Antisense oligonucleotide targeting inhibin βe and use thereof
By designing antisense oligonucleotides that target inhibin βE, specifically binding to the INHβE mRNA or pre-mRNA region, the lack of nucleic acid drugs targeting increased waist-to-hip ratio and abdominal obesity in existing technologies has been solved, achieving effective treatment of metabolic diseases.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- LNCTAC CO LTD
- Filing Date
- 2025-12-17
- Publication Date
- 2026-07-02
AI Technical Summary
Currently, there are no nucleic acid drugs that target β-inhibin E for the treatment of increased waist-to-hip ratio, abdominal obesity, and related metabolic diseases. Existing gene therapy methods mainly target rare diseases, and there is a lack of effective means for common diseases.
We designed and synthesized antisense oligonucleotides (ASOs) that target inhibin βE, specifically binding to specific regions of INHβE mRNA or pre-mRNA, and enhanced their efficacy through chemical modification, for use in the preparation of drugs to treat related diseases.
It significantly inhibits the expression of INHβE, reduces triglycerides, increases high-density lipoprotein cholesterol, improves waist-to-hip ratio and abdominal obesity, and has potential protective effects in the treatment of type 2 diabetes.
Smart Images

Figure CN2025143215_02072026_PF_FP_ABST
Abstract
Description
Antisense oligonucleotides targeting β-inhibin E and their applications Technical Field
[0001] This invention relates to the field of biomedicine, specifically to antisense oligonucleotides targeting β-inhibin E and their applications. Background Technology
[0002] Increased waist-to-hip ratio and abdominal obesity are risk markers for cardiovascular disease, and abdominal obesity is an important marker of insulin resistance. Genetic variations associated with abdominal fat accumulation are related to hepatic steatosis in metabolic diseases such as insulin resistance.
[0003] mRNA-based gene-targeted therapy is one of the methods of specific targeted therapy, and it is currently experiencing rapid development. It works by endogenously cleaving and inhibiting the expression of disease-causing genes in patients, and has made good progress. Existing gene therapy products are mainly for rare disease indications, but are gradually expanding to common indications, indicating that gene therapy can be a potential treatment for cancer. Currently, antisense oligonucleotides specifically inhibiting mRNA expression and thereby reducing the expression of regulatory proteins are among the competing technologies for targeted gene therapy.
[0004] Inhibin beta-E (INHβE) is primarily expressed in the liver and belongs to the TGF-β family, regulating various cellular functions. Exon sequencing revealed that INHβE is associated with a body mass index-corrected waist-to-hip ratio, and loss of INHβE function (INHβEpLOF) contributes to healthy fat distribution. Analysis of INHβEpLOF carriers showed a favorable metabolic profile characterized by reduced triglycerides and fasting blood glucose and increased high-density lipoprotein cholesterol. INHβEpLOF mutations are associated with favorable metabolic profiles and protection against type 2 diabetes, suggesting that INHβE is a potential therapeutic target for abdominal obesity and metabolic diseases. [1] .
[0005] Currently, there are no nucleic acid drugs targeting this specific target that are in the clinical trial stage. Therefore, this invention is proposed.
[0006] References
[0007] [1]Deaton AM, Dubey A, Ward LD, et al. Rare loss of function variants in the hepatokine gene INHBE protect from abdominal obesity[J]. Nature Communications, 2022, 13(1):4319. Summary of the Invention
[0008] This invention first relates to a set of antisense oligonucleotide (ASO) molecules targeting the inhibinbetaE (INHβE) mRNA gene. The ASO molecules are 16–22 bases in length, and the target gene is INHβE mRNA. The ASOs specifically pair with a specific region of the target gene, and the initiation site of this specific region is located at:
[0009] The mRNA of INHβE is located at the following positions:
[0010] (1) Bits 1 to 206 of 5`UTR;
[0011] (2) Bits 216 to 502 of EXON1;
[0012] (3) Bits 511 to 531 of EXON1 / EXON2;
[0013] (4) Bits 541 to 1275 of EXON2;
[0014] (5) Bits 1288 to 2441 of 3`UTR;
[0015] The mRNA sequence of INHβE is shown in SEQ ID NO: 318;
[0016] The following is the location of the pre-mRNA of INHβE:
[0017] (1) Bits 3495 to 3513 of EXON1 / INTRON 1-2;
[0018] (2) Bits 3520 to 3727 of INTRON 1-2;
[0019] (3) Bits 3757 to 3774 of INTRON 1-2 / EXON2;
[0020] The pre-mRNA sequence of INHβE is shown in SEQ ID NO: 319.
