AAV genomes encoding engineered human frataxin transgene

The rAAV vector encoding frataxin with a signal peptide and cell-penetrating peptide, administered via intra-CSF, addresses the limitations of current treatments by enhancing frataxin expression and distribution, providing a one-time therapy for Friedreich's ataxia.

WO2026142957A1PCT designated stage Publication Date: 2026-07-02GENZYME CORP
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/060605
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-12-24
Filing Date
2025-12-19
Publication Date
2026-07-02

AI Technical Summary

Technical Problem

Current gene delivery methods for treating Friedreich's ataxia, such as those using recombinant adeno-associated virus (rAAV), face challenges including toxicity and biodistribution limitations, failing to address the underlying cause of the disease and requiring multiple doses.

Method used

A recombinant adeno-associated virus (rAAV) vector encoding a human frataxin protein with a signal peptide and cell-penetrating peptide, administered via intra-CSF, enhances frataxin secretion and uptake across cells, using a modified AAV9 capsid with targeting peptides for improved biodistribution.

Benefits of technology

This approach enables a one-time therapy that effectively increases frataxin expression in targeted tissues, reducing neurodegeneration and cardiomyopathy symptoms by enabling cross-correction of frataxin in both expressing and non-expressing cells, with enhanced biodistribution and reduced toxicity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000052_0001_TABLE
    Figure IMGF000052_0001_TABLE
  • Figure IMGF000053_0001_TABLE
    Figure IMGF000053_0001_TABLE
  • Figure IMGF000054_0001_TABLE
    Figure IMGF000054_0001_TABLE
Patent Text Reader

Abstract

Provided herein are expression cassettes for expressing a transgene in a cell, wherein the transgene encodes a disorder-related polypeptide. Also provided are methods to treat Friedreich's ataxia. Further provided herein are vectors (e.g., rAAV vectors), viral particles, pharmaceutical compositions and kits for expressing a disorder-related polypeptide in an individual in need thereof.
Need to check novelty before this filing date? Find Prior Art

Description

Attorney Reference: 15979-20193.40AAV GENOMES ENCODING ENGINEERED HUMAN FRATAXIN TRANSGENECROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of, and priority to, U.S. Provisional Application 63 / 738,721, filed on December 24, 2024, the contents of each of which are hereby incorporated herein by reference in their entirety.REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

[0002] The content of the electronic sequence listing (159792019340seqlist.xml; Size: 27,229 bytes; and Date of Creation: December 11, 2025) is herein incorporated by reference in its entirety.FIELD OF THE INVENTION

[0003] The present disclosure relates to methods for treating neurodegenerative disorders, including Friedreich’s ataxia (FRDA), in a patient in need thereof, the methods comprising administering to the cerebrospinal fluid (CSF) of a patient a recombinant adeno-associated virus (rAAV) viral particle.BACKGROUND

[0004] Friedreich’s ataxia (FRDA) is an autosomal-recessive neurodegenerative and cardiac disorder which occurs when transcription of the FXN gene is silenced due to an excessive expansion of GAA repeats into its first intron. The features of FRDA are progressive limb and gait ataxia, dysarthria, dysphagia, loss of deep tendon reflexes, oculomotor dysfunction, and cardiomyopathy. The first FDA approved treatment for FRDA, omaveloxolone, targets activation of Nrf2, which is decreased in cells of individuals with FRDA, but does not treat the underlying cause of disease. Further, the use of vectors for gene delivery and thus treatment of human diseases presents a potential therapeutic approach for FRDA. However, current gene delivery methods have associated drawbacks, including toxicity and biodistribution limitations, resulting in safety and dosing issues. Thus, there is a need for therapeutics to treat the cause of FRDA and counter the drawbacks associated with gene delivery.1MF-365376951Attorney Reference: 15979-20193.40SUMMARY OF THE INVENTION

[0005] The disclosure described herein provides a method for treatment of ataxia and cardiomyopathy related to Friedreich’s ataxia (FRDA), which is caused by loss of expression of the gene frataxin. Progressive ataxia results from primary neurodegeneration in cerebellar dentate nucleus and cerebellar cortex, as well as secondary degeneration in spinal cord.Hypertrophic cardiomyopathy results in left ventricular dysfunction and arrythmia. There is one approved therapy that does not treat the underlying cause of disease.

[0006] The disclosure provides methods for treating or improving symptoms associated with Friedrich’s ataxia (FRDA) in patients in need thereof, said methods comprising administering to the patient an expression cassette encoding: a) a signal peptide, and b) a Frataxin (FXN) protein. Further, methods provided herein comprise administering to the patient a recombinant adeno-associated virus (rAAV) viral particle comprising (1) an expression cassette encoding: a) a signal peptide, and b) a Frataxin (FXN) protein, and (2) a capsid protein as set forth herein. In some embodiments, the methods provided herein provide an AAV vector encoding a human frataxin protein engineered for cross-correction by appending a signal peptide and cell penetrating peptide driven from a promoter. In some embodiments, the methods provided herein provide an AAV vector encoding a human frataxin protein engineered for cross-correction by appending a signal peptide and cell penetrating peptide driven from a tissue-selective promoter.

[0007] In some aspects, the treatment described herein is intended as a one-time therapy to treat the underlying cause of disease. In some embodiments, the treatment should be administered via intra-CSF administration.

[0008] In some aspects, the method of treatment and compositions provided herein increase the efficiency of AAV-mediated frataxin repletion by enabling cross-correction of the therapeutic transgene product. Current AAV-mediated therapeutics in pre-clinical development or clinical trials are limited by AAV biodistribution and only restore FXN protein and function to individual cells that have taken up and are expressing from the AAV vector genome. By engineering the human frataxin transgene, as described herein, secretion of frataxin from primary cells that are actively expressing the AAV vector genome as well as uptake of frataxin by secondary cells that may or may not be expressing the AAV vector genome is enabled.

[0009] Described herein are various methods and compositions based in part on the development of rAAV viral particles comprising (a) an rAAV vector comprising (1) an expression cassette2MF-365376951Attorney Reference: 15979-20193.40that encodes a) a signal peptide, and b) a Frataxin (FXN) protein, and (2) a capsid protein. In some embodiments, the expression cassette encodes a) a signal peptide and b) a Frataxin (FXN) protein. In some embodiments, the expression cassette encodes a) a Frataxin (FXN) protein, and b) a cell-penetrating peptide. In some embodiments, the expression cassette encodes (a) a Frataxin (FXN) protein, (b) a signal peptide and (c) a cell-penetrating peptide.

[0010] Accordingly, the disclosure provides methods for treating or improving symptoms associated with FRDA in patients in need thereof. In some aspects, a polynucleotide construct comprising an expression cassette encoding: a) a signal peptide, and b) a Frataxin (FXN) protein is provided. In some embodiments, the expression cassette encodes in order from N-terminus to C-terminus the signal peptide and the FXN protein. In some embodiments, the expression cassette comprises a gene encoding from 5’ to 3’ the signal peptide and the FXN protein, wherein the gene is operably linked to a promoter.

[0011] In some embodiments, the promoter is a tissue-specific promoter. In some embodiments, the tissue-specific promoter is a muscle-specific promoter. In some embodiments, the musclespecific promoter is a human desmin promoter. In some embodiments, the human desmin promoter comprises a nucleotide sequence of SEQ ID NO: 11. In some embodiments, the human desmin promoter comprises a nucleotide sequence with at least 90% homology to the nucleotide sequence of SEQ ID NO: 11.

[0012] In some embodiments, the expression cassette comprises a gene encoding the signal peptide, wherein the signal peptide is encoded by a nucleotide sequence selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 5, and SEQ ID NO: 7. In various embodiments, the signal peptide is encoded by a nucleotide sequence of SEQ ID NO: 3. In various embodiments, the signal peptide is encoded by a nucleotide sequence with at least 90% homology to the nucleotide sequence of SEQ ID NO: 3. In various embodiments, the signal peptide is encoded by a nucleotide sequence of SEQ ID NO: 5. In various embodiments, the signal peptide is encoded by a nucleotide sequence with at least 90% homology to the nucleotide sequence of SEQ ID NO: 5. In various embodiments, the signal peptide is encoded by a nucleotide sequence of SEQ ID NO: 7. In various embodiments, the signal peptide is encoded by a nucleotide sequence with at least 90% homology to the nucleotide sequence of SEQ ID NO: 7.

