domain which has an amino acid sequence according to SEQ ID NO: 13.

[0036] The alpha- WOLF 31 allele when homozygously or heterozygously present in a spinach plant confers complete resistance to at least Peronospora effusa races races Pe:l, Pe:2, Pe:4, Pe:5, Pe:6, Pe:7, Pe:10, Pe:12, Pe:13, Pe:14, Pe:15, Pe:16, Pe:18, Pe:19, and Pe:20.

[0037] The invention further relates to a protein encoded by the allele of the invention. This protein is also referred to herein as the “protein of the invention” and confers downy mildew resistance to a spinach plant, in particular to at least Peronospora effusa races Pe:l, Pe:2, Pe:4, Pe:5, Pe:6, Pe:7, Pe:10, Pe:12, Pe:13, Pe:14, Pe:15, Pe:16, Pe:18, Pe:19, and Pe:20 when the alpha- WOLF 31 allele encoding the protein of the invention is homozygously present in the genome of the spinach plant.

[0038] As used herein, sequence identity is the percentage of nucleotides or amino acids that is identical between two sequences after proper alignment of those sequences. The person skilled in the art is aware of how to align sequences, for example by using a sequence alignment tool such as BLAST®, which can be used for both nucleotide sequences and protein sequences. To obtain the most significant result, the best possible alignment that gives the highest sequence identity score should be obtained. The percentage sequence identity is calculated through comparison over the length of the shortest sequence in the assessment. In the present case, a nucleotide sequence represents a gene that at least comprises a start codon and a stop codon or encodes an amino acid sequence which comprises a complete protein encoded by such a gene.

[0039] Sequence similarity for an amino acid sequence is calculated using EMBOSS stretcher 6.6.0 (www.ebi.ac.uk / Tools / psa / emboss_stretcher), using the EBLOSUM62 matrix with settings Gap open penalty: 12 and Gap extend penalty: 2. In case of DNA, sequence similarity is calculated using the DNA full matrix with settings Gap open penalty: 16 and Gap extend penalty: 4.

[0040] The invention further relates to a plant, preferably a plant of the species Spinacia oleracea L., wherein the plant comprises the allele of the invention in its genome. A plant comprising the allele of the invention in its genome is referred to herein as a ‘plant of the invention’. In the context of this invention, a plant of the species Spinacia oleracea L. is a spinach plant.

[0041] In a further embodiment, the plant of the invention is an agronomically elite plant, preferably an agronomically elite spinach plant.

[0042] In the context of this invention, an agronomically elite plant is a plant having a genotype that, as a result of human intervention, comprises an accumulation of distinguishable and desirable agronomic traits which allow a producer to harvest a product of commercial significance, preferably the agronomically elite plant of the invention is a plant of an inbred line or a hybrid. As used herein, a plant of an inbred line is a plant of a population of plants that is the result of three or more rounds of selfing, or backcrossing; or which plant is a double haploid. An inbred line may e.g. be a parent line used for the production of a commercial hybrid.

[0043] As used herein, a hybrid plant is a plant which is the result of a cross between two different plants having different genotypes. More in particular, a hybrid plant is the result of a cross between plants of two different inbred lines. Such a hybrid plant may e.g. be a plant of an Fi hybrid variety.

[0044] Seeds of Spinacia oleracea L. comprising the alpha-WOLF 31 allele was deposited with the NCIMB under accession number NCIMB 44422.

[0045] The invention thus relates to plants grown from seed deposited under NCIMB accession number NCIMB 44422.

[0046] The resistance of a spinach plant against one or more races of Peronospora effusa can be determined using a seedling test. Herein, a seedling test is defined as a test wherein spinach seeds are planted in trays containing growth medium, fertilized twice a week after seedling emergence. Plants are inoculated at the first true leaf stage with a sporangial suspension having a concentration of approximately 2.5 x 105 / ml of one of the pathogenic races of Peronospora effusa or isolates to be tested. Thirty plants per race are tested. The inoculated plants are placed in a dew chamber at 18 °C with 100% relative humidity for a 24 h period, and then moved to a growth chamber at 18 °C with a 12 h photoperiod for 6 days. After 6 days, the plants are returned to the dew chamber for 24 h to induce sporulation, and subsequently scored for a disease reaction.