[0021] Preferably, the starting point of the specific region is located at,
[0022] The following is the location of the INHβE gene mRNA sequence:
[0023] (1) EXON1's 282-bit;
[0024] (2) The 502nd bit of EXON1;
[0025] (3) EXON2's 724-bit;
[0026] (4) EXON2's 964-bit;
[0027] (5) The 1253rd bit of EXON2;
[0028] (6) EXON2's 1258-bit;
[0029] (7) EXON2's 1260-bit;
[0030] (8) 1288 bits of EXON2 / 3`UTR;
[0031] (9) 1510 bits of EXON2 / 3`UTR;
[0032] (10) 1516 bits of EXON2 / 3`UTR;
[0033] (11) 1726 bits of EXON2 / 3`UTR;
[0034] (12) 1752 bits of EXON2 / 3`UTR;
[0035] The following is the location of the INHβE gene Pre-mRNA sequence:
[0036] (1) Bits 3511 to 3512 of EXON1 / INTRON 1-2.
[0037] More preferably, the start site of the specific region is located at the following position in the INHβE gene mRNA sequence:
[0038] (1) The 799th bit of EXON2;
[0039] (2) 1689th bit of EXON2 / 3`UTR;
[0040] (3) 1706 bits of EXON2 / 3`UTR;
[0041] (4) 2295 bits of EXON2 / 3`UTR;
[0042] (5) 1483 bits of EXON2 / 3`UTR;
[0043] (6) 1509th bit of EXON2 / 3`UTR;
[0044] (7) 1511th bit of EXON2 / 3`UTR;
[0045] (8) The 1167th bit of EXON2;
[0046] (9) Bits 1251-1252 of EXON2;
[0047] (10) EXON2's 1254-bit;
[0048] (11) The 1259th bit of EXON2.
[0049] Furthermore, the ASO molecule is selected from any one of the nucleotide sequences shown in SEQ ID NO:1 to 316;
[0050] Preferably, the sequence of the ASO molecule is selected from: SEQ ID NO: 37, 39, 80, 135, 138, 155, 180, 208, 232-233, 261, 289, 293;
[0051] More preferably, the sequence of the ASO molecule is selected from: SEQ ID NO:36, 230, 231, 243, 252, 260, 262, 263, 287, 288, 290, 292;
[0052] Most preferably, the sequence of the ASO molecule is selected from: SEQ ID NO:298, 300.
[0053] Furthermore, the ASO molecule described in this invention is a chemically modified form containing chemical modifications;
[0054] Preferably, the chemical modification comprises: 5'-thiophosphate nucleotides, 5-methylated cytosine nucleotides, 2'-O-methyl modified nucleotides, 2'-O-2-methoxyethyl modified nucleotides, deoxyhypoxanthine, 2'-fluoro modified nucleotides, 3'-nitrogen-substituted modified nucleotides, 2'-deoxy-2'-fluoro modified nucleotides, 2'-deoxy modified nucleotides, locked nucleotides, abasic nucleotides, 2'-amino modified nucleotides, morpholino nucleotides, polypeptide nucleotides, abasic nucleotides, or aminophosphates;
[0055] Most preferably, the chemical modification refers to,
[0056] (1) All nucleotides in the ASO molecular sequence are 5'-phosphothioester nucleotides, and
[0057] (2) The five nucleotides at the 5' and 3' ends of the ASO molecule sequence are modified with MOE (i.e., methoxyethyl modification at the 2' position of the base, 5-N-5).
[0058] Furthermore, the present invention also relates to the following uses of the ASO molecule.