[0013] In some embodiments, the signal peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 4, SEQ ID NO: 6, and SEQ ID NO: 8. In various3MF-365376951Attorney Reference: 15979-20193.40embodiments, the signal peptide comprises an amino acid sequence of SEQ ID NO: 4. In various embodiments, the signal peptide comprises an amino acid sequence with at least 90% homology to the amino acid sequence of SEQ ID NO: 4. In various embodiments, the signal peptide comprises an amino acid sequence of SEQ ID NO: 6. In various embodiments, the signal peptide comprises an amino acid sequence with at least 90% homology to the amino sequence of SEQ ID NO: 6. In various embodiments, the signal peptide comprises an amino acid sequence of SEQ ID NO: 8. In various embodiments, the signal peptide comprises an amino acid sequence with at least 90% homology to the amino sequence of SEQ ID NO: 8. In some embodiments, the expression cassette comprises a gene encoding the FXN protein, wherein the FXN protein comprises a nucleotide sequence of SEQ ID NO: 2. In some embodiments, the expression cassette comprises a gene encoding the FXN protein, wherein the FXN protein comprises a nucleotide sequence with at least 90% homology to the nucleotide sequence of SEQ ID NO: 2. In some embodiments, the FXN protein comprises an amino acid sequence of SEQ ID NO: 1. In some embodiments, the expression cassette comprises a gene encoding the FXN protein, wherein the FXN protein comprises a nucleotide sequence with at least 90% homology to the nucleotide sequence of SEQ ID NO: 1.

[0014] In some embodiments, the expression cassette encodes in order from N-terminus to C-terminus the signal peptide comprising an amino acid sequence of SEQ ID NO: 4, and the FXN protein comprising an amino acid sequence of SEQ ID NO: 1. In some embodiments, the expression cassette encodes in order from N-terminus to C-terminus the signal peptide comprising an amino acid sequence with at least 90% homology to the amino acid sequence of SEQ ID NO: 4, and the FXN protein comprising an amino acid sequence with at least 90% homology to the amino acid sequence of SEQ ID NO: 1. In some embodiments, the expression cassette encodes in order from N-terminus to C-terminus the signal peptide comprising an amino acid sequence with at least 80% homology to the amino acid sequence of SEQ ID NO: 4, and the FXN protein comprising an amino acid sequence with at least 80% homology to the amino acid sequence of SEQ ID NO: 1. In some embodiments, the expression cassette encodes in order from N-terminus to C-terminus the signal peptide comprising an amino acid sequence of SEQ ID NO: 6, and the FXN protein comprising an amino acid sequence of SEQ ID NO: 1. In some embodiments, the expression cassette encodes in order from N-terminus to C-terminus the signal peptide comprising an amino acid sequence with at least 90% homology to the amino acid4MF-365376951Attorney Reference: 15979-20193.40sequence of SEQ ID NO: 6, and the FXN protein comprising an amino acid sequence with at least 90% homology to the amino acid sequence of SEQ ID NO: 1. In some embodiments, the expression cassette encodes in order from N-terminus to C-terminus the signal peptide comprising an amino acid sequence with at least 80% homology to the amino acid sequence of SEQ ID NO: 6, and the FXN protein comprising an amino acid sequence with at least 80% homology to the amino acid sequence of SEQ ID NO: 1. In some embodiments, the expression cassette encodes in order from N-terminus to C-terminus the signal peptide comprising an amino acid sequence of SEQ ID NO: 8, and the FXN protein comprising an amino acid sequence of SEQ ID NO: 1. In some embodiments, the expression cassette encodes in order from N-terminus to C-terminus the signal peptide comprising an amino acid sequence with at least 90% homology to the amino acid sequence of SEQ ID NO: 8, and the FXN protein comprising an amino acid sequence with at least 90% homology to the amino acid sequence of SEQ ID NO: 1. In some embodiments, the expression cassette encodes in order from N-terminus to C-terminus the signal peptide comprising an amino acid sequence with at least 80% homology to the amino acid sequence of SEQ ID NO: 8, and the FXN protein comprising an amino acid sequence with at least 80% homology to the amino acid sequence of SEQ ID NO: 1. In some embodiments, the gene encoding the FXN protein is a codon-optimized gene.

[0015] In some aspects, a polynucleotide construct comprising an expression cassette encoding: a) a signal peptide, b) a Frataxin (FXN) protein, and c) a cell-penetrating peptide (CPP) is provided. In some embodiments, the expression cassette encodes in order from N-terminus to C-terminus the signal peptide, the FXN protein, and the CPP. In some embodiments, the expression cassette encodes in order from N-terminus to C-terminus the signal peptide, the CPP, and the FXN protein. In some embodiments, the expression cassette comprises a gene encoding from 5’ to 3’ the signal peptide and the FXN protein, wherein the gene is operably linked to a promoter. In some embodiments, the promoter is a tissue-specific promoter. In some embodiments, the tissue-specific promoter is a muscle-specific promoter. In some embodiments, the musclespecific promoter is a human desmin promoter. In some embodiments, the human desmin promoter comprises a nucleotide sequence of SEQ ID NO: 11. In some embodiments, the human desmin promoter comprises a nucleotide sequence with at least 90% homology to the nucleotide sequence of SEQ ID NO: 11. In some embodiments, the expression cassette comprises a gene encoding the signal peptide, wherein the signal peptide is encoded by a nucleotide sequence5MF-365376951Attorney Reference: 15979-20193.40selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 5, and SEQ ID NO: 7. In various embodiments, the signal peptide is encoded by a nucleotide sequence of SEQ ID NO: 3. In various embodiments, the signal peptide is encoded by a nucleotide sequence with at least 90% homology to the nucleotide sequence of SEQ ID NO: 3. In various embodiments, the signal peptide is encoded by a nucleotide sequence of SEQ ID NO: 5. In various embodiments, the signal peptide is encoded by a nucleotide sequence with at least 90% homology to the nucleotide sequence of SEQ ID NO: 5. In various embodiments, the signal peptide is encoded by a nucleotide sequence of SEQ ID NO: 7. In various embodiments, the signal peptide is encoded by a nucleotide sequence with at least 90% homology to the nucleotide sequence of SEQ ID NO: 7. In some embodiments, the signal peptide comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 4, SEQ ID NO: 6, and SEQ ID NO: 8. In various embodiments, the signal peptide comprises an amino acid sequence of SEQ ID NO: 4. In various embodiments, the signal peptide comprises an amino acid sequence with at least 90% homology to the amino acid sequence of SEQ ID NO: 4. In various embodiments, the signal peptide comprises an amino acid sequence of SEQ ID NO: 6. In various embodiments, the signal peptide comprises an amino acid sequence with at least 90% homology to the amino sequence of SEQ ID NO: 6. In some embodiments, the expression cassette comprises a gene encoding the CPP, wherein the CPP is encoded by a nucleotide sequence of SEQ ID NO: 10. In some embodiments, the expression cassette comprises a gene encoding the CPP, wherein the CPP comprises a nucleotide sequence with at least 90% homology to the nucleotide sequence of SEQ ID NO: 10. In some embodiments, the CPP comprises an amino sequence of SEQ ID NO: 9. In some embodiments, the CPP comprises an amino sequence with at least 90% homology to the amino acid sequence of SEQ ID NO: 9. In some embodiments, the expression cassette comprises a gene encoding the FXN protein, wherein the FXN protein is encoded by a nucleotide sequence of SEQ ID NO: 2. In some embodiments, the expression cassette comprises a gene encoding the FXN protein, wherein the FXN protein is encoded by a nucleotide sequence with at least 90% homology to the nucleotide sequence of SEQ ID NO: 2. In some embodiments, the FXN protein comprises an amino acid sequence of SEQ ID NO: 1. In some embodiments, the expression cassette comprises a gene encoding the FXN protein, wherein the FXN protein is encoded by a nucleotide sequence with at least 90% homology to the nucleotide sequence of SEQ ID NO: 1.6MF-365376951Attorney Reference: 15979-20193.40

[0016] In some embodiments, the expression cassette encodes in order from N-terminus to C-terminus the signal peptide comprising an amino acid sequence of SEQ ID NO: 4, the FXN protein comprising an amino acid sequence of SEQ ID NO: 1, and the CPP comprising an amino acid sequence of SEQ ID NO: 9. In some embodiments, the expression cassette encodes in order from N-terminus to C-terminus the signal peptide comprising an amino acid sequence with at least 90% homology to the amino acid sequence of SEQ ID NO: 4, the FXN protein comprising an amino acid sequence with at least 90% homology to the amino acid sequence of SEQ ID NO: 1 , and the CPP comprising an amino acid sequence with at least 90% homology to the amino acid sequence of SEQ ID NO: 9. In some embodiments, the expression cassette encodes in order from N-terminus to C-terminus the signal peptide comprising an amino acid sequence with at least 80% homology to the amino acid sequence of SEQ ID NO: 4, the FXN protein comprising an amino acid sequence with at least 80% homology to the amino acid sequence of SEQ ID NO: 1, and the CPP comprising an amino acid sequence with at least 90% homology to the amino acid sequence of SEQ ID NO: 9. In some embodiments, the expression cassette encodes in order from N-terminus to C-terminus the signal peptide comprising an amino acid sequence of SEQ ID NO: 6, the FXN protein comprising an amino acid sequence of SEQ ID NO: 1, and the CPP comprising an amino acid sequence of SEQ ID NO: 9. In some embodiments, the expression cassette encodes in order from N-terminus to C-terminus the signal peptide comprising an amino acid sequence with at least 90% homology to the amino acid sequence of SEQ ID NO: 6, the FXN protein comprising an amino acid sequence with at least 90% homology to the amino acid sequence of SEQ ID NO: 1, and the CPP comprising an amino acid sequence with at least 90% homology to the amino acid sequence of SEQ ID NO: 9. In some embodiments, the expression cassette encodes in order from N-terminus to C-terminus the signal peptide comprising an amino acid sequence with at least 80% homology to the amino acid sequence of SEQ ID NO: 6, the FXN protein comprising an amino acid sequence with at least 80% homology to the amino acid sequence of SEQ ID NO: 1, and the CPP comprising an amino acid sequence with at least 90% homology to the amino acid sequence of SEQ ID NO: 9. In some embodiments, the expression cassette encodes in order from N-terminus to C-terminus the signal peptide comprising an amino acid sequence of SEQ ID NO: 8, the FXN protein comprising an amino acid sequence of SEQ ID NO: 1, and the CPP comprising an amino acid sequence of SEQ ID NO: 9. In some embodiments, the expression cassette encodes in order from N-terminus to C-terminus the signal7MF-365376951Attorney Reference: 15979-20193.40peptide comprising an amino acid sequence with at least 90% homology to the amino acid sequence of SEQ ID NO: 8, the FXN protein comprising an amino acid sequence with at least 90% homology to the amino acid sequence of SEQ ID NO: 1, and the CPP comprising an amino acid sequence with at least 90% homology to the amino acid sequence of SEQ ID NO: 9. In some embodiments, the expression cassette encodes in order from N-terminus to C-terminus the signal peptide comprising an amino acid sequence with at least 80% homology to the amino acid sequence of SEQ ID NO: 8, the FXN protein comprising an amino acid sequence with at least 80% homology to the amino acid sequence of SEQ ID NO: 1, and the CPP comprising an amino acid sequence with at least 90% homology to the amino acid sequence of SEQ ID NO: 9. In some embodiments, the gene encoding the FXN protein is a codon-optimized gene.

[0017] In some aspects, a polynucleotide construct comprising an expression cassette encoding: a) a Frataxin (FXN) protein and b) a cell-penetrating peptide (CPP) is provided. In some embodiments, the expression cassette encodes in order from N-terminus to C-terminus the signal peptide, the FXN protein, and the CPP. In some embodiments, the expression cassette encodes in order from N-terminus to C-terminus the signal peptide, the CPP, and the FXN protein. In some embodiments, the expression cassette comprises a gene encoding from 5’ to 3’ the signal peptide and the FXN protein, wherein the gene is operably linked to a promoter. In some embodiments, the promoter is a tissue-specific promoter. In some embodiments, the tissue-specific promoter is a muscle-specific promoter. In some embodiments, the muscle-specific promoter is a human desmin promoter. In some embodiments, the human desmin promoter comprises a nucleotide sequence of SEQ ID NO: 11. In some embodiments, the human desmin promoter comprises a nucleotide sequence with at least 90% homology to the nucleotide sequence of SEQ ID NO: 11. In some embodiments, the expression cassette comprises a gene encoding the CPP, wherein the CPP comprising a nucleotide sequence of SEQ ID NO: 10. In some embodiments, the expression cassette comprises a gene encoding the CPP, wherein the CPP comprises a nucleotide sequence with at least 90% homology to the nucleotide sequence of SEQ ID NO: 10. In some embodiments, the CPP comprises an amino sequence of SEQ ID NO: 9. In some embodiments, the CPP comprises an amino sequence with at least 90% homology to the amino acid sequence of SEQ ID NO: 9. In some embodiments, the expression cassette comprises a gene encoding the FXN protein, wherein the FXN protein comprises a nucleotide sequence of SEQ ID NO: 2. In some embodiments, the expression cassette comprises a gene encoding the FXN protein, wherein8MF-365376951Attorney Reference: 15979-20193.40the FXN protein is encoded by a nucleotide sequence with at least 90% homology to the nucleotide sequence of SEQ ID NO: 2. In some embodiments, the FXN protein comprises an amino acid sequence of SEQ ID NO: 1. In some embodiments, the expression cassette comprises a gene encoding the FXN protein, wherein the FXN protein comprises a nucleotide sequence with at least 90% homology to the nucleotide sequence of SEQ ID NO: 1.

[0018] In some aspects, a polynucleotide construct comprising an expression cassette encoding: a Frataxin (FXN) protein is provided. In some embodiments, the expression cassette comprises a gene encoding the FXN protein, wherein the gene is operably linked to a promoter. In some embodiments, the promoter is a tissue-specific promoter. In some embodiments, the tissuespecific promoter is a muscle-specific promoter. In some embodiments, the muscle-specific promoter is a human desmin promoter. In some embodiments, the human desmin promoter comprises a nucleotide sequence of SEQ ID NO: 11. In some embodiments, the human desmin promoter comprises a nucleotide sequence with at least 90% homology to the nucleotide sequence of SEQ ID NO: 11. In some embodiments, the expression cassette comprises a gene encoding the FXN protein, wherein the FXN protein is encoded by a nucleotide sequence of SEQ ID NO: 2. In some embodiments, the expression cassette comprises a gene encoding the FXN protein, wherein the FXN protein is encoded by a nucleotide sequence with at least 90% homology to the nucleotide sequence of SEQ ID NO: 2. In some embodiments, the FXN protein comprises an amino acid sequence of SEQ ID NO: 1. In some embodiments, the expression cassette comprises a gene encoding the FXN protein, wherein the FXN protein is encoded by a nucleotide sequence with at least 90% homology to the nucleotide sequence of SEQ ID NO: 1.

[0019] In some aspects, the expression cassette is delivered using AAV. In some embodiments, the AAV is an AAV9. In some embodiments, the AAV9 comprises a modified AAV9 capsid protein. The modified AAV9 capsid proteins of the AAV viral particles comprise targeting peptides inserted into the AAV9 capsid that alter the transduction and / or endosomal release of the viral particle following administration to the patient. The rAAV particles comprising modified AAV9 capsid proteins, as disclosed herein, comprise three structural capsid proteins, VP1, VP2, and VP3. The three capsid proteins are alternative splice variants. In some embodiments, the targeting peptide is inserted into the VP1, VP2, and VP3 capsid proteins within the rAAV particle.9MF-365376951Attorney Reference: 15979-20193.40

[0020] In particular embodiments, the targeting peptide of the modified AAV9 capsids are inserted after residue 588 of the AAV9 structural protein (numbering based on VP1 numbering of AAV9). In some embodiments, the targeting peptide has SEQ ID NO: 17. In some embodiments, the targeting peptide is flanked by linker sequences on the N-terminal and the C-terminal end of the targeting peptide. In some embodiments, the linker sequence on the N-terminal side has the sequence AAA. In some embodiments, the linker sequence on the C-terminal side is AS. In some embodiments, the full sequence inserted after residue 588 of the AAV9 capsid structural protein has SEQ ID NO: 18. In some embodiments, the full modified AAV9 capsid structural protein has SEQ ID NO: 12. In some embodiments, the full modified AAV9 capsid structural protein that it at least 90% (e.g., at least 92%, at least 95%, at least 98%, at least 98.5%, at least 99%, at least 99.2%, at least 99.5%, or at least 99.8%) identical to SEQ ID NO: 12, wherein the modified AAV9 structural capsid comprises the targeting peptide of SEQ ID NO: 17. The capsid having SEQ ID NO: 12 will also be referred to herein as SAN or AAV.SAN.

[0021] In some aspects, the rAAV viral particle is used to treat FRDA. In some embodiments, the rAAV viral particle can be administered to the cerebrospinal fluid (CSF) of the CNS disorder patient. In some embodiments, the viral particle is administered directly by intra-CSF administration of the patient with the CNS disorder. In some embodiments of the above aspects, the rAAV is administered via direct injection into the spinal cord, via intrathecal injection, or via intracisternal injection of the patient with the neurodegenerative disorder. In some embodiments, the rAAV is administered to more than one location of the spinal cord or cisterna magna of the patient with the neurodegenerative disorder. In some embodiments, the rAAV is administered to more than one location of the spinal cord of the patient with the neurodegenerative disorder. In some embodiments, the rAAV is administered to one or more of a lumbar subarachnoid space, thoracic subarachnoid space, and a cervical subarachnoid space of the spinal cord of the patient with the neurodegenerative disorder. In some embodiments, the rAAV is administered to the cisterna magna of the patient with the neurodegenerative disorder. In some embodiments, the method may comprise treating the neurodegenerative disorder in a patient in need thereof. In particular embodiments, the expression cassette of the viral particle is able to drive transgene expression in the central nervous system and cardiac system to treat the disorder. In some embodiments, administration of the rAAV particles ameliorates symptoms associated with10MF-365376951Attorney Reference: 15979-20193.40FRDA. For instance, administration of the viral particle may reduce or impede the progression of brainstem and cortical dysfunction, seizures and cognitive defects.

[0022] In some embodiments, transgene expression is further enhanced by the addition of the woodchuck hepatitis virus post-transcriptional regulatory element (WPRE). In some embodiments, the vector comprises a Chicken 0-actin (CBA) promoter. In some embodiments, the vector comprises a WPRE element and a CBA promoter.

[0023] In some embodiments of the above aspects, the rAAV particle comprises a vector comprising an expression cassette flanked by one or more AAV inverted terminal repeat (ITR) sequences. In some embodiments, the expression cassette is flanked by two AAV ITRs. In some embodiments, the AAV ITRs are AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAV.rhlO, AAV11, AAV12, AAV2R471A, AAV DJ, a goat AAV, bovine AAV, or mouse AAV serotype ITRs. In some embodiments, the AAV ITRs are AAV2 ITRs. In some embodiments, the vector is a self-complimenting vector. In some embodiments, the vector comprises first nucleic acid sequence encoding the disorder-related polypeptide and a second nucleic acid sequence encoding a complement of the disorder-related polypeptide, wherein the first nucleic acid sequence can form intrastrand base pairs with the second nucleic acid sequence along most or all of its length. In some embodiments, the first nucleic acid sequence and the second nucleic acid sequence are linked by a mutated AAV ITR, wherein the mutated AAV ITR comprises a deletion of the D region and comprises a mutation of the terminal resolution sequence.

[0024] In some aspects, the disclosure provides a composition comprising any of the rAAV particles described herein. In some embodiments, the composition further comprises a pharmaceutically acceptable carrier.

[0025] In some aspects, the disclosure provides a cell comprising any of the rAAV particles described herein. In some aspects, the disclosure provides a method of producing FXN, the method comprising culturing a cell as described herein under conditions to produce the FXN polypeptide. In some embodiments, the methods further comprise the step of purifying the FXN polypeptide.

[0026] In some aspects, the disclosure provides methods for treating FRDA in an individual in need thereof, comprising administering to the individual a rAAV particle as described herein. In some aspects, the disclosure provides methods for treating FRDA in an individual in need11MF-365376951Attorney Reference: 15979-20193.40thereof, comprising administering to the individual a composition as described herein. In some embodiments, the disclosure provides methods for treating the neurodegenerative disorder in an individual in need thereof, comprising administering to the individual the cell as described herein. In some embodiments, the individual lacks transcription of FXN gene.

[0027] In some embodiments of the above aspects, the rAAV particle is administered only one time to a patient in need thereof. In some embodiments, the rAAV particle is administered multiple times to a patient in need thereof (e.g., over one or more months or years). In other embodiments, the rAAV particle is administered once every year to a patient in need thereof. In other embodiments, the rAAV particle is administered twice yearly to a patient in need thereof.

[0028] In some embodiments, the disclosure provides kits comprising any of the rAAV particles, the compositions, or the cell as described herein. In some embodiments, the kit further comprises instructions for use; buffers and / or pharmaceutically acceptable excipients; and / or bottles, vials and / or syringes.BRIEF DESCRIPTION OF THE DRAWINGS

[0029] FIG. 1A shows the quantification of vector genome biodistribution of AAV. SAN expressing GFP in the liver, the heart, and several neural tissues from non-human primates (NHP). FIG. IB shows immunohistochemistry of GFP expression in NHP cardiomyocytes transduced with AAV. SAN expressing GFP. The virus was delivered intravenously.

[0030] FIGS.2A-2B show the quantification of vector genome biodistribution of AAV. SAN expressing GFP in the liver, the heart, and several neural tissues from non-human primates (NHP) following intra-cisterna magna (ICM; left, FIG.2A) and intracerebroventricular (ICV; right, FIG.2B) administration of the virus. FIG.2C shows immunohistochemistry of GFP expression in NHP cardiomyocytes after ICM administration of AAV. SAN expressing GFP.

[0031] FIG. 3A shows the quantification of vector genome biodistribution of AAV. SAN expressing GFP in the cerebellum, dorsal root ganglia, spinal cord, and the heart from mouse having received through different routes of administration (ROA). Tested routes of administration (ROA) include intracerebroventricular (ICV), intra-cisterna magna (ICM), intrathecal (IT), and a combined ICM+IT route. FIGS.3B-3C show in situ hybridization (ISH) for GFP mRNA in cerebellum (FIG.3B) and cardiomyocytes in the heart (FIG.3C) after ICM+IT administration of AAV. SAN expressing GFP.12MF-365376951Attorney Reference: 15979-20193.40

[0032] FIGS.4A-4B show the hFXN mRNA levels in several tissues after treating musclespecific FXN-null mouse model (cardiac / skeletal muscle- specific Fxn mouse knockout;MCKFXN) with AAV. SAN encoding a codon-optimized human frataxin (hFXN) transgene driven from the newDesmin promoter (AAV.SAN-newDesmin-hFXN). The RNA expression of hFXN was normalized to the vector genome load (FIG.4 A) or to an internal control (FIG.4B). Viruses were delivered by intrathecal administration.

[0033] FIGS.5A-5B show the quantification of hFXN mRNA (FIG.5A) and protein (FIG.5B) levels in heart tissues after MCKFXNmice lacking FXN expression in muscle tissue were treated with AAV.SAN-newDesmin-hFXN. FIG.5A shows quantification of hFXN mRNA expression normalized to vector genome biodistribution driven by newDesmin promoter in the atria and ventricles of mouse heart. Each dot represents one animal; n=6 mice per group. FIG. 5B shows quantification of hFXN protein levels driven by newDesmin promoter in the heart of mice at two- and six-weeks post- injection (wpi). Each dot represents one animal.

[0034] FIGS.6A-6B show the hFXN mRNA (FIG.6A) and protein (FIG. 6B) levels in dorsal root ganglion (DRG) after mice lacking FXN expression were treated with AAV.SAN-newDesmin-hFXN. FIG.6A shows the quantification of hFXN mRNA expression normalized to vector genome biodistribution driven by newDesmin promoter in cervical, thoracic, and lumbar DRG. FIG. 6B shows quantification of hFXN protein expression in DRG for mice at two- and six-weeks post-injection (wpi). Each dot represents one animal.

[0035] FIG. 7 A shows immunohistochemistry of hFXN expression in mouse cerebellum six weeks post-injection of AAV.SAN-newDesmin-hFXN. FIG.7B shows immunohistochemistry of hFXN expression in mouse DRG six weeks post-injection of AAV.SAN-newDesmin-hFXN. Insets show negative hFXN staining in cerebellum (FIG.7A) and DRG (FIG.7B) from buffer-treated animals.

[0036] FIGS.8A-8C show in situ hybridization (ISH, top of panels) and immunohistochemistry (IHC, bottom of panels) detection of FXN mRNA and protein, respectively, in consecutive sections of cerebellum from mice treated with AAV encoding SPl-TATk-FXN (FIG. 8A), SP3-TATk-FXN (FIG.8B), or SP5-TATk-FXN (FIG. 8C). Small arrows indicate transduced cells expressing both FXN RNA and FXN protein. Large arrowheads indicate cross-corrected cells expressing FXN protein in the absence of FXN RNA.13MF-365376951Attorney Reference: 15979-20193.40

[0037] FIGS.9A-9D show immunohistochemistry (IHC) detection of FXN protein in sections of mouse spinal cord from mice treated with AAV encoding WT-hFXN (FIG. 9A), SPl-TATk-FXN (FIG. 9B), SP3-TATk-FXN (FIG.9C), or SP5-TATk-FXN (FIG.9D). Smaller images in FIG. 9D show a magnified view of the boxed area for IHC (top) and in situ hybridization (ISH) for FXN RNA (bottom).

[0038] FIGS. 10A-10B show immunohistochemistry (IHC) detection of FXN protein in sections of heart tissue from mice treated with AAV encoding WT-hFXN (FIG. 10A) or SPl-TATk-FXN (FIG. 10B) FIG. 10C shows quantification of FXN signal in mouse heart sections across treatment groups: WT-hFXN, SPl-TATk-FXN, SP3-TATk-FXN, and SP5-TATk-FXN. FXN signal was quantified using an unbiased, automated protocol as percentage of total slice area expressing FXN for two sections per animal. Percentage of slice area was scaled to total vector genome load in peripheral tissues and normalized to the average of the group treated with AAV encoding WT-hFXN. Each dot represents an individual animal; n = 5-6 mice per group.

[0039] FIG. 11 shows a capillary Western blot of FXN protein from mice treated with WT-hFXN, SPl-TATk-FXN, SP3-TATk-FXN, or SP5-TATk-FXN. Full-length, intermediate, and mature hFXN isoforms were quantified independently using ImageJ. Values shown beneath the plot reflect the percentage of the total hFXN signal contained within the mature hFXN band. Each column represents an individual sample.

[0040] FIGS. 12A - 12C show various assessments of ataxia phenotypes in a neuronal FXN-null mouse model (parvalbumin neuron-specific Fxn knockout; PVFXN) after treatment with AAV-FXN. PVFXNmice were treated with buffer or AAV-FXN treatments: WT-hFXN, SPl-TATk-FXN, SP3-TATk-FXN, or SP5-TATk-FXN. FIG. 12A shows a longitudinal assessment of coordination in FXN-null mice via a rotarod assay. Values show the length of time each mouse stayed on the rotating rod, normalized to the performance during training sessions. Each value is the median of three trials per session. The dashed grey line shows the performance during the training. Each dot reflects an individual animal and red stars indicate a significant reduction in performance from training, with p-value < 0.05 assessed by t-test with Bonferroni-Holm correction for multiple comparisons, n = 10 mice per group. FIG. 12B shows an assessment of ataxia phenotypes over the duration of the study via a NeuroScore assessment. See methods for scoring criteria. Each dot reflects the group’s mean, and the shaded area reflects the standard error, n = 10 mice per group. FIG. 12C shows quantification of hFXN protein14MF-365376951Attorney Reference: 15979-20193.40expression in mouse cerebellum and lumbar DRG by ELISA. Values are normalized to the total protein content per sample as assessed by a BCA assay. Each dot represents one animal; n = 10 mice per group.

[0041] FIGS. 13A-13B show survival analysis and protein analysis of muscle-specific FXN-null mouse model (cardiac / skeletal muscle- specific Fxn knockout; MCKFXN) treated with AAV-FXN. MCKFXNmice were treated with buffer or AAV-FXN treatments: WT-hFXN, SPl-TATk-FXN, SP3-TATk-FXN, and SP5-TATk-FXN. FIG. 13A shows the survival analysis of MCKFXNmice treated with AAV-FXN. P-values were determined by Cox proportional hazard regression analysis, n = 16 mice per group, with 8 mice per group collected at 70 days for tissue collection.FIG. 13B shows quantification of hFXN protein expression in mouse liver and heart by ELISA. Values were normalized to total protein content per sample as assessed by BCA assay. Each dot represents one animal; n = 8 mice per group.

[0042] FIG. 14A shows the quantification of vector genomes per cell in several different nonhuman primates (NHP) tissues, including brain, spinal cord, DRG, heart, muscle, and peripheral tissues. AAV. SAN viruses encoding cross-correcting SPl-TATk-hFXN or SP3-TATk-hFXN driven from a newDesmin promoter were administered to a cynomolgus monkey (1.5el3 total vg) via intra-cisterna magna (ICM) injection. Each point represents an individual tissue punch; n=l NHP per group. Purple dots reflect tissues of particular interest for Friedreich’s ataxia. FIG.14B shows the correlation between vector genome biodistribution and FXN RNA expression. Each dot represents an individual tissue punch. Purple dots show heart tissue with strongly increased expression per vector genome due to the newDesmin promoter.

[0043] FIG. 15 shows the quantification of hFXN RNA expression relative to endogenous cynomolgus monkey FXN (cynoFXN) RNA after ICM administration of AAV encoding SPl-TATk-hFXN (left) or SP3-TATk-hFXN (right). Each point represents an individual tissue punch; n=l NHP per group. Purple dots reflect tissues of particular interest for Friedreich’s ataxia. The dashed grey line shows the endogenous expression level of cynoFXN per tissue.

[0044] FIGS. 16A-16C show immunohistochemistry of FXN protein expression in NHP heart from NHPs treated with buffer (FIG. 16A), SPl-TATk-hFXN (FIG. 16B), or SP3-TATk-hFXN (FIG. 16C). The inset image in FIG. 16A shows the lack of background signal in the tissue sections lacking primary FXN detection antibody. The virus was delivered via ICM injection.15MF-365376951Attorney Reference: 15979-20193.40

[0045] FIGS. 17A-17B depict clinically relevant FXN repletion in the heart of NHP treated with AAV-FXN. NHP were treated with buffer or AAV-FXN treatments: SPl-TATk-FXN or SP3-TATk-FXN. FIG. 17A shows the distributions of FXN signal intensity across the quantified NHP hearts. FXN protein signal was quantified in 2-3 representative sections from six heart regions: left / right ventricle, left / right atrium, apex, and the interventricular septum. Each image was divided into discrete segments encompassing ~5-7 cardiomyocytes (see methods). Each dot reflects an individual segment. FIG. 17B shows the aligned FXN intensity distributions via modified QQ-analysis. Each distribution was divided into 100 quantiles and the quantile intensity was scaled to the quantile intensity for the buffer-treated animal. Vertical lines represent FXN signal intensity of 30% and 60% above the signal intensity of buffer-treated animals.

[0046] FIG. 18 shows a capillary Western blot of hFXN protein from NHP treated with buffer, SPl-TATk-FXN, or SP3-TATk-FXN. NHP samples were loaded at equivalent total protein levels and increased band intensity reflects higher mature FXN protein expression. Each column represents an individual sample. A human heart sample was included as a size reference.DETAILED DESCRIPTIONIntroduction

[0047] The disclosure provides methods for treating neurodegenerative disorders, including Friedreich’s ataxia (FRDA), and pharmaceutical compositions comprising viral particles (e.g., rAAV) encapsulating a vector comprising a transgene capable of encoding a disorder-related polypeptide, including the frataxin (FXN gene. In some aspects, the disclosure provides expression cassettes, recombinant adeno-associated virus (rAAV) vectors, and viral particles and pharmaceutical compositions comprising a FXN gene encoding frataxin protein. The rAAV particles of the disclosure can be administered to patients diagnosed with Friedreich’s ataxia (FRDA).Definitions

[0048] A “vector,” as used herein, refers to a recombinant plasmid or virus that comprises a nucleic acid to be delivered into a host cell, either in vitro or in vivo.

[0049] The terms “polypeptide” and “protein” are used interchangeably to refer to a polymer of amino acid residues, and are not limited to a minimum length. Such polymers of amino acid16MF-365376951Attorney Reference: 15979-20193.40residues may contain natural or non-natural amino acid residues, and include, but are not limited to, peptides, oligopeptides, dimers, trimers, and multimers of amino acid residues. Both full-length proteins and fragments thereof are encompassed by the definition. The terms also include post-expression modifications of the polypeptide, for example, glycosylation, sialylation, acetylation, phosphorylation, and the like. Furthermore, for purposes of the present disclosure, a “polypeptide” refers to a protein which includes modifications, such as deletions, additions, and substitutions (generally conservative in nature), to the native sequence, as long as the protein maintains the desired activity. These modifications may be deliberate, as through site-directed mutagenesis, or may be accidental, such as through mutations of hosts which produce the proteins or errors due to PCR amplification.

[0050] A “recombinant viral vector” refers to a recombinant polynucleotide vector comprising one or more heterologous sequences (z.e., nucleic acid sequence not of viral origin). In the case of recombinant AAV vectors, the recombinant nucleic acid is flanked by at least one and in some embodiments two, inverted terminal repeat sequences (ITRs).

[0051] A “recombinant AAV vector (rAAV vector)” refers to a polynucleotide vector comprising one or more heterologous sequences (z.e., nucleic acid sequence not of AAV origin) that are flanked by at least one, and in some embodiments two, AAV inverted terminal repeat sequences (ITRs). Such rAAV vectors can be replicated and packaged into infectious viral particles when present in a host cell that has been infected with a suitable helper virus (or that is expressing suitable helper functions) and that is expressing AAV rep and cap gene products (z.e. AAV Rep and Cap proteins). When a rAAV vector is incorporated into a larger polynucleotide (e.g., in a chromosome or in another vector such as a plasmid used for cloning or transfection), then the rAAV vector may be referred to as a “pro-vector” which can be “rescued” by replication and encapsidation in the presence of AAV packaging functions and suitable helper functions. A rAAV vector can be in any of a number of forms, including, but not limited to, plasmids, linear artificial chromosomes, complexed with lipids, encapsulated within liposomes, and encapsidated in a viral particle, particularly an AAV particle. A rAAV vector can be packaged into an AAV virus capsid to generate a “recombinant adeno-associated viral particle (rAAV particle)”.

[0052] “Heterologous” means derived from a genotypically distinct entity from that of the rest of the entity to which it is compared or into which it is introduced or incorporated. For example, a polynucleotide introduced by genetic engineering techniques into a different cell type is a17MF-365376951Attorney Reference: 15979-20193.40heterologous polynucleotide (and, when expressed, can encode a heterologous polypeptide). Similarly, a cellular sequence (e.g., a gene or portion thereof) that is incorporated into a viral vector is a heterologous nucleotide sequence with respect to the vector.

[0053] The term “transgene” refers to a polynucleotide that is introduced into a cell and is capable of being transcribed into RNA and optionally, translated and / or expressed under appropriate conditions. In aspects, it confers a desired property to a cell into which it was introduced, or otherwise leads to a desired therapeutic or diagnostic outcome.

[0054] “Chicken P-actin (CBA) promoter” refers to a polynucleotide sequence derived from a chicken P-actin gene (e.g., Gallus beta actin, represented by GenBank Entrez Gene ID 396526). As used herein, “chicken P-actin promoter” may refer to a promoter containing a cytomegalovirus (CMV) early enhancer element, the promoter and first exon and intron of the chicken P-actin gene, and the splice acceptor of the rabbit beta-globin gene, such as the sequences described in Miyazaki, J. et al. (1989) Gene 79(2):269-77. As used herein, the term “CAG promoter” may be used interchangeably. As used herein, the term “CMV early enhancer / chicken beta actin (CAG) promoter” may be used interchangeably.

[0055] The terms “genome particles (gp),” “genome equivalents,” or “genome copies” as used in reference to a viral titer, refer to the number of virions containing the recombinant AAV DNA genome, regardless of infectivity or functionality. The number of genome particles in a particular vector preparation can be measured by procedures such as described in the Examples herein, or for example, in Clark et al. Hum. Gene Ther., 10:1031-1039; Veldwijk et al. (2002) Mol. Ther., 6:272-278.

[0056] The term “vector genome (vg)” as used herein may refer to one or more polynucleotides comprising a set of the polynucleotide sequences of a vector, e.g., a viral vector. A vector genome may be encapsidated in a viral particle. Depending on the particular viral vector, a vector genome may comprise single-stranded DNA, double-stranded DNA, or single-stranded RNA, or double-stranded RNA. A vector genome may include endogenous sequences associated with a particular viral vector and / or any heterologous sequences inserted into a particular viral vector through recombinant techniques. For example, a recombinant AAV vector genome may include at least one ITR sequence flanking a promoter, a stuffer, a sequence of interest (e.g., FXN), and a polyadenylation sequence. A complete vector genome may include a complete set of the polynucleotide sequences of a vector. In some embodiments, the nucleic acid titer of a18MF-365376951Attorney Reference: 15979-20193.40viral vector may be measured in terms of vg / mL. Methods suitable for measuring this titer are known in the art (e.g., quantitative PCR).

[0057] The terms “infection unit (iu),” “infectious particle,” or “replication unit,” as used in reference to a viral titer, refer to the number of infectious and replication-competent recombinant AAV vector particles as measured by the infectious center assay, also known as replication center assay, as described, for example, in McLaughlin et al. (1988) J. Virol., 62:1963-1973.

[0058] The term “transducing unit (tu)” as used in reference to a viral titer, refers to the number of infectious recombinant AAV vector particles that result in the production of a functional transgene product as measured in functional assays such as described in Examples herein, or for example, in Xiao et al. (1997) Exp. Neurobiol., 144:113-124; or in Fisher et al. (1996) J. Virol., 70:520-532 (LFU assay).

[0059] An “inverted terminal repeat” or “ITR” sequence is a term well understood in the art and refers to relatively short sequences found at the termini of viral genomes which are in opposite orientation.

[0060] An “AAV inverted terminal repeat (ITR)” sequence, a term well-understood in the art, is an approximately 145 -nucleotide sequence that is present at both termini of the native singlestranded AAV genome. The outermost 125 nucleotides of the ITR can be present in either of two alternative orientations, leading to heterogeneity between different AAV genomes and between the two ends of a single AAV genome. The outermost 125 nucleotides also contains several shorter regions of self-complementarity (designated A, A', B, B', C, C and D regions), allowing intrastrand base-pairing to occur within this portion of the ITR.

[0061] A “terminal resolution sequence” or “trs” is a sequence in the D region of the AAV ITR that is cleaved by AAV rep proteins during viral DNA replication. A mutant terminal resolution sequence is refractory to cleavage by AAV rep proteins.

[0062] “AAV helper functions” refer to functions that allow AAV to be replicated and packaged by a host cell. AAV helper functions can be provided in any of a number of forms, including, but not limited to, helper virus or helper virus genes which aid in AAV replication and packaging. Other AAV helper functions are known in the art such as genotoxic agents.

[0063] A “helper virus” for AAV refers to a virus that allows AAV (which is a defective parvovirus) to be replicated and packaged by a host cell. A helper virus provides “helper functions” which allow for the replication of AAV. A number of such helper viruses have been19MF-365376951Attorney Reference: 15979-20193.40identified, including adenoviruses, herpesviruses and, poxviruses such as vaccinia and baculovirus. The adenoviruses encompass a number of different subgroups, although Adenovirus type 5 of subgroup C (Ad5) is most commonly used. Numerous adenoviruses of human, nonhuman mammalian and avian origin are known and are available from depositories such as the ATCC. Viruses of the herpes family, which are also available from depositories such as ATCC, include, for example, herpes simplex viruses (HSV), Epstein-Barr viruses (EBV), cytomegaloviruses (CMV) and pseudorabies viruses (PRV). Examples of adenovirus helper functions for the replication of AAV include El A functions, E1B functions, E2A functions, VA functions and E4orf6 functions. Baculoviruses available from depositories include Autographa calif ornica nuclear polyhedrosis virus.

[0064] A preparation of rAAV is said to be “substantially free” of helper virus if the ratio of infectious AAV particles to infectious helper virus particles is at least about 102:l; at least about 104:l, at least about 106:l; or at least about 108:l or more. In some embodiments, preparations are also free of equivalent amounts of helper virus proteins (i.e., proteins as would be present as a result of such a level of helper virus if the helper virus particle impurities noted above were present in disrupted form). Viral and / or cellular protein contamination can generally be observed as the presence of Coomassie staining bands on SDS gels (e.g., the appearance of bands other than those corresponding to the AAV capsid proteins VP1, VP2, and VP3).

[0065] An “effective amount” is an amount sufficient to effect beneficial or desired results, including clinical results (e.g., amelioration of symptoms, achievement of clinical endpoints, and the like). An effective amount can be administered in one or more administrations. In terms of a disease state, an effective amount is an amount sufficient to ameliorate, stabilize, or delay development of a disease.

[0066] An “individual” or “subject” is a mammal. Mammals include, but are not limited to, domesticated animals (e.g., cows, sheep, cats, dogs, and horses), primates (e.g., humans and nonhuman primates such as monkeys), rabbits, and rodents (e.g., mice and rats). In certain embodiments, the individual or subject is a human.

[0067] As used herein, “treatment” is an approach for obtaining beneficial or desired clinical results. For purposes of this disclosure, beneficial or desired clinical results include, but are not limited to, alleviation of symptoms, diminishment of extent of disease, stabilized (e.g., not worsening) state of disease, preventing spread (e.g., metastasis) of disease, delay or slowing of20MF-365376951Attorney Reference: 15979-20193.40disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable. “Treatment” can also mean prolonging survival as compared to expected survival if not receiving treatment.

[0068] As used herein, the term “prophylactic treatment” refers to treatment, wherein an individual is known or suspected to have or be at risk for having a disorder but has displayed no symptoms or minimal symptoms of the disorder. An individual undergoing prophylactic treatment may be treated prior to onset of symptoms.

[0069] Reference to “about” a value or parameter herein includes (and describes) embodiments that are directed to that value or parameter per se. For example, description referring to “about X” includes description of “X.”

[0070] As used herein, the singular form of the articles “a,” “an,” and “the” includes plural references unless indicated otherwise.

[0071] It is understood that aspects and embodiments of the disclosure described herein include “comprising,” “consisting,” and / or “consisting essentially of’ aspects and embodiments.Friedrich’s Ataxia

[0072] In certain aspects, the subject has Friedreich’s ataxia (FRDA), which is a rare, inherited, autosomal recessive neurodegenerative and cardiac disorder. Patients present features of FRDA, which are progressive limb and gait ataxia, dysarthria, dysphagia, loss of deep tendon reflexes, oculomotor dysfunction, and cardiomyopathy. In some cases, patients may present a wider range of symptoms including diabetes mellitus, aggressive sclerosis, visual loss and most commonly, defective hearing. Loss of postural balance and ataxia are caused by the degeneration of dorsal root ganglia (DRG), peripheral nerves, and the dentate nucleus in the cerebellum. Further, mitochondrial dysfunction resulting from frataxin deficiency is considered to be an underlying cause of the devastating genetic disease of FRDA, which is characterized by progressive neurodegeneration and hypertrophic cardiomyopathy. Ultimately, cardiac failure is the most common cause of mortality.

[0073] FRDA is caused by mutations in the gene encoding frataxin (FXN), a small mitochondrial protein. Specifically, transcription of the FXN gene is silenced or severely reduced due to the expansion of the GAA trinucleotide repeats in the first intron of the same gene. The FXN gene contains five exons, and in FRDA patients, expanded GAA repeats in intron 1 of FXN reduce FXN mRNA levels. FXN alleles in healthy individuals contain <36 GAA repeats, whereas21MF-365376951Attorney Reference: 15979-20193.40in FRDA patients GAA expansions, ranging from 70 to 1,700 GAA repeats, lead to FXN mRNA deficiency and subsequent reduced levels of frataxin, a nuclear-encoded mitochondrial protein essential for life. The highest amount of frataxin mRNA is present in the heart, spinal cord, liver, skeletal muscle, and pancreas, which are also the most affected sites in patients with FRDA. The length of the GAA expansion correlates proportionally with the severity of the disease and inversely with the age of onset, which can occur from infancy to after 60 years of age.

[0074] The primary consequence of the expanded repeats is a defective expression of FXN, with basal protein levels decreased by 70-98%, which foremost affects the cerebellum, dorsal root ganglia (DRG), heart, and liver. The FXN gene encodes for the mitochondrial protein frataxin which plays several roles in iron metabolism and respiration. In fact, insufficient frataxin protein levels in FRDA results in far-reaching mitochondrial dysfunctions that affect functionality and integrity of the mitochondria and more broadly deregulation of the cell antioxidant defenses. In particular, FXN controls the biogenesis of iron-sulfur (Fe-S) clusters which are essential for the proper function of complexes I, II, and III of the electron transport chain, the citric acid cycle enzyme, aconitase, and many others. Interestingly, reduction of FXN in FRDA is most dramatic in the peripheral nerve roots and DRGs as compared with a milder reduction in the central neural structures. Similarly, FRDA patients present a significantly decreased activity of iron-sulfur (Fe-S) proteins in DRGs and, to a lesser extent, the cerebellum accompanied by impaired oxidative phosphorylation.

[0075] Mouse models have been developed to investigate the molecular mechanism of FRDA disease and therapy. In some embodiments, the methods and compositions disclosed herein are used in relevant FRDA mouse models. A non-exhaustive list of relevant mouse models include “YG8R, YG22R, YG8sR, YG8 800”, mice with Fxn alleles knocked out and transgenic for human FXN gene with an expanded GAA repeat sequence; “KIKO, KIKI”, mice with a repeat sequence inserted into the mouse gene; “MCK-Cre, NSE-Cre, PVALB-Cre, Fxn flox / null:MCK-Cre, Fxn flox / null::PV-Cre, aMyhc-Cre”, conditional knock-out models; “G127V mouse, I151F mouse”, point mutation models; and “FRDAkd”, an inducible knock-down. Other mouse models suitable for use of methods and compositions disclosed herein are known in the art.

[0076] Several therapeutic strategies targeting either the defects of FRDA are aimed at: (1) restoring FXN levels using gene expression modulators, protein stabilizers and gene therapy, and (2) alleviating secondary cellular defects such as mitochondrial functions, iron accumulation,22MF-365376951Attorney Reference: 15979-20193.40oxidative stress and ferroptosis. Pharmacologic approaches including iron-chelators, antioxidants, NRF2 activators, ferroptosis inhibitors, and molecules improving mitochondrial functions have reached clinical trials.

[0077] The first FDA approved treatment of FRDA, omaveloxolone, is a small molecule semisynthetic triterpenoid drug that targets activation of nuclear factor (erythroid-derived 2)-like 2 (Nrf2) pathway. The Nrf2 pathway is suppressed in FRDA patients and is associated with oxidative stress, mitochondrial dysfunction, and damage to cells. While omaveloxolone changes the modified Friedreich’s Ataxia Rating Scale (mFARS) score compared to placebo, it does not treat the cause of FRDA. See, e.g., Omaveloxolone: First Approval, Drugs. 2023 Jun;83(8):725-729.

[0078] There is a need for treatment that corrects the deficiency of mature human frataxin (hFXN) protein in FRDA patients and alleviates the neurodegenerative and cardiodegenerative effects associated with hFXN deficiency. Gene therapy presents a potential treatment for FRDA. Gene therapies attempt to replace or correct the underlying fault in disease-causing genes, particularly FXN. As FRDA is a multisystemic disease, there is a need for development and improvements of current delivery systems to ensure both targeted and systemic FXN delivery in FRDA patients. Some challenges that still need to be overcome include potentially toxic frataxin overexpression, and complicated localized delivery to target sites. Improving symptoms of FXN deficiency requires expression in multiple tissue types, including heart, spinal cord, liver, skeletal muscle, and pancreas. The current gene delivery methods potentially result in tissue-specific rescue only and / or a high vector load is required for systematic delivery. The methods and compositions disclosed herein overcome these challenges and deliver FXN to multiple tissue types, including heart, spinal cord, and liver.

[0079] Moreover, expression of FXN through viral delivery has been tested in mice and nonhuman primates (NHP). These prior methodologies focus on expression of the transduced cells. See, e.g., Prevention and reversal of severe mitochondrial cardiomyopathy by gene therapy in a mouse model of Friedreich's ataxia, Nat Med. 2014 May;20(5):542-7. doi: 10.1038 / nm.3510., which shows AAV rhlO vector expressing human FXN injected intravenously in mice; Rapid and Complete Reversal of Sensory Ataxia by Gene Therapy in a Novel Model of Friedreich Ataxia, Mol Ther. 2018 Aug 1 ;26(8): 1940-1952. doi: 10.1016 / j.ymthe.2018.05.006, which shows AAV9 vector was used to deliver FXN to a parvalbumin-conditional FXN knockout23MF-365376951Attorney Reference: 15979-20193.40mouse model that mimics the neuropathophysiology in individuals with FRDA; Stress-Induced Mouse Model of the Cardiac Manifestations of Friedreich's Ataxia Corrected by AAV-mediated Gene Therapy, Hum Gene Ther. 2020 Aug;31(15-16):819-827, doi:10.1089 / hum.2019.363, which created a mouse model for early FRDA disease and used a cardiac promoter (aMyhc) driving CRE recombinase cardiac-specific excision of FXN exon 4 to generate a mild, cardiacspecific FA model. For other examples of prior methodologies focusing on transduced cells, see, e.g., Quantification of human mature frataxin protein expression in nonhuman primate hearts after gene therapy, Commun Biol. 2023 Oct 27;6(l):1093. doi: 10.1038 / s42003-023-05472-z, which tests the pharmacology of an adeno-associated virus (AAV) hu68.CB7.hFXN therapy in rhesus macaque monkeys; Expression and processing of mature human frataxin after gene therapy in mice Sci Rep. 2024 Apr 10;14(l): 8391. doi: 10.1038 / s41598-024-59060-0., which shows that consistent induction of therapeutic FXN protein expression that is sub-toxic has proven challenging.Vectors and Viral Particles

[0080] In certain aspects, the expression cassette for expressing a disorder-related polypeptide, particularly FXN, is contained in a vector. In some embodiments, the present disclosure contemplates the use of a recombinant viral genome for introduction of nucleic acid sequences encoding the FXN polypeptide for packaging into a viral particle, e.g., a viral particle described below. The recombinant viral genome may include any element to establish the expression of the disorder-related polypeptide, for example, a promoter, an ITR, a ribosome binding element, terminator, enhancer, selection marker, intron, polyA signal, and / or origin of replication.Exemplary viral genome elements and delivery methods for viral particles are described in greater detail below.Expression Cassettes

[0081] In some embodiments, the expression cassette encoding a disorder-related polypeptide, particularly FXN, may be codon-optimized. In some embodiments, the transgene also encodes a signal peptide and a cell-penetrating peptide along with the disorder-related polypeptide. In some embodiments, the expression cassette also encodes a cell-penetrating peptide along with the FXN polypeptide. In some embodiments, the expression cassette also encodes a signal peptide along with the FXN polypeptide. In some embodiments, the expression cassette encoding an FXN polypeptide may be codon optimized for expression in a particular cell, such as a eukaryotic cell.24MF-365376951Attorney Reference: 15979-20193.40Eukaryotic cells may be those of or derived from a particular organism, such as a mammal, including but not limited to human, mouse, rat, rabbit, dog, or non-human primate. In general, codon optimization refers to a process of modifying a nucleic acid sequence for enhanced expression in the host cells of interest by replacing at least one codon of the native sequence with codons that are more frequently or most frequently used in the genes of that host cell while maintaining the native amino acid sequence. Various species exhibit particular bias for certain codons of a particular amino acid. Codon usage tables are readily available, for example, at the “Codon Usage Database”, and these tables can be adapted in a number of ways (see, e.g., Nakamura, Y. et al. (2000) Nucleic Acids Res. 28:292). Computer algorithms for codon optimizing a particular sequence for expression in a particular host cell are also available, such as Gene Forge (Aptagen; Jacobus, Pa.), DNA2.0, GeneArt (GA) or Genscript (GS) and a GS algorithm combined with reduction in CpG content. In some embodiments, a transgene encoding the disorder-related polypeptide is codon optimized using the GA algorithm.Tissue specific promoters

[0082] As disclosed above, vectors used in gene therapy require an expression cassette. The expression cassette contains three important components: promoter, the therapeutic gene (e.g., FXN), and a polyadenylation signal. The promoter is essential to control expression of the therapeutic gene. In some embodiments, the expression cassette for expressing a disorder-related polypeptide, particularly FXN, a signal peptide, and / or a cell-penetrating peptide comprises a tissue-specific promoter. A tissue-specific promoter is a promoter that has activity in only certain cell types. Use of a tissue-specific promoter in the expression cassette can restrict unwanted transgene expression as well as facilitate persistent transgene expression.

[0083] In some embodiments, the promoter is a tissue-specific promoter. In some embodiments, wherein the tissue-specific promoter is a muscle-specific promoter. In some embodiments, the muscle-specific promoter is a human desmin promoter. In some embodiments, the human desmin promoter is encoded by a nucleotide sequence of SEQ ID NO: 11. In some embodiments, the human desmin promoter is encoded by a nucleotide sequence with at least 90% homology to the nucleotide sequence of SEQ ID NO: 11.Cell-penetrating peptide (CPP)

[0084] Cell-penetrating peptides (CPPs) have shown potential for the delivery of a wide range of molecules, including large active proteins to enter cells via endocytosis. Typically composed of25MF-365376951Attorney Reference: 15979-20193.405-30 amino acids, CPPs are mostly positively charged at physiological pH due to the presence of several arginine and / or lysine residues. Different internalization mechanisms have been reported to be utilized by CPPs, including direct penetration across the plasma membrane and endosomal uptake via one or several endocytic pathways.

[0085] In some embodiments, the polynucleotide construct comprising the expression cassette encodes a cell-penetrating peptide (CPP). In some embodiments, the CPP encoded is TAT, TATk, MAP, penetratin, MPG, ARF, Transportan, Pep-1, pVEC, C105Y, R8, or Xentry. Other CPPs known in the art can also be used.

[0086] In some embodiments, the expression cassette comprises a gene encoding the CPP, wherein the CPP is encoded by a nucleotide sequence of SEQ ID NO: 10. In some embodiments, the expression cassette comprises a gene encoding the CPP, wherein the CPP is encoded by a nucleotide sequence with at least 90% homology to the nucleotide sequence of SEQ ID NO: 10. In some embodiments, the CPP is comprises an amino sequence of SEQ ID NO: 9. In some embodiments, the CPP comprises an amino sequence with at least 90% homology to the amino acid sequence of SEQ ID NO: 9.Signaling peptide (SP)

[0087] Signal peptide, also known as signal sequence, targeting signal, localization signal, localization sequence, transit peptide, leader sequence, or leader peptide, is a short peptide present in newly synthesized proteins. In some embodiments, the signal peptide is located at the N-terminus or C-terminus of the protein. In some embodiments, the signal peptide is located internally. Signal peptides known in the art can be used.

[0088] Signal peptide may be 10 - 30 amino acids long. In some embodiments, the signal peptide encoded in the expression cassette is 10 amino acids, 11 amino acids, 12 amino acids, 13 amino acids, 14 amino acids, 15 amino acids, 16 amino acids, 17 amino acids, 18 amino acids, 19 amino acids, 20 amino acids, 21 amino acids, 22 amino acids, 23 amino acids, 24 amino acids, 25 amino acids, 26 amino acids, 27 amino acids, 28 amino acids, 29 amino acids, or 30 amino acids. In some embodiments, the signal peptide may be longer than 30 amino acids.T ransgene ( FXN )

[0089] In some aspects, a polynucleotide construct comprising an expression cassette encoding: a Frataxin (FXN) protein is provided. In some embodiments, the expression cassette comprises a gene encoding the FXN protein, wherein the gene is operably linked to a promoter. In some26MF-365376951Attorney Reference: 15979-20193.40embodiments, the expression cassette comprises a gene encoding the FXN protein, wherein the FXN protein comprises a nucleotide sequence of SEQ ID NO: 2. In some embodiments, the expression cassette comprises a gene encoding the FXN protein, wherein the FXN protein comprises a nucleotide sequence with at least 90% homology to the nucleotide sequence of SEQ ID NO: 2. In some embodiments, the FXN protein comprises an amino acid sequence of SEQ ID NO: 1. In some embodiments, the expression cassette comprises a gene encoding the FXN protein, wherein the FXN protein comprises a nucleotide sequence with at least 90% homology to the nucleotide sequence of SEQ ID NO: 1.

[0090] In some embodiments, the expression cassette encodes an FXN protein. In some embodiments, the FXN protein is between 150 and 250 amino acids. In some embodiments, the FXN protein is between 175 and 225 amino acids. In some embodiments, the FXN protein is between 180 and 210 amino acids. In some embodiments, the FXN protein is 210 amino acids. In some embodiments, the FXN protein comprises SEQ ID NO: 1.

[0091] In some embodiments, the expression cassette further comprises an intron. A variety of introns for use in the disclosure are known to those of skill in the art, and include the MVM intron, the F IX truncated intron 1 , the P-globin SD / immunoglobin heavy chain SA, the adenovirus SD / immunoglobin SA, the SV40 late SD / SA (19S / 16S), and the hybrid adenovirus SD / IgG SA. (Wu et al. 2008, Kurachi et al., 1995, Choi et al. 2014, