T cell-specific promoters and methods of use

Abstract

Compositions and methods for specific expression of RNA or protein are provided, such as a Chimeric Antigen Receptor (CAR) or T Cell Receptor (TCR), in T cells, with limited or no expression in non-T cells.

Description

Attorney Docket No. JBI6969WOPCT1T cell-Specific Promoters and Methods of UseCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of U.S. Serial No. 63 / 734,241 filed December 16, 2024 and U.S. Serial No. 63 / 806,340 filed May 15, 2025, the contents of each of which are herein incorporated by reference in its entirety.SEQUENCE LISTING

[0002] This application contains a computer readable Sequence Listing which has been submitted in XML file format with this application, the entire content of which is incorporated by reference herein in its entirety. The Sequence Listing XML file submitted with this application is entitled “JBI6969WOPCT1 sequence listing.xml”, was created on November 17, 2025, and is 69,632 bytes in size.INCORPORATION BY RERFERENCE

[0003] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.BACKGROUND

[0004] Immunotherapies such as Chimeric Antigen Receptor T-cell (CAR-T) therapy and T-cell receptor (TCR) therapies require controlled activation or suppression of expression in T cells. One of the challenges of these approaches is limiting off-target effects where non-T cells express genes, RNA, or proteins of interest.

[0005] Therefore, there is a need for compositions and methods for specific expression of RNA and proteins in T cells, and not in off-target cells. The embodiments described herein satisfies this unmet need.Attorney Docket No. JBI6969WOPCT1SUMMARY

[0006] In a first aspect, a nucleic acid is provided, comprising: a first sequence comprising a promoter, wherein the promoter drives expression in T cells, and a second sequence encoding a protein or an RNA.

[0007] In some embodiments, the promoter does not drive expression in cells that are non-T cells.

[0008] In some embodiments, the first sequence comprises a lymphocyte protein tyrosine kinase (LCK) promoter. In some embodiments, the first sequence comprises an LCK promoter comprising about 80%, 85%, 90%, 95% or 100% sequence identity to SEQ ID NO: 1.

[0009] In some embodiments, the protein comprises a chimeric antigen receptor or an engineered T cell receptor. In some embodiments, the RNA is a microRNA or a microRNA-adapted shRNA.

[0010] In some embodiments, the nucleic acid further comprises a third sequence comprising an enhancer sequence downstream or upstream from the first sequence.

[0011] In some embodiments, the enhancer sequence comprises an intronic enhancer region, at least one transcription factor binding site, or a combination thereof.

[0012] In some embodiments, the enhancer sequence comprises an intronic enhancer derived from the first intron of the human LCK gene.

[0013] In some embodiments the enhancer sequence comprises a synthetic intronic enhancer designed for efficient splicing.

[0014] In some embodiments, the third sequence comprises at least 80%, 85%, 90%, 95% or 100% sequence identity to SEQ ID NO: 12-21, 29-35. In some embodiments, the third sequence comprises SEQ ID NO: 18.

[0015] In some embodiments, the nucleic acid molecule comprises a sequence comprising at least 80%, 85%, 90%, 95% or 100% sequence identity to any one of SEQ ID NOs: 2-11. In some embodiments, the nucleic acid molecule comprises SEQ ID NO: 8.

[0016] In some embodiments, the transcription factor binding site comprises a T cellspecific transcription factor binding site. In some embodiments, the transcription factorAttorney Docket No. JBI6969WOPCT1 binding site comprises a sequence comprising at least 80%, 85%, 90%, 95% or 100% sequence identity to any one of SEQ ID NOs: 23-28.

[0017] In some embodiments, the nucleic acid is comprised within a vector.

[0018] In some embodiments, the promoter drives expression in T cells. In some embodiments, the T cells comprise primary a[3 T cells, iPSC-derived y8 T (iy8 T) cells, or both. In some embodiments, the T cells comprise iPSC-derived y8T (iy8 T) cells.

[0019] In some embodiments, the non-T cells comprise iPSCs.

[0020] In some embodiments, the nucleic acid is comprised within a viral vector or a non-viral vector. In some embodiments, the viral vector comprises a lentiviral vector.

[0021] In some embodiments, the enhancer comprises an EFla intron.

[0022] In some embodiments, the enhancer comprises at least one transcription factor binding site comprising a T cell-specific transcription factor binding site, wherein the transcription factor binding site is TS6. In some embodiments, TS6 is a DNA sequence represented by SEQ ID NO: 28 comprising motifs for five transcription factors expressed in T cells. In some embodiments, the transcription factors comprises NRF, ZNF, CREB, ZBTB and CREB3L / XBP.

[0023] In some embodiments, the at least one transcription factor binding site or EFla intron is incorporated within or is adjacent to a human LCK promoter region.

[0024] In some embodiments, a method of genetically modifying an immune cell is provided, the method comprising delivering a nucleic acid molecule to a cell, wherein the nucleic acid molecule comprises: a first sequence comprising a promoter, wherein the promoter drives expression in T cells, and wherein the promoter does not drive expression in cells that are non-T cells, and a second sequence encoding a protein or an RNA.

[0025] In some embodiments, the nucleic acid is delivered by electroporation or a viralbased gene transfer system. In some embodiments, the nucleic acid is delivered by a CRISPR / Mad7 -based non-viral delivery system.

[0026] In some embodiments, the nucleic acid is not expressed in non-immune cells. In some embodiments, expression of the nucleic acid is within T cells.

[0027] In some embodiments, off-target cells exhibit reduced or no activity or expression of the nucleic acid compared to cells modified using a vector with ubiquitous promoters.Attorney Docket No. JBI6969WOPCT1

[0028] In some embodiments, off-target cells comprise iPSCs and / or non T cells.

[0029] In some embodiments, the promoter comprises an LCK promoter sequence. In some embodiments, the LCK promoter sequence comprises a sequence comprising about 80%, 85%, 90%, 95% or 100% sequence identity to SEQ ID NO:1.

[0030] In some embodiments, the protein comprises a chimeric antigen receptor or an engineered T cell receptor.

[0031] In some embodiments, the nucleic acid further comprises an enhancer sequence downstream or upstream from the promoter sequence. In some embodiments, the enhancer sequence comprises an intronic enhancer region, at least one transcription factor binding site, or a combination thereof.

[0032] In some embodiments, the enhancer sequence comprises an intronic enhancer derived from the first intron of the human LCK gene.

[0033] In some embodiments, the enhancer sequence comprises a synthetic intronic enhancer designed for efficient splicing.

[0034] In some embodiments, the enhancer sequence comprises a sequence with at least 80%, 85%, 90%, 95% or 100% sequence identity to any one of SEQ ID NOs: 12-21, 29- 35.

[0035] In some embodiments, the nucleic acid sequence comprises a sequence with at least 80%, 85%, 90%, 95% or 100% sequence identity to any one of SEQ ID NOs: 2-11.

[0036] In some embodiments, the transcription factor binding site comprises a T cellspecific transcription factor binding site. In some embodiments, the transcription factor binding site comprises a sequence comprising at least 80%, 85%, 90%, 95% or 100% sequence identity to any one of SEQ ID NOs: 23-28.

[0037] In some embodiments, the nucleic acid is comprised within a vector.

[0038] In some embodiments, the promoter drives expression in T cells.

[0039] In some embodiments, the T cells comprise primary a[3 T cells, iPSC-derived y8 T (iy8 T) cells, or both. In some embodiments, the non-T cells comprise iPSCs.

[0040] In some embodiments, the nucleic acid is comprised within a viral vector or a non-viral vector.

[0041] In some embodiments, the viral vector comprises a lentiviral vector.

[0042] In some embodiments, the enhancer comprises an EFla intron.Attorney Docket No. JBI6969WOPCT1

[0043] In some embodiments, the at least one transcription factor binding site comprises a T cell-specific transcription factor binding site, wherein the transcription factor binding site is TS6. In some embodiments, TS6 is a DNA sequence represented by SEQ ID NO: 28 comprising motifs for five transcription factors expressed in T cells. In some embodiments, the transcription factors comprises NRF, ZNF, CREB, ZBTB and CREB3E / XBP.

[0044] In some embodiments, the at least one transcription factor binding site or EFla intron is incorporated within or is adjacent to the human LCK gene.

[0045] In some embodiments, the protein is expressed only in T cells as compared to a method using a nucleic acid comprising promoter that is a ubiquitous promoter.

[0046] In a second aspect, a method of making a genetically modified immune cell is provided. The method comprises delivering a nucleic acid molecule to a cell, wherein the nucleic acid molecule comprises a first sequence comprising a promoter, wherein the promoter drives expression in T cells, and wherein the promoter does not drive expression in cells that are non-T cells and a second sequence encoding a protein or an RNA.BRIEF DESCRIPTION OF THE DRAWINGS

[0047] The following detailed description of embodiments can be better understood when read in conjunction with the appended drawings. It should be understood there are no limitations to the precise arrangements and instrumentalities of the embodiments shown in the drawings.

[0048] FIG. 1A, FIG. IB, FIG. 1C, FIG ID, FIG. IE and FIG IF, depicts the ECK promoter design and evaluation. FIG. 1 A depicts various ECK promoter designs for testing. FIG. IB and FIG. 1C depicts the results of example experiments demonstrating promoter activity in primary a[3 T cells (on-target cells). FIG. ID and FIG. IE depicts the results of example experiments demonstrating promoter activity in iPSC-derived y8 T cells (on-target cells). FIG. IF depicts the results of example experiments demonstrating promoter activity in iPSCs (off-target cells).Attorney Docket No. JBI6969WOPCT1

[0049] FIG. 2A, FIG. 2B and FIG. 2C, depicts the evaluation of the LCK promoter using a dual promoter system. FIG. 2A depicts the design of the dual promoter system comprising a CAG promoter-driven GFP reporter to identify knocked-in cells. FIG. 2B depicts the results of example experiments demonstrating promoter activity in primary aP T cells. FIG. 2C depicts the results of example experiments demonstrating promoter activity in iPSCs.

[0050] FIG. 3 depicts the design of the LCK promoter with T cell-specific TF binding sites. Two types of intronic enhancers are used: 1) il, an enhancer derived from the first intron of the human LCK gene, retaining the splicing donor and acceptor sites while other intronic regions were removed. Within the il intron, either T cell-specific transcription factor motifs (TS1-6), random DNA sequences, or the EFla intron were incorporated; and 2) si 1 , a synthetic intron previously designed for efficient splicing, modified to include either T cell-specific transcription factor motifs (TS1-6) or random DNA sequences.

[0051] FIG. 4A, FIG. 4B and FIG. 4C, depicts the results of example experiments demonstrating the activity of the LCK promoter with T cell-specific TF binding sites. FIG. 4A depicts the results of example experiments demonstrating the activity of the LCK promoter with T cell-specific TF binding sites in primary a[3 T cells. The LCK promoter without TF binding sites (dLCK-CTRL) served as a baseline control. The GFP+ population marks successfully knocked-in cells, while the CAR+ population reflects active promoter-driven CAR expression. RNP only is the negative control for knock-in with CRISPR / Mad7. FIG. 4B depicts the analysis of flow cytometry data from FIG.4A. FIG. 4C depicts the results of example experiments evaluating the LCK promoter with T cell-specific TF binding sites in iPSCs (off-target cell).

[0052] FIG.5 depicts LCK promotor optimization. For the dLCK_core-P, the core promoter of the distal LCK promoter consisting of a modified sequence of 269 bp upstream of the transcription start site and an additional 88bp within the 1stexon of the distal LCK transcript in human. For the i 1 , this enhancer was derived from the first intron of the human LCK gene, retaining the splicing donor and acceptor sites while other intronic regions were removed. Within this il intron, new T cell-specific transcription factor binding sites were incorporated (Tl, T2, T3, T4, T5, T6).Attorney Docket No. JBI6969WOPCT1

[0053] FIG.6 shows the evaluation of the newly designed LCK promoters in primary aP T cells utilizing the dual promoter system. A single experiment was conducted with aP T cells from two donors. The GFP+ population indicates successfully knocked-in cells, while the CAR+ population reflects active promoter-driven CAR expression.

[0054] As shown in FIG.7 is the analysis of flow cytometry data, combining results from two T cell donors. Promoter activity was quantified using CAR mean fluorescence intensity (MFI), calculated based on CAR expression levels.

[0055] FIG.8 shows the evaluation of the new LCK designs in iPSCs using the dual promoter system using flow cytometry.

[0056] FIG.9 shows additional designs within the lentiviral system. The object was to determine whether the T cell specific promoter designs could be incorporated into the lentiviral system. 3rdgeneration lentiviral platform with a single promoter were utilized and both the long version of the LCK promoter (dLCK_CTRL) and the short version of the LCK promoter (dLCK_core-P), with or without the intronic enhancers were tested.

[0057] FIG.10 shows a lentivirus titer quantitation . The lentiviral titer was calculated by analyzing transgene expression through flow cytometry. Transducing Units per milliliter (TU / mL) reflects the number of viral particles that are capable of infecting and integrating into the target cells.

[0058] FIG.l 1 shows the evaluation of the LCK promoters in primary aP T cells within the lentiviral system. The previously established distal LCK 2kb promoter design (dLCK_CTRL) served as the baseline control, while the lead design dLCK-il_TS6 from previous optimization, was used as the benchmark. Additionally, the full length EFla promoter (1334 bp) was included as a positive control. The data shown are derived from a single experiment conducted with aP T cells from two donors.

[0059] FIG.12 shows the analysis of flow cytometry data, combining results from two T cell donors. Promoter activity was quantified using CAR mean fluorescence intensity (MFI), calculated based on CAR expression levels. The previous lead design dLCK-il- TS6, along with the new designs, dLCK_core-P_il_Tl and dLCK_core-P_il_T2, showed similar CAR MFI, indicating similar promoter activities. The measured promoter activities from these promoters were -60% of the activity observed for the EFla promoter based on the CAR MFI calculations.Attorney Docket No. JBI6969WOPCT1DETAILED DESCRIPTION

[0060] Compositions and methods for specific expression of RNA or protein in T cells, with limited or no expression in non-T cells are provided herein.

[0061] In an attempt to help the reader of the present application, the description has been separated in various paragraphs or sections. These separations should not be considered as disconnecting the substance of a paragraph or section from the substance of another paragraph or section. To the contrary, the present description encompasses all the combinations of the various sections, paragraphs and sentences that can be contemplated.

[0062] In some embodiments, a nucleic acid molecule is provided comprising a first sequence comprising a promoter, wherein the promoter drives expression in T cells, and wherein the promoter does not drive expression in cells that are non-T cells, and a second sequence encoding a protein or an RNA. In some embodiments, the nucleic acid molecule comprises a third sequence comprising an enhancer sequence.

[0063] In some embodiments, a method of genetically modifying an immune cell is provided. In some embodiments, the method comprises delivering a nucleic acid molecule to a cell, wherein the nucleic acid molecule comprises a first sequence comprising a promoter, wherein the promoter exhibits T cell specificity, and wherein the promoter does not drive expression in cells that are non-T cells, and a second sequence encoding a protein or an RNA.

[0064] In some embodiments, genetically modified immune cells are provided. In some embodiments, the genetically modified immune cells comprise a nucleic acid molecule comprising a first sequence comprising a promoter, wherein the promoter drives expression in T cells, and wherein the promoter does not drive expression in cells that are non-T cells, and a second sequence encoding a protein or an RNA.

[0065] In some embodiments, methods of administering the genetically modified immune cells described herein to a subject is provided.Definitions

[0066] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which thisAttorney Docket No. JBI6969WOPCT1 invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

[0067] As used herein, each of the following terms has the meaning associated with it in this section.

[0068] The articles “a” and “an” are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element.

[0069] Also, the use of “or” means “and / or” unless stated otherwise. Similarly, “comprise,” “comprises,” “comprising” “include,” “includes,” and “including” are interchangeable and not intended to be limiting.

[0070] It is to be further understood that where descriptions of various embodiments use the term “comprising,” those skilled in the art would understand that in some specific instances, an embodiment can be alternatively described using language “consisting essentially of’ or “consisting of.”

[0071] As used herein, the term “about” or “approximately” refers to a quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length that varies by as much as 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2% or 1% to a reference quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length. In one embodiment, the term “about” or “approximately” refers a range of quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length ±15%, ±10%, ±9%, ±8%, ±7%, ±6%, ±5%, ±4%, ±3%, ±2%, or ±1% about a reference quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length.

[0072] Throughout this specification, unless the context requires otherwise, the words “comprise”, “comprises” and “comprising” will be understood to imply the inclusion of a stated step or element or group of steps or elements but not the exclusion of any other step or element or group of steps or elements. By “consisting of’ is meant including, and limited to, whatever follows the phrase “consisting of.” Thus, the phrase “consisting of’ indicates that the listed elements are required or mandatory, and that no other elements may be present. By “consisting essentially of’ is meant including any elements listedAttorney Docket No. JBI6969WOPCT1 after the phrase, and limited to other elements that do not interfere with or contribute to the activity or action specified in the disclosure for the listed elements. Thus, the phrase “consisting essentially of’ indicates that the listed elements are required or mandatory, but that no other elements are optional and may or may not be present depending upon whether or not they affect the activity or action of the listed elements.

[0073] As used herein, the term “Chimeric Antigen Receptor” or alternatively a “CAR” refers to a recombinant polypeptide construct comprising at least an extracellular antigen binding domain, a transmembrane domain, and a cytoplasmic signaling domain comprising a functional signaling domain derived from a stimulatory molecule as defined below. In one aspect, the stimulatory molecule is the zeta chain associated with the T cell receptor complex. In one aspect, the cytoplasmic signaling domain further comprises one or more functional signaling domains derived from at least one costimulatory molecule as defined below. In one aspect, the costimulatory molecule is chosen from 4-1BB (i.e., CD137), CD3, and / or CD28.

[0074] In certain embodiments, the extracellular antigen binding domain comprise an antibody or antibody fragment that binds an antigen. The portion of the CAR composition comprising an antibody or antibody fragment thereof may exist in a variety of forms where the antigen binding domain is expressed as part of a contiguous polypeptide chain including, for example, a single domain antibody fragment (sdAb), a single chain antibody (scFv) and a humanized antibody (Harlow et al., 1999, In: Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY; Harlow et al., 1989, In: Antibodies: A Laboratory Manual, Cold Spring Harbor, New York; Houston et al., 1988, Proc. Natl. Acad. Sci. USA 85:5879-5883; Bird et al., 1988, Science 242:423-426). In one aspect, the antigen binding domain of a CAR composition comprises an antibody fragment. In one embodiment, the CAR comprises an antibody fragment that comprises a scFv.

[0075] As used herein, a “signaling domain” is the functional portion of a protein which acts by transmitting information within the cell to regulate cellular activity via defined signaling pathways by generating second messengers or functioning as effectors by responding to such messengers.Attorney Docket No. JBI6969WOPCT1

[0076] Antibodies can be polyclonal or monoclonal, multiple or single chain, or intact immunoglobulins, and may be derived from natural sources or from recombinant sources. Antibodies are typically tetramers of immunoglobulin molecules.

[0077] The term “antibody fragment” refers to at least one portion of an intact antibody, or recombinant variants thereof, and refers to the antigen binding domain, e.g., an antigenic determining variable region of an intact antibody, that is sufficient to confer recognition and specific binding of the antibody fragment to a target, such as an antigen. Examples of antibody fragments include, but are not limited to, Fab, Fab', F(ab')2, and Fv fragments, scFv antibody fragments, linear antibodies, single domain antibodies such as sdAb (either VE or VH), camelid VHH domains, and multi-specific antibodies formed from antibody fragments. The term “scFv” refers to a fusion protein comprising at least one antibody fragment comprising a variable region of a light chain and at least one antibody fragment comprising a variable region of a heavy chain, wherein the light and heavy chain variable regions are contiguously linked via a short flexible polypeptide linker, and capable of being expressed as a single chain polypeptide, and wherein the scFv retains the specificity of the intact antibody from which it is derived. Unless specified, as used herein an scFv may have the VE and VH variable regions in either order, e.g., with respect to the N-terminal and C-terminal ends of the polypeptide, the scFv may comprise VE-linker-VH or may comprise VH-linker-VE.

[0078] An “antibody heavy chain,” as used herein, refers to the larger of the two types of polypeptide chains present in antibody molecules in their naturally occurring conformations, and which normally determines the class to which the antibody belongs.

[0079] An “antibody light chain,” as used herein, refers to the smaller of the two types of polypeptide chains present in antibody molecules in their naturally occurring conformations. Kappa (K) and lambda (X) light chains refer to the two major antibody light chain isotypes.

[0080] By the term “recombinant antibody” as used herein, is meant an antibody which is generated using recombinant DNA technology, such as, for example, an antibody expressed by a bacteriophage or yeast expression system. The term should also be construed to mean an antibody which has been generated by the synthesis of a DNA molecule encoding the antibody and which DNA molecule expresses an antibody protein,Attorney Docket No. JBI6969WOPCT1 or an amino acid sequence specifying the antibody, wherein the DNA or amino acid sequence has been obtained using recombinant DNA or amino acid sequence technology which is available and well known in the art.

[0081] As used herein, the term “immune cell” includes cells that are of hematopoietic origin and that play a role in the immune response. Immune cells include lymphocytes, such as B cells and T cells; natural killer cells; myeloid cells, such as monocytes, macrophages, dendritic cells, eosinophils, mast cells, basophils, and granulocytes.

[0082] As used herein, the term “immune response” includes T cell mediated and / or B cell mediated immune responses that are influenced by modulation of T cell costimulation. The term immune response further includes immune responses that are indirectly effected by T cell activation such as antibody production (humoral responses) and the activation of cytokine responsive cells such as macrophages.

[0083] As used herein, the term “T cell immune response” refers to activation of antigen specific T cells as measured by proliferation or expression of molecules on the cell surface or secretion of proteins such as cytokines.

[0084] As used herein, the term “T cell” refers to a lymphocyte (e.g., white blood cell) that functions in cell-mediated immunity. In some embodiments, the presence of a T cell receptor (TCR) on the cell surface distinguishes T cells from other lymphocytes. As is known in the art, T cells typically do not present antigens, and rely on other lymphocytes (e.g., natural killer cells and B cells) to aid in antigen presentation. Types of T cells include: a[3 T cells, including primary a[3 T cells, y8 T cells T helper cells (TH cells), Memory T cells (Tcm, Tern, or Temra), Regulatory T cells (Treg), Cytotoxic T cells (CTLs), Natural killer T cells (NK cells), gamma delta T cells, and Mucosal associated invariant T cells (MAIT), and T cells derived from induced pluripotent stem cells (iPSCs), such as iy8 T cells.

[0085] As used herein, the term "TCR" refers to "T cell receptor." A T cell receptor is a molecule on the surface of T lymphocytes ("T cells"). In embodiments, the receptor is an aP-TCR receptor, meaning that the T cell receptor comprises an alpha (a) and beta (P) chain, which is typically expressed as part of a complex with CD3 chain molecules.

[0086] As used herein, the term “B cell” refers to a cell produced in the bone marrow of an animal expressing membrane -bound antibody specific for an antigen. FollowingAttorney Docket No. JBI6969WOPCT1 interaction with the antigen it differentiates into a plasma cell producing antibodies specific for the antigen or into a memory B cell. “B cell” and “B lymphocyte” are used interchangeably. Naive as well as activated B cells are within the scope of the invention.

[0087] As used herein, the term “antigen-specific B cell” refers to a B cell which expresses antibodies that are able to distinguish between the antigen of interest and other antigens and which specifically bind to that antigen of interest with high or low affinity but which do not bind to other antigens.

[0088] As used herein, the term “positive B cell” means any B cell which is labeled with any one of the labeling compounds of the embodiments described herein and which is selected or sorted or otherwise separated from a mixture of cells by a device capable of detecting said labeling compound. For example, a B cell which is positive for the first labeling compound is a B cell which is labeled with a first labeling compound and which is selected by the device capable of detecting said first labeling compound.

[0089] As used herein, the term “B cell marker” refers to surface molecules on the B cells which are specific for antigen-specific IgG-producing B cells. B cell markers suitable for use as described in the embodiments herein include, but are not limited to surface IgG, kappa and lambda chains, Ig-alpha (CD79alpha), Ig-beta (CD79beta), CD19, la, Fc receptors, B220 (CD45R), CD20, CD21, CD22, CD23, CD81 (TAPA-1) or any other CD antigen specific for B cells.

[0090] As used herein, the term “autologous” is meant to refer to any material derived from the same individual to whom it is later to be re-introduced into the individual.

[0091] “Allogeneic” refers to any material derived from a different animal of the same species as the individual to whom the material is introduced. Two or more individuals are said to be allogeneic to one another when the genes at one or more loci are not identical. In some aspects, allogeneic material from individuals of the same species may be sufficiently unlike genetically to interact antigenically.

[0092] “Xenogeneic” refers to a graft derived from an animal of a different species.

[0093] An “antigen presenting cell” or “APC” as used herein, means an immune system cell such as an accessory cell (e.g., a B-cell, a dendritic cell, and the like) that displays foreign antigens complexed with HLA I, HLA II, MHC I, or MHC II complexes on theirAttorney Docket No. JBI6969WOPCT1 surfaces. For example, T cells may recognize these complexes using their T cell receptors (TCRs). APCs process antigens and present them to T cells.