[0059] (1) Prepare a formulation that inhibits the expression of INHβE; or
[0060] (2) To prepare a medicine or pharmaceutical composition for treating diseases related to INHβE; or
[0061] (3) Treatment of diseases related to INHβE; or
[0062] (4) Inhibit the expression of INHβE;
[0063] The diseases mentioned are those caused by hepatic steatosis and / or insulin resistance, including but not limited to: increased waist-to-hip ratio, abdominal obesity, or cardiovascular disease.
[0064] The present invention also relates to a pharmaceutical or pharmaceutical composition comprising the aforementioned ASO molecule, wherein the pharmaceutical or pharmaceutical composition comprises a therapeutically effective amount of the aforementioned ASO molecule, and necessary pharmaceutical excipients.
[0065] The drug or drug composition is an aqueous solvent or an injection; the drug or drug composition is administered via local, intravenous, intramuscular, subcutaneous, or intradermal routes. Attached Figure Description
[0066] Figure 1. Some ASOs inhibit INHβE protein expression in human hepatocellular carcinoma Hep3B cells. Detailed Implementation
[0067] Example 1: Design, synthesis and modification of ASO targeting target genes
[0068] The INHβE mRNA (ENST00000266646) from the Ensembl database was selected as the target gene, and its sequence is shown in SEQ ID NO.318.
[0069] SEQ ID NO.318:
[0070] The INHβE Pre-mRNA (ENST00000266646) from the Ensembl database was selected as the target gene, and its sequence is shown in SEQ ID NO.319:
[0071] SEQ ID NO.319:
[0072] 316 antisense oligonucleotide sequences (ASOs) were designed targeting INHβE mRNA and Pre mRNA genes. These ASO molecular sequences are shown in Table 1.
[0073] Furthermore, the 316 ASO sequences were chemically modified, specifically as follows:
[0074] (1) Monothiolation of phospholipid bonds in all nucleotides in the sequence;
[0075] (2) The modification method of 20ntASO is MOE modification of 5 bases at the 3' end and 5' end (i.e., methoxyethyl modification at the 2' position of the base, 5-10-5);
[0076] (3) The modification of 18ntASO is MOE modification of 4 bases at the 3' end and 5' end (i.e., methoxyethyl modification at the 2' position of the base, 4-10-4);
[0077] The ASO targeting INHβE, number 20_136, is a positive control (GCCACAGGCCTCCACCACCA);
[0078] ASO1 (CCTATAGGACTATCCAGGAA), which does not target INHβE, served as a negative control. [2] ;
[0079] The modification methods for positive and negative control ASOs are the same as above.
[0080] Table 1. Detailed information on ASO molecules (the underlined parts of the sequences in the table represent the loop regions of ASO). Note: The information shown in Table 1 is determined based on the corresponding position of the sequence in the ensembl database.
[0081] Example 1: Testing the activity of antisense oligonucleotides (ASO) in an in vitro cell model (Hep3B human liver cancer cells)
[0082] In this embodiment, the inhibitory effect of the ASO molecules shown in Table 1 on the expression of the Hep3B repressin E protein gene (INHβE) was verified. The specific experimental procedure is as follows:
[0083] (1) Preparation of suspension transfection reagent: Dissolve ASO dry powder in sterile water to a concentration of 10 μM. Dilute 10 μM ASO stock solution to the required concentration using serum-reduced medium (basalmedia, L530KJ). Dilute Lipofectamine 2000 transfection reagent (Invitrogen, 11668-019) with serum-reduced medium. Mix the transfection reagent dilution and ASO dilution separately to prepare the preset concentrations. Prepare ASO transfection complexes with corresponding concentration gradients. Mix by pipetting and aspirating 3-5 times and let stand at room temperature for 20 min.
[0084] (2) Cell treatment: Under the microscope, the confluence rate of Hep3B cells was observed to be >70%. Cells were plated one day before transfection at 5×103 cells / well in 96-well plates. 100 μl of EMEM medium containing 10% FBS was added to each well. Before transfection, 50 μl of EMEM medium containing 10% FBS was replaced. The transfection complex with the set ASO concentration prepared in step (1) was added to the 96-well plate and incubated at 37℃ in a 5% CO2 incubator. After 5 h, the medium was replaced with 100 μl of EMEM medium containing 10% FBS.