[0047] As used herein, a plant is completely resistant against a Peronospora effusa race when a plant shows no symptoms in the seedling test described herein.

[0048] As used herein, a plant is intermediately resistant against a Peronospora effusa race when a plant shows only symptoms of chlorosis, or sporulation occurring only on the tips of the cotyledons in the seedling test described herein.

[0049] As used herein, a plant is susceptible to an isolate of a Peronospora effusa race when a plant shows more than only symptoms of chlorosis, or when sporulation occurs on an area larger than only the tips of the cotyledons in the seedling test described herein.

[0050] A plant carrying the alpha-WOLF 31 allele in heterozygous form may further comprise a beta-WOLF 0 allele on the complementary chromosome (as e.g. present in variety Viroflay), wherein the beta-WOLF 0 allele does not confer any resistance to downy mildew. Alternatively, a plant heterozygous for the alpha-WOLF 31 allele may further comprise an allele of the alpha or beta-WOLF gene on the complementary chromosome that does provide resistance to downy mildew. Preferably, such an allele would complement the alpha-WOLF 31 allele such that the spinach plant will be at least intermediately resistant to one or more other races to which the alpha-WOLF 31 allele does not provide resistance. Most preferably the other allele of the alpha- or beta- WOLF gene complements the alpha- WOLF 31 allele such that the plant is resistant to Peronospora effusa races Pe:l to Pe:20. In one embodiment such a plant is an agronomically elite plant.

[0051] Alternatively, the resistance profile of a plant carrying the alpha-WOLF 31 allele is complemented by a resistance conferring allele of a totally different gene. Examples of such genes are e.g. DMR1 as described in US8,354,570, DMR6 as described in US9,121,029 and plO as described in US10,226,016, and the genomic fragment on chromosome 4 as described in WO2020 / 239215.

[0052] The invention thus relates to a spinach plant carrying the alpha-WOLF 31 allele, and further comprising another genetic determinant, together resulting in resistance against Peronospora effusa races Pe:l to Pe:20. The genetic determinant can be another resistance conferring alpha / beta-WOLF allele or a resistance conferring allele of a totally different gene.

[0053] Another aspect of the invention relates to a seed capable of growing into a plant of the invention wherein said plant comprises the allele of the invention. The invention also relates to use of said seed for the production of a plant of the invention, by growing said seed into a plant.

[0054] The invention further relates to a method for growing a spinach plant having the allele of the invention, which method comprises the step of germinating a seed that has at least one copy of the allele of the invention. The invention further relates to a method for growing a spinach plant showing resistance to at least Peronospora effusa races Pe:l, Pe:2, Pe:4, Pe:5, Pe:6, Pe:7, Pe:10, Pe:12, Pe:13, Pe:14, Pe:15, Pe:16, Pe:18, Pe:19, and Pe:20, comprising the step of sowing a seed comprising the allele of the invention, a representative sample which is deposited with the NCIMB under accession number NCIMB 44422. In a particular embodiment, the seed that is grown is a seed deposited with the NCIMB under accession number NCIMB 44422.

[0055] Yet another aspect of the invention relates to a leaf harvested from a spinach plant of the invention either in natural or processed form. Spinach leaves are sold in packaged form, including without limitation as pre-packaged spinach leaves or as processed in a salad comprising said leaves. Mention of such a package is e.g. made in US Patent No. 5,523,136, which provides packaging film, and packages from such packaging film, including such packaging containing leafy produce, and methods for making and using such packaging film and packages, which are suitable for use with the spinach leaves of the invention. Thus, the invention comprises the use of and methods for making and using the leaves of the spinach plant of the invention, as well as leaves of spinach plants derived from the invention.

[0056] The invention further relates to a container which comprises one or more plants of the invention, or one or more spinach plants derived from a plant of the invention, in a growth substrate for harvest of leaves from the plant, in a domestic environment. This way the consumer may pick very fresh leaves for use in salads, when the plant is in a ready-to-harvest condition. The invention also relates to propagation material suitable for producing a plant of the invention, wherein the propagation material is suitable for sexual reproduction, and is in particular selected from a microspore, a pollen, an ovary, an ovule, an embryo sac and an egg cell, or is suitable for vegetative reproduction, and is in particular selected from a cutting, a root, a stem a cell, and a protoplast, or is suitable for tissue culture of regenerable cells or protoplasts, and is in particular selected from a leaf, a pollen, an embryo, a cotyledon, a hypocotyl, a meristematic cell, a root, a root tip, an anther, a flower, a seed and a stem, wherein the propagation material comprises the allele of the invention.

[0057] The invention further relates to a cell of a plant of the invention. Such a cell may either be in isolated form, or a part of the complete plant or parts thereof and still forms a cell of the invention because such a cell comprises the allele of the invention. A cell of the invention may also be a regenerable cell that can regenerate into a new plant of the invention.

[0058] The invention further relates to plant tissue of a plant of the invention, which comprises the allele of the invention. The tissue can be undifferentiated tissue or already differentiated tissue. Undifferentiated tissue is for example a stem tip, an anther, a petal, or pollen, and can be used in micropropagation to obtain new plantlets that are grown into new plants of the invention. The tissue can also be grown from a cell of the invention.

[0059] The invention further relates to a method for the production of a plant comprising the allele of the invention, which plant is resistant to Peronospora effusa, by using tissue culture or by using vegetative propagation.

[0060] Progeny of a plant, a cell, a tissue, or a seed of the invention, which progeny comprises the alpha-WOLF 31 allele also part of the invention. Such progeny can in itself be a plant, a cell, a tissue, or a seed. The progeny can in particular be progeny of a plant of the invention, representative seeds of which were deposited under NCIMB number 44422. As used herein, progeny comprises the first and all further descendants from a cross with a plant of the invention, wherein a cross comprises a cross with itself or a cross with another plant, and wherein a descendant that is determined to be progeny comprises the allele of the invention. Descendants can be obtained through selfing and / or further crossing of the deposit. Progeny also encompasses material that is obtained by vegetative propagation or another form of multiplication.

[0061] The invention further relates to the germplasm of plants of the invention. The germplasm is constituted by all inherited characteristics of an organism and according to the invention encompasses at least the resistance trait of the invention. The germplasm can be used in a breeding program for the development of plants that show resistance to Peronospora effusa. The use of germplasm that comprises the allele of the invention in breeding is also part of the present invention. Seed capable of growing into a plant comprising the allele of the invention and being representative for the germplasm was deposited with the NCIMB under accession number NCIMB 44422.

[0062] The invention also relates to the use of the alpha- WOLF 31 allele for producing a spinach plant that is resistant to Peronospora ejfusa.

[0063] The current invention also relates to the use of a plant of the invention as a crop, as a source of seed or as a source of propagation material.

[0064] The invention also relates to the use of a plant of the invention in breeding to confer resistance to Peronospora effusa.

[0065] The invention further relates to a method for seed production comprising growing a spinach plant from a seed of the invention that comprises the allele of the invention homozygously, allowing the plant to produce seed and harvesting the seed. Production of the seed is suitably done by selfing or by crossing with another plant that is optionally also a plant of the invention. The plant grown from the seed produced as described herein is at least resistant to Peronospora effusa Pe:l, Pe:2, Pe:4, Pe:5, Pe:6, Pe:7, Pe:10, Pe:12, Pe:13, Pe:14, Pe:15, Pe:16, Pe:18, Pe:19, and Pe:20.

[0066] The invention also relates to a method for producing a hybrid spinach seed, comprising crossing a first parent plant with a second parent plant and harvesting the resultant hybrid spinach seed, wherein the first parent plant and / or the second parent plant is a plant of the invention. Preferably, at least one of the parent plants comprises the allele of the invention homozygously.

[0067] In a particular embodiment, the first and / or second parent plant is a plant of an inbred line as defined herein.

[0068] The invention also relates to the hybrid seed produced by the method described herein and a hybrid plant grown from said hybrid seed, wherein said hybrid seed and plant comprise the allele of the invention.

[0069] Transgenic techniques used for transferring nucleotide sequences between plants that are sexually incompatible can also be used to produce a plant of the invention, by transferring the allele of the invention from one species to another. Techniques that can suitably be used comprise general plant transformation techniques known to the skilled person, such as the use of an Agrobacterium-mediated transformation method. A plant of the deposit or a descendant thereof is a suitable source of the modified gene.

[0070] The invention further relates to a method for identifying a spinach plant comprising the allele of the invention, wherein the method comprises: al) detecting the allele of the invention in the genome of a plant by determining the sequence of the allele, or a2) detecting the sequence of the LRR domain of the allele of the invention in the genome of a plant, or a3) detecting a unique polymorphism in the allele of the invention, and b) optionally testing the plant comprising the allele of the invention for exhibiting resistance to Peronospora effusa. The sequence of the LRR domain of the allele of the invention can be determined by using a primer pair to amplify the LRR domain, wherein the forward primer is a nucleic acid molecule having the sequence of SEQ ID NO: 5 and wherein the reverse primer is a nucleic acid molecule having the sequence of SEQ ID NO: 6.

[0071] The invention further relates to a method for selecting a spinach plant resistant to Peronospora effusa, comprising identifying the presence of the allele of the invention, optionally testing the plant for resistance against Peronospora effusa, and selecting a plant comprising said allele as a plant which is resistant to at least Peronospora effusa races Pe:l, Pe:2, Pe:4, Pe:5, Pe:6, Pe:7, Pe:10, Pe:12, Pe:13, Pe:14, Pe:15, Pe:16, Pe:18, Pe:19, and Pe:20.

[0072] Introduction of the allele of the invention can also be done through introgression from a plant comprising said allele, for example from a plant, representative seed of which was deposited as NCIMB 44422, or from progeny thereof, or from any other plant of the invention. Breeding methods such as crossing and selection, backcrossing, recombinant selection, or other breeding methods that result in the transfer of a genetic sequence from a resistant plant to a susceptible plant can be used. A resistant plant can be of the same species or of a different and / or wild species. Difficulties in crossing between species can be overcome through techniques known in the art such as embryo rescue, or cis-genesis can be applied instead. Progeny of a deposit can be sexual or vegetative descendants of that deposit, which can be selfed and / or crossed, and can be of an Fl, F2, or further generation as long as the descendants of the deposit still comprise the modified allele the invention as present in seed of that deposit. A plant produced by such method is also a part of the invention.

[0073] The invention also relates to a method for the production of a plant exhibiting resistance against at least Peronospora effusa Pe:l, Pe:2, Pe:4, Pe:5, Pe:6, Pe:7, Pe:10, Pe:12, Pe:13, Pe:14, Pe:15, Pe:16, Pe:18, Pe:19, and Pe:20, comprising the steps of: a) crossing a first parent plant comprising the allele of the invention with a second parent plant to obtain an Fl population; b) optionally performing one or more rounds of selfing and / or crossing with a plant from the Fl population to obtain a further generation; c) selecting from the Fl population or further generation population a plant that comprises the allele of the invention as a resistant plant. The invention also relates to a method for producing a plant which is resistant to at least Peronospora effusa Pe:l, Pe:2, Pe:4, Pe:5, Pe:6, Pe:7, Pe:10, Pe:12, Pe:13, Pe:14, Pe:15, Pe:16, Pe:18, Pe:19, and Pe:20, said method comprising: a) crossing a first parent plant comprising the allele of the invention with a second parent plant not comprising the allele of the invention; b) backcrossing the plant resulting from step a) with the second parent plant for at least three generations; c) selecting from the third or higher backcross population a plant that comprises at least the allele of the invention of the first parent plant of step a) as the plant which is resistant to Peronospora effusa.

[0074] The invention additionally provides for a method of introducing another desired trait into a plant that is resistant to Peronospora effusa, comprising: a) crossing a plant comprising the allele of the invention with a second plant that comprises the other desired trait to produce Fl progeny; b) selecting in the Fl for a plant that comprises the resistance and the other desired trait; c) crossing the optionally selected Fl progeny with one of the parents for at least three generations, to produce backcross progeny; d) selecting backcross progeny comprising the resistance and the other desired trait; and e) optionally repeating steps c) and d) one or more times in succession to produce selected fourth or higher backcross progeny that comprises the resistance and the other desired trait.

[0075] Optionally, selfing steps are performed after any of the crossing or backcrossing steps in above-described methods. Selection of a plant comprising the Peronospora effusa resistance and the other desired trait can alternatively be done following any crossing or selfing step of the method. The other desired trait can be selected from, but is not limited to, the following group: resistance to bacterial, fungal or viral diseases, insect or pest resistance, improved germination, plant size, plant type, improved shelf-life, water stress and heat stress tolerance, and male sterility. The invention includes a plant produced by this method. RESISTANCE INFORMATION

[0076] Table 1

[0077] Resistance profile conferred by the alpha- WOLF 31 allele when heterozygously or homozygously present in a spinach plant. A means complete resistance against a particular downy mildew race; means intermediate resistance against a particular downy mildew race; “+” means that the allele confers no resistance and would cause a plant only carrying the alpha-WOLF 31 allele to be fully susceptible for that particular downy mildew race; “nt” means that it has not been tested against that isolate.

[0078] DEPOSIT INFORMATION

[0079] Seeds of a plant that comprises the alpha-WOLF 31 allele of the invention in its genome were deposited with NCIMB Ltd, Wellheads Place, Dyce, Aberdeen AB21 7GB, UK, on 29 August 2024, under accession number NCIMB 44422. The deposit was made pursuant to the terms of the Budapest Treaty. Upon issuance of a patent, all restrictions upon the deposit will be removed, and the deposit is intended to meet the requirements of 37 CFR § 1.801-1.809. The deposit will be irrevocably and without restriction or condition released to the public upon the issuance of a patent. The deposit will be maintained in the depository for a period of 30 years, or 5 years after the last request, or for the effective life of the patent, whichever is longer, and will be replaced if necessary during that period. SEQUENCE INFORMATION

[0080] Table 2. Sequence information.

[0081] The present invention will be further illustrated in the Examples that follow and that are for illustration purposes only. The Examples are not intended to limit the invention in any way.

[0082] EXAMPLES EXAMPLE 1

[0083] Testing for resistance to Peronospora effusa n spinach plants

[0084] The resistance to downy mildew infection was assayed as described by Irish et al. (2008; Phytopathol. 98: 894-900), using the differential set of the International Seed Federation (https : / / worldseed.org / document / differential-sets-peronospora-effusa-pe-spinach / ) . Spinach plants of the invention were sown along with spinach plants from different other genotypes (see Table 3) in trays containing Scotts Redi-Earth medium, and fertilized twice a week after seedling emergence with Osmocote Peter’s (13-13-13) fertilizer (Scotts). Plants were inoculated with a sporangial suspension (2.5 x 105 / ml) of a pathogenic race of Peronospora ejfusa at the first true leaf stage. In this manner, 4 officially recognized pathogenic race were tested.

[0085] The inoculated plants were placed in a dew chamber at 18 °C with 100% relative humidity for a 24 h period, and then moved to a growth chamber at 18 °C with a 12 h photoperiod for 6 days. After 6 days, the plants were returned to the dew chamber for 24 h to induce sporulation, and they were scored for disease reaction.

[0086] Plants for this specific test were scored as resistant, intermediately resistant, or susceptible based on symptoms of chlorosis and signs of pathogen sporulation on the cotyledons and true leaves, as described by Irish et al. (2007; Plant Dis. 91: 1392-1396). Plants exhibiting no evidence of chlorosis and sporulation were in this specific test considered as resistant. Resistant plants were re-inoculated to assess whether plants initially scored as resistant had escaped infection, or whether they were truly resistant. Plants that showed only symptoms of chlorosis, or sporulation occurring only on the tips of the cotyledons were scored as intermediately resistant. Plants showing more than these symptoms of downy mildew infection were scored as being susceptible.