[0094] As used herein “zeta” or alternatively “zeta chain”, “CD3-zeta” or “TCR-zeta” is defined as the protein provided as GenBank acc. no. BAG36664.1, or the equivalent residues from a non-human species, e.g., mouse, rodent, monkey, ape and the like, and a “zeta stimulatory domain” or alternatively a “CD3-zeta stimulatory domain” or a “TCR- zeta stimulatory domain” is defined as the amino acid residues from the cytoplasmic domain of the zeta chain that are sufficient to functionally transmit an initial signal necessary for T cell activation. In one aspect, the cytoplasmic domain of zeta comprises residues 52 through 164 of GenBank acc. no. BAG36664.1 or the equivalent residues from a non-human species, e.g., mouse, rodent, monkey, ape and the like, that are functional orthologs thereof.

[0095] A “costimulatory molecule” refers to the cognate binding partner on a cell that specifically binds with a costimulatory ligand, thereby mediating a costimulatory response by the cell, such as, but not limited to, proliferation. Costimulatory molecules are cell surface molecules other than antigen receptors or their ligands that are required for an efficient immune response. Costimulatory molecules include, but are not limited to an HLA class I molecule, HLA class II molecule, MHC class I molecule, MHC class II molecule, MHC class III molecule, BTLA and a Toll ligand receptor, as well as 0X40, CD3, CD27, CD28, CDS, ICAM-1, LFA-1 (CDl la / CD18) and 4- IBB (CD 137).

[0096] As used herein “4- IBB” is defined as member of the TNFR superfamily with an amino acid sequence provided as GenBank aceno. AAA62478.2, or the equivalent residues from a non-human species, e.g., mouse, rodent, monkey, ape and the like; and a “4-1BB costimulatory domain” are defined amino acid residues 214-255 of GenBank aceno. AAA62478.2, or the equivalent residues from a non-human species, e.g., mouse, rodent, monkey, ape and the like. In one aspect, the “4- IBB costimulatory domain” is a sequence derived from a non-human species, e.g., mouse, rodent, monkey, ape and the like.

[0097] As used herein, the terms nucleic acid, polynucleotide and nucleotide are interchangeable and refer to any nucleic acid, whether composed of phosphodiester linkages or modified linkages such as phosphotriester, phosphoramidate, siloxane,Attorney Docket No. JBI6969WOPCT1 carbonate, carboxymethylester, acetamidate, carbamate, thioether, bridged phosphoramidate, bridged methylene phosphonate, bridged phosphoramidate, bridged phosphoramidate, bridged methylene phosphonate, phosphorothioate, methylphosphonate, phosphorodithioate, bridged phosphorothioate or sultone linkages, and combinations of such linkages.

[0098] The terms nucleic acid, polynucleotide and nucleotide also specifically include nucleic acids composed of bases other than the five biologically occurring bases (adenine, guanine, thymine, cytosine and uracil).

[0099] As used herein, a nucleic acid molecule is said to be “isolated” when the nucleic acid molecule is substantially separated from contaminant nucleic acid molecules encoding other polypeptides.

[0100] The terms “complementary” and “complementarity” refer to polynucleotides (i.e., a sequence of nucleotides) related by the base-pairing rules. For example, the complementary strand of the DNA sequence 5' A G T C A T G 3' is 3' T C A G T A C 5'. The latter sequence is often written as the reverse complement with the 5' end on the left and the 3' end on the right, 5' C A T G A C T 3'. A sequence that is equal to its reverse complement is said to be a palindromic sequence. Complementarity can be “partial,” in which only some of the nucleic acids' bases are matched according to the base pairing rules. Or, there can be “complete” or “total” complementarity between the nucleic acids.

[0101] By “transgene” is meant any nucleotide sequence, particularly a DNA sequence, that is integrated into one or more chromosomes of a host cell by human intervention, such as by the methods of the present description. The transgene preferably comprises a “gene of interest.”

[0102] A “gene of interest” is not limited in any way and may be any nucleic acid, without limitation, that is desired to be delivered to, integrated, transcribed, translated, and / or expressed in a target cell. The gene of interest may encode a functional product, such as a protein or an RNA molecule. The gene of interest is generally operatively linked to other sequences that are useful for obtaining the desired expression of the gene of interest, such as transcriptional regulatory sequences. The term “polynucleotide(s)-of- interest” refers to one or more polynucleotides, e.g., a polynucleotide encoding aAttorney Docket No. JBI6969WOPCT1 polypeptide (i.e., a polypeptide-of-interest), inserted into an expression vector that is desired to be expressed.

[0103] The term “operably linked”, refers to a juxtaposition wherein the components described are in a relationship permitting them to function in their intended manner. A “functional relationship” and “operably linked” mean, with respect to the gene of interest, that the gene is in the correct location and orientation with respect to the promoter and / or enhancer that expression of the gene will be affected when the promoter and / or enhancer is contacted with the appropriate molecules.

[0104] The terms “express” and “expression” mean allowing or causing the information in a gene or DNA sequence to become manifest, for example producing a protein by activating the cellular functions involved in transcription and translation of a corresponding gene or DNA sequence. A DNA sequence is expressed in or by a cell to form an “expression product” such as a protein. The expression product itself, e.g. the resulting protein, may also be said to be “expressed” by the cell. A polynucleotide or polypeptide is expressed recombinantly, for example, when it is expressed or produced in a foreign host cell under the control of a foreign or native promoter, or in a native host cell under the control of a foreign promoter.

[0105] The term “regulatory element” and “expression control element” are used interchangeably and refer to nucleic acid molecules that can influence the transcription and / or translation of an operably linked coding sequence in a particular environment. These terms are used broadly and cover all elements that promote or regulate transcription, including promoters, core elements required for basic interaction of RNA polymerase and transcription factors, upstream elements, enhancers, and response elements (see, e.g., Lewin, “Genes V” (Oxford University Press, Oxford) pages 847-873). Exemplary regulatory elements in prokaryotes include promoters, operator sequences and a ribosome binding sites. Regulatory elements that are used in eukaryotic cells may include, without limitation, promoters, enhancers, splicing signals and polyadenylation signals.

[0106] The term “nucleic acid regulatory domain” refers collectively to promoter sequences (e.g., pol II promoter sequences), polyadenylation signals, transcription termination sequences, upstream regulatory domains, origins of replication, enhancersAttorney Docket No. JBI6969WOPCT1 and the like, which collectively provide for the replication, transcription and translation of a coding sequence in a recipient cell. Not all of these control sequences need always be present so long as the selected coding sequence is capable of being replicated, transcribed and translated in an appropriate host cell.

[0107] The term “promoter” or “promoter region” is used herein in its ordinary sense to refer to a nucleotide region comprising a DNA regulatory sequence, wherein the regulatory sequence is derived from a gene which is capable of binding RNA polymerase and initiating transcription of a downstream (3 '-direction) coding sequence. The regulatory sequence may be homologous or heterologous to the desired gene sequence.

[0108] The term “polypeptide” is used interchangeably with the term “protein” and in its broadest sense refers to a compound of two or more subunit amino acids, amino acid analogs or peptidomimetics. The subunits may be linked by peptide bonds. In another embodiment, the subunit may be linked by other bonds, e.g., ester, ether, etc. As used herein the term “amino acid” refers to either natural and / or unnatural or synthetic amino acids, including glycine and both the D and L optical isomers, amino acid analogs and peptidomimetics. A peptide of three or more amino acids is commonly called an oligopeptide if the peptide chain is short. If the peptide chain is long, the peptide is commonly called a polypeptide or a protein.

[0109] “Polynucleotide,” synonymously referred to as “nucleic acid molecule,” “nucleotides” or “nucleic acids,” refers to any polyribonucleotide or polydeoxyribonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA. “Polynucleotides” include, without limitation single- and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and doublestranded RNA, and RNA that is mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or a mixture of single- and double-stranded regions. In addition, “polynucleotide” refers to triple-stranded regions comprising RNA or DNA or both RNA and DNA. The term polynucleotide also includes DNAs or RNAs containing one or more modified bases and DNAs or RNAs with backbones modified for stability or for other reasons. “Modified” bases include, for example, tritylated bases and unusual bases such as inosine. A variety of modifications may be made to DNA and RNA; thus,Attorney Docket No. JBI6969WOPCT1“polynucleotide” embraces chemically, enzymatically or metabolically modified forms of polynucleotides as typically found in nature, as well as the chemical forms of DNA and RNA characteristic of viruses and cells. “Polynucleotide” also embraces relatively short nucleic acid chains, often referred to as oligonucleotides. In some embodiments, a nucleic acid is provided, wherein the nucleic acid encodes an RNA. In some embodiments, the RNA is a microRNA or a microRNA-adapted shRNA.

[0110] “Intronic enhancer” as described herein refers to a DNA sequence located within an intron that helps regulate gene expression by binding transcription factors and other proteins.

[0111] The term “enhancer” refers to a segment of DNA which contains sequences capable of providing enhanced transcription and in some instances can function independent of their orientation relative to another control sequence. An enhancer can function cooperatively or additively with promoters and / or other enhancer elements. The term “promoter / enhancer” refers to a segment of DNA which contains sequences capable of providing both promoter and enhancer functions.

[0112] An “endogenous” control sequence is one which is naturally linked to a given gene in the genome. An “exogenous” control sequence is one which is placed in juxtaposition to a gene by means of genetic manipulation (i.e., molecular biological techniques) such that transcription of that gene is directed by the linked enhancer / promoter. A “heterologous” control sequence is an exogenous sequence that is from a different species than the cell being genetically manipulated. A “synthetic” control sequence may comprise elements of one more endogenous and / or exogenous sequences, and / or sequences determined in vitro or in silico that provide optimal promoter and / or enhancer activity for the particular gene therapy.

[0113] As used herein, the term “constitutive expression control sequence” refers to a promoter, enhancer, or promoter / enhancer that continually or continuously allows for transcription of an operably linked sequence. A constitutive expression control sequence may be a “ubiquitous” promoter, enhancer, or promoter / enhancer that allows expression in a wide variety of cell and tissue types or a “cell specific,” “cell type specific,” “cell lineage specific,” or “tissue specific” promoter, enhancer, or promoter / enhancer that allows expression in a restricted variety of cell and tissue types, respectively.Attorney Docket No. JBI6969WOPCT1

[0114] As used herein, “conditional expression” may refer to any type of conditional expression including, but not limited to, inducible expression; repressible expression; expression in cells or tissues having a particular physiological, biological, or disease state, etc. This definition is not intended to exclude cell type or tissue specific expression.

[0115] As used herein, the term “heterologous” nucleic acid sequence or transgene refers to (i) a sequence that does not normally exist in a wild-type subject (i.e., human or homo sapiens), (ii) a sequence that originates from a foreign species, or (iii) if from the same species, it may be substantially modified from its original form. Alternatively, an unchanged nucleic acid sequence that is not normally expressed in a cell is a heterologous nucleic acid sequence.

[0116] The term “virus” as used herein is intended to mean the physical virus or retrovirus particle. “Retroviruses” are viruses having an RNA genome.

[0117] “Lentivirus” refers to a genus of retroviruses that are capable of infecting dividing and non-dividing cells. By “dividing” cell is meant a cell that undergoes active mitosis, or meiosis. The phrase “non-dividing” cell refers to a cell that does not go through mitosis. Several examples of lentiviruses include, but are not limited to, HIV (human immunodeficiency virus: including HIV type 1, and HIV type 2), the etiologic agent of the human acquired immunodeficiency syndrome (AIDS); visna-maedi, which causes encephalitis (visna) or pneumonia (maedi) in sheep, the caprine arthritis-encephalitis virus, which causes immune deficiency, arthritis, and encephalopathy in goats; equine infectious anemia virus, which causes autoimmune hemolytic anemia, and encephalopathy in horses; feline immunodeficiency virus (FIV), which causes immune deficiency in cats; bovine immune deficiency virus (BIV), which causes lymphadenopathy, lymphocytosis, and possibly central nervous system infection in cattle; and simian immunodeficiency virus (SIV), which cause immune deficiency and encephalopathy in sub-human primates.

[0118] “Gammaretrovirus” refers to a genus of the retroviridae family. Exemplary gammaretroviruses include, but are not limited to, mouse stem cell virus, murine leukemia virus, feline leukemia virus, feline sarcoma virus, and avian reticuloendotheliosis viruses.Attorney Docket No. JBI6969WOPCT1

[0119] A “hybrid virus” as used herein refers to a virus having components from one or more other viral vectors, including element from non-retroviral vectors, for example, adenoviral-retroviral hybrids. As used herein hybrid vectors having a retroviral component are to be considered within the scope of the retroviruses.

[0120] The terms “vector”, “vector construct” and “expression vector” mean the vehicle by which a nucleic acid molecule such as a DNA or RNA sequence (e.g. a foreign gene) can be introduced into a host cell, so as to transform the host and promote expression (e.g. transcription and translation) of the introduced sequence. Vectors typically comprise the DNA of a transmissible agent, into which foreign DNA encoding a protein is inserted by restriction enzyme technology. A common type of vector is a “plasmid”, which generally is a self-contained molecule of double-stranded DNA that can readily accept additional (foreign) DNA and which can readily introduced into a suitable host cell.

[0121] The term viral vector may refer either to a virus or viral particle capable of transferring a nucleic acid into a cell or to the transferred nucleic acid itself. Viral vectors and transfer plasmids contain structural and / or functional genetic elements that are primarily derived from a virus. As will be evident to one of skill in the art, the term “viral vector” is widely used to refer either to a nucleic acid molecule (e.g., a transfer plasmid) that includes virus-derived nucleic acid elements that typically facilitate transfer of the nucleic acid molecule or integration into the genome of a cell or to a viral particle that mediates nucleic acid transfer. Viral particles will typically include various viral components and sometimes also host cell components in addition to nucleic acid(s).

[0122] The term “cell line” as used herein refers to cultured cells that can be passed (divided) more than once.

[0123] “Transformation,” as defined herein, describes a process by which exogenous DNA enters a target cell. Transformation may rely on any known method for the insertion of foreign nucleic acid sequences into a prokaryotic or eukaryotic host cell and may include, but is not limited to, viral infection, electroporation, heat shock, lipofection, and particle bombardment. “Transformed” cells include stably transformed cells in which the inserted nucleic acid is capable of replication either as an autonomously replicating plasmid or as part of the host chromosome. Also included are cells that transiently express a gene of interest.Attorney Docket No. JBI6969WOPCT1

[0124] The terms “transfecting” or “transfection” as used herein are intended to mean the transfer of at least one exogenous nucleic acid into a cell. The nucleic acid may be RNA, DNA or a combination of both. The exogenous nucleic acid refers to nucleic that is not found as a result of host cell division or host cell multiplication.

[0125] The expressions “transient expression” and “transiently expressing” as used herein are intended to mean that the genetic material temporal expression period and / or is not integrated permanently and stably in the genome of the host cell, and thus does not have the same expression potential over time as the native genetic material of the host cell.

[0126] The delivery of a gene(s) or other polynucleotide sequences using a retroviral or lentiviral vector by means of viral infection rather than by transfection is referred to as “transduction.” A target cell, is “transduced” if it comprises a gene or other polynucleotide sequence delivered to the cell by infection using a viral or retroviral vector.

[0127] The expressions “stable expression” and “stably expressing” as used herein are intended to mean that the genetic material that is being stably expressed and / or is integrated permanently and stably in the genome of the host cell, and thus has the same expression potential over time as the native genetic material of the host cell.

[0128] A “host cell” includes cells transfected, infected, or transduced in vivo, ex vivo, or in vitro with a recombinant vector or a polynucleotide of the embodiments described herein. Host cells may include packaging cells, producer cells, and cells infected with viral vectors. The term “target cell” is used interchangeably with host cell and refers to transfected, infected, or transduced cells of a desired cell type.

[0129] The term “epitope” or “antigenic determinant” refers to a site on an antigen to which B and / or T cells respond. B-cell epitopes can be formed both from contiguous amino acids or noncontiguous amino acids juxtaposed by tertiary folding of a protein. Epitopes formed from contiguous amino acids are typically retained on exposure to denaturing solvents whereas epitopes formed by tertiary folding are typically lost on treatment with denaturing solvents. An epitope typically includes at least 3, and more usually, at least 5 or 8-10 amino acids in a unique spatial conformation. Methods of determining spatial conformation of epitopes include, for example, x-ray crystallographyAttorney Docket No. JBI6969WOPCT1 and 2-dimensional nuclear magnetic resonance. See, e.g., Epitope Mapping Protocols in Methods in Molecular Biology, Vol. 66, Glenn E. Morris, Ed. (1996). Antibodies that recognize the same epitope can be identified in a simple immunoassay showing the ability of one antibody to block the binding of another antibody to a target antigen. T cells recognize continuous epitopes of about nine amino acids for CD8 cells or about 13- 15 amino acids for CD4 cells. T cells that recognize the epitope can be identified by in vitro assays that measure antigen-dependent proliferation, as determined by3H-thymidine incorporation by primed T cells in response to an epitope (see Burke, supra; Tigges, supra).

[0130] An “immunogenic agent” or “immunogen” is capable of inducing an immunological response against itself on administration to a patient, optionally in conjunction with an adjuvant.

[0131] A “subject,” as used herein, includes any animal that exhibits a symptom of a monogenic disease, disorder, or condition that can be treated with the gene therapy vectors, cell-based therapeutics, and methods disclosed elsewhere herein.

[0132] Suitable subjects (e.g., patients) include laboratory animals (such as mouse, rat, rabbit, or guinea pig), farm animals, and domestic animals or pets (such as a cat or dog). Non-human primates and, preferably, human patients, are included. Typical subjects include animals that exhibit aberrant amounts (lower or higher amounts than a “normal” or “healthy” subject) of one or more physiological activities that can be modulated by gene therapy.

[0133] As used herein “treatment” or “treating,” includes any beneficial or desirable effect on the symptoms or pathology of a disease or pathological condition, and may include even minimal reductions in one or more measurable markers of the disease or condition being treated. Treatment can involve optionally either the reduction or amelioration of symptoms of the disease or condition, or the delaying of the progression of the disease or condition. “Treatment” does not necessarily indicate complete eradication or cure of the disease or condition, or associated symptoms thereof.

[0134] As used herein, “prevent,” and similar words such as “prevented,” “preventing” etc., indicate an approach for preventing, inhibiting, or reducing the likelihood of the occurrence or recurrence of, a disease or condition. It also refers to delaying the onset orAttorney Docket No. JBI6969WOPCT1 recurrence of a disease or condition or delaying the occurrence or recurrence of the symptoms of a disease or condition. As used herein, “prevention” and similar words also includes reducing the intensity, effect, symptoms and / or burden of a disease or condition prior to onset or recurrence of the disease or condition.

[0135] The term “therapeutic” is used in a generic sense and includes treating agents, prophylactic agents, and replacement agents. The term “therapeutic” can to an action that prevents, reverses, or slows the natural course of a disease, or its symptoms. A therapeutic action can be preventive, curative or merely palliative, and does not mean that the affected human or animal patient will not die from the disease.

[0136] As used herein, the term “amount” refers to “an amount effective” or “an effective amount” of a virus or transduced therapeutic cell to achieve a beneficial or desired prophylactic or therapeutic result, including clinical results.

[0137] A “prophylactically effective amount” refers to an amount of a virus or transduced therapeutic cell effective to achieve the desired prophylactic result. Typically but not necessarily, since a prophylactic dose is used in subjects prior to or at an earlier stage of disease, the prophylactically effective amount is less than the therapeutically effective amount.

[0138] A “therapeutically effective amount” of a virus or transduced therapeutic cell may vary according to factors such as the disease state, age, sex, and weight of the individual, and the ability of the stem and progenitor cells to elicit a desired response in the individual. A therapeutically effective amount is also one in which any toxic or detrimental effects of the virus or transduced therapeutic cells are outweighed by the therapeutically beneficial effects. The term “therapeutically effective amount” includes an amount that is effective to “treat” a subject (e.g., a patient).

[0139] The phrase “pharmaceutically-acceptable” refers to molecular entities and compositions that do not produce an allergic or similar untoward reaction when administered to a human. The preparation of an aqueous composition that contains a protein as an active ingredient is well understood in the art. Typically, such compositions are prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for solution in, or suspension in, liquid prior to injection can also be prepared. The preparation can also be emulsified.Attorney Docket No. JBI6969WOPCT1

[0140] As used herein, “carrier” includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredient, its use in the therapeutic compositions is contemplated. Supplementary active ingredients can also be incorporated into the compositions.

[0141] As used herein “pharmaceutically acceptable carrier” includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible, including pharmaceutically acceptable cell culture media.

[0142] In the following description, certain specific details are set forth in order to provide a thorough understanding of various embodiments of the invention. However, one skilled in the art will understand that the invention may be practiced without these details.

[0143] Reference throughout this specification to “one embodiment” or “an embodiment” means that a particular feature, structure or characteristic described in connection with the embodiment is included in at least one embodiment of the present description. Thus, the appearances of the phrases “in one embodiment” or “in an embodiment” in various places throughout this specification are not necessarily all referring to the same embodiment. Furthermore, the particular features, structures, or characteristics may be combined in any suitable manner in one or more embodiments.

[0144] All publications mentioned herein are incorporated herein by reference in full for the purpose of describing and disclosing the methodologies, which are described in the publications, which might be used in connection with the description herein. The publications discussed above and throughout the text are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior disclosure.Attorney Docket No. JBI6969WOPCT1Nucleic acids

[0145] In some embodiments, a nucleic acid molecule is provided comprising a first sequence comprising a promoter, wherein the promoter drives expression in T cells, and wherein the promoter does not drive expression in cells that are non-T cells, and a second sequence encoding a protein or an RNA. In some embodiments, the promoter comprises a lymphocyte protein tyrosine kinase (LCK) promoter. In some embodiments, the nucleic acid molecule is a DNA molecule. In some embodiments, the T cells are primary aP T cells. In some embodiments, the T cells are iPSC-derived y8 T (iy8 T) cells. In some embodiments, the non-T cells are iPSCs.

[0146] In some embodiments, the nucleic acid molecule comprises a first sequence comprising an LCK promoter comprising a nucleic acid sequence with at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93% ,94%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO:1. In some embodiments, the nucleic acid molecule comprises a first sequence comprising SEQ ID NO: 1.

[0147] In some embodiments, the nucleic acid molecule comprises a second nucleic acid sequence encoding an RNA. In some embodiments, the second nucleic acid encodes a microRNA, a microRNA-adapted shRNA, small interfering RNA (siRNA), antisense oligonucleotide (ASO), or a ribozyme. In some embodiments, the second nucleic acid sequence encodes a microRNA.

[0148] In some embodiments, the second sequence encodes a protein. In some embodiments, the protein is a Chimeric Antigen Receptor (CAR) or an engineered T cell receptor (TCR). In various embodiments, the CAR can be any CAR molecule including, but not limited to, a “first generation,” “second generation,” “third generation,” “fourth generation” or “fifth generation” CAR (see, for example, Sadelain et al., Cancer Discov. 3(4):388-398 (2013); Jensen et al., Immunol. Rev. 257:127-133 (2014); Sharpe et al., Dis. Model Meeh. 8(4):337-350 (2015); Brentjens et al., Clin. Cancer Res. 13:5426-5435 (2007); Gade et al., Cancer Res. 65:9080-9088 (2005); Maher et al., Nat. Biotechnol.20:70-75 (2002); Kershaw et al., J. Immunol. 173:2143-2150 (2004); Sadelain et al., Curr. Opin. Immunol. (2009); Hollyman et al., J. Immunother. 32: 169-180 (2009)).Attorney Docket No. JBI6969WOPCT1

[0149] “First generation” CARs for use in the embodiments described herein comprise an antigen binding domain, for example, a single-chain variable fragment (scFv), fused to a transmembrane domain, which is fused to a cytoplasmic / intracellular domain of a T cell receptor chain. “First generation” CARs typically have the intracellular domain from the CD3^-chain, which is the primary transmitter of signals from endogenous T cell receptors (TCRs). “First generation” CARs can provide de novo antigen recognition and cause activation of both CD4+ and CD8+ T cells through their CD3^ chain signaling domain in a single fusion molecule, independent of HLA-mediated antigen presentation.

[0150] “Second-generation” CARs for use in the embodiments described herein comprise an antigen binding domain, for example, a single-chain variable fragment (scFv), fused to an intracellular signaling domain capable of activating T cells and a co-stimulatory domain designed to augment T cell potency and persistence (Sadelain et al., Cancer Discov. 3:388-398 (2013)). CAR design can therefore combine antigen recognition with signal transduction, two functions that are physiologically borne by two separate complexes, the TCR heterodimer and the CD3 complex. “Second generation” CARs include an intracellular domain from various co-stimulatory molecules, for example, CD28, 4-1BB, ICOS, 0X40, and the like, in the cytoplasmic tail of the CAR to provide additional signals to the cell.