[0085] (3) After 24 hours, total RNA was extracted from the cells, and the expression of INHβE mRNA in the cells was detected by quantitative real-time PCR. The qPCR primers used to amplify the internal reference genes ACTB and INHβE are shown in Table 2.
[0086] Table 2 qPCR primer and probe sequences
[0087] Relative gene expression was calculated using the 2^-ΔΔCT method (Livak method), and the inhibition rate of antisense oligonucleotide mRNA expression level was calculated according to the following equation:
[0088] Inhibition rate = (1 - 2^-ΔΔCT) × 100%.
[0089] The experimental groups are as follows:
[0090] Cells treated with modified ASO as indicated by their respective numbers;
[0091] Blank, the blank control group, consists of cells that have not undergone any ASO treatment.
[0092] The efficiency of the ASO sequences described in Table 1 in inhibiting INHβE mRNA in human hepatocellular carcinoma Hep3B cells is shown in Tables 3-1 and 3-2 below. The results show that the ASO sequences shown in Table 1 have a significant inhibitory effect on INHβE mRNA transcription.
[0093] Table 3-1 Antisense oligonucleotide treatment mRNA inhibition rate in Hep3B cells
[0094] Table 3-2 Antisense oligonucleotide treatment mRNA inhibition rate in Hep3B cells
[0095] Example 2: Testing the activity of antisense oligonucleotides (ASO) in an in vitro cell model (Hep3B human liver cancer cells)
[0096] In this embodiment, the inhibitory effect of the ASO molecules shown in Table 1 on the INHβE protein level in Hep3B cells was verified. The transfection reagent was prepared in the same manner as in Example 2, and the experimental steps are as follows:
[0097] (1) Use a 6-well plate and use 1×10⁵ cells / well;
[0098] (2) The concentration of ASO molecules in the cells was 10 nM;
[0099] (3) 72 h after ASO treatment, total protein was extracted from the treated HeLa cells using RIPA lysis buffer (beyotime, P0013B) supplemented with PMSF (phenylmethylsulfonyl fluoride, beyotime, ST505) and protease inhibitor.
[0100] (4) Proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and then transferred to a PVDF membrane. After blocking with 5% skim milk powder, the membrane was incubated overnight at 4°C with INHβE antibody (HUABIO, ER65538) and Tubulin antibody (ZENBIO, R23622). The next day, the membrane was incubated with secondary antibody (ZENBIO, 511203) at room temperature for 1 h. Protein expression levels were observed using a multi-functional imaging system (Tanon 5200 Multi).
[0101] The effects of the ASO sequences described in Table 1 on the inhibition of INHβE protein expression in human hepatocellular carcinoma Hep3B cells are shown in Figure 1 and Table 4. The results show that the ASO sequences shown in Table 1 have an inhibitory effect on INHβE protein expression.
[0102] Table 4. Inhibition rate of INHβE protein
[0103] Finally, it should be noted that the above embodiments are only used to help those skilled in the art understand the essence of the present invention, and are not intended to limit the scope of protection of the present invention.
Claims
1. A group of antisense oligonucleotide (ASO) molecules targeting the inhibin beta E chain (INHβE), characterized in that, The ASO molecule is 16-22 bases in length, and its target gene is INHβE mRNA. The ASO specifically pairs with a specific region of the target gene, and the start site of the specific region is located at: The mRNA of INHβE is located at the following positions: (1) Bits 1 to 206 of 5`UTR; (2) Bits 216 to 502 of EXON1; (3) Bits 511 to 531 of EXON1 / EXON2; (4) Bits 541 to 1275 of EXON2; (5) Bits 1288 to 2441 of 3`UTR; Alternatively, the pre-mRNA of INHβE may be located at the following position: (1) Bits 3495 to 3513 of EXON1 / INTRON 1-2; (2) Bits 3520 to 3727 of INTRON 1-2; (3) Bits 3757 to 3774 of INTRON 1-2 / EXON2; The mRNA sequence of INHβE is shown in SEQ ID NO: 318; The pre-mRNA sequence of INHβE is shown in SEQ ID NO:
319.