[0087] Table 1 shows the resistance of a plant carrying the alpha-WOLF 31 allele to each one of these pathogenic races. Table 3 shows the differential set of spinach downy mildew races and the resistance of various spinach varieties (hybrids) to each one of these pathogenic races. A susceptible reaction is scored as “+” (indicating a successful infection by the fungus, with sporulation occurring on the entire cotyledon), and resistance is depicted as (absence of sporulation on the cotyledons). A weak resistance response is indicated as “(-)”, which in practice means a slightly reduced level of infection (with only symptoms of chlorosis, or sporulation only occurring on the tips of the cotyledons in the differential seedling test).

[0088] Table 3: EXAMPLE 2

[0089] Amplification of the LRR domain-encoding region

[0090] The isolated genomic DNA of a spinach plant comprising the alpha-WOLF 31 allele, of which a representative sample of seed was deposited with the NCIMB under accession number NCIMB 44422 was used in polymerase chain reactions (PCR), using forward primer ACAAGTGGATGTGTCTTAGG (SEQ ID NO: 5) and reverse primer TTCGCCCTCATCTTCCTGG (SEQ ID NO: 6). The primer pair amplifies the LRR domainencoding region of an alpha-WOLF gene, and has been designed for selectively amplifying part of a WOLF gene, and not of other CC-NBS-LRR protein-encoding genes.

[0091] PCR conditions for amplifying the LRR domain-encoding region of an alpha- WOLF gene using primers having SEQ ID NO: 5 and SEQ ID NO: 6 were as follows, using Platinum Taq enzyme (Thermo Fisher Scientific):

[0092] - 3 minutes at 95 °C (initial denaturing step)

[0093] - 40 amplification cycles, each cycle consisting of: 30 seconds denaturation at 95°C, 30 seconds annealing at 60°C, and 30 seconds extension at 72°C

[0094] - 2 minutes at 72°C (final extension step)

[0095] The isolated genomic DNA of a spinach plant of variety Viroflay comprising the beta- WOLF 0 allele was used in polymerase chain reactions (PCR), using forward primer TCACGTGGGTTGTGTTGT (SEQ ID NO: 7) and reverse primer TTCGCCCTCATCTTCCTGG (SEQ ID NO: 6). The primer pair amplifies the LRR domain-encoding region of a beta- WOLF gene, and has been designed for selectively amplifying part of a WOLF gene, and not of other CC- NBS-LRR protein-encoding genes.

[0096] PCR conditions for amplifying the LRR domain-encoding region of a beta- WOLF gene using primers having SEQ ID NO: 6 and SEQ ID NO: 7 were as follows, using Platinum Taq enzyme (Thermo Fisher Scientific):

[0097] - 3 minutes at 95 °C (initial denaturing step)

[0098] - 40 amplification cycles, each cycle consisting of: 30 seconds denaturation at 95°C, 50 seconds annealing at 58°C and 50 seconds extension at 72°C

[0099] - 2 minutes at 72°C (final extension step)

[0100] The PCR products were visualized on agarose gel (not shown), and DNA was purified from the PCR reaction. Subsequently the sequence of the PCR products was determined using methods well known in the art.

[0101] The DNA sequence of the LRR domain of the alpha-WOLF 31 allele amplified by primers having SEQ ID NO: 5 and SEQ ID NO: 6 is provided in Table 2 under SEQ ID NO: 12.

[0102] The DNA sequence of the LRR domain of the beta-WOLF 0 allele amplified by primers having SEQ ID NO: 6 and SEQ ID NO: 7 is provided in Table 2 under SEQ ID NO: 8. Finally, the obtained sequences were translated into the corresponding amino acid sequence of the LRR domain having SEQ ID NO: 13 and SEQ ID NO: 9 for the alpha- WOLF 31 allele and the beta-WOLF 0, respectively (See also Table 2).

[0103] If PCR products were to be sequenced using SMRT sequencing (Pacific Biosciences), PCR primers and PCR conditions were different.

[0104] To the above-mentioned forward primers the following standard amplification sequence was added: GCAGTCGAACATGTAGCTGACTCAGGTCAC.