[0151] “Second generation” CARs provide both co-stimulation, for example, by CD28 or 4- IBB domains, and activation, for example, by a CD3^ signaling domain. Preclinical studies have indicated that “Second Generation” CARs can improve the anti-tumor activity of T cells. For example, robust efficacy of “Second Generation” CAR modified T cells was demonstrated in clinical trials targeting the CD 19 molecule in patients with chronic lymphoblastic leukemia (CLL) and acute lymphoblastic leukemia (ALL) (Davila et al., Oncoimmunol. 1(9): 1577-1583 (2012)).

[0152] “Third generation” CARs provide multiple co-stimulation, for example, by comprising both CD28 and 4- IBB domains, and activation, for example, by comprising a CD3^ activation domain.

[0153] “Fourth generation” CARs provide co-stimulation, for example, by CD28 or 4- 1BB domains, and activation, for example, by a CD3^ signaling domain in addition to a constitutive or inducible chemokine component.Attorney Docket No. JBI6969WOPCT1

[0154] “Fifth generation” CARs provide co-stimulation, for example, by CD28 or 4- IBB domains, and activation, for example, by a CD3^ signaling domain, a constitutive or inducible chemokine component, and an intracellular domain of a cytokine receptor, for example, IL-2R[3.

[0155] In various embodiments, the CAR can be included in a multivalent CAR system, for example, a DualCAR or “TandemCAR” system. Multivalent CAR systems include systems or cells comprising multiple CARs and systems or cells comprising bivalent / bispecific CARs targeting more than one antigen.

[0156] A CAR can be generated using well known methods for designing a CAR, including those as described herein. A CAR, whether a first, second, third, fourth or fifth generation CAR, can be readily designed by fusing an antigen binding domain, to an immune cell signaling domain, such as a T cell receptor cytoplasmic / intracellular domain. As described above, the CAR generally has the structure of a cell surface receptor, with the antigen binding activity, such as an scFv, as at least a portion of the extracellular domain, fused to a transmembrane domain, which is fused to an intracellular domain that has cell signaling activity in a T cell. The CAR can include co-stimulatory molecules, as described herein. One skilled in the art can readily select appropriate transmembrane domains, as described herein and known in the art, and intracellular domains to provide the desired signaling capability in the T cell.

[0157] In some embodiments, the antigen binding domain of the CAR binds a tumor antigen. In one embodiment, the antigen binding domain of the CAR comprises an antibody or fragment thereof. The antibody can be expressed as an immunoglobulin, for example, an IgG, or as a Bi-specific T cell engager (BiTE), a diabody, a duel affinity retargeting antibody (DART), a Fab, a F(ab'), a single chain variable fragment (scFv), a nanobody, a bi-specific antibody, or the like.

[0158] In some embodiments, the antigen binding domain can be an scFv or a Fab, or any suitable antigen binding fragment of an antibody (see Sadelain et al., Cancer Discov. 3:38-398 (2013)). Many antibodies or antigen binding domains derived from antibodies that bind to an antigen, such as a cancer antigen, are known in the art. Alternatively, such antibodies or antigen binding domains can be produced by routine methods. Methods of generating an antibody are well known in the art, including methods of producing aAttorney Docket No. JBI6969WOPCT1 monoclonal antibody or screening a library to obtain an antigen binding polypeptide, including screening a library of human Fabs (Winter and Harris, Immunol. Today 14:243-246 (1993); Ward et al., Nature 341:544-546 (1989); Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press (1988); Hilyard et al., Protein Engineering: A practical approach (IRL Press 1992); Borrabeck, Antibody Engineering, 2nd ed. (Oxford University Press 1995); Huse et al., Science 246:1275-1281 (1989)). For the CAR, the antigen binding domain derived from an antibody can be human, humanized, chimeric, CDR-grafted, and the like, as desired. For example, if a mouse monoclonal antibody is a source antibody for generating the antigen binding domain of a CAR, such an antibody can be humanized by grafting CDRs of the mouse antibody onto a human framework (see Borrabeck, supra, 1995), which can be beneficial for administering the CAR to a human subject. In a preferred embodiment, the antigen binding domain is an scFv. The generation of scFvs is well known in the art (see, for example, Huston, et al., Proc. Nat. Acad. Sci. USA 85:5879-5883 (1988); Ahmad et al., Clin. Dev. Immunol. 2012: ID980250 (2012); U.S. Pat. Nos. 5,091,513, 5,132,405 and 4,956,778; and U.S. Patent Publication Nos. 20050196754 and 20050196754)).

[0159] In some embodiments, a CAR can comprise a signaling domain derived from a CD3^ polypeptide, for example, a signaling domain derived from the intracellular domain of CD3^, which can activate or stimulate an immune cell. CD3^ comprises 3 Immune - receptor-Tyrosine-based- Activation-Motifs (IT AMs), and transmits an activation signal to the cell, for example, a cell of the lymphoid lineage, such as a T cell, after antigen is bound. It is understood that a “CD3^ nucleic acid molecule” refers to a polynucleotide encoding a CD3^ polypeptide.

[0160] In certain non-limiting embodiments, an intracellular domain of a CAR can further comprise at least one co-stimulatory signaling domain. Such a co-stimulatory signaling domain can provide increased activation of an immune cell. A co-stimulatory signaling domain can be derived from a CD28 polypeptide, a 4- IBB polypeptide, an 0X40 polypeptide, an ICOS polypeptide, a DAP10 polypeptide, a 2B4 polypeptide, and the like. In some embodiments, the intracellular domain of a CAR can comprise a co- stimulatory signaling region that comprises two co-stimulatory molecules, such as CD28 and 4- IBB, or other combinations of co-stimulatory ligands, as disclosed herein.Attorney Docket No. JBI6969WOPCT1

[0161] In some embodiments, the antigen binding domain of a CAR can be fused to a leader or a signal peptide that directs the nascent protein into the endoplasmic reticulum and subsequent translocation to the cell surface. It is understood that, once a polypeptide containing a signal peptide is expressed at the cell surface, the signal peptide has generally been proteolytically removed during processing of the polypeptide in the endoplasmic reticulum and translocation to the cell surface. Thus, in some embodiments, a polypeptide such as a CAR is expressed at the cell surface as a mature protein lacking the signal peptide, whereas the precursor form of the polypeptide includes the signal peptide. The signal sequence or leader is a peptide sequence generally present at the N- terminus of newly synthesized proteins that directs their entry into the secretory pathway. The signal peptide is covalently joined to the N-terminus of the extracellular antigenbinding domain of a CAR as a fusion protein. Any suitable signal peptide, as are well known in the art, can be applied to a CAR to provide cell surface expression in an immune cell (see Gierasch Biochem. 28:923-930 (1989); von Heijne, J. Mol. Biol. 184 ( 1):99- 105 (1985)). Exemplary signal peptides can be derived from cell surface proteins naturally expressed in an immune cell, including any of the signal peptides of the polypeptides disclosed herein. Thus, any suitable signal peptide can be utilized to direct a CAR to be expressed at the cell surface of an immune cell.

[0162] In some embodiments, an antigen-binding domain of a CAR can comprise a linker sequence or peptide linker connecting the heavy chain variable region and light chain variable region of the antigen-binding domain. In certain non-limiting embodiments, a CAR can also comprise a spacer region or sequence that links the domains of the CAR to each other. For example, a spacer can be included between a signal peptide and an antigen binding domain, between the antigen binding domain and the transmembrane domain, between the transmembrane domain and the intracellular domain, and / or between domains within the intracellular domain, for example, between a stimulatory domain and a co-stimulatory domain. The spacer region can be flexible enough to allow interactions of various domains with other polypeptides, for example, to allow the antigen binding domain to have flexibility in orientation in order to facilitate antigen recognition. The spacer region can be, for example, the hinge region from an IgG,Attorney Docket No. JBI6969WOPCT1 the CH2CH3 (constant) region of an immunoglobulin, and / or portions of CD3 (cluster of differentiation 3) or some other sequence suitable as a spacer.

[0163] In some embodiments, the transmembrane domain of a CAR comprises a hydrophobic alpha helix that spans at least a portion of the membrane. Different transmembrane domains result in different receptor stability. After antigen recognition, receptors cluster, and a signal is transmitted to the cell. In an embodiment, the transmembrane domain of a CAR can be derived from another polypeptide that is naturally expressed in the immune cell. In one embodiment, a CAR can have a transmembrane domain derived from CD8, CD28, CD3, CD4, 4- IBB, 0X40, ICOS, CTLA-4, PD-1, LAG-3, 2B4, BTLA, or other polypeptides expressed in the immune cell having a transmembrane domain, including others as disclosed herein or that are well known in the art. In some embodiments, the CAR has a transmembrane domain derived from CD28 and / or 4-1BB. Optionally, the transmembrane domain can be derived from a polypeptide that is not naturally expressed in the immune cell, so long as the transmembrane domain can function in transducing signal from antigen bound to the CAR to the intracellular signaling and / or co-stimulatory domains. It is understood that the portion of the polypeptide that comprises a transmembrane domain of the polypeptide can include additional sequences from the polypeptide, for example, additional sequences adjacent on the N-terminal or C-terminal end of the transmembrane domain, or other regions of the polypeptide, as desired.

[0164] Exemplary CARs include those described, for example, in U.S. Patent No.: 7,446,190, and those described in International Patent Application Publication No.: WO / 2014055668 Al. Examples of the CARs include CARs as disclosed in any of the aforementioned publications, such as WO2014031687, US 8,339,645, US 7,446,179, US 2013 / 0149337, U.S. Patent No.: 7,446,190, US Patent No.: 8,389,282, Kochenderfer et al., 2013, Nature Reviews Clinical Oncology, 10, 267-276 (2013); Wang et al. (2012) J. Immunother. 35(9): 689-701; and Brentjens et al., Sci Transl Med. 2013 5(177). See also WO2014031687, US 8,339,645, US 7,446,179, US 2013 / 0149337, U.S. Patent No.: 7,446,190, and US Patent No.: 8,389,282. Exemplary CARs also include any described in Marofi et al., Stem Cell Res Ther 12: 81 (2021); Townsend et al., J Exp Clin Cancer Res 37: 163 (2018); Ma et al., Int J Biol Sci 15(12): 2548-2560 (2019); Zhao and Cao, FrontAttorney Docket No. JBI6969WOPCT1Immunol 10: 2250 (2019); Han et al., J Cancer 12(2): 326-334 (2021); Specht et al., Cancer Res 79: 4 Supplement, Abstract P2-09-13; Byers et al., Journal of Clinical Oncology 37, no. 15_suppl (2019); Panowski et al., Cancer Res 79 (13 Supplement) 2326 (2019); and Sauer et al., Blood 134 (Supplement_l): 1932 (2019); or can contain any of the antibodies or antigen-binding fragments described in U.S. Patent No. 8,153,765; 8,603477, 8,008,450; U.S. Pub. No. US20120189622 or US20100260748; and International PCT Publication Nos.W02006099875, W02009080829, WO2012092612, W02014210064.

[0165] Further exemplary CARs include the CARs of idecabtagene vicleucel, ABECMA®, BCMA02, JCARH125, JNJ- 68284528 (LCAR-B38M; ciltacabtagene autoleucel; CARVYKTI™) (Janssen / Legend), P- BCMA-101 (Poseida), PBCAR269A (Poseida), P-BCMA-Allol (Poseida), Allo-715 (Pfizer / Allogene), CT053 (Carsgen), Descartes-08 (Cartesian), PHE885 (Novartis), ARI-002 (Hospital Clinic Barcelona, ID IB APS), and CTX120 (CRISPR Therapeutics).

[0166] Exemplary CARs also include the CARs of FDA- approved products BREYANZI® (lisocabtagene maraleucel), TECARTUS™ (brexucabtagene autoleucel), KYMRIAH™ (tisagenlecleucel), and YESCARTA™ (axicabtagene ciloleucel), ABECMA® (idecabtagene vicleucel), and CARVYKTI™ (ciltacabtagene autoleucel). In some of any of the provided embodiments, the CAR is the CAR of BREYANZI® (lisocabtagene maraleucel), TECARTUS™ (brexucabtagene autoleucel), KYMRIAH™ (tisagenlecleucel), YESCARTA™ (axicabtagene ciloleucel), ABECMA® (idecabtagene vicleucel), or CARVYKTI™ (ciltacabtagene autoleucel).

[0167] In some embodiments, the nucleic acid molecule further comprises a third sequence comprising an enhancer sequence. In some embodiments, the third sequence is upstream from the first sequence comprising the promoter. In some embodiments, the third sequence is downstream from the first sequence. In some embodiments, the third sequence is incorporated within the first sequence. In some embodiments, the third sequence is adjacent to the first sequence.

[0168] In some embodiments, the enhancer sequence comprises an intronic enhancer. In some embodiments, the enhancer comprises a sequence derived from the first intron of the human LCK gene. In some embodiments, the enhancer sequence comprises theAttorney Docket No. JBI6969WOPCT1 splicing donor and acceptor sites from the first intron of the human LCK gene. In some embodiments, the enhancer sequence comprises a synthetic intronic enhancer designed for efficient splicing. In some embodiments, the enhancer sequence comprises at least one transcription factor binding site. In some embodiments, the transcription factor binding site is a T cell-specific transcription factor binding site. In some embodiments, the enhancer sequence comprises a combination of at least one intronic enhancer region and at least one transcription factor binding site.

[0169] In some embodiments, the third sequence comprises at least one T cell-specific transcription factor binding site with at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, or SEQ ID NO:28. In some embodiments, the third sequence comprises SEQ ID NO:28.

[0170] In some embodiments, the third sequence comprises a sequence derived from the first intron of the human LCK gene and at least one T cell-specific transcription factor binding site. In some embodiments, the nucleic acid molecule comprises a third sequence with at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, or SEQ ID NO: 18. In some embodiments, the third sequence comprises SEQ ID NO: 18.

[0171] In some embodiments, the nucleic acid molecule comprises a third sequence comprising a synthetic intronic enhancer and at least one T cell-specific transcription factor binding site. In some embodiments, the nucleic acid molecule comprises a third sequence with at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO:20 or SEQ ID NO:21.Attorney Docket No. JBI6969WOPCT1

[0172] In some embodiments, the nucleic acid molecule comprises a third sequence comprising a sequence derived from the first intron of the human LCK gene and the EFla intron. In some embodiments, the nucleic acid molecule comprises a third sequence with at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 19. In some embodiments, the nucleic acid molecule comprises a third sequence comprising SEQ ID NO: 19.

[0173] In some embodiments, the nucleic acid molecule comprises a first sequence comprising an LCK promoter, a second sequence encoding a protein or RNA, and a third sequence comprising at least one enhancer. In some embodiments, the nucleic acid molecule comprises a first sequence comprising an LCK promoter and a third sequence comprising a sequence derived from the first intron of the human LCK gene and at least one T cell-specific transcription factor binding site. In some embodiments, the nucleic acid molecule comprises a sequence with at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, or SEQ ID NO:8. In some embodiments, the nucleic acid molecule comprises SEQ ID NO:8.

[0174] In some embodiments, the nucleic acid molecule comprises a first sequence comprising an LCK promoter and a third sequence comprising a synthetic intronic enhancer and at least one T cell-specific transcription factor binding site. In some embodiments, the nucleic acid molecule comprises a sequence with at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO:9 or SEQ ID NO: 10.

[0175] In some embodiments, the nucleic acid molecule comprises a first sequence comprising an LCK promoter and a third sequence comprising a sequence derived from the first intron of the human LCK gene and the EFla intron. In some embodiments, theAttorney Docket No. JBI6969WOPCT1 nucleic acid molecule comprises a sequence with at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 11.

[0176] Also provided herein are vectors in which a nucleic acid molecule described herein is inserted. The desired nucleic acid molecule can be cloned into a number of types of vectors. However, embodiments of the present description should not be construed to be limited to any particular vector. Instead, the present description should be construed to encompass a wide plethora of vectors which are readily available and / or well-known in the art. For example, a desired polynucleotide can be cloned into a vector including, but not limited to a plasmid, a phagemid, a phage derivative, an animal virus, and a cosmid. Vectors of particular interest include expression vectors, replication vectors, probe generation vectors, and sequencing vectors.

[0177] Further, the expression vector may be provided to a cell in the form of a viral vector. Viral vector technology is well known in the art and is described, for example, in Sambrook et al. (2012), and in Ausubel et al. (1997), and in other virology and molecular biology manuals. Viruses, which are useful as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpes viruses, and lentiviruses. In general, a suitable vector contains an origin of replication functional in at least one organism, a promoter sequence, convenient restriction endonuclease sites, and one or more selectable markers. (See, e.g., WO 01 / 96584; WO 01 / 29058; and U.S. Pat. No. 6,326,193.

[0178] A common type of vector is a “plasmid”, which generally is a self-contained molecule of double-stranded DNA that can readily accept additional (foreign) DNA and which can readily introduced into a suitable host cell. A large number of vectors, including plasmid and fungal vectors, have been described for replication and / or expression in a variety of eukaryotic and prokaryotic hosts. Non-limiting examples include pKK plasmids (Clonetech), pUC plasmids, pET plasmids (Novagen, Inc., Madison, Wis.), pRSET or pREP plasmids (Invitrogen, San Diego, Calif.), or pMAL plasmids (New England Biolabs, Beverly, Mass.), and many appropriate host cells, using methods disclosed or cited herein or otherwise known to those skilled in the relevant art.Attorney Docket No. JBI6969WOPCT1Recombinant cloning vectors will often include one or more replication systems for cloning or expression, one or more markers for selection in the host, e.g., antibiotic resistance, and one or more expression cassettes.

[0179] In order to assess the expression of polypeptide or portions thereof, the expression vector to be introduced into a cell can also contain either a selectable marker gene or a reporter gene or both to facilitate identification and selection of expressing cells from the population of cells sought to be transfected or infected through viral vectors. In various embodiments, the selectable marker may be carried on a separate piece of DNA and used in a co- transfection procedure. Both selectable markers and reporter genes may be flanked with appropriate regulatory sequences to enable expression in the host cells. Useful selectable markers include, for example, antibiotic -resistance genes, such as neo and the like.

[0180] Reporter genes are used for identifying potentially transfected cells and for evaluating the functionality of regulatory sequences. In general, a reporter gene is a gene that is not present in or expressed by the recipient organism or tissue and that encodes a polypeptide whose expression is manifested by some easily detectable property, e.g., enzymatic activity. Expression of the reporter gene is assayed at a suitable time after the DNA has been introduced into the recipient cells. Suitable reporter genes may include genes encoding luciferase, beta-galactosidase, chloramphenicol acetyl transferase, secreted alkaline phosphatase, or the green fluorescent protein gene (e.g., Ui-Tei et al., 2000 FEBS Letters 479: 79-82). Suitable expression systems are well known and may be prepared using known techniques or obtained commercially. In general, the construct with the minimal 5' flanking region showing the highest level of expression of reporter gene is identified as the promoter. Such promoter regions may be linked to a reporter gene and used to evaluate agents for the ability to modulate promoter-driven transcription.Methods of Genetically Modifying an Immune Cell

[0181] In some embodiments, the a method of genetically modifying an immune cell is provided. In some embodiments, the method comprises delivering a nucleic acid molecule to a cell, wherein the nucleic acid molecule comprises a first sequenceAttorney Docket No. JBI6969WOPCT1 comprising a promoter, wherein the promoter drives expression in T cells, and wherein the promoter does not drive expression in cells that are non-T cells, and a second sequence encoding a protein or an RNA. In some embodiments, T cells include primary aP T cells, iPSC-derived y8 T (iy8 T) cells. In some embodiments, non-T cells include iPSCs. In some embodiments, the promoter comprises a lymphocyte protein tyrosine kinase (LCK) promoter. In some embodiments, the nucleic acid molecule is a DNA molecule.

[0182] Physical methods for introducing a nucleic acid molecule into a cell include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, nucleof ection, and the like. See, for example, Sambrook et al., 2012, MOLECULAR CLONING: A LABORATORY MANUAL, volumes 1-4, Cold Spring Harbor Press, NY).

[0183] Biological methods for introducing a nucleic acid molecule of interest into a host cell include the use of DNA and RNA vectors. Viral vectors can be derived from lentivirus, poxviruses, herpes simplex virus I, adenoviruses and adeno-associated viruses, and the like. See, for example, U.S. Pat. Nos. 5,350,674 and 5,585,362.

[0184] Biological methods for introducing a nucleic acid molecule of interest into a host cell further include the use of a DNA-targeting protein and a nuclease or an RNA-guided nuclease. The DNA-targeting protein and a nuclease or an RNA-guided nuclease can comprise a zinc finger protein (ZFP), clustered regularly interspaced short palindromic nucleic acid (CRISPR), or a TAL-effector nuclease (TALEN).

[0185] The naturally occurring CRISPR / Cas system is a genetic defense system that provides a form of acquired immunity in prokaryotes. CRISPR stands for Clustered Regularly Interspaced Short Palindromic Repeats and is a family of DNA sequences found in the genomes of bacteria and archaea that contain segments ofDNA (spacer DNA) that have similarity to foreign DNA previously exposed to the cell, for example, by a virus that infects or attacks the prokaryote. These DNA segments are used by the prokaryote to detect and destroy similar foreign DNA upon reintroduction (for example, from a similar virus during a subsequent attack). Transcription of the CRISPR locus results in the formation of an RNA molecule containing the spacer sequence that associates with and targets the Cas (CRISPR-associated) protein, which canAttorney Docket No. JBI6969WOPCT1 recognize and cleave the foreign exogenous DNA. Numerous types and classes of CRISPR / Cas systems have been described (see, e.g., Koonin et al., (2017) Curr Opin Microbiol 37:67-78). In some embodiments, the Cas nuclease is a Mad endonuclease.The CRISPR / Mad system is closely related to the class-2 family of Cas enzymes, type V (Cpfl-like). In some embodiments, the CRISPR-Mad system uses the Eubacterium rectale Mad7 endonuclease or a variant thereof. The Mad7-crRNA complex cleaves the target DNA upon recognition of the PAM 5'-YTTN.

[0186] Chemical means for introducing a nucleic acid molecule into a host cell include colloidal dispersion systems, such as macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes. An exemplary colloidal system for use as a delivery vehicle in vitro and in vivo is a liposome (e.g., an artificial membrane vesicle). Other methods of state-of-the-art targeted delivery of nucleic acids are available, such as delivery of polynucleotides with targeted nanoparticles.

[0187] In some embodiments, the method comprises delivering the nucleic acid molecule by electroporation. In some embodiments, the method comprises delivering the nucleic acid molecule by viral-based gene transfer system. In some embodiments, the method comprises delivering the nucleic acid molecule by a CRISPR / Mad7 delivery system.

[0188] In some embodiments, the nucleic acid molecule is cloned into a DNA repair template plasmid. In some embodiments, the plasmid is a pUC18 vector. In some embodiments, the DNA repair template plasmid comprising the nucleic acid molecule is introduced to cells by nucleofection or electroporation. In some embodiments, Mad7:gRNA RNP complexes are introduced to cells along with the DNA repair template plasmid comprising the nucleic acid molecule.

[0189] In some embodiments, the nucleic acid molecule is not expressed in non-T cells. In some embodiments, the expression of the nucleic acid molecule is reduced in off-target cells when compared with the expression of a nucleic acid molecule with a ubiquitous promoter, wherein off-target cells comprise iPSCs or non-T cells.

[0190] In some embodiments, the method comprises delivering a nucleic acid molecule comprising a first sequence comprising a promoter. In some embodiments, the first sequence comprises an LCK promoter. In some embodiments, the first sequenceAttorney Docket No. JBI6969WOPCT1 comprising an LCK promoter comprises a nucleic acid sequence with at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO:1. In some embodiments, the first sequence comprises SEQ ID NO:1.

[0191] In some embodiments, the method comprises delivering a nucleic acid molecule comprising a second sequence encoding a protein. In one embodiment, the protein comprises a CAR or an engineered TCR. In some embodiments, the method comprises delivering a nucleic acid molecule comprising a second sequence encoding an RNA. In one embodiment, the RNA comprises a microRNA, microRNA-adapted shRNA, small interfering RNA (siRNA), antisense oligonucleotide (ASO), or a ribozyme. In some embodiments, the RNA comprises a microRNA.

[0192] In some embodiments, the method comprises delivering a nucleic acid molecule comprising a first sequence comprising a promoter, wherein the promoter comprises T cell specificity, and wherein the promoter does not drive expression in cells that are non- T cells, a second sequence encoding a protein or an RNA, and a third sequence comprising an enhancer sequence. In some embodiments, the third sequence is upstream from the first sequence. In some embodiments, the third sequence is downstream from the first sequence. In some embodiments, the third sequence is incorporated within the first sequence. In some embodiments, the third sequence is adjacent to the first sequence.