2. The ASO molecule according to claim 1, characterized in that, The starting point of the specific region is located at, The following is the location of the INHβE gene mRNA sequence: (1) EXON1's 282-bit; (2) The 502nd bit of EXON1; (3) EXON2's 724-bit; (4) EXON2's 964-bit; (5) The 1253rd bit of EXON2; (6) EXON2's 1258-bit; (7) EXON2's 1260-bit; (8) 1288 bits of EXON2 / 3`UTR; (9) 1510 bits of EXON2 / 3`UTR; (10) 1516 bits of EXON2 / 3`UTR; (11) 1726 bits of EXON2 / 3`UTR; (12) 1752 bits of EXON2 / 3`UTR; Alternatively, the following location in the INHβE gene Pre-mRNA sequence: (1) Bits 3511 to 3512 of EXON1 / INTRON 1-2.
3. The ASO molecule according to claim 1, characterized in that, The start site of the specific region is located at the following position in the INHβE gene mRNA sequence: (1) The 799th bit of EXON2; (2) 1689th bit of EXON2 / 3`UTR; (3) 1706 bits of EXON2 / 3`UTR; (4) 2295 bits of EXON2 / 3`UTR; (5) 1483 bits of EXON2 / 3`UTR; (6) 1509th bit of EXON2 / 3`UTR; (7) 1511th bit of EXON2 / 3`UTR; (8) The 1167th bit of EXON2; (9) Bits 1251-1252 of EXON2; (10) EXON2's 1254-bit; (11) The 1259th bit of EXON2.
4. The ASO molecule according to any one of claims 1-3, characterized in that, The ASO molecule is selected from any one of the nucleotide sequences shown in SEQ ID NO:1 to 316; Preferably, the sequence of the ASO molecule is selected from: SEQ ID NO: 37, 39, 80, 135, 138, 155, 180, 208, 232-233, 261, 289, 293; More preferably, the sequence of the ASO molecule is selected from: SEQ ID NO:36, 230, 231, 243, 252, 260, 262, 263, 287, 288, 290, 292; Most preferably, the sequence of the ASO molecule is selected from: SEQ ID NO:298, 300.
5. The ASO molecule according to any one of claims 1-4, characterized in that, The ASO molecule is a chemically modified version containing chemical modifications; the chemical modifications include, but are not limited to: nucleotides with a 5'-thiophosphate group, 5-methylated cytosine nucleotides, nucleotides modified with 2'-O-methyl, nucleotides modified with 2'-O-2-methoxyethyl, deoxyhypoxanthine, nucleotides modified with 2'-fluorine, nucleotides modified with 3'-nitrogen, nucleotides modified with 2'-deoxy-2'-fluorine, nucleotides modified with 2'-deoxy, locked nucleotides, debased nucleotides, nucleotides modified with 2'-amino, morpholinonucleotides, polypeptide nucleotides, abase-free nucleotides, or aminophosphates.
6. The ASO molecule according to claim 5, characterized in that, The aforementioned chemical modification refers to, (1) All nucleotides in the ASO molecular sequence are 5'-phosphothioester nucleotides, and (2) The five nucleotides at the 5' and 3' ends of the ASO molecule sequence are modified with MOE (i.e., methoxyethyl modification at the 2' position of the base, 5-N-5).
7. The following use of the ASO molecule according to any one of claims 1-6: (1) Prepare a formulation that inhibits the expression of INHβE; or (2) To prepare a medicine or pharmaceutical composition for treating diseases related to INHβE; or (3) Treatment of diseases related to INHβE; or (4) Inhibit the expression of INHβE; The diseases described are: increased waist-to-hip ratio, abdominal obesity, or cardiovascular disease caused by hepatic steatosis and / or insulin resistance.
8. A medicament or pharmaceutical composition comprising the ASO molecule according to any one of claims 1-6, wherein the medicament or pharmaceutical composition comprises a therapeutically effective amount of the ASO molecule, and necessary pharmaceutical excipients.
9. The drug or drug composition according to claim 8, characterized in that, The drug or drug composition is an aqueous solvent or an injection. The drug or drug composition is administered via local, intravenous, intramuscular, subcutaneous, or intradermal routes.