[0105] To the reverse primer, the following standard amplification sequence was added: TGGATCACTTGTGCAAGCATCACATCGTAG.

[0106] EXAMPLE 3

[0107] Introducing an alpha-WOLF 31 allele in a plant not carrying the allele

[0108] A spinach plant comprising the alpha-WOLF 31 allele, of which a representative sample of seed was deposited with the NCIMB under accession number NCIMB 44422 was crossed with a plant of variety Viroflay carrying the beta-WOLF 0 allele to obtain a Fl generation. Subsequently, a Fl plant was selfed to obtain a F2 population.

[0109] Plants of the F2 population were assayed as described in Example 1 for resistance to Peronospora effusa races Pe:l, Pe:2, Pe:4, Pe:5, Pe:6, Pe:7, Pe:10, Pe:12, Pe:13, Pe:14, Pe:15, Pe:16, Pe:18, Pe:19, and Pe:20. Approximately 75% of the plants scored completely resistant in the assay. This segregation pattern is consistent with that of a dominant inheritance.

[0110] Genomic DNA of each plant of the same F2 population was isolated and used in two different polymerase chain reactions (PCR). The first PCR reaction was done using primers for amplifying the LRR domain of an alpha-WOLE allele and the second PCR reaction was done using primers for amplifying the LRR domain of a beta-WOLE allele, both as described in Example 2.

[0111] The PCR products were visualized on agarose gel (not shown), this demonstrated that approximately 75% of the plants contained an alpha-WOLE fragment, and that the remaining approximately 25% of the plants only contained a beta-WOLE fragment. The plants containing the alpha-WOLE fragment completely correlated with the plants that scored resistant for Pe:l, Pe:2, Pe:4, Pe:5, Pe:6, Pe:7, Pe:10, Pe:12, Pe:13, Pe:14, Pe:15, Pe:16, Pe:18, Pe:19, and Pe:20. The plants only comprising the beta-WOLE fragment completely correlated with the plants that scored susceptible for all races.

[0112] DNA from the PCR reaction was purified, and subsequently the sequence of the PCR products was determined. The alpha-WOLE PCR products gave a sequence that corresponded to the sequence of SEQ ID NO: 12, the sequence of the LRR domain of the alpha-WOLE 31 allele. The beta-WOLE PCR products gave a sequence that corresponded to the sequence of SEQ ID NO: 8 the sequence of the LRR domain of the beta-WOLE 0 allele. BUDAPEST TREATY ON THE INTERNATIONAL RECOGNITION OF THE DEPOSIT OF CULTIVARS FOR THE PURPOSES OF PATENT PROCEDURE

[0113] INTERNATIONAL FORM

[0114] RECEIPT IN THE CASE OF AN ORIGINAL DEPOSIT issued pursuant to Rule 7.1 by the INTERNATIONAL DEPOSITARY AUTHORITY identified at the bottom of this page

[0115] NAME AND ADDRESS OF DEPOSITOR

[0116] *Where Rule 6 / 4(d) applies, such date is the date on which the status of International Depositary Authority was acquired.

[0117] Form BP / 4 (sole page)

Claims

25CLAIMS1. An allele of an alpha-WOLF gene encoding a protein which confers at least resistance to Peronospora effusa races Pe:l, Pe:2, Pe:4, Pe:5, Pe:6, Pe:7, Pe:10, Pe:12, Pe:13, Pe:14, Pe:15, Pe:16, Pe:18, Pe:19, and Pe:20 when expressed in a spinach plant, and wherein the protein comprises in its amino acid sequence the motif “MAEIGYS VC” at its N-terminus, and the motif “KWMCLR”; and wherein said allele comprises: a) a nucleotide sequence comprising a coding sequence that in order in order of increased preference has at least 97.0% sequence identity to SEQ ID NO: 10 or SEQ ID NO: 14, or b) a nucleotide sequence encoding a protein which has an amino acid sequence that in order of increased preference has at least 97.0% sequence similarity to SEQ ID NO: 11 or SEQ ID NO: 15, or c) a nucleotide sequence encoding an LRR domain which nucleotide sequence in order of increased preference has at 96.0% sequence identity to SEQ ID NO: 12, or d) a nucleotide sequence encoding an LRR domain which has an amino acid sequence that in order of increased preference has at least 96.0% sequence similarity to SEQ ID NO: 13.

2. The allele as claimed in claim 1 , wherein the allele further comprises motif “DQEDEGEDN” in its amino acid sequence.

3. A protein encoded by the allele as claimed in claim 1 or 2.

4. A spinach plant comprising the allele as claimed in any of the claims 1 and 2, of which a representative sample of seed was deposited with the NCIMB under accession number NCIMB 44422.

5. The spinach plant of claim 4, wherein the plant is an agronomically elite plant, in particular a hybrid variety or an inbred line.

6. A spinach seed capable of growing into a spinach plant as claimed in any one of the claims 4 and 5.

7. Propagation material suitable for producing a spinach plant as claimed in any one of the claims 4 and 5, wherein the propagation material is suitable for sexual reproduction, and is in particular selected from a microspore, pollen, ovary, ovule, embryo sac and egg cell, or is suitable for vegetative reproduction, and is in particular selected from a cutting, root, stem cell, andprotoplast, or is suitable for tissue culture of regenerable cells or protoplasts, which regenerable cells or protoplasts are in particular selected from a leaf, pollen, embryo, cotyledon, hypocotyl, meristematic cell, root, root tip, anther, flower and stem, and wherein the propagation material comprises the allele as claimed in claim 1 or claim 2.

8. Method for identifying a spinach plant comprising the allele as claimed in claim 1 or 2, wherein the method comprises: al) detecting the allele as claimed in claim 1 or 2 in the genome of a plant by determining the sequence of the allele, or a2) detecting the sequence of the LRR domain of the allele as claimed in claim 1 or 2 in the genome of a plant, or a3) detecting a unique polymorphism in the allele as claimed in claim 1 or 2, and b) optionally testing the plant comprising the allele according to claim 1 or 2 for exhibiting resistance to Peronospora effusa.

9. The method of claim 8, wherein the LRR domain is determined by using a primer pair to amplify the LRR domain, wherein the forward primer is a nucleic acid molecule having the sequence of SEQ ID NO: 5.

10. The method of claim 8, wherein the LRR domain is determined by using a primer pair to amplify the LRR domain, wherein the reverse primer is a nucleic acid molecule having the sequence of SEQ ID NO: 6.I L A method for selecting a spinach plant resistant to Peronospora effusa, comprising identifying the presence of the allele as claimed in claim 1 or 2 in a plant, and selecting a plant comprising said allele as a plant which is resistant to at least Peronospora effusa races Pe:l, Pe:2, Pe:4, Pe:5, Pe:6, Pe:7, Pe:10, Pe:12, Pe:13, Pe:14, Pe:15, Pe:16, Pe:18, Pe:19, and Pe:20 .

12. A method for producing a spinach plant resistant to against Peronospora effusa comprising the steps of: a) crossing a first parent plant comprising the allele as claimed in claim 1 or 2 with a second parent plant to obtain an Fl population; b) optionally performing one or more rounds of selfing and / or crossing with a plant from the Fl population to obtain a further generation population; c) selecting from the first or further generation population a plant that comprises the allele as claimed in claim lor 2 as a resistant plant.

13. A method for producing hybrid spinach seed resistant to Peronospora effusa, comprising the steps of crossing a first parent plant with a second parent plant, wherein one or both parent plants are homozygous for the allele as described in claim 1 or 2 and harvesting the hybrid seed.

14. The hybrid seed produced by the method of claim 13.

15. A plant grown from the hybrid seed of claim 14.

16. A method for growing a spinach plant at least resistant to Peronospora effusa races Pe:l, Pe:2, Pe:4, Pe:5, Pe:6, Pe:7, Pe:10, Pe:12, Pe:13, Pe:14, Pe:15, Pe:16, Pe:18, Pe:19, and Pe:20 , comprising the step of planting a seed comprising the allele as claimed in claim 1 or 2, a representative sample of which was deposited with the NCIMB under accession number NCIMB 44422.

Images