[0193] In some embodiments, the enhancer sequence comprises an intronic enhancer. In some embodiments, the enhancer comprises a sequence derived from the first intron of the human LCK gene. In some embodiments, the enhancer sequence comprises the splicing donor and acceptor sites from the first intron of the human LCK gene. In some embodiments, the enhancer sequence comprises a synthetic intronic enhancer designed for efficient splicing. In some embodiments, the enhancer sequence comprises at least one transcription factor binding site. In some embodiments, the transcription factor binding site is a T cell-specific transcription factor binding site. In some embodiments, the enhancer sequence comprises a combination of at least one intronic enhancer region and at least one transcription factor binding site.Attorney Docket No. JBI6969WOPCT1

[0194] In some embodiments, the third sequence comprises at least one T cell-specific transcription factor binding site with at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, or SEQ ID NO:28. In some embodiments, the third sequence comprises SEQ ID NO:28.

[0195] In some embodiments, the third sequence comprises a sequence derived from the first intron of the human LCK gene and at least one T cell-specific transcription factor binding site. In some embodiments, the nucleic acid molecule comprises a third sequence with at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, or SEQ ID NO: 18. In some embodiments, the third sequence comprises SEQ ID NO: 18.

[0196] In some embodiments, the nucleic acid molecule comprises a third sequence comprising a synthetic intronic enhancer and at least one T cell-specific transcription factor binding site. In some embodiments, the nucleic acid molecule comprises a third sequence with at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO:20 or SEQ ID NO:21.

[0197] In some embodiments, the nucleic acid molecule comprises a third sequence comprising a sequence derived from the first intron of the human LCK gene and the EFla intron. In some embodiments, the nucleic acid molecule comprises a third sequence with at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 19. In some embodiments, the nucleic acid molecule comprises a third sequence comprising SEQ ID NO: 19.Attorney Docket No. JBI6969WOPCT1

[0198] In some embodiments, the nucleic acid molecule comprises a first sequence comprising an LCK promoter, a second sequence encoding a protein or RNA, and a third sequence comprising at least one enhancer. In some embodiments, the nucleic acid molecule comprises a first sequence comprising an LCK promoter and a third sequence comprising a sequence derived from the first intron of the human LCK gene and at least one T cell-specific transcription factor binding site. In some embodiments, the nucleic acid molecule comprises a sequence with at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, or SEQ ID NO:8. In some embodiments, the nucleic acid molecule comprises SEQ ID NO:8.

[0199] In some embodiments, the nucleic acid molecule comprises a first sequence comprising an LCK promoter and a third sequence comprising a synthetic intronic enhancer and at least one T cell-specific transcription factor binding site. In some embodiments, the nucleic acid molecule comprises a sequence with at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO:9 or SEQ ID NO: 10.

[0200] In some embodiments, the nucleic acid molecule comprises a first sequence comprising an LCK promoter and a third sequence comprising a sequence derived from the first intron of the human LCK gene and the EFla intron. In some embodiments, the nucleic acid molecule comprises a sequence with at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 11.Administration

[0201] In some embodiments, administering the modified immune cells described herein to a subject in need thereof is provided.Attorney Docket No. JBI6969WOPCT1

[0202] In some embodiments, proliferation of the cells is done ex vivo, prior to administration to a subject, or in vivo after administration to a subject (see Kaiser et al., Cancer Gene Therapy 22:72-78 (2015)).

[0203] In some embodiments, the cell is autologous, allogeneic, syngeneic, or xenogeneic with respect to the recipient. In some embodiments, the cell is derived from a stem cell or precursor cell. In some embodiments, the stem cell or precursor cell from which the modified cell is derived is autologous, allogeneic, syngeneic, or xenogeneic with respect to the recipient.EXPERIMENTAL EXAMPLES

[0204] The embodiments are further described in detail by reference to the following experimental examples. These examples are provided for purposes of illustration only and are not intended to be limiting unless otherwise specified. Thus, the embodiments should in no way be construed as being limited to the following examples but rather should be construed to encompass any and all variations which become evident as a result of the teaching provided herein.

[0205] Without further description, it is believed that one of ordinary skill in the art can, using the preceding description and the following illustrative examples, make and utilize the embodiments and practice the claimed methods. The following working examples therefore are not to be construed as limiting in any way the remainder of the disclosure.EmbodimentsAL A nucleic acid comprising a first sequence comprising a promoter, wherein the promoter drives expression in T cells and a second sequence encoding a protein or an RNA.A2. The nucleic acid of embodiment Al, wherein the promoter does not drive expression in cells that are non-T cells.A3. The nucleic acid of embodiment Al or A2, wherein the first sequence comprises a lymphocyte protein tyrosine kinase (LCK) promoter.Attorney Docket No. JBI6969WOPCT1A4. The nucleic acid of any one of embodiments Al -A3, wherein the first sequence comprises an LCK promoter comprising at least 80%, 85%, 90%, 95% or 100% sequence identity to SEQ ID NO: 1.A5. The nucleic acid of any one of embodiments A1-A4, wherein the protein comprises a chimeric antigen receptor or an engineered T cell receptor.A6. The nucleic acid of any one of embodiments A1-A5, wherein the RNA is a microRNA or a microRNA-adapted shRNA.A7. The nucleic acid of any one of embodiments A1-A6, further comprising a third sequence comprising an enhancer sequence downstream or upstream from the first sequence.A8. The nucleic acid of any one of embodiment A7, wherein the enhancer sequence comprises an intronic enhancer region, at least one transcription factor binding site, or a combination thereof.A9. The nucleic acid of any one of embodiment A8, wherein the enhancer sequence comprises an intronic enhancer derived from the first intron of the human LCK gene.A10. The nucleic acid of any one of Embodiments A7-A9, wherein the enhancer sequence comprises a synthetic intronic enhancer designed for efficient splicing.Al l. The nucleic acid of any one of Embodiments A5-A10, wherein the third sequence comprises at least 80%, 85%, 90%, 95% or 100% sequence identity to SEQ ID NO: I i, 29-35.All. The nucleic acid of embodiment Al l, wherein the third sequence comprises SEQ ID NO: 18.Al 3. The nucleic acid of any one of Embodiments Al -A 11, wherein the nucleic acid sequence comprises a sequence comprising at least 80%, 85%, 90%, 95% or 100% sequence identity to any one of SEQ ID NOs: 1-11.A 14. The nucleic acid of any one of Embodiments Al -A 13, wherein the nucleic acid sequence comprises SEQ ID NO: 8.Attorney Docket No. JBI6969WOPCT1Al 5. The nucleic acid of any one of Embodiments A8-A14, wherein the transcription factor binding site comprises a T cell-specific transcription factor binding site.Al 6. The nucleic acid of Embodiment A 15, wherein the transcription factor binding site comprises a sequence comprising at least 80%, 85%, 90%, 95% or 100% sequence identity to any one of SEQ ID NOs: 23-28.A17. The nucleic acid of any one of Embodiments A1-A16, wherein the nucleic acid is comprised within a vector.Al 8. The nucleic acid of any one of Embodiments A1-A17, wherein the promoter drives expression in T cells.A19. The nucleic acid of Embodiment A18, wherein the T cells comprise primary aP T cells, iPSC-derived T cells, or both.A20. The nucleic acid of Embodiment 19, wherein the iPSC-derived T cells comprise iPSC-derived y8T (iy8 T) cells.A21. The nucleic acid of any one of Embodiments A2-A19, wherein the non-T cells comprise iPSCs.A22. The nucleic acid of any one of Embodiments A1-A21, wherein the nucleic acid is comprised within a viral vector or a non-viral vector.A23. The nucleic acid of Embodiment A22, wherein the viral vector comprises a lentiviral vector.A24. The nucleic acid of any one of Embodiments A7-A23, wherein the enhancer comprises an EFla intron.A25. The nucleic acid of any one of Embodiments A8-A24, wherein the at least one transcription factor binding site comprises a T cell-specific transcription factor binding site, wherein the transcription factor binding site is TS6.A26. The nucleic acid of any one of Embodiments A8-A25, wherein the at least one transcription factor binding site or EFla intron is incorporated within or is adjacent to a human LCK promoter region.Attorney Docket No. JBI6969WOPCT1A27. The nucleic acid of any one of Embodiments A25 or A26, wherein the transcription factor binding site comprises a sequence set forth in SEQ ID NO: 28.A28. The nucleic acid of any one of Embodiments A25-A27, further comprising at least five transcription factors expressed in T cells.A29. The nucleic acid of any one of Embodiments A25-A28, wherein the transcription factors comprises NRF, ZNF, CREB, ZBTB and CREB3L / XBP.Bl. A method of making a genetically modified immune cell, the method comprising delivering a nucleic acid molecule to a cell, wherein the nucleic acid molecule comprises a. a first sequence comprising a promoter, wherein the promoter drives expression in T cells, and wherein the promoter does not drive expression in cells that are non-T cells; and b. a second sequence encoding a protein or an RNA.B2. The method of Embodiment B 1 , wherein the delivering of the nucleic acid is by electroporation or a viral-based gene transfer system.B3. The method of Embodiment B2, wherein the delivering is by a CRISPR / MAD7- based non-viral delivery system.B4. The method of any one of Embodiments B 1-B3, wherein the nucleic acid is not expressed in non-immune cells.B5. The method of any one of Embodiments B 1-B4, wherein expression of the nucleic acid is within T cells.B6. The method of any one of claims B1-B5, wherein off-target cells exhibit reduced or no activity or expression of the nucleic acid compared to cells modified using a vector with ubiquitous promoters.B7. The method of any one of claims B1-B6, wherein the off-target cells comprise iPSCs and / or non T cells.B8. The method of any one of claims B1-B7, wherein the promoter comprises an LCK promoter sequence.Attorney Docket No. JBI6969WOPCT1B9. The method of Embodiment B8, wherein the LCK promoter sequence comprises a sequence comprising at least 80%, 85%, 90%, 95% or 100% sequence identity to SEQ ID NO: 1.BIO. The method of any one of claims B1-B9, wherein the protein comprises a chimeric antigen receptor or an engineered T cell receptor.B 11. The method of any one of claims B 1-B 10, wherein the nucleic acid further comprises an enhancer sequence downstream or upstream from the promoter sequence.B 12. The method of Embodiment B 11 , wherein the enhancer sequence comprises an intronic enhancer region, at least one transcription factor binding site, or a combination thereof.B 13. The method of any one of Embodiments B 11 or B 12 wherein the enhancer sequence comprises an intronic enhancer derived from the first intron of the human LCK gene.B14. The method of any one of Embodiments Bl 1-B 13, wherein the enhancer sequence comprises a synthetic intronic enhancer designed for efficient splicing.B15. The method of any one of Embodiments Bl 1-B 14, wherein the enhancer sequence comprises a sequence with at least 80%, 85%, 90%, 95% or 100% sequence identity to any one of SEQ ID NOs: 12-21, 29-35.B16. The method of any one of Embodiments Bl 1-B 15, wherein the nucleic acid sequence comprises a sequence with at least 80%, 85%, 90%, 95% or 100% sequence identity to any one of SEQ ID NOs: 2-11.B17. The method of any one of Embodiments B12-B16, wherein the transcription factor binding site comprises a T cell-specific transcription factor binding site.Bl 8. The method of Embodiment B 17, wherein the transcription factor binding site comprises a sequence comprising at least 80%, 85%, 90%, 95% or 100% sequence identity to any one of SEQ ID NOs: 23-28.B19. The method of any one of Embodiments Bl 1-B 18, wherein the nucleic acid is comprised within a vector.Attorney Docket No. JBI6969WOPCT1B20. The method of any one of Embodiments Bl 1-B19, wherein the promoter drives expression in T cells.B21. The method of Embodiment B20, wherein the T cells comprise primary aP T cells, iPSC-derived T cells, or both.B22. The method of embodiment B21, wherein the iPSC-derived T cells comprise iPSC- derived y8 T (iy8 T) T cells.B23. The method of any one of Embodiments Bl 1-B22, wherein the non-T cells comprise iPSCs.B24. The method of any one of Embodiments Bl 1-B23, wherein the nucleic acid is comprised within a viral vector or a non-viral vector.B25. The method of Embodiment B24, wherein the viral vector comprises a lentiviral vector.B26. The method of any one of Embodiments Bl 1-B25, wherein the enhancer comprises an EFla intron.B27. The method of any one of Embodiment Bl 1-B26, wherein the at least one transcription factor binding site comprises a T cell-specific transcription factor binding site, wherein the transcription factor binding site is TS6.B28. The method of Embodiment B27, wherein TS6 comprises a DNA sequence represented by SEQ ID NO: 28.B29. The method of Embodiment B28, wherein TS6 comprises comprising motifs for transcription factors expressed in T cells.B30. The method of Embodiment B29, wherein the transcription factors comprises any one or more of NRF, ZNF, CREB, ZBTB and CREB3L / XBP.B31. The method of any one of Embodiment Bl 1-B30, wherein the at least one transcription factor binding site or EFla intron is incorporated within or is adjacent to the human LCK gene.Attorney Docket No. JBI6969WOPCT1B32. The method of any one of Embodiments B 11 -B31 , wherein the protein is expressed only in T cells as compared to a method using a nucleic acid comprising promoter that is a ubiquitous promoter.Example 1 : T cell-specific promoter optimization

[0206] A synthetic promoter with T cell specificity that exhibits no activity in off-target cells, such as iPSCs or other non-T cells was identified and evaluated. This T cellspecific promoter was derived from the promoter sequence of the T cell-specific gene, LCK, and was enhanced by incorporating T cell-specific transcription factor binding sites to boost promoter activity while preserving its T cell specificity.

[0207] First, proximal (p) and distal (d) human LCK promoters in both long (2kb) and short (800 bp) forms were evaluated (FIG. 1A). Experiments were conducted using a CRISPR / MAD7-based non-viral delivery system via electroporation knock-in (See Methods). Promoter activity was tested in three cell types: primary a[3 T cells (FIG. IB and FIG. 1C) and iPSC-derived y8 T (iy8 T) cells (FIG. ID and FIG. IE) as the on-target cells, and iPSCs as the off-target cells (FIG. IF). The results demonstrate that the distal LCK promoter with a 2 kb length exhibited the highest activity in both primary a[3 T cells and iy8 T cells, as measured by CAR expression intensity. The CAG promoter, used as a positive control, consistently showed strong and stable activity across different cell types. Notably, the 2 kb distal LCK promoter exhibited no activity in iPSCs, underscoring its T cell- specific promoter specificity.

[0208] Next, a dual promoter system was utilized to evaluate promoter activities across different cell types. This system included a CAG promoter-driven GFP reporter to identify successfully knocked-in cells (FIG. 2A). The results revealed a mixture of GFP+CAR+ cells and GFP+CAR- cells in primary a[3 T cells (FIG. 2B), suggesting that the distal LCK 2 kb promoter was partially active in T cells In contrast, no CAR+ cells were observed in iPSCs, despite clear populations of GFP+ cells, indicating no LCK promoter activity in iPSCs (FIG. 2C). These findings suggest that while the distal LCK 2 kb promoter demonstrated good T cell specificity, its activity was low and not fully active in T cells.Attorney Docket No. JBI6969WOPCT1

[0209] The distal LCK 2kb promoter was further optimized to enhance activity while maintaining T cell specificity by introducing an intronic enhancer region downstream of the LCK promoter, incorporating T cell-specific transcription factor binding sites within the intron to boost promoter activity. The dual promoter system was again used for this optimization. Two types of intronic enhancers were evaluated (FIG. 3):

[0210] il: This enhancer was derived from the first intron of the human LCK gene, retaining the splicing donor and acceptor sites while other intronic regions were removed. Within this il intron, either T cell-specific transcription factor motifs, random DNA sequences, or the EFla intron were incorporated.

[0211] sil: A synthetic intron previously designed for efficient splicing. This intron was modified to include either T cell-specific transcription factor motifs or random DNA sequences.

[0212] Random DNA sequences served as controls to determine whether the intron region itself contributed to improved promoter activity. Additionally, T cell-specific transcription factor binding sites (TS1-TS6, SEQ ID NO:23-SEQ ID NO:28) were tested. As part of the design, the full-length EFla promoter intron 1 region (SEQ ID NO: 19) was incorporated into the dLCK-il-EFla construct for comparison.

[0213] FIG.4A depicts the evaluation of the LCK promoter designs with T cell-specific TF binding sites in primary a|3 T cells (on-target cells) using the dual promoter system. The distal LCK 2 kb promoter design with no TF binding sites (dLCK-CTRL) served as the baseline control. The data shown is from one experiment conducted with a[3 T cells from two donors. The GFP+ population marks successfully knocked-in cells, while the CAR+ population reflects active promoter-driven CAR expression. RNP only is the negative control for MAD7 knock-in. Promoter activity was quantified using CAR mean fluorescence intensity (MFI), calculated based on CAR expression levels (FIG.4B). The baseline control (dLCK_2k) had an average MFI of 1911. Designs incorporating the TS6 DNA sequence (SEQ ID NO: 18) exhibited approximately a 2-fold increase in MFI compared to the baseline, while the EFla intron (SEQ ID NO: 19) design showed a ~4- fold increase in CAR MFI.

[0214] The CAR+ / GFP+ population ratio was used to assess whether the promoter was fully or partially active in primary T cells (FIG.4B, a combination of data from twoAttorney Docket No. JBI6969WOPCT1 donors). A higher CAR+GFP+ population indicates a more fully active promoter. The baseline control showed that approximately 40% of the knocked-in LCK promoters were active (60% GFP+ only vs. 40% CAR+GFP+), whereas the designs with TS6 or the EFla intron demonstrated -80% promoter activity (20% GFP+ only vs. 80% CAR+GFP+). In summary, the inclusion of the EFla intron or T cell-specific enriched transcription factor motifs (TS6) significantly enhanced dLCK promoter activity, while intronic enhancers containing random nucleotide sequences or other T cell-specific transcription factor motifs (TS1, TS2, TS3, TS4, TS5) did not enhance dLCK promoter activity.

[0215] FIG.4C depicts the evaluation of the LCK promoter designs with T cell-specific TF binding sites in iPSCs (off-target cells) using the dual promoter system. Again, the distal LCK 2 kb promoter design with no TF binding sites (dLCK-CTRL) served as the baseline control, while the CAG promoter served as a positive control. The GFP+ population marks successfully knocked-in cells, while the CAR+ population reflects active promoter-driven CAR expression. While all LCK designs displayed clear GFP+ populations, no CAR+ cells were detected in iPSCs, indicating an absence of LCK promoter activity in iPSCs.

[0216] Methods:

[0217] DNA repair template generation: The DNA repair templates used here were in plasmid format, optimized for non-viral CRISPR delivery. The target nucleic acid sequences were either PCR-amplified from the human genome or synthesized as gBlocks (IDT). These sequences were then cloned into the pUC19 vector backbone using the InFusion cloning (TaKaRa #638949). The resulting plasmids were prepared in large quantities using the Qiagen EndoFree Maxiprep Kit (Qiagen #12362) and were subsequently used for electroporation.

[0218] Preparation of MAD7:gRNA RNP complexes with DNA repair templates: Alt-R crRNA (IDT) was synthesized and dissolved in nuclease-free duplex buffer (IDT #11-05- 01-12) at a concentration of 200 pM. RNP complexes were freshly prepared on the day of nucleofection by mixing 24.5 pmol of MAD7 protein (0.39 pl of 10 pg / pl, Aldevron) with 122.5 pmol of crRNA (0.62 pl of 200 pM) (targeting human RFX5 gene region, sequence: AGGATCCGCTCTGCCCAGTC, SEQ ID NO:22). The mixture was incubated at room temperature for 10 minutes to allow complex formation. FollowingAttorney Docket No. JBI6969WOPCT1 this, DNA repair templates were added to the RNA-protein complexes and incubated for an additional 10 minutes at room temperature. The resulting RNP complexes, combined with DNA repair templates, were then ready for use in nucleofection.

[0219] Generation of gene edited human T cells using CRISPR: Human T cells were isolated from peripheral blood mononuclear cells (PBMCs) via negative selection (StemCell #17951) and resuspended in ImmunoCult™-XF T Cell Expansion Medium (StemCell #10981) supplemented with 200 lU / ml hIL-2IS (Miltenyi #130-097-748) at a density of 1 x 106cells / ml. T cells were activated by adding 25 pl / ml of ImmunoCult™ Human CD3 / CD28 T Cell Activator (StemCell #10991) and incubating for 2 days. Activated T cells were then harvested, washed with PBS, and nucleofected with 5 pl of RNP complexes along with DNA repair templates in 20 pl of P3 buffer (Lonza #V4SP- 3096) containing 4 pM electroporation enhancer (IDT #1075916) using 96-well cuvettes (Lonza #V4SP-3096). Nucleofection was performed on the Lonza 4D system using the EH- 115 program. Immediately following nucleofection, T cells were resuspended in ImmunoCult™-XE T Cell Expansion Medium supplemented with 500 lU / ml hIL-2IS (referred to as “media”) at a density of ~1 x 106cells / ml. The cells were cultured and expanded with fresh media replenished every 2-3 days for 14 days. After the expansion period, the surface expression of relevant molecules was analyzed via flow cytometry.

[0220] Generation of gene edited human induced pluripotent stem cells (iPSCs) using CRISPR. Human iPSCs were generated by reprogramming isolated y5 T cells to iPSCs. The iPSCs were cultured in StemFit Basic 04 Medium (Amsbio # SFB-504-CT) supplemented with bFGF (Amsbio # AMS.AS-bFGF) and CEPT cocktail (Wako # 033- 26071) at a density of 3,000 cells / well in an iMatrix 511 (Amsbio # AMS.892 012) pretreated 6-well plate. The culture medium was replaced daily. After seven days of culture, the iPSCs were detached using TrypLE (Thermofisher # 12563011), washed with PBS, and nucleofected with 5 pl of RNP complexes and DNA repair templates in 20 pl of P3 buffer containing 4 pM electroporation enhancer using Lonza 96-well cuvettes.Nucleofection was performed on the Lonza 4D system using the CA- 137 program. Immediately following nucleofection, iPSCs were seeded in StemFit Basic 04 Medium supplemented with bFGF and CEPT cocktail at a density of 3,000 cells / well in iMatrix 511 pre-treated 6-well plates. The cells were cultured with daily medium changes forAttorney Docket No. JBI6969WOPCT1 seven days, and then the surface expression of relevant molecules was analyzed via flow cytometry.

[0221] Promoter activity evaluation: Promoter activity was assessed by quantifying the CAR expression mean fluorescence intensity (MFI) derived from flow cytometry data. Higher MFI indicated higher promoter activity. To determine whether the promoter was fully or partially active, the ratio of CAR+ GFP+ cells to GFP+ only cells was analyzed. The GFP+ population represented successfully knocked-in cells, while the CAR+ population indicated active promoter-driven CAR expression.Table 1: Antibodies used in this studyExample 2: SequencesDistal_LCK_2k_promoter (SEQ ID NO: 1)TTTCACTCTTTCGCCCAGGCTGGAGTAGTGGCGCGATCTTGGCTCACTGCAACCTCCACCTTCCGATTTCAAGCGATTCTCCTGCCTCAGCCTCCCGAGTAGCTGGGATTATAGGCACCCGCCACCATGCCCGGCTAATTTTTGTATTTTTAATAGAGACAGGGTTTCAGCATGTTGGCCAGGCTGGTCTCAAACTCCTGACCTCAAGTGATCCACCTGCCTGGGGTTTCCAAAGTGCTAGGATTACAGGCCTGAGCCACCGTTTATTTCTATTCGACCCTGAGGAGCTCCCTTAACCCCTGAGTCTGTTTCCTCACCTCCACAATGGAGATGCTGATTCTCACTCCACAGGCAGCAGATGTGCCTTACGGGAGATAGTGCACAGTGAGCGCTCAGTGAATATGAACTATTACTCACTCCCAGCGCGGCAGTCTTTCTACTCTGTGCTGAGACAGGGAGATGGACCGTGAAGTGTTCAGGCTTACATTGCAAGGGAGTCTGGGCCCTGCACCAGGCTTGGAGCTCCAACTCTAGGCTCTGTGTCACTGTGAAGGTTTTTCACTTTGTCTCTCTCAGCCTTTGTTTCTGTGTTACCCTCTTTGTCTGACTTTCCAACTCAGGCTTCCTCTTCCCCCCACCTATTTCCTGCCCCCACTTCTCTCTGCAGCTGAGGTGCACACAGCATCGCTTCCACCTCACAAGCCCCAACAATGCTCTGTGGGTTCCCCTCCCCCTACCAGCTCACTCAGGCAGTGACGCATGTGCACTTTCCTCCTGGTGGGGTCAAGGCCGAGTTCTTGGACCTGATGAGGCCACCTGGAGTTCCTCATATCACTGGTGACCTGGCCCTCAGCTAATGATGGGTGCCCCCTCAGCCTGGCCCCAGGGGAAATGGAAATTCTTTGCCTGCCTGCTGCTCGTGACAATCTTCTTGCCTCCTGCTTATAACAGAAttorney Docket No. JBI6969WOPCT1AAGTCCTGACAGTCTGTGGCCTGCACCTGGGGGCCTGAGCGGCCCTGTTTGCTCTGTCTTCCACCTGTTGCAGGAGATAGTGCCAAGCCCTCCACCTCTGCCAGGGGCTGTGGCCTTGCCTCTACCTGAATTCGAACTGTTGCCCTACTCTCCAACCATGATTAATGGGTGTTGTCCTGGCCTCTGACTACAGCAGGGGCCGTTACTATGCCCTCTTGAAGACATGAGGTTGTCCTGTCTGCCTCCTGAAACAGGCTGTTTTCCAGCATTCTGTCTGTAAGAGGGATGGTAGCCTGCCATTCACCTACCCTTGACTATAATAAAGCTACTGTTCCATGCCCTGAGATGACATGGGAATTGTTCTCTCGGCCTGACCTGACTGTAACATGCATGGTCTGCTCACCAGCTATTTAACAGGGATATTGTCCTCTCCTCTGACTCTGAACGATGCTACCTTTGCTGCCAGACAGAAACAAAAGGGTCTCTCAGCTGCAACGGTGGTGCTGAGGTGCTGTTTGCCTCTCACCATAAGCTGAGTGTGTGTCCGCTTGCCCCCTGCTCACTGGGCCCAAAGGCTGCCCTTGAATCTCTTGCCCAGATGCACCCTGGAGGGCAGAAGGGAGGGTCTATCAGACATCCTCCCCTCAACTTTAAACCTCCCAGTGTCACCCTGGGACAGTAGGGGAAGATGGACCTGGTCTGGAGATGTAGGGGACCCCCAGGGGCTGAGAGGCAGGGGTCTATGGTGGCAGGAAGCTTGGCGTGCTAGAGGGTTGTGGTTGGGCTGCTGGGGCCCGGTTGGCTGCGGAGCCCTCCGGAGGAGGCAGGAAGTCAGGGTGGGACGTGGGCGCGGGGAGACAGGTGGTGGCTACGACGGCGAAGGGAGCTGAGACTGTCCAGGCAGCCAGGTTAGGCCAGGAGGACCATGTGAATGGGGCCAGA dLCK_il_random_promoter (SEQ ID NO: 2)TTTCACTCTTTCGCCCAGGCTGGAGTAGTGGCGCGATCTTGGCTCACTGCAACCTCCACCTTCCGATTTCAAGCGATTCTCCTGCCTCAGCCTCCCGAGTAGCTGGGATTATAGGCACCCGCCACCATGCCCGGCTAATTTTTGTATTTTTAATAGAGACAGGGTTTCAGCATGTTGGCCAGGCTGGTCTCAAACTCCTGACCTCAAGTGATCCACCTGCCTGGGGTTTCCAAAGTGCTAGGATTACAGGCCTGAGCCACCGTTTATTTCTATTCGACCCTGAGGAGCTCCCTTAACCCCTGAGTCTGTTTCCTCACCTCCACAATGGAGATGCTGATTCTCACTCCACAGGCAGCAGATGTGCCTTACGGGAGATAGTGCACAGTGAGCGCTCAGTGAATATGAACTATTACTCACTCCCAGCGCGGCAGTCTTTCTACTCTGTGCTGAGACAGGGAGATGGACCGTGAAGTGTTCAGGCTTACATTGCAAGGGAGTCTGGGCCCTGCACCAGGCTTGGAGCTCCAACTCTAGGCTCTGTGTCACTGTGAAGGTTTTTCACTTTGTCTCTCTCAGCCTTTGTTTCTGTGTTACCCTCTTTGTCTGACTTTCCAACTCAGGCTTCCTCTTCCCCCCACCTATTTCCTGCCCCCACTTCTCTCTGCAGCTGAGGTGCACACAGCATCGCTTCCACCTCACAAGCCCCAACAATGCTCTGTGGGTTCCCCTCCCCCTACCAGCTCACTCAGGCAGTGACGCATGTGCACTTTCCTCCTGGTGGGGTCAAGGCCGAGTTCTTGGACCTGATGAGGCCACCTGGAGTTCCTCATATCACTGGTGACCTGGCCCTCAGCTAATGATGGGTGCCCCCTCAGCCTGGCCCCAGGGGAAATGGAAATTCTTTGCCTGCCTGCTGCTCGTGACAATCTTCTTGCCTCCTGCTTATAACAGAAAGTCCTGACAGTCTGTGGCCTGCACCTGGGGGCCTGAGCGGCCCTGTTTGCTCTGTCTTCCACCTGTTGCAGGAGATAGTGCCAAGCCCTCCACCTCTGCCAGGGGCTGTGGCCTTGCCTCTACCTGAATTCGAACTGTTGCCCTACTCTCCAACCATGATTAATGGGTGTTGTCCTGGCCTCTGACTACAGCAGGGGCCGTTACTATGCCCTCTTGAAGACATGAGGTTGTCCTGTCTGCCTCCTGAAACAGGCTGTTTTCCAGCATTCTGTCTGTAAGAGGGATGGTAGCCTGCCATTCACCTACCCTTGACTATAATAAAGCTACTGTTCCATGCCCTGAGATGACATGGGAATTGTTCTCTCGGCCTGACCTGACTGTAACATGCATGGTCTGCTCACCAGCTATTTAACAGGGATATTAttorney Docket No. JBI6969WOPCT1GTCCTCTCCTCTGACTCTGAACGATGCTACCTTTGCTGCCAGACAGAAACAAAAGGGTCTCTCAGCTGCAACGGTGGTGCTGAGGTGCTGTTTGCCTCTCACCATAAGCTGAGTGTGTGTCCGCTTGCCCCCTGCTCACTGGGCCCAAAGGCTGCCCTTGAATCTCTTGCCCAGATGCACCCTGGAGGGCAGAAGGGAGGGTCTATCAGACATCCTCCCCTCAACTTTAAACCTCCCAGTGTCACCCTGGGACAGTAGGGGAAGATGGACCTGGTCTGGAGATGTAGGGGACCCCCAGGGGCTGAGAGGCAGGGGTCTATGGTGGCAGGAAGCTTGGCGTGCTAGAGGGTTGTGGTTGGGCTGCTGGGGCCCGGTTGGCTGCGGAGCCCTCCGGAGGAGGCAGGAAGTCAGGGTGGGACGTGGGCGCGGGGAGACAGGTGGTGGCTACGACGGCGAAGGGAGCTGAGACTGTCCAGGCAGCCAGGTTAGGCCAGGAGGACCATGTGAATGGGGCCAGAGGGCTCCCGGGCTGGGCAGGTAAGGAGCGCTGGTATTGGTGTGTTCGTGTCATCTAGGAGGGGCGCGTAGGATAAATAATTCAATTAAGATTACGTTATGCTACTGTACACCTACCCGTCACCGGCCAACAATGTGCGGCCCCTTCAGCCCCCTCTTCCATTCCCTCAGGGACC dLCK_il_TSl_promoter: (SEQ ID NO: 3)TTTCACTCTTTCGCCCAGGCTGGAGTAGTGGCGCGATCTTGGCTCACTGCAACCTCCACCTTCCGATTTCAAGCGATTCTCCTGCCTCAGCCTCCCGAGTAGCTGGGATTATAGGCACCCGCCACCATGCCCGGCTAATTTTTGTATTTTTAATAGAGACAGGGTTTCAGCATGTTGGCCAGGCTGGTCTCAAACTCCTGACCTCAAGTGATCCACCTGCCTGGGGTTTCCAAAGTGCTAGGATTACAGGCCTGAGCCACCGTTTATTTCTATTCGACCCTGAGGAGCTCCCTTAACCCCTGAGTCTGTTTCCTCACCTCCACAATGGAGATGCTGATTCTCACTCCACAGGCAGCAGATGTGCCTTACGGGAGATAGTGCACAGTGAGCGCTCAGTGAATATGAACTATTACTCACTCCCAGCGCGGCAGTCTTTCTACTCTGTGCTGAGACAGGGAGATGGACCGTGAAGTGTTCAGGCTTACATTGCAAGGGAGTCTGGGCCCTGCACCAGGCTTGGAGCTCCAACTCTAGGCTCTGTGTCACTGTGAAGGTTTTTCACTTTGTCTCTCTCAGCCTTTGTTTCTGTGTTACCCTCTTTGTCTGACTTTCCAACTCAGGCTTCCTCTTCCCCCCACCTATTTCCTGCCCCCACTTCTCTCTGCAGCTGAGGTGCACACAGCATCGCTTCCACCTCACAAGCCCCAACAATGCTCTGTGGGTTCCCCTCCCCCTACCAGCTCACTCAGGCAGTGACGCATGTGCACTTTCCTCCTGGTGGGGTCAAGGCCGAGTTCTTGGACCTGATGAGGCCACCTGGAGTTCCTCATATCACTGGTGACCTGGCCCTCAGCTAATGATGGGTGCCCCCTCAGCCTGGCCCCAGGGGAAATGGAAATTCTTTGCCTGCCTGCTGCTCGTGACAATCTTCTTGCCTCCTGCTTATAACAGAAAGTCCTGACAGTCTGTGGCCTGCACCTGGGGGCCTGAGCGGCCCTGTTTGCTCTGTCTTCCACCTGTTGCAGGAGATAGTGCCAAGCCCTCCACCTCTGCCAGGGGCTGTGGCCTTGCCTCTACCTGAATTCGAACTGTTGCCCTACTCTCCAACCATGATTAATGGGTGTTGTCCTGGCCTCTGACTACAGCAGGGGCCGTTACTATGCCCTCTTGAAGACATGAGGTTGTCCTGTCTGCCTCCTGAAACAGGCTGTTTTCCAGCATTCTGTCTGTAAGAGGGATGGTAGCCTGCCATTCACCTACCCTTGACTATAATAAAGCTACTGTTCCATGCCCTGAGATGACATGGGAATTGTTCTCTCGGCCTGACCTGACTGTAACATGCATGGTCTGCTCACCAGCTATTTAACAGGGATATTGTCCTCTCCTCTGACTCTGAACGATGCTACCTTTGCTGCCAGACAGAAACAAAAGGGTCTCTCAGCTGCAACGGTGGTGCTGAGGTGCTGTTTGCCTCTCACCATAAGCTGAGTGTGTGTCCGCTTGCCCCCTGCTCACTGGGCCCAAAGGCTGCCCTTGAATCTCTTGCCCAGATGCACCCTGGAGGGCAGAAGGGAGGGTCTATCAGACAttorney Docket No. JBI6969WOPCT1ATCCTCCCCTCAACTTTAAACCTCCCAGTGTCACCCTGGGACAGTAGGGGAAGATGGACCTGGTCTGGAGATGTAGGGGACCCCCAGGGGCTGAGAGGCAGGGGTCTATGGTGGCAGGAAGCTTGGCGTGCTAGAGGGTTGTGGTTGGGCTGCTGGGGCCCGGTTGGCTGCGGAGCCCTCCGGAGGAGGCAGGAAGTCAGGGTGGGACGTGGGCGCGGGGAGACAGGTGGTGGCTACGACGGCGAAGGGAGCTGAGACTGTCCAGGCAGCCAGGTTAGGCCAGGAGGACCATGTGAATGGGGCCAGAGGGCTCCCGGGCTGGGCAGGTAAGGAGCGCTGGTATTGGTCTGGAATGCATGGTACATTAAACTTTGAGGACAGCGCTTTCCAAGCACTCTGAGGGACAAAAAATTTCCACTGCTAAAACAGGCAAATAAACAAAAAAAAAGTTATGGCCAACAGAGTCACTGTAGGGGAGGGTCTGATAAGTCAGGTCTCTCCCAGGCTTGGGAAAGTGTGTGTCATCTCTAGGAGGTGGTTCAGGTACTTTTGGAACTTTCCAGGGCAAGGCCCCATTATATCTGATGTTGGGGGAGCAGATCTTGGGGGAGCCCCTTCAGCCCCCTCTTCCATTCCCTCAGGGACC dLCK_il_TS2_promoter: (SEQ ID NO: 4)TTTCACTCTTTCGCCCAGGCTGGAGTAGTGGCGCGATCTTGGCTCACTGCAACCTCCACCTTCCGATTTCAAGCGATTCTCCTGCCTCAGCCTCCCGAGTAGCTGGGATTATAGGCACCCGCCACCATGCCCGGCTAATTTTTGTATTTTTAATAGAGACAGGGTTTCAGCATGTTGGCCAGGCTGGTCTCAAACTCCTGACCTCAAGTGATCCACCTGCCTGGGGTTTCCAAAGTGCTAGGATTACAGGCCTGAGCCACCGTTTATTTCTATTCGACCCTGAGGAGCTCCCTTAACCCCTGAGTCTGTTTCCTCACCTCCACAATGGAGATGCTGATTCTCACTCCACAGGCAGCAGATGTGCCTTACGGGAGATAGTGCACAGTGAGCGCTCAGTGAATATGAACTATTACTCACTCCCAGCGCGGCAGTCTTTCTACTCTGTGCTGAGACAGGGAGATGGACCGTGAAGTGTTCAGGCTTACATTGCAAGGGAGTCTGGGCCCTGCACCAGGCTTGGAGCTCCAACTCTAGGCTCTGTGTCACTGTGAAGGTTTTTCACTTTGTCTCTCTCAGCCTTTGTTTCTGTGTTACCCTCTTTGTCTGACTTTCCAACTCAGGCTTCCTCTTCCCCCCACCTATTTCCTGCCCCCACTTCTCTCTGCAGCTGAGGTGCACACAGCATCGCTTCCACCTCACAAGCCCCAACAATGCTCTGTGGGTTCCCCTCCCCCTACCAGCTCACTCAGGCAGTGACGCATGTGCACTTTCCTCCTGGTGGGGTCAAGGCCGAGTTCTTGGACCTGATGAGGCCACCTGGAGTTCCTCATATCACTGGTGACCTGGCCCTCAGCTAATGATGGGTGCCCCCTCAGCCTGGCCCCAGGGGAAATGGAAATTCTTTGCCTGCCTGCTGCTCGTGACAATCTTCTTGCCTCCTGCTTATAACAGAAAGTCCTGACAGTCTGTGGCCTGCACCTGGGGGCCTGAGCGGCCCTGTTTGCTCTGTCTTCCACCTGTTGCAGGAGATAGTGCCAAGCCCTCCACCTCTGCCAGGGGCTGTGGCCTTGCCTCTACCTGAATTCGAACTGTTGCCCTACTCTCCAACCATGATTAATGGGTGTTGTCCTGGCCTCTGACTACAGCAGGGGCCGTTACTATGCCCTCTTGAAGACATGAGGTTGTCCTGTCTGCCTCCTGAAACAGGCTGTTTTCCAGCATTCTGTCTGTAAGAGGGATGGTAGCCTGCCATTCACCTACCCTTGACTATAATAAAGCTACTGTTCCATGCCCTGAGATGACATGGGAATTGTTCTCTCGGCCTGACCTGACTGTAACATGCATGGTCTGCTCACCAGCTATTTAACAGGGATATTGTCCTCTCCTCTGACTCTGAACGATGCTACCTTTGCTGCCAGACAGAAACAAAAGGGTCTCTCAGCTGCAACGGTGGTGCTGAGGTGCTGTTTGCCTCTCACCATAAGCTGAGTGTGTGTCCGCTTGCCCCCTGCTCACTGGGCCCAAAGGCTGCCCTTGAATCTCTTGCCCAGATGCACCCTGGAGGGCAGAAGGGAGGGTCTATCAGACATCCTCCCCTCAACTTTAAACCTCCCAGTGTCACCCTGGGACAGTAGGGGAAAttorney Docket No. JBI6969WOPCT1GATGGACCTGGTCTGGAGATGTAGGGGACCCCCAGGGGCTGAGAGGCAGGGGTCTATGGTGGCAGGAAGCTTGGCGTGCTAGAGGGTTGTGGTTGGGCTGCTGGGGCCCGGTTGGCTGCGGAGCCCTCCGGAGGAGGCAGGAAGTCAGGGTGGGACGTGGGCGCGGGGAGACAGGTGGTGGCTACGACGGCGAAGGGAGCTGAGACTGTCCAGGCAGCCAGGTTAGGCCAGGAGGACCATGTGAATGGGGCCAGAGGGCTCCCGGGCTGGGCAGGTAAGGAGCGCTGGTATTGGGCAGCAGCCCTTTGTGGCTGGGGAGAGAAAAGCGCTGAACTTCCATCTGGAAAGTCACCATTCCTGCCCCTGCCAAGCGTCACATTTGGGAAGTCCTCACTCAGCCAGATTTCCAGGTTTCCCCTGCTTCGTTGGAGTTTTTCTTGACACACACTTTCCGCCTAGTCAGTTAAGATCTGGAAAGCTTCCTGCAAGAGTCAAGACAGTTCTGAGAGATGGTTTCGATCTCCTGACCTCGTGATCCGCCCACCTCGGCCCCCCAAAGTGAGCACTTTGGGAGGCCAAAGCAGGTCCCCTTCAGCCCCCTCTTCCATTCCCTCAGGGACC dLCK_il_TS3_promoter: (SEQ ID NO: 5)TTTCACTCTTTCGCCCAGGCTGGAGTAGTGGCGCGATCTTGGCTCACTGCAACCTCCACCTTCCGATTTCAAGCGATTCTCCTGCCTCAGCCTCCCGAGTAGCTGGGATTATAGGCACCCGCCACCATGCCCGGCTAATTTTTGTATTTTTAATAGAGACAGGGTTTCAGCATGTTGGCCAGGCTGGTCTCAAACTCCTGACCTCAAGTGATCCACCTGCCTGGGGTTTCCAAAGTGCTAGGATTACAGGCCTGAGCCACCGTTTATTTCTATTCGACCCTGAGGAGCTCCCTTAACCCCTGAGTCTGTTTCCTCACCTCCACAATGGAGATGCTGATTCTCACTCCACAGGCAGCAGATGTGCCTTACGGGAGATAGTGCACAGTGAGCGCTCAGTGAATATGAACTATTACTCACTCCCAGCGCGGCAGTCTTTCTACTCTGTGCTGAGACAGGGAGATGGACCGTGAAGTGTTCAGGCTTACATTGCAAGGGAGTCTGGGCCCTGCACCAGGCTTGGAGCTCCAACTCTAGGCTCTGTGTCACTGTGAAGGTTTTTCACTTTGTCTCTCTCAGCCTTTGTTTCTGTGTTACCCTCTTTGTCTGACTTTCCAACTCAGGCTTCCTCTTCCCCCCACCTATTTCCTGCCCCCACTTCTCTCTGCAGCTGAGGTGCACACAGCATCGCTTCCACCTCACAAGCCCCAACAATGCTCTGTGGGTTCCCCTCCCCCTACCAGCTCACTCAGGCAGTGACGCATGTGCACTTTCCTCCTGGTGGGGTCAAGGCCGAGTTCTTGGACCTGATGAGGCCACCTGGAGTTCCTCATATCACTGGTGACCTGGCCCTCAGCTAATGATGGGTGCCCCCTCAGCCTGGCCCCAGGGGAAATGGAAATTCTTTGCCTGCCTGCTGCTCGTGACAATCTTCTTGCCTCCTGCTTATAACAGAAAGTCCTGACAGTCTGTGGCCTGCACCTGGGGGCCTGAGCGGCCCTGTTTGCTCTGTCTTCCACCTGTTGCAGGAGATAGTGCCAAGCCCTCCACCTCTGCCAGGGGCTGTGGCCTTGCCTCTACCTGAATTCGAACTGTTGCCCTACTCTCCAACCATGATTAATGGGTGTTGTCCTGGCCTCTGACTACAGCAGGGGCCGTTACTATGCCCTCTTGAAGACATGAGGTTGTCCTGTCTGCCTCCTGAAACAGGCTGTTTTCCAGCATTCTGTCTGTAAGAGGGATGGTAGCCTGCCATTCACCTACCCTTGACTATAATAAAGCTACTGTTCCATGCCCTGAGATGACATGGGAATTGTTCTCTCGGCCTGACCTGACTGTAACATGCATGGTCTGCTCACCAGCTATTTAACAGGGATATTGTCCTCTCCTCTGACTCTGAACGATGCTACCTTTGCTGCCAGACAGAAACAAAAGGGTCTCTCAGCTGCAACGGTGGTGCTGAGGTGCTGTTTGCCTCTCACCATAAGCTGAGTGTGTGTCCGCTTGCCCCCTGCTCACTGGGCCCAAAGGCTGCCCTTGAATCTCTTGCCCAGATGCACCCTGGAGGGCAGAAGGGAGGGTCTATCAGACATCCTCCCCTCAACTTTAAACCTCCCAGTGTCACCCTGGGACAGTAGGGGAAGATGGACCTGGTCTGGAGATGTAGGGGACCCCCAGGGGCTGAGAGGCAGGGAttorney Docket No. JBI6969WOPCT1GTCTATGGTGGCAGGAAGCTTGGCGTGCTAGAGGGTTGTGGTTGGGCTGCTGGGGCCCGGTTGGCTGCGGAGCCCTCCGGAGGAGGCAGGAAGTCAGGGTGGG ACGTGGGCGCGGGGAGACAGGTGGTGGCTACGACGGCGAAGGGAGCTGAGA CTGTCCAGGCAGCCAGGTTAGGCCAGGAGGACCATGTGAATGGGGCCAGAGGGCTCCCGGGCTGGGCAGGTAAGGAGCGCTGGTATTGGCTCTTTATTGAACATGGGCAGCTTTGTCATTAATCAAGTCTGGGTCGGGGCAAAGGCGAAGAAAATGTTTTAAATGATTCAACAGAGACAAAGTCTCACTATGTTGCCCAGGCTGGTCTTGAACTTCTGAGCTCAAGTGATTTTCCCATCTCGGCCCTAGGATTACAGCTCCCAAAGTGCTGGGATTACAGGTGTGAGTCACTGCACCTGGCCTCAAGTTTACATTTTAATCAAAGATTTGGCTGGGCACAGTGGCTCTCGCTTGTAATTTTGCATT TTCCTCCATAATAGGTCATGTTTGTTTAACTTACATGAATAAGGTCAGGAAAC ACTCATGCTCTGGAAAAATGCACACCATGACATGACTTCCGGCCCCTTCAGCCCCCTCTTCCATTCCCTCAGGGACC dLCK_il_TS4_promoter: (SEQ ID NO: 6)TTTCACTCTTTCGCCCAGGCTGGAGTAGTGGCGCGATCTTGGCTCACTGCAACCTCCACCTTCCGATTTCAAGCGATTCTCCTGCCTCAGCCTCCCGAGTAGCTGGGATTATAGGCACCCGCCACCATGCCCGGCTAATTTTTGTATTTTTAATAGAGACAGGGTTTCAGCATGTTGGCCAGGCTGGTCTCAAACTCCTGACCTCAAGTGATCCACCTGCCTGGGGTTTCCAAAGTGCTAGGATTACAGGCCTGAGCCACCGTTTATTTCTATTCGACCCTGAGGAGCTCCCTTAACCCCTGAGTCTGTTTCCTCACCTCCACAATGGAGATGCTGATTCTCACTCCACAGGCAGCAGATGTGCCTTACGGGAGATAGTGCACAGTGAGCGCTCAGTGAATATGAACTATTACTCACTCCCAGCGCGGCAGTCTTTCTACTCTGTGCTGAGACAGGGAGATGGACCGTGAAGTGTTCAGGCTTACATTGCAAGGGAGTCTGGGCCCTGCACCAGGCTTGGAGCTCCAACTCTAGGCTCTGTGTCACTGTGAAGGTTTTTCACTTTGTCTCTCTCAGCCTTTGTTTCTGTGTTACCCTCTTTGTCTGACTTTCCAACTCAGGCTTCCTCTTCCCCCCACCTATTTCCTGCCCCCACTTCTCTCTGCAGCTGAGGTGCACACAGCATCGCTTCCACCTCACAAGCCCCAACAATGCTCTGTGGGTTCCCCTCCCCCTACCAGCTCACTCAGGCAGTGACGCATGTGCACTTTCCTCCTGGTGGGGTCAAGGCCGAGTTCTTGGACCTGATGAGGCCACCTGGAGTTCCTCATATCACTGGTGACCTGGCCCTCAGCTAATGATGGGTGCCCCCTCAGCCTGGCCCCAGGGGAAATGGAAATTCTTTGCCTGCCTGCTGCTCGTGACAATCTTCTTGCCTCCTGCTTATAACAGAAAGTCCTGACAGTCTGTGGCCTGCACCTGGGGGCCTGAGCGGCCCTGTTTGCTCTGTCTTCCACCTGTTGCAGGAGATAGTGCCAAGCCCTCCACCTCTGCCAGGGGCTGTGGCCTTGCCTCTACCTGAATTCGAACTGTTGCCCTACTCTCCAACCATGATTAATGGGTGTTGTCCTGGCCTCTGACTACAGCAGGGGCCGTTACTATGCCCTCTTGAAGACATGAGGTTGTCCTGTCTGCCTCCTGAAACAGGCTGTTTTCCAGCATTCTGTCTGTAAGAGGGATGGTAGCCTGCCATTCACCTACCCTTGACTATAATAAAGCTACTGTTCCATGCCCTGAGATGACATGGGAATTGTTCTCTCGGCCTGACCTGACTGTAACATGCATGGTCTGCTCACCAGCTATTTAACAGGGATATTGTCCTCTCCTCTGACTCTGAACGATGCTACCTTTGCTGCCAGACAGAAACAAAAGGGTCTCTCAGCTGCAACGGTGGTGCTGAGGTGCTGTTTGCCTCTCACCATAAGCTGAGTGTGTGTCCGCTTGCCCCCTGCTCACTGGGCCCAAAGGCTGCCCTT GAATCTCTTGCCCAGATGCACCCTGGAGGGCAGAAGGGAGGGTCTATCAGAC ATCCTCCCCTCAACTTTAAACCTCCCAGTGTCACCCTGGGACAGTAGGGGAAAttorney Docket No. JBI6969WOPCT1GATGGACCTGGTCTGGAGATGTAGGGGACCCCCAGGGGCTGAGAGGCAGGGGTCTATGGTGGCAGGAAGCTTGGCGTGCTAGAGGGTTGTGGTTGGGCTGCTGGGGCCCGGTTGGCTGCGGAGCCCTCCGGAGGAGGCAGGAAGTCAGGGTGGGACGTGGGCGCGGGGAGACAGGTGGTGGCTACGACGGCGAAGGGAGCTGAGACTGTCCAGGCAGCCAGGTTAGGCCAGGAGGACCATGTGAATGGGGCCAGAGGGCTCCCGGGCTGGGCAGGTAAGGAGCGCTGGTATTGGAGCACTTTGGGAGGCTGAGGTCAGGAGTTCGAGACCAGCCTGGCCAACGTGGCAAAACTCTGTCTCTACTAAAAATACAAAACACAAAATCTTATGAGAAATGGATGAAGAGCCCCATTTGACAGAAGAGGAAAAGTGAGGCTTAGGAGGAATGATTTCAGCAAAGTCACACAGTAAGTGTCAAAATTGCAAATAAACTACAGCTTCTGCTCTTGATGAACCCCCACTCTCATCAAAGGTATGGGAGAGGCAGTGGGACCCTGGGGCTGACATGTAACGCATTTCAAAGCAGGGAGAACCACAAGTACAAAGGCATTAAGTAAGAAAATAGCATGGGGTGTTTGGGAAAGGCAAGAATAGTTCAGAACACAGGCTGTGCCCCTTCAGCCCCCTCTTCCATTCCCTCAGGGACC dLCK_il_TS5_promoter: (SEQ ID NO: 7)TTTCACTCTTTCGCCCAGGCTGGAGTAGTGGCGCGATCTTGGCTCACTGCAACCTCCACCTTCCGATTTCAAGCGATTCTCCTGCCTCAGCCTCCCGAGTAGCTGGGATTATAGGCACCCGCCACCATGCCCGGCTAATTTTTGTATTTTTAATAGAGACAGGGTTTCAGCATGTTGGCCAGGCTGGTCTCAAACTCCTGACCTCAAGTGATCCACCTGCCTGGGGTTTCCAAAGTGCTAGGATTACAGGCCTGAGCCACCGTTTATTTCTATTCGACCCTGAGGAGCTCCCTTAACCCCTGAGTCTGTTTCCTCACCTCCACAATGGAGATGCTGATTCTCACTCCACAGGCAGCAGATGTGCCTTACGGGAGATAGTGCACAGTGAGCGCTCAGTGAATATGAACTATTACTCACTCCCAGCGCGGCAGTCTTTCTACTCTGTGCTGAGACAGGGAGATGGACCGTGAAGTGTTCAGGCTTACATTGCAAGGGAGTCTGGGCCCTGCACCAGGCTTGGAGCTCCAACTCTAGGCTCTGTGTCACTGTGAAGGTTTTTCACTTTGTCTCTCTCAGCCTTTGTTTCTGTGTTACCCTCTTTGTCTGACTTTCCAACTCAGGCTTCCTCTTCCCCCCACCTATTTCCTGCCCCCACTTCTCTCTGCAGCTGAGGTGCACACAGCATCGCTTCCACCTCACAAGCCCCAACAATGCTCTGTGGGTTCCCCTCCCCCTACCAGCTCACTCAGGCAGTGACGCATGTGCACTTTCCTCCTGGTGGGGTCAAGGCCGAGTTCTTGGACCTGATGAGGCCACCTGGAGTTCCTCATATCACTGGTGACCTGGCCCTCAGCTAATGATGGGTGCCCCCTCAGCCTGGCCCCAGGGGAAATGGAAATTCTTTGCCTGCCTGCTGCTCGTGACAATCTTCTTGCCTCCTGCTTATAACAGAAAGTCCTGACAGTCTGTGGCCTGCACCTGGGGGCCTGAGCGGCCCTGTTTGCTCTGTCTTCCACCTGTTGCAGGAGATAGTGCCAAGCCCTCCACCTCTGCCAGGGGCTGTGGCCTTGCCTCTACCTGAATTCGAACTGTTGCCCTACTCTCCAACCATGATTAATGGGTGTTGTCCTGGCCTCTGACTACAGCAGGGGCCGTTACTATGCCCTCTTGAAGACATGAGGTTGTCCTGTCTGCCTCCTGAAACAGGCTGTTTTCCAGCATTCTGTCTGTAAGAGGGATGGTAGCCTGCCATTCACCTACCCTTGACTATAATAAAGCTACTGTTCCATGCCCTGAGATGACATGGGAATTGTTCTCTCGGCCTGACCTGACTGTAACATGCATGGTCTGCTCACCAGCTATTTAACAGGGATATTGTCCTCTCCTCTGACTCTGAACGATGCTACCTTTGCTGCCAGACAGAAACAAAAGGGTCTCTCAGCTGCAACGGTGGTGCTGAGGTGCTGTTTGCCTCTCACCATAAGCTGAGTGTGTGTCCGCTTGCCCCCTGCTCACTGGGCCCAAAGGCTGCCCTTGAATCTCTTGCCCAGATGCACCCTGGAGGGCAGAAGGGAGGGTCTATCAGACAttorney Docket No. JBI6969WOPCT1ATCCTCCCCTCAACTTTAAACCTCCCAGTGTCACCCTGGGACAGTAGGGGAAGATGGACCTGGTCTGGAGATGTAGGGGACCCCCAGGGGCTGAGAGGCAGGGGTCTATGGTGGCAGGAAGCTTGGCGTGCTAGAGGGTTGTGGTTGGGCTGCTGGGGCCCGGTTGGCTGCGGAGCCCTCCGGAGGAGGCAGGAAGTCAGGGTGGGACGTGGGCGCGGGGAGACAGGTGGTGGCTACGACGGCGAAGGGAGCTGAGACTGTCCAGGCAGCCAGGTTAGGCCAGGAGGACCATGTGAATGGGGCCAGAGGGCTCCCGGGCTGGGCAGGTAAGGAGCGCTGGTATTGGTGGTCCTCCCAACACAGGGTACTGGCAGAGGGAGAGGGAGGGGGCAGAGGCAGGAAGTGGGTAACTAGACTAACAAAGGTGCCTGTGGCGGTTTGCCCATCCCAGGTGGGAGGGTGGGGCTAGGGCTCAGGGGCCGTGTGTGAATTTACTTGTAGCCTGAGGGCTCAGAGGGAGCACCGGTTTGGAGCTGGGACCCCCTATTTTAGCTTTTCTGTGGCTGGTGAATGGGGATCCCAGGATCTCACAATCTCAGGTACTTTTGGAACTTTCCAGGGCAAGGCCCCATTATATCTGATGTTGGGGGAGCAGATCTTGGGGGAGCCCCTTCAGCCCCCTCTTCCATTCCCTCAGGGACC dLCK_il_TS6_promoter: (SEQ ID NO: 8 )TTTCACTCTTTCGCCCAGGCTGGAGTAGTGGCGCGATCTTGGCTCACTGCAACCTCCACCTTCCGATTTCAAGCGATTCTCCTGCCTCAGCCTCCCGAGTAGCTGGGATTATAGGCACCCGCCACCATGCCCGGCTAATTTTTGTATTTTTAATAGAGACAGGGTTTCAGCATGTTGGCCAGGCTGGTCTCAAACTCCTGACCTCAAGTGATCCACCTGCCTGGGGTTTCCAAAGTGCTAGGATTACAGGCCTGAGCCACCGTTTATTTCTATTCGACCCTGAGGAGCTCCCTTAACCCCTGAGTCTGTTTCCTCACCTCCACAATGGAGATGCTGATTCTCACTCCACAGGCAGCAGATGTGCCTTACGGGAGATAGTGCACAGTGAGCGCTCAGTGAATATGAACTATTACTCACTCCCAGCGCGGCAGTCTTTCTACTCTGTGCTGAGACAGGGAGATGGACCGTGAAGTGTTCAGGCTTACATTGCAAGGGAGTCTGGGCCCTGCACCAGGCTTGGAGCTCCAACTCTAGGCTCTGTGTCACTGTGAAGGTTTTTCACTTTGTCTCTCTCAGCCTTTGTTTCTGTGTTACCCTCTTTGTCTGACTTTCCAACTCAGGCTTCCTCTTCCCCCCACCTATTTCCTGCCCCCACTTCTCTCTGCAGCTGAGGTGCACACAGCATCGCTTCCACCTCACAAGCCCCAACAATGCTCTGTGGGTTCCCCTCCCCCTACCAGCTCACTCAGGCAGTGACGCATGTGCACTTTCCTCCTGGTGGGGTCAAGGCCGAGTTCTTGGACCTGATGAGGCCACCTGGAGTTCCTCATATCACTGGTGACCTGGCCCTCAGCTAATGATGGGTGCCCCCTCAGCCTGGCCCCAGGGGAAATGGAAATTCTTTGCCTGCCTGCTGCTCGTGACAATCTTCTTGCCTCCTGCTTATAACAGAAAGTCCTGACAGTCTGTGGCCTGCACCTGGGGGCCTGAGCGGCCCTGTTTGCTCTGTCTTCCACCTGTTGCAGGAGATAGTGCCAAGCCCTCCACCTCTGCCAGGGGCTGTGGCCTTGCCTCTACCTGAATTCGAACTGTTGCCCTACTCTCCAACCATGATTAATGGGTGTTGTCCTGGCCTCTGACTACAGCAGGGGCCGTTACTATGCCCTCTTGAAGACATGAGGTTGTCCTGTCTGCCTCCTGAAACAGGCTGTTTTCCAGCATTCTGTCTGTAAGAGGGATGGTAGCCTGCCATTCACCTACCCTTGACTATAATAAAGCTACTGTTCCATGCCCTGAGATGACATGGGAATTGTTCTCTCGGCCTGACCTGACTGTAACATGCATGGTCTGCTCACCAGCTATTTAACAGGGATATTGTCCTCTCCTCTGACTCTGAACGATGCTACCTTTGCTGCCAGACAGAAACAAAAGGGTCTCTCAGCTGCAACGGTGGTGCTGAGGTGCTGTTTGCCTCTCACCATAAGCTGAGTGTGTGTCCGCTTGCCCCCTGCTCACTGGGCCCAAAGGCTGCCCTTGAATCTCTTGCCCAGATGCACCCTGGAGGGCAGAAGGGAGGGTCTATCAGACAttorney Docket No. JBI6969WOPCT1ATCCTCCCCTCAACTTTAAACCTCCCAGTGTCACCCTGGGACAGTAGGGGAAGATGGACCTGGTCTGGAGATGTAGGGGACCCCCAGGGGCTGAGAGGCAGGGGTCTATGGTGGCAGGAAGCTTGGCGTGCTAGAGGGTTGTGGTTGGGCTGCTGGGGCCCGGTTGGCTGCGGAGCCCTCCGGAGGAGGCAGGAAGTCAGGGTGGGACGTGGGCGCGGGGAGACAGGTGGTGGCTACGACGGCGAAGGGAGCTGAGACTGTCCAGGCAGCCAGGTTAGGCCAGGAGGACCATGTGAATGGGGCCAGAGGGCTCCCGGGCTGGGCAGGTAAGGAGCGCTGGTATTGGATGGCGCCACGACTTACTGGTGCGCATGCGCGCCTGATTTCACCGCTTCTAGGCGCCGGCGCATACCGCACACTGGGCAATAGGGTTGACGTACGAGGTCAAGCCAGTCACGCCGCGCGCACGCACGCGCGCGAGTAACGTTCATCAGCTAACATGACGTGGCGTAACAGTTAGAGGCTCGCTCGGAAGTACTTCCGAAATCGCACTGTCGGCGTCCTGCGCATGCGCCTTGGGTATTTTACGCTAGCATGACGCAATCAGGTAGGCTAGCATGTATAAACAGGAAGTCTTTCCTCCCAGGGGTATGCCCCTTCAGCCCCCTCTTCCATTCCCTCAGGGACC dLCK_sil_random_promoter: (SEQ ID NO: 9)TTTCACTCTTTCGCCCAGGCTGGAGTAGTGGCGCGATCTTGGCTCACTGCAACCTCCACCTTCCGATTTCAAGCGATTCTCCTGCCTCAGCCTCCCGAGTAGCTGGGATTATAGGCACCCGCCACCATGCCCGGCTAATTTTTGTATTTTTAATAGAGACAGGGTTTCAGCATGTTGGCCAGGCTGGTCTCAAACTCCTGACCTCAAGTGATCCACCTGCCTGGGGTTTCCAAAGTGCTAGGATTACAGGCCTGAGCCACCGTTTATTTCTATTCGACCCTGAGGAGCTCCCTTAACCCCTGAGTCTGTTTCCTCACCTCCACAATGGAGATGCTGATTCTCACTCCACAGGCAGCAGATGTGCCTTACGGGAGATAGTGCACAGTGAGCGCTCAGTGAATATGAACTATTACTCACTCCCAGCGCGGCAGTCTTTCTACTCTGTGCTGAGACAGGGAGATGGACCGTGAAGTGTTCAGGCTTACATTGCAAGGGAGTCTGGGCCCTGCACCAGGCTTGGAGCTCCAACTCTAGGCTCTGTGTCACTGTGAAGGTTTTTCACTTTGTCTCTCTCAGCCTTTGTTTCTGTGTTACCCTCTTTGTCTGACTTTCCAACTCAGGCTTCCTCTTCCCCCCACCTATTTCCTGCCCCCACTTCTCTCTGCAGCTGAGGTGCACACAGCATCGCTTCCACCTCACAAGCCCCAACAATGCTCTGTGGGTTCCCCTCCCCCTACCAGCTCACTCAGGCAGTGACGCATGTGCACTTTCCTCCTGGTGGGGTCAAGGCCGAGTTCTTGGACCTGATGAGGCCACCTGGAGTTCCTCATATCACTGGTGACCTGGCCCTCAGCTAATGATGGGTGCCCCCTCAGCCTGGCCCCAGGGGAAATGGAAATTCTTTGCCTGCCTGCTGCTCGTGACAATCTTCTTGCCTCCTGCTTATAACAGAAAGTCCTGACAGTCTGTGGCCTGCACCTGGGGGCCTGAGCGGCCCTGTTTGCTCTGTCTTCCACCTGTTGCAGGAGATAGTGCCAAGCCCTCCACCTCTGCCAGGGGCTGTGGCCTTGCCTCTACCTGAATTCGAACTGTTGCCCTACTCTCCAACCATGATTAATGGGTGTTGTCCTGGCCTCTGACTACAGCAGGGGCCGTTACTATGCCCTCTTGAAGACATGAGGTTGTCCTGTCTGCCTCCTGAAACAGGCTGTTTTCCAGCATTCTGTCTGTAAGAGGGATGGTAGCCTGCCATTCACCTACCCTTGACTATAATAAAGCTACTGTTCCATGCCCTGAGATGACATGGGAATTGTTCTCTCGGCCTGACCTGACTGTAACATGCATGGTCTGCTCACCAGCTATTTAACAGGGATATTGTCCTCTCCTCTGACTCTGAACGATGCTACCTTTGCTGCCAGACAGAAACAAAAGGGTCTCTCAGCTGCAACGGTGGTGCTGAGGTGCTGTTTGCCTCTCACCATAAGCTGAGTGTGTGTCCGCTTGCCCCCTGCTCACTGGGCCCAAAGGCTGCCCTTGAATCTCTTGCCCAGATGCACCCTGGAGGGCAGAAGGGAGGGTCTATCAGACAttorney Docket No. JBI6969WOPCT1ATCCTCCCCTCAACTTTAAACCTCCCAGTGTCACCCTGGGACAGTAGGGGAAGATGGACCTGGTCTGGAGATGTAGGGGACCCCCAGGGGCTGAGAGGCAGGGGTCTATGGTGGCAGGAAGCTTGGCGTGCTAGAGGGTTGTGGTTGGGCTGCTGGGGCCCGGTTGGCTGCGGAGCCCTCCGGAGGAGGCAGGAAGTCAGGGTGGGACGTGGGCGCGGGGAGACAGGTGGTGGCTACGACGGCGAAGGGAGCTGAGACTGTCCAGGCAGCCAGGTTAGGCCAGGAGGACCATGTGAATGGGGCCAGAGGGCTCCCGGGCTGGGCAGGTAAGTATCTTTACAAGACAGGTTTAAGGTGTGTTCGTGTCATCTAGGAGGGGCGCGTAGGATAAATAATTCAATTAAGATTACGTTATGCTACTGTACACCTACCCGTCACCGGCCAACAATGTGCGGCCTATTGGTCTTATACTAACTCTCTCCTTTCTCTCCACAGGTTGGACC dLCK_sil_TS6_promoter: (SEQ ID NO: 10)TTTCACTCTTTCGCCCAGGCTGGAGTAGTGGCGCGATCTTGGCTCACTGCAACCTCCACCTTCCGATTTCAAGCGATTCTCCTGCCTCAGCCTCCCGAGTAGCTGGGATTATAGGCACCCGCCACCATGCCCGGCTAATTTTTGTATTTTTAATAGAGACAGGGTTTCAGCATGTTGGCCAGGCTGGTCTCAAACTCCTGACCTCAAGTGATCCACCTGCCTGGGGTTTCCAAAGTGCTAGGATTACAGGCCTGAGCCACCGTTTATTTCTATTCGACCCTGAGGAGCTCCCTTAACCCCTGAGTCTGTTTCCTCACCTCCACAATGGAGATGCTGATTCTCACTCCACAGGCAGCAGATGTGCCTTACGGGAGATAGTGCACAGTGAGCGCTCAGTGAATATGAACTATTACTCACTCCCAGCGCGGCAGTCTTTCTACTCTGTGCTGAGACAGGGAGATGGACCGTGAAGTGTTCAGGCTTACATTGCAAGGGAGTCTGGGCCCTGCACCAGGCTTGGAGCTCCAACTCTAGGCTCTGTGTCACTGTGAAGGTTTTTCACTTTGTCTCTCTCAGCCTTTGTTTCTGTGTTACCCTCTTTGTCTGACTTTCCAACTCAGGCTTCCTCTTCCCCCCACCTATTTCCTGCCCCCACTTCTCTCTGCAGCTGAGGTGCACACAGCATCGCTTCCACCTCACAAGCCCCAACAATGCTCTGTGGGTTCCCCTCCCCCTACCAGCTCACTCAGGCAGTGACGCATGTGCACTTTCCTCCTGGTGGGGTCAAGGCCGAGTTCTTGGACCTGATGAGGCCACCTGGAGTTCCTCATATCACTGGTGACCTGGCCCTCAGCTAATGATGGGTGCCCCCTCAGCCTGGCCCCAGGGGAAATGGAAATTCTTTGCCTGCCTGCTGCTCGTGACAATCTTCTTGCCTCCTGCTTATAACAGAAAGTCCTGACAGTCTGTGGCCTGCACCTGGGGGCCTGAGCGGCCCTGTTTGCTCTGTCTTCCACCTGTTGCAGGAGATAGTGCCAAGCCCTCCACCTCTGCCAGGGGCTGTGGCCTTGCCTCTACCTGAATTCGAACTGTTGCCCTACTCTCCAACCATGATTAATGGGTGTTGTCCTGGCCTCTGACTACAGCAGGGGCCGTTACTATGCCCTCTTGAAGACATGAGGTTGTCCTGTCTGCCTCCTGAAACAGGCTGTTTTCCAGCATTCTGTCTGTAAGAGGGATGGTAGCCTGCCATTCACCTACCCTTGACTATAATAAAGCTACTGTTCCATGCCCTGAGATGACATGGGAATTGTTCTCTCGGCCTGACCTGACTGTAACATGCATGGTCTGCTCACCAGCTATTTAACAGGGATATTGTCCTCTCCTCTGACTCTGAACGATGCTACCTTTGCTGCCAGACAGAAACAAAAGGGTCTCTCAGCTGCAACGGTGGTGCTGAGGTGCTGTTTGCCTCTCACCATAAGCTGAGTGTGTGTCCGCTTGCCCCCTGCTCACTGGGCCCAAAGGCTGCCCTTGAATCTCTTGCCCAGATGCACCCTGGAGGGCAGAAGGGAGGGTCTATCAGACATCCTCCCCTCAACTTTAAACCTCCCAGTGTCACCCTGGGACAGTAGGGGAAGATGGACCTGGTCTGGAGATGTAGGGGACCCCCAGGGGCTGAGAGGCAGGGGTCTATGGTGGCAGGAAGCTTGGCGTGCTAGAGGGTTGTGGTTGGGCTGCTGGGGCCCGGTTGGCTGCGGAGCCCTCCGGAGGAGGCAGGAAGTCAGGGTGGGAttorney Docket No. JBI6969WOPCT1ACGTGGGCGCGGGGAGACAGGTGGTGGCTACGACGGCGAAGGGAGCTGAGACTGTCCAGGCAGCCAGGTTAGGCCAGGAGGACCATGTGAATGGGGCCAGAGGGCTCCCGGGCTGGGCAGGTAAGTATCTTTACAAGACAGGTTTAAGGATGGCGCCACGACTTACTGGTGCGCATGCGCGCCTGATTTCACCGCTTCTAGGCGCCGGCGCATACCGCACACTGGGCAATAGGGTTGACGTACGAGGTCAAGCCAGTCACGCCGCGCGCACGCACGCGCGCGAGTAACGTTCATCAGCTAACATGACGTGGCGTAACAGTTAGAGGCTCGCTCGGAAGTACTTCCGAAATCGCACTGTCGGCGTCCTGCGCATGCGCCTTGGGTATTTTACGCTAGCATGACGCAATCAGGTAGGCTAGCATGTATAAACAGGAAGTCTTTCCTCCCAGGGGTATGCCTATTGGTCTTA TACTAACTCTCTCCTTTCTCTCCACAGGTTGGACC dLCK_il_EFla_promoter: (SEQ ID NO: 11)TTTCACTCTTTCGCCCAGGCTGGAGTAGTGGCGCGATCTTGGCTCACTGCAACCTCCACCTTCCGATTTCAAGCGATTCTCCTGCCTCAGCCTCCCGAGTAGCTGGGATTATAGGCACCCGCCACCATGCCCGGCTAATTTTTGTATTTTTAATAGAGACAGGGTTTCAGCATGTTGGCCAGGCTGGTCTCAAACTCCTGACCTCAAGTGATCCACCTGCCTGGGGTTTCCAAAGTGCTAGGATTACAGGCCTGAGCCACCGTTTATTTCTATTCGACCCTGAGGAGCTCCCTTAACCCCTGAGTCTGTTTCCTCACCTCCACAATGGAGATGCTGATTCTCACTCCACAGGCAGCAGATGTGCCTTACGGGAGATAGTGCACAGTGAGCGCTCAGTGAATATGAACTATTACTCACTCCCAGCGCGGCAGTCTTTCTACTCTGTGCTGAGACAGGGAGATGGACCGTGAAGTGTTCAGGCTTACATTGCAAGGGAGTCTGGGCCCTGCACCAGGCTTGGAGCTCCAACTCTAGGCTCTGTGTCACTGTGAAGGTTTTTCACTTTGTCTCTCTCAGCCTTTGTTTCTGTGTTACCCTCTTTGTCTGACTTTCCAACTCAGGCTTCCTCTTCCCCCCACCTATTTCCTGCCCCCACTTCTCTCTGCAGCTGAGGTGCACACAGCATCGCTTCCACCTCACAAGCCCCAACAATGCTCTGTGGGTTCCCCTCCCCCTACCAGCTCACTCAGGCAGTGACGCATGTGCACTTTCCTCCTGGTGGGGTCAAGGCCGAGTTCTTGGACCTGATGAGGCCACCTGGAGTTCCTCATATCACTGGTGACCTGGCCCTCAGCTAATGATGGGTGCCCCCTCAGCCTGGCCCCAGGGGAAATGGAAATTCTTTGCCTGCCTGCTGCTCGTGACAATCTTCTTGCCTCCTGCTTATAACAGAAAGTCCTGACAGTCTGTGGCCTGCACCTGGGGGCCTGAGCGGCCCTGTTTGCTCTGTCTTCCACCTGTTGCAGGAGATAGTGCCAAGCCCTCCACCTCTGCCAGGGGCTGTGGCCTTGCCTCTACCTGAATTCGAACTGTTGCCCTACTCTCCAACCATGATTAATGGGTGTTGTCCTGGCCTCTGACTACAGCAGGGGCCGTTACTATGCCCTCTTGAAGACATGAGGTTGTCCTGTCTGCCTCCTGAAACAGGCTGTTTTCCAGCATTCTGTCTGTAAGAGGGATGGTAGCCTGCCATTCACCTACCCTTGACTATAATAAAGCTACTGTTCCATGCCCTGAGATGACATGGGAATTGTTCTCTCGGCCTGACCTGACTGTAACATGCATGGTCTGCTCACCAGCTATTTAACAGGGATATTGTCCTCTCCTCTGACTCTGAACGATGCTACCTTTGCTGCCAGACAGAAACAAAAGGGTCTCTCAGCTGCAACGGTGGTGCTGAGGTGCTGTTTGCCTCTCACCATAAGCTGAGTGTGTGTCCGCTTGCCCCCTGCTCACTGGGCCCAAAGGCTGCCCTTGAATCTCTTGCCCAGATGCACCCTGGAGGGCAGAAGGGAGGGTCTATCAGACATCCTCCCCTCAACTTTAAACCTCCCAGTGTCACCCTGGGACAGTAGGGGAAGATGGACCTGGTCTGGAGATGTAGGGGACCCCCAGGGGCTGAGAGGCAGGGGTCTATGGTGGCAGGAAGCTTGGCGTGCTAGAGGGTTGTGGTTGGGCTGCTGGGGCCCGGTTGGCTGCGGAGCCCTCCGGAGGAGGCAGGAAGTCAGGGTGGGAttorney Docket No. JBI6969WOPCT1ACGTGGGCGCGGGGAGACAGGTGGTGGCTACGACGGCGAAGGGAGCTGAGA CTGTCCAGGCAGCCAGGTTAGGCCAGGAGGACCATGTGAATGGGGCCAGAG GGCTCCCGGGCTGGGCAGGTAAGTGCCGTGTGTGGTTCCCGCGGGCCTGGCC TCTTTACGGGTTATGGCCCTTGCGTGCCTTGAATTACTTCCACGCCCCTGGCT GCAGTACGTGATTCTTGATCCCGAGCTTCGGGTTGGAAGTGGGTGGGAGAGT TCGAGGCCTTGCGCTTAAGGAGCCCCTTCGCCTCGTGCTTGAGTTGAGGCCTG GCTTGGGCGCTGGGGCCGCCGCGTGCGAATCTGGTGGCACCTTCGCGCCTGT CTCGCTGCTTTCGATAAGTCTCTAGCCATTTAAAATTTTTGATGACCTGCTGCGACGCTTTTTTTCTGGCAAGATAGTCTTGTAAATGCGGGCCAAGATCTGCACA CTGGTATTTCGGTTTTTGGGGCCGCGGGCGGCGACGGGGCCCGTGCGTCCCA GCGCACATGTTCGGCGAGGCGGGGCCTGCGAGCGCGGCCACCGAGAATCGG ACGGGGGTAGTCTCAAGCTGGCCGGCCTGCTCTGGTGCCTGGCCTCGCGCCG CCGTGTATCGCCCCGCCCTGGGCGGCAAGGCTGGCCCGGTCGGCACCAGTTG CGTGAGCGGAAAGATGGCCGCTTCCCGGCCCTGCTGCAGGGAGCTCAAAATG GAGGACGCGGCGCTCGGGAGAGCGGGCGGGTGAGTCACCCACACAAAGGAA AAGGGCCTTTCCGTCCTCAGCCGTCGCTTCATGTGACTCCACGGAGTACCGGGCGCCGTCCAGGCACCTCGATTAGTTCTCGAGCTTTTGGAGTACGTCGTCTTTA GGTTGGGTGGAGGGGTTTTATGCGATGGAGTTTCCCCACACTGAGTGGGTGG ACTG TA TC TT TG GA AA GG TT TT TA GG GG AC TC CA TTG GC GTT TG TCG AC TA TC CT TT CG AA AT GG CT CA TA CT AT GCT AC CC AT GT TG GG GA TA TT CT AT AG AC GCTTTTTTTCTTCCATTTCAGGGACCil_random: (SEQ ID NO: 12)GGGCTCCCGGGCTGGGCAGGTAAGGAGCGCTGGTATTGGTGTGTTCGTGTCA TCTAGGAGGGGCGCGTAGGATAAATAATTCAATTAAGATTACGTTATGCTAC TGTACACCTACCCGTCACCGGCCAACAATGTGCGGCCCCTTCAGCCCCCTCTT CCATTCCCTCAGGGACC il_TSl: (SEQ ID NO: 13)GGGCTCCCGGGCTGGGCAGGTAAGGAGCGCTGGTATTGGTCTGGAATGCATG GTACATTAAACTTTGAGGACAGCGCTTTCCAAGCACTCTGAGGGACAAAAAA TTTCCACTGCTAAAACAGGCAAATAAACAAAAAAAAAGTTATGGCCAACAGA GTCACTGTAGGGGAGGGTCTGATAAGTCAGGTCTCTCCCAGGCTTGGGAAAG TGTGTGTCATCTCTAGGAGGTGGTTCAGGTACTTTTGGAACTTTCCAGGGCAA GGCCCCATTATATCTGATGTTGGGGGAGCAGATCTTGGGGGAGCCCCTTCAG CCCCCTCTTCCATTCCCTCAGGGACC il_TS2: (SEQ ID NO: 14)GGGCTCCCGGGCTGGGCAGGTAAGGAGCGCTGGTATTGGGCAGCAGCCCTTT GTGGCTGGGGAGAGAAAAGCGCTGAACTTCCATCTGGAAAGTCACCATTCCT GCCCCTGCCAAGCGTCACATTTGGGAAGTCCTCACTCAGCCAGATTTCCAGGT TTCCCCTGCTTCGTTGGAGTTTTTCTTGACACACACTTTCCGCCTAGTCAGTTA AGATCTGGAAAGCTTCCTGCAAGAGTCAAGACAGTTCTGAGAGATGGTTTCG ATCTCCTGACCTCGTGATCCGCCCACCTCGGCCCCCCAAAGTGAGCACTTTGG GAGGCCAAAGCAGGTCCCCTTCAGCCCCCTCTTCCATTCCCTCAGGGACCAttorney Docket No. JBI6969WOPCT1 il_TS3: (SEQ ID NO: 15)GGGCTCCCGGGCTGGGCAGGTAAGGAGCGCTGGTATTGGCTCTTTATTGAACATGGGCAGCTTTGTCATTAATCAAGTCTGGGTCGGGGCAAAGGCGAAGAAAATGTTTTAAATGATTCAACAGAGACAAAGTCTCACTATGTTGCCCAGGCTGGTCTTGAACTTCTGAGCTCAAGTGATTTTCCCATCTCGGCCCTAGGATTACAGCTCCCAAAGTGCTGGGATTACAGGTGTGAGTCACTGCACCTGGCCTCAAGTTTACATTTTAATCAAAGATTTGGCTGGGCACAGTGGCTCTCGCTTGTAATTTTGCATTTTCCTCCATAATAGGTCATGTTTGTTTAACTTACATGAATAAGGTCAGGAAA CACTCATGCTCTGGAAAAATGCACACCATGACATGACTTCCGGCCCCTTCAG CCCCCTCTTCCATTCCCTCAGGGACC il_TS4: (SEQ ID NO: 16)GGGCTCCCGGGCTGGGCAGGTAAGGAGCGCTGGTATTGGAGCACTTTGGGAGGCTGAGGTCAGGAGTTCGAGACCAGCCTGGCCAACGTGGCAAAACTCTGTCTCTACTAAAAATACAAAACACAAAATCTTATGAGAAATGGATGAAGAGCCCCATTTGACAGAAGAGGAAAAGTGAGGCTTAGGAGGAATGATTTCAGCAAAGTCACACAGTAAGTGTCAAAATTGCAAATAAACTACAGCTTCTGCTCTTGATGAACCCCCACTCTCATCAAAGGTATGGGAGAGGCAGTGGGACCCTGGGGCTGACATGTAACGCATTTCAAAGCAGGGAGAACCACAAGTACAAAGGCATTAAGTAA GAAAATAGCATGGGGTGTTTGGGAAAGGCAAGAATAGTTCAGAACACAGGC TGTGCCCCTTCAGCCCCCTCTTCCATTCCCTCAGGGACC il_TS5: (SEQ ID NO: 17)GGGCTCCCGGGCTGGGCAGGTAAGGAGCGCTGGTATTGGTGGTCCTCCCAACACAGGGTACTGGCAGAGGGAGAGGGAGGGGGCAGAGGCAGGAAGTGGGTAACTAGACTAACAAAGGTGCCTGTGGCGGTTTGCCCATCCCAGGTGGGAGGGTGGGGCTAGGGCTCAGGGGCCGTGTGTGAATTTACTTGTAGCCTGAGGGCTCAGAGGGAGCACCGGTTTGGAGCTGGGACCCCCTATTTTAGCTTTTCTGTGGCTGGTGAATGGGGATCCCAGGATCTCACAATCTCAGGTACTTTTGGAACTTTCCAG GGCAAGGCCCCATTATATCTGATGTTGGGGGAGCAGATCTTGGGGGAGCCCC TTCAGCCCCCTCTTCCATTCCCTCAGGGACC il_TS6: (SEQ ID NO: 18)GGGCTCCCGGGCTGGGCAGGTAAGGAGCGCTGGTATTGGATGGCGCCACGACTTACTGGTGCGCATGCGCGCCTGATTTCACCGCTTCTAGGCGCCGGCGCATACCGCACACTGGGCAATAGGGTTGACGTACGAGGTCAAGCCAGTCACGCCGCGCGCACGCACGCGCGCGAGTAACGTTCATCAGCTAACATGACGTGGCGTAACAGTTAGAGGCTCGCTCGGAAGTACTTCCGAAATCGCACTGTCGGCGTCCTGCGCATGCGCCTTGGGTATTTTACGCTAGCATGACGCAATCAGGTAGGCTAGCATGT ATAAACAGGAAGTCTTTCCTCCCAGGGGTATGCCCCTTCAGCCCCCTCTTCCA TTCCCTCAGGGACC il_EFla: (SEQ ID NO: 19)GGGCTCCCGGGCTGGGCAGGTAAGTGCCGTGTGTGGTTCCCGCGGGCCTGGC CTCTTTACGGGTTATGGCCCTTGCGTGCCTTGAATTACTTCCACGCCCCTGGCT GCAGTACGTGATTCTTGATCCCGAGCTTCGGGTTGGAAGTGGGTGGGAGAGTAttorney Docket No. JBI6969WOPCT1TCGAGGCCTTGCGCTTAAGGAGCCCCTTCGCCTCGTGCTTGAGTTGAGGCCTGGCTTGGGCGCTGGGGCCGCCGCGTGCGAATCTGGTGGCACCTTCGCGCCTGTCTCGCTGCTTTCGATAAGTCTCTAGCCATTTAAAATTTTTGATGACCTGCTGCGACGCTTTTTTTCTGGCAAGATAGTCTTGTAAATGCGGGCCAAGATCTGCACACTGGTATTTCGGTTTTTGGGGCCGCGGGCGGCGACGGGGCCCGTGCGTCCCAGCGCACATGTTCGGCGAGGCGGGGCCTGCGAGCGCGGCCACCGAGAATCGGACGGGGGTAGTCTCAAGCTGGCCGGCCTGCTCTGGTGCCTGGCCTCGCGCCGCCGTGTATCGCCCCGCCCTGGGCGGCAAGGCTGGCCCGGTCGGCACCAGTTGCGTGAGCGGAAAGATGGCCGCTTCCCGGCCCTGCTGCAGGGAGCTCAAAATGGAGGACGCGGCGCTCGGGAGAGCGGGCGGGTGAGTCACCCACACAAAGGAAAAGGGCCTTTCCGTCCTCAGCCGTCGCTTCATGTGACTCCACGGAGTACCGGGCGCCGTCCAGGCACCTCGATTAGTTCTCGAGCTTTTGGAGTACGTCGTCTTTAGGTTGGGTGGAGGGGTTTTATGCGATGGAGTTTCCCCACACTGAGTGGGTGGACTGTATCTTTGGAAAGGTTTTTAGGGGACTCCATTGGCGTTTGTCGACTATCCTTTCGAAATGGCTCATACTATGCTACCCATGTTGGGGATATTCTATAGACGCTTTTTTTCTTCCATTTCAGGGACCsil_random: (SEQ ID NO: 20)GGGCTCCCGGGCTGGGCAGGTAAGTATCTTTACAAGACAGGTTTAAGGTGTGTTCGTGTCATCTAGGAGGGGCGCGTAGGATAAATAATTCAATTAAGATTACGTTATGCTACTGTACACCTACCCGTCACCGGCCAACAATGTGCGGCCTATTGGTCTTATACTAACTCTCTCCTTTCTCTCCACAGGTTGGACC sil_TS6: (SEQ ID NO: 21)GGGCTCCCGGGCTGGGCAGGTAAGTATCTTTACAAGACAGGTTTAAGGATGGCGCCACGACTTACTGGTGCGCATGCGCGCCTGATTTCACCGCTTCTAGGCGCCGGCGCATACCGCACACTGGGCAATAGGGTTGACGTACGAGGTCAAGCCAGTCACGCCGCGCGCACGCACGCGCGCGAGTAACGTTCATCAGCTAACATGACGTGGCGTAACAGTTAGAGGCTCGCTCGGAAGTACTTCCGAAATCGCACTGTCGGCGTCCTGCGCATGCGCCTTGGGTATTTTACGCTAGCATGACGCAATCAGGTAGGCTAGCATGTATAAACAGGAAGTCTTTCCTCCCAGGGGTATGCCTATTGGTCTTATACTAACTCTCTCCTTTCTCTCCACAGGTTGGACC crRNA (SEQ ID NO: 22)AGGATCCGCTCTGCCCAGTCTS1 (SEQ ID NO:23)TCTGGAATGCATGGTACATTAAACTTTGAGGACAGCGCTTTCCAAGCACTCTGAGGGACAAAAAATTTCCACTGCTAAAACAGGCAAATAAACAAAAAAAAAGTTATGGCCAACAGAGTCACTGTAGGGGAGGGTCTGATAAGTCAGGTCTCTCCCAGGCTTGGGAAAGTGTGTGTCATCTCTAGGAGGTGGTTCAGGTACTTTTGGAACTTTCCAGGGCAAGGCCCCATTATATCTGATGTTGGGGGAGCAGATCTTGG GGGAGAttorney Docket No. JBI6969WOPCT1TS2 (SEQ ID NO: 24)GCAGCAGCCCTTTGTGGCTGGGGAGAGAAAAGCGCTGAACTTCCATCTGGAAAGTCACCATTCCTGCCCCTGCCAAGCGTCACATTTGGGAAGTCCTCACTCAGCCAGATTTCCAGGTTTCCCCTGCTTCGTTGGAGTTTTTCTTGACACACACTTTCC GCCTAGTCAGTTAAGATCTGGAAAGCTTCCTGCAAGAGTCAAGACAGTTCTG AGAGATGGTTTCGATCTCCTGACCTCGTGATCCGCCCACCTCGGCCCCCCAAAGTGAGCACTTTGGGAGGCCAAAGCAGGTTS3 (SEQ ID NO:25)CTCTTTATTGAACATGGGCAGCTTTGTCATTAATCAAGTCTGGGTCGGGGCAAAGGCGAAGAAAATGTTTTAAATGATTCAACAGAGACAAAGTCTCACTATGTTGCCCAGGCTGGTCTTGAACTTCTGAGCTCAAGTGATTTTCCCATCTCGGCCCTAGGATTACAGCTCCCAAAGTGCTGGGATTACAGGTGTGAGTCACTGCACCTGGCCTCAAGTTTACATTTTAATCAAAGATTTGGCTGGGCACAGTGGCTCTCGCT TGTAATTTTGCATTTTCCTCCATAATAGGTCATGTTTGTTTAACTTACATGAAT AAGGTCAGGAAACACTCATGCTCTGGAAAAATGCACACCATGACATGACTTCCGGTS4 (SEQ ID NO:26)AGCACTTTGGGAGGCTGAGGTCAGGAGTTCGAGACCAGCCTGGCCAACGTGGCAAAACTCTGTCTCTACTAAAAATACAAAACACAAAATCTTATGAGAAATGGATGAAGAGCCCCATTTGACAGAAGAGGAAAAGTGAGGCTTAGGAGGAATGATTTCAGCAAAGTCACACAGTAAGTGTCAAAATTGCAAATAAACTACAGCTTCTGCTCTTGATGAACCCCCACTCTCATCAAAGGTATGGGAGAGGCAGTGGGAC CCTGGGGCTGACATGTAACGCATTTCAAAGCAGGGAGAACCACAAGTACAAAGGCATTAAGTAAGAAAATAGCATGGGGTGTTTGGGAAAGGCAAGAATAGTTC AGAACACAGGCTGTGTS5 (SEQ ID NO:27)TGGTCCTCCCAACACAGGGTACTGGCAGAGGGAGAGGGAGGGGGCAGAGGCAGGAAGTGGGTAACTAGACTAACAAAGGTGCCTGTGGCGGTTTGCCCATCCCAGGTGGGAGGGTGGGGCTAGGGCTCAGGGGCCGTGTGTGAATTTACTTGTAGCCTGAGGGCTCAGAGGGAGCACCGGTTTGGAGCTGGGACCCCCTATTTTAGC TTTTCTGTGGCTGGTGAATGGGGATCCCAGGATCTCACAATCTCAGGTACTTT TGGAACTTTCCAGGGCAAGGCCCCATTATATCTGATGTTGGGGGAGCAGATCTTGGGGGAGTS6 (SEQ ID NO:28)ATGGCGCCACGACTTACTGGTGCGCATGCGCGCCTGATTTCACCGCTTCTAGGCGCCGGCGCATACCGCACACTGGGCAATAGGGTTGACGTACGAGGTCAAGCC AGTCACGCCGCGCGCACGCACGCGCGCGAGTAACGTTCATCAGCTAACATGA CGTGGCGTAACAGTTAGAGGCTCGCTCGGAAGTACTTCCGAAATCGCACTGTAttorney Docket No. JBI6969WOPCT1CGGCGTCCTGCGCATGCGCCTTGGGTATTTTACGCTAGCATGACGCAATCAGGTAGGCTAGCATGTATAAACAGGAAGTCTTTCCTCCCAGGGGTATG dLCK_core-P_promoter (SEQ ID NO: 29)GGCCCAAAGGCTGCCCTTGAATCTCTTGCCCAGATGCACCCTGGAGGGCAGAAGGGAGGGTCTATCAGACATCCTCAACTTTAAACCTCCCAGTGCTGGGACAGTAGGGGAAGATGGACCTGGTCTGGAGGGGGACCCCCAGGGGCTGAGGGGGTCTATGGTGGCAGGAAGCTTGGCGTGCTAGAGGGTTGTGGTTGGGCTGCTGGGGCCCGGTTGGCTGCGGAGCCCTCCGGAGGAGGCAGGAAGTCAGGGTGGGACGTGGGCGCGGGGAGACAGGTGGTGGCTACGACGGCGAAGGGAGCTGAGACTGTCCAGGCAGCCAGGTTAGGCCAGGAGGACCATGTGAATGGGGCCAGA dLCK_core-P-il_Tl_promoter: (SEQ ID NO: 30)GGCCCAAAGGCTGCCCTTGAATCTCTTGCCCAGATGCACCCTGGAGGGCAGAAGGGAGGGTCTATCAGACATCCTCAACTTTAAACCTCCCAGTGCTGGGACAGTAGGGGAAGATGGACCTGGTCTGGAGGGGGACCCCCAGGGGCTGAGGGGGTCTATGGTGGCAGGAAGCTTGGCGTGCTAGAGGGTTGTGGTTGGGCTGCTGGGGCCCGGTTGGCTGCGGAGCCCTCCGGAGGAGGCAGGAAGTCAGGGTGGGACGTGGGCGCGGGGAGACAGGTGGTGGCTACGACGGCGAAGGGAGCTGAGACTGTCCAGGCAGCCAGGTTAGGCCAGGAGGACCATGTGAATGGGGCCAGAGGGCTCCCGGGCTGGGCAGGTAAGGAGCGCTGGTATTGGATGGCGCCACGACTTACTGGTGCGCATGCGCGCCTGATTTCACCGCTTCTAGGCGCCGGCGCATACCGCACACTGGGCAATAGGGTTGACGTACGAGGTCAAGCCAGTCACGCCGCGCGCACGCACGCGCGCGAGTAACGTTCATCAGCTAACATGACGTGGCGTAACAGTTAGAGGCTCGCTCGGAAGTACTTCCGAAATCGCACTGTCGGCGTCCTGCGCATGCGCCTTGGGTATTTTACGCTAGCATGACGCAATCAGGTAGGCTAGCATGTATAAACAGGAAGACGCGTTCTTTCCTCCCAGGGGTATGCCCCTTCAGCCCCCTCTTCCATTCCCTCAGGGACC dLCK_core-P-il_T2_promoter (SEQ ID NO: 31)GGCCCAAAGGCTGCCCTTGAATCTCTTGCCCAGATGCACCCTGGAGGGCAGAAGGGAGGGTCTATCAGACATCCTCAACTTTAAACCTCCCAGTGCTGGGACAGTAGGGGAAGATGGACCTGGTCTGGAGGGGGACCCCCAGGGGCTGAGGGGGTCTATGGTGGCAGGAAGCTTGGCGTGCTAGAGGGTTGTGGTTGGGCTGCTGGGGCCCGGTTGGCTGCGGAGCCCTCCGGAGGAGGCAGGAAGTCAGGGTGGGACGTGGGCGCGGGGAGACAGGTGGTGGCTACGACGGCGAAGGGAGCTGAGACTGTCCAGGCAGCCAGGTTAGGCCAGGAGGACCATGTGAATGGGGCCAGAGGGCTCCCGGGCTGGGCAGGTAAGGAGCGCTGGTATTGGATGGCGCCACGACTTACTGGTGCGCATGCGCGCCTGATTTCACCGCTTCTAGGCGCCGGCGCATACCGCACACTGGGCAATAGGGTTGACGTACGAGGTCAAGCCAGTCACGCCGCGCGCACGCACGCGCGCGAGTAACGTTCATCAGCTAACATGACGTGGCGTAACAGTTAGAGGCTCGCTCGGAAGTACTTCCGAAATCGCACTGTCGGCGTCCTGCGCATGCGCCTTGGGTATTTTACGCTAGCATGACGCAATCAGGTAGGCTAGCATGTATAAttorney Docket No. JBI6969WOPCT1AACAGGAAGACGCGTTCTTTCCTCCCAGGGGTATGGGACAGCTTGGTATCCT GAGAACCTCACACAGTCGCGCGTCCGAATCGGAACACAATGTTCCTAGCTCT ACTTTCAAGGCCCACCGGAAGTGCGGATTCTGATGGTCGTAGAAACCGGAAATAATGTACAACAATATCTGTTAGTAAACAGGAAGTGTCACCTTTGGGTCACG GTCCCACTTCCTGATTGCTACCTTACTGGAATTTACCCCTTCAGCCCCCTCTTC CATTCCCTCAGGGACC dLCK_core-P-il_T3_promoter (SEQ ID NO: 32)GGCCCAAAGGCTGCCCTTGAATCTCTTGCCCAGATGCACCCTGGAGGGCAGAAGGGAGGGTCTATCAGACATCCTCAACTTTAAACCTCCCAGTGCTGGGACAGTAGGGGAAGATGGACCTGGTCTGGAGGGGGACCCCCAGGGGCTGAGGGGGTCTATGGTGGCAGGAAGCTTGGCGTGCTAGAGGGTTGTGGTTGGGCTGCTGGGGCCCGGTTGGCTGCGGAGCCCTCCGGAGGAGGCAGGAAGTCAGGGTGGGACGTGGGCGCGGGGAGACAGGTGGTGGCTACGACGGCGAAGGGAGCTGAGACTGTCCAGGCAGCCAGGTTAGGCCAGGAGGACCATGTGAATGGGGCCAGAGGGCTCCCGGGCTGGGCAGGTAAGGAGCGCTGGTATTGGATGGCGCCACGACTTACTGGTGCGCATGCGCGCCTGATTTCACCGCTTCTAGGCGCCGGCGCATACCGCACACTGGGCAATAGGGTTGACGTACGAGGTCAAGCCAGTCACGCCGCGCGCACGCACGCGCGCGAGTAACGTTCATCAGCTAACATGACGTGGCGTAACAGTTAGAGGCTCGCTCGGAAGTACTTCCGAAATCGCACTGTCGGCGTCCTGCGCATGCGCCTTGGGTATTTTACGCTAGCATGACGCAATCAGGTAGGCTAGCATGTATAAACAGGAAGACGCGTTCTTTCCTCCCAGGGGTATGGGACAGCTTGGTATCCTGAGAAACCGCAACACAGTCGCGCGTCCGAATCGGTACATAATGTTCCTAGCTCTACTTTCAAGGCCCACAGGAAGTGCGGATTCTGATGGTCGTAGAATAAACAGGAAGTAATGTACAACAATATCTGTTAGTAAACAATGTCACCTTTGGGTCACGGTCAACAGGCCGTGCTACCTTACTGGAATTTACCCCTTCAGCCCCCTCTTCC ATTCCCTCAGGGACC dLCK_core-P-il_T4_promoter (SEQ ID NO: 33)GGCCCAAAGGCTGCCCTTGAATCTCTTGCCCAGATGCACCCTGGAGGGCAGAAGGGAGGGTCTATCAGACATCCTCAACTTTAAACCTCCCAGTGCTGGGACAGTAGGGGAAGATGGACCTGGTCTGGAGGGGGACCCCCAGGGGCTGAGGGGGTCTATGGTGGCAGGAAGCTTGGCGTGCTAGAGGGTTGTGGTTGGGCTGCTGGGGCCCGGTTGGCTGCGGAGCCCTCCGGAGGAGGCAGGAAGTCAGGGTGGGACGTGGGCGCGGGGAGACAGGTGGTGGCTACGACGGCGAAGGGAGCTGAGACTGTCCAGGCAGCCAGGTTAGGCCAGGAGGACCATGTGAATGGGGCCAGAGGGCTCCCGGGCTGGGCAGGTAAGGAGCGCTGGTATTGGATGGCGCCACGACTTACTGGTGCGCATGCGCGCCTGATTTCACCGCTTCTAGGCGCCGGCGCATACCGCACACTGGGCAATAGGGTTGACGTACGAGGTCAAGCCAGTCACGCCGCGCGCACGCACGCGCGCGAGTAACGTTCATCAGCTAACATGACGTGGCGTAACAGTTAGAGGCTCGCTCGGAAGTACTTCCGAAATCGCACTGTCGGCGTCCTGCGCATG CGCCTTGGGTATTTTACGCTAGCATGACGCAATCAGGTAGGCTAGCATGTATA AACAGGAAGACGCGTTCTTTCCTCCCAGGGGTATGGGACAGCTTGGTATCCTGAGCTTGTGGTTTCACAGTCGCGCGTCCGAATCGGCACATTCTGTACTTAGCT CTACTTTCAAGGCCCTGTTTACTTTCGGATTCTGATGGTCGTAGAAGGCAGGAAttorney Docket No. JBI6969WOPCT1AGTGGATGTACAACAATATCTGTTATTGTTTACTGTCACCTTTGGGTCACGGTCAAACAGGAAGTGGTGCTACCTTACTGGAATTTATGTTTGCTTTGCCCCTTCA GCCCCCTCTTCCATTCCCTCAGGGACC dLCK_core-P-il_T5_promoter (SEQ ID NO: 34)GGCCCAAAGGCTGCCCTTGAATCTCTTGCCCAGATGCACCCTGGAGGGCAGAAGGGAGGGTCTATCAGACATCCTCAACTTTAAACCTCCCAGTGCTGGGACAGTAGGGGAAGATGGACCTGGTCTGGAGGGGGACCCCCAGGGGCTGAGGGGGTCTATGGTGGCAGGAAGCTTGGCGTGCTAGAGGGTTGTGGTTGGGCTGCTGGGGCCCGGTTGGCTGCGGAGCCCTCCGGAGGAGGCAGGAAGTCAGGGTGGGACGTGGGCGCGGGGAGACAGGTGGTGGCTACGACGGCGAAGGGAGCTGAGACTGTCCAGGCAGCCAGGTTAGGCCAGGAGGACCATGTGAATGGGGCCAGAGGGCTCCCGGGCTGGGCAGGTAAGGAGCGCTGGTATTGGATGGCGCCACGACTTACTGGTGCGCATGCGCGCCTGATTTCACCGCTTCTAGGCGCCGGCGCATACCGCACACTGGGCAATAGGGTTGACGTACGAGGTCAAGCCAGTCACGCCGCGCGCACGCACGCGCGCGAGTAACGTTCATCAGCTAACATGACGTGGCGTAACAGTTAGAGGCTCGCTCGGAAGTACTTCCGAAATCGCACTGTCGGCGTCCTGCGCATGCGCCTTGGGTATTTTACGCTAGCATGACGCAATCAGGTAGGCTAGCATGTATAAACAGGAAGACGCGTTCTTTCCTCCCAGGGGTATGGGACAGCTTGGTATCCTGAGGGAACAACGTGTACTCACAGTCGCGCGTCCGAATCTCTGTTTACTAGCTCTACTTTCAAGGCCCATTGTTCGGATTCTGATGGTCGTAGATGCTGGGTATAGTATTCTTGGTTGATGTACAACAATATCTGTTAAAAAGAGGAAGTGAGTCACCTTTGGGTCACGGTCATTGTTTATTTTGCTACCTTACTGGAATTTAATTTATGCCCC TTCAGCCCCCTCTTCCATTCCCTCAGGGACC dLCK_core-P-il_T6_promoter (SEQ ID NO: 35)GGCCCAAAGGCTGCCCTTGAATCTCTTGCCCAGATGCACCCTGGAGGGCAGAAGGGAGGGTCTATCAGACATCCTCAACTTTAAACCTCCCAGTGCTGGGACAGTAGGGGAAGATGGACCTGGTCTGGAGGGGGACCCCCAGGGGCTGAGGGGGTCTATGGTGGCAGGAAGCTTGGCGTGCTAGAGGGTTGTGGTTGGGCTGCTGGGGCCCGGTTGGCTGCGGAGCCCTCCGGAGGAGGCAGGAAGTCAGGGTGGGACGTGGGCGCGGGGAGACAGGTGGTGGCTACGACGGCGAAGGGAGCTGAGACTGTCCAGGCAGCCAGGTTAGGCCAGGAGGACCATGTGAATGGGGCCAGAGGGCTCCCGGGCTGGGCAGGTAAGGAGCGCTGGTATTGGATGGCGCCACGACTTACTGGTGCGCATGCGCGCCTGATTTCACCGCTTCTAGGCGCCGGCGCATACCGCACACTGGGCAATAGGGTTGACGTACGAGGTCAAGCCAGTCACGCCGCGCGCACGCACGCGCGCGAGTAACGTTCATCAGCTAACATGACGTGGCGTAACAGTTAGAGGCTCGCTCGGAAGTACTTCCGAAATCGCACTGTCGGCGTCCTGCGCATGCGCCTTGGGTATTTTACGCTAGCATGACGCAATCAGGTAGGCTAGCATGTATAAACAGGAAGACGCGTTCTTTCCTCCCAGGGGTATGGGACAGCTTGGTATCCTGAGTTGGAACAATTGGTGACACAGTCGCGCGTCCGAATCACGAGGAAGTTAGCTCTACTTTCAAGGCCCGAAGCCGGAAGTGCCGGATTCTGATGGTCGTAGATGTGGATTCATGTACAACAATATCTGTTAGACCGGAAGTGGTCACCTTTGGGTCACGGTCATTTAGTCCATTTACATTTAATGTTGCTACCTTACTGGAATTTACCCCTTCAGCCCCCTCTTCCATTCCCTCAGGGACCAttorney Docket No. JBI6969WOPCT1Example 3 : Lentiviral production and their use in human T cells

[0222] Lentivirus production. Suspension 293 cells were transfected with four plasmids to produce 3rd generation lentiviral vectors. The transfer plasmid encodes the vector genome that is integrated into cells and is responsible for driving CAR expression. The envelope plasmid encodes the vesicular stomatitis virus glycoprotein (VSVG), which is carried on the viral surface and facilitates cell entry. The Gag / Pol plasmid encodes for viral structural proteins to form functional particles. The Rev plasmid encodes HIV Rev, which enables export of viral genomes for packaging. The plasmids were transfected using LV-Max reagents, followed by transfection enhancer addition 3-4 hours later. Viruses were harvested 48 hours post-transfection, separated from 293 cells via centrifugation (1500g x 10 minutes), and may also be optionally concentrated using polyethylene glycol precipitation. Concentrated viruses were resuspended in phosphate- buffered saline (PBS). Isolated lentiviral vectors were then aliquoted and frozen for analysis and experiments.

[0223] Lentivirus titer quantitation. Lenti viruses were titered by three-fold serial dilution on SupTl cells in well -plates. Four days after adding viruses to cells, transduction was analyzed by flow cytometry. Antibodies directed at the gene of interest encoded by the transfer plasmid were used to detect expression on Sup-Tl cells. Titers were then calculated by multiplying the transduction rate by the virus dilution and dividing by the volume of virus added to cells in wells exhibiting 5%-30% transgene expression. Titers calculated from these wells were averaged and the average was reported as the titer for the batch of virus.

[0224] Lentiviral transduction of human T cells. Human T cells were isolated from peripheral blood mononuclear cells (PBMCs) via negative selection (StemCell #17951) and resuspended in CTS™ OpTmizer™ T Cell Expansion SFM Medium (ThermoFisher #A1048501) supplemented with 100 lU / ml hIL-2IS (Miltenyi #130-097-748), 5% Human AB Serum (Valley Biomedical #HP1022HI), and Antibiotic-Antimycotic (ThermoFisher #15240062) at a density of 2.5 x 106cells / ml. T cells were activated by adding 58.8 pl / ml of MACS® GMP T Cell TransAct™ (Miltenyi #170-076-156) and incubating for 1 day. Activated T cells were then transduced with lentivirus at a Multiplicity of InfectionAttorney Docket No. JBI6969WOPCT1(MOI) of 1, combined with Vectofusin®-! (Miltenyi #130-111-163) at the 1: 100 dilution for 48 hours. The cells were cultured and expanded with fresh media replenished every 2-3 days for 14 days. After the expansion period, the surface expression of relevant molecules was analyzed via flow cytometry.

[0225] LCK promoter optimization. The nonviral designs of the LCK promoter were optimized using the dual promoter system which included a CAG promoter-driven GFP to identify successfully knocked-in cells. The goal was to enhance the promoter activity while preserving T cell specificity and minimizing the size of the promoter. The strategy involved shortening the distal LCK promoter size, referred to as the dLCK core promoter, and incorporating new T cell-specific transcription factor binding sites within the intron to enhance the promoter activity. For the dLCK_core-P, the core promoter of the distal LCK promoter consisting of a modified sequence of 269 bp upstream of the transcription start site and an additional 88bp within the 1stexon of the distal LCK transcript in human. For il, this enhancer was derived from the first intron of the human LCK gene, retaining the splicing donor and acceptor sites while other intronic regions were removed (FIG.5). Within this il intron, new T cell-specific transcription factor binding sites were incorporated (Tl, T2, T3, T4, T5, T6).

[0226] The newly designed LCK promoters in primary a[3 T cells utilizing the dual promoter system were evaluated (FIG.6). The previous distal LCK 2kb promoter design (dLCK_CTRL) served as the baseline control, while the lead design dLCK-il_TS6 from previous optimization, was used as the benchmark. Full length EFla promoter (1334 bp) was included as a positive control. The data is from a single experiment conducted with aP T cells from two donors. The GFP+ population indicated successfully knocked-in cells, while the CAR+ population reflects active promoter-driven CAR expression.

[0219] Flow cytometry data was analyzed, combining results from two T cell donors (FIG.7). Promoter activity was quantified using CAR mean fluorescence intensity (MFI), calculated based on CAR expression levels. The previous lead design dLCK-il-TS6 and the new design dLCK_core-P_il_Tl exhibited similar CAR MFI, indicating comparable promoter activities. As previously described, the CAR+ / GFP+ population was utilized to evaluate whether the promoter was fully or partially active in primary T cells, with a higher proportion of CAR+GFP+ cells indicating a more fully active promoter. TheAttorney Docket No. JBI6969WOPCT1 dLCK_core-P_il_Tl design showed -80% of the knocked-in LCK promoters were active (with 80% CAR+GFP+ compared to 20% GFP+ only). This aligns with the promoter activity observed in the previous lead design dLCK-il-TS6 and the EFla control, but dLCK_core-P_il_Tl is significantly smaller in size (744 bp for dLCK_core-P_il_Tl vs. 2275 bp for dLCK-il-TS6). Thus, the new design dLCK_core-P_il_Tl exhibited similar promoter activity to the previous lead design dLCK-il-TS6, while being significantly smaller in size. No improvements in dLCK promoter activity were observed for the other designs, except for the dLCK_core-P_i2_T2 design, which showed enhanced promoter activity compared to the dlCK_core-P design but similar activity to the dLCK_CTRL.

[0220] The new LCK designs in iPSCs using the dual promoter system were evaluated using flow cytometry (FIG.8). The previous distal LCK 2 kb promoter design (dLCK- CTRL) was used as the baseline control, with the CAG promoter serving as a positive control. The GEP+ population marks successfully knocked-in cells. While all LCK designs displayed clear GEP+ populations, no CAR+ cells were detected in these groups, indicating an absence of LCK promoter activity in iPSCs.

[0221] New additional designs within the lentiviral system were also evaluated (LIG.9). The object was to determine whether the T cell specific promoter designs could be incorporated into the lentiviral system. Lor this assessment, 3rdgeneration lentiviral platform was utilized with a single promoter. Similar to the non-viral designs, both the long version of the LCK promoter (dLCK_CTRL) and the short version of the LCK promoter (dLCK_core-P), with or without the intronic enhancers were tested. The sequences used were identical to those of the promoter sequences in the non-viral designs.

[0222] Lentivirus titer quantitation was quantitated (EIG.10 ). The lentiviral titer was calculated by analyzing transgene expression through flow cytometry. Transducing Units per milliliter (TU / mL) reflects the number of viral particles that are capable of infecting and integrating into the target cells. Results indicated that the lead design in the non-viral system, dLCK_core-P-il_Tl, along with the design dLCK_core-P-il_T2, showed a titer comparable to that of the EE la control. The titration data suggest that the dLCK promoter designs are also effective the lentiviral delivery system.Attorney Docket No. JBI6969WOPCT1

[0223] LCK promoters in primary aP T cells within the lentiviral system were evaluated using flow cytometry (FIG.l 1). The previously established distal LCK 2kb promoter design (dLCK_CTRL) served as the baseline control, while the lead design dLCK- il_TS6 from previous optimization, was used as the benchmark. Additionally, the full length EFla promoter (1334 bp) was included as a positive control. The data shown are derived from a single experiment conducted with aP T cells from two donors. The CAR+ population reflects active promoter-driven CAR expression, indicating the promoter activities.

[0227] Results from two T cell donors were analyzed using flow cytometry. Promoter activity was quantified using CAR mean fluorescence intensity (MFI), calculated based on CAR expression levels. The previous lead design dLCK-il-TS6, along with the new designs, dLCK_core-P_il_Tl and dLCK_core-P_il_T2, showed similar CAR MFI, indicating similar promoter activities. The measured promoter activities from these promoters were -60% of the activity observed for the EFla promoter based on the CAR MFI calculations. The new designs dLCK_core-P_il_Tl and dLCK_core-P_il_T2 exhibited similar promoter activities to the previous lead design dLCK-il-TS6, while being significantly smaller in size. The promoter activities of dLCK-il-TS6, dLCK_core- P_il_Tl and dLCK_core-P_il_T2 were -60% of the EFla control promoter activity within the lentiviral system. The LCK promoter designs also demonstrated effective performance in the lentiviral system. FIG.11 shows the evaluation of the LCK promoters in primary aP T cells within the lentiviral system. The previously established distal LCK 2kb promoter design (dLCK_CTRL) served as the baseline control, while the lead design dLCK-il_TS6 from previous optimization, was used as the benchmark. Additionally, the full length EFla promoter (1334 bp) was included as a positive control. The data shown are derived from a single experiment conducted with aP T cells from two donors. The CAR+ population reflects active promoter-driven CAR expression, indicating the promoter activities.

[0228] FIG.12 shows the analysis of flow cytometry data, combining results from two T cell donors. Promoter activity was quantified using CAR mean fluorescence intensity (MFI), calculated based on CAR expression levels. The previous lead design dLCK-il- TS6, along with the new designs, dLCK_core-P_il_Tl and dLCK_core-P_il_T2,Attorney Docket No. JBI6969WOPCT1 showed similar CAR MFI, indicating similar promoter activities. The measured promoter activities from these promoters were -60% of the activity observed for the EFla promoter based on the CAR MFI calculations. Conclusion: The new designs dLCK_core- P_il_Tl and dLCK_core-P_il_T2 exhibited similar promoter activities to the previous lead design dLCK-il-TS6, while being significantly smaller in size; The promoter activities of dLCK-il-TS6, dLCK_core-P_il_Tl and dLCK_core-P_il_T2 were -60% of the EFla control promoter activity within the lenti viral system. The LCK promoter designs also demonstrated effective performance in the lentiviral system.

[0224] The disclosures of each and every patent, patent application, and publication cited herein are hereby incorporated herein by reference in their entirety. While there are reference to specific embodiments, it is apparent that other embodiments and variations may be devised by others skilled in the art without departing from the true spirit and scope of the invention. The appended claims are intended to be construed to include all such embodiments and equivalent variations.

Claims

Attorney Docket No. JBI6969WOPCT1CLAIMSWhat is claimed is:

1. A nucleic acid comprising a. a first sequence comprising a promoter, wherein the promoter drives expression in T cells, and b. a second sequence encoding a protein or an RNA.

2. The nucleic acid of claim 1 , wherein the promoter does not drive expression in cells that are non-T cells.

3. The nucleic acid of claim 1 or 2, wherein the first sequence comprises a lymphocyte protein tyrosine kinase (LCK) promoter.

4. The nucleic acid any one of claims 1-3, wherein the first sequence comprises an LCK promoter comprising at least 80%, 85%, 90%, 95% or 100% sequence identity to SEQ ID NO: 1.

5. The nucleic acid of any one of claims 1-4, wherein the protein comprises a chimeric antigen receptor or an engineered T cell receptor.

6. The nucleic acid of any one of claims 1-4, wherein the RNA is a microRNA or a microRNA-adapted shRNA.

7. The nucleic acid of any one of claims 1-6, further comprising a third sequence comprising an enhancer sequence downstream or upstream from the first sequence.

8. The nucleic acid of claim 7, wherein the enhancer sequence comprises an intronic enhancer region, at least one transcription factor binding site, or a combination thereof.

9. The nucleic acid claim 8, wherein the enhancer sequence comprises an intronic enhancer derived from the first intron of the human LCK gene.

10. The nucleic acid of any one of claims 7-9, wherein the enhancer sequence comprises a synthetic intronic enhancer designed for efficient splicing.

11. The nucleic acid of any one of claims 7-10, wherein the third sequence comprises at least 80%, 85%, 90%, 95% or 100% sequence identity to SEQ ID NO: 12-21, 29-35.

12. The nucleic acid of claim 11, wherein the third sequence comprises SEQ ID NO: 18.Attorney Docket No. JBI6969WOPCT113. The nucleic acid of any one of claims 1-12, wherein the nucleic acid sequence comprises a sequence comprising at least 80%, 85%, 90%, 95% or 100% sequence identity to any one of SEQ ID NOs: 2-11.

14. The nucleic acid of any one of claims 1-13, wherein the nucleic acid sequence comprises SEQ ID NO: 8.

15. The nucleic acid of any one of claims 8-14, wherein the transcription factor binding site comprises a T cell-specific transcription factor binding site.

16. The nucleic acid of claim 15, wherein the transcription factor binding site comprises a sequence comprising at least 80%, 85%, 90%, 95% or 100% sequence identity to any one of SEQ ID NOs: 23-28.

17. The nucleic acid of any one of claims 1-16 wherein the nucleic acid is comprised within a vector.

18. The nucleic acid of any one of claims 1-17, wherein the promoter drives expression in T cells.

19. The nucleic acid of claim 17, wherein the T cells comprise primary aP T cells, iPSC- derived T cells, or both.

20. The nucleic acid of claim 19, wherein the iPSC-derived T cells comprise iPSC- derived y8T (iy8 T) cells.

21. The nucleic acid of any one of claims 7-20, wherein the enhancer comprises at least one transcription factor binding site comprising a T cell-specific transcription factor binding site, wherein the transcription factor binding site is TS6.

22. The nucleic acid of claim 21 , wherein the transcription factor binding site comprises a sequence set forth in SEQ ID NO: 28.

23. The nucleic acid of claim 21 or 22, further comprising at least five transcription factors expressed in T cells.

24. The nucleic acid of any one of claims 21-23, wherein the transcription factors comprises NRF, ZNF, CREB, ZBTB and CREB3L / XBP.

25. The nucleic acid of any one of claims 2-24, wherein the non-T cells comprise iPSCs.

26. The nucleic acid of any one of claims 1-26, wherein the nucleic acid is comprised within a viral vector or a non-viral vector.

27. The nucleic acid of claim 26, wherein the viral vector comprises a lentiviral vector.Attorney Docket No. JBI6969WOPCT128. The nucleic acid of any one of claims 7-27, wherein the enhancer comprises an EFla intron.

29. The nucleic acid of any one of claims 8-Error! Reference source not found., wherein the at least one transcription factor binding site or EFla intron is incorporated within or is adjacent to a human LCK promoter region.

30. A method of making a genetically modified immune cell, the method comprising delivering a nucleic acid molecule to a cell, wherein the nucleic acid molecule comprises a. a first sequence comprising a promoter, wherein the promoter drives expression in T cells, and wherein the promoter does not drive expression in cells that are non-T cells; and b. a second sequence encoding a protein or an RNA.

31. The method of claim 30, wherein the delivering of the nucleic acid is by electroporation or a viral-based gene transfer system.

32. The method of claim 31, wherein the delivering is by a CRISPR / MAD7-based non- viral delivery system.

33. The method of any one of claims 30-32, wherein the nucleic acid is not expressed in non-immune cells.

34. The method of any one of claims 30-33, wherein expression of the nucleic acid is within T cells.

35. The method of any one of claims 30-34, wherein off-target cells exhibit reduced or no activity or expression of the nucleic acid compared to cells modified using a vector with ubiquitous promoters.

36. The method of any one of claims 30-35, wherein the off-target cells comprise iPSCs and / or non T cells.

37. The method of any one of claims 30-36, wherein the promoter comprises an LCK promoter sequence.

38. The method of claim 37, wherein the LCK promoter sequence comprises a sequence comprising at least 80%, 85%, 90%, 95% or 100% sequence identity to SEQ ID NO: 1.

39. The method of any one of claims 30-38, wherein the protein comprises a chimeric antigen receptor or an engineered T cell receptor.Attorney Docket No. JBI6969WOPCT140. The method of any one of claims 30-39, wherein the nucleic acid further comprises an enhancer sequence downstream or upstream from the promoter sequence.

41. The method of claim 40, wherein the enhancer sequence comprises an intronic enhancer region, at least one transcription factor binding site, or a combination thereof.

42. The method of any one of claims 40 or 41 wherein the enhancer sequence comprises an intronic enhancer derived from the first intron of the human LCK gene.

43. The method of any one of claims 40-42, wherein the enhancer sequence comprises a synthetic intronic enhancer designed for efficient splicing.

44. The method of any one of claims 40-43, wherein the enhancer sequence comprises a sequence with at least 80%, 85%, 90%, 95% or 100% sequence identity to any one of SEQ ID NOs: 12-21, 29-35.

45. The method of any one of claims 40-44, wherein the nucleic acid sequence comprises a sequence with at least 80%, 85%, 90%, 95% or 100% sequence identity to any one of SEQ ID NOs: 2-11.

46. The method of any one of claims 41-45, wherein the transcription factor binding site comprises a T cell-specific transcription factor binding site.

47. The method of claim 46, wherein the transcription factor binding site comprises a sequence comprising at least 80%, 85%, 90%, 95% or 100% sequence identity to any one of SEQ ID NOs: 23-28.

48. The method of any one of claims 30-47, wherein the nucleic acid is comprised within a vector.

49. The method of any one of claims 30-48, wherein the promoter drives expression in T cells.

50. The method of claim 49, wherein the T cells comprise primary aP T cells, iPSC- derived T cells, or both.

51. The method of claim 50, wherein the iPSC-derived cells comprise IPSC derived T cells.

52. The method of any one of claims 30-51, wherein the non-T cells comprise iPSCs.

53. The method of any one of claims 30-52, wherein the nucleic acid is comprised within a viral vector or a non-viral vector.

54. The method of claim 53, wherein the viral vector comprises a lentiviral vector.Attorney Docket No. JBI6969WOPCT155. The method of any one of claims 40-54, wherein the enhancer comprises an EFla intron.

56. The method of any one of claims 41-55, wherein the at least one transcription factor binding site comprises a T cell-specific transcription factor binding site, wherein the transcription factor binding site is TS6.

57. The method of any one of claims 41-56, wherein the at least one transcription factor binding site or EFla intron is incorporated within or is adjacent to the human LCK gene.

58. The method of any one of claims 41-57, wherein the protein is expressed only in T cells as compared to a method using a nucleic acid comprising promoter that is a ubiquitous promoter.

59. The method of any one of claims 30-58, wherein the nucleic acid further comprises at least five transcription factors expressed in T cells.

60. The method of claim 59, wherein the transcription factors comprises NRF, ZNF, CREB, ZBTB and CREB3L / XBP.

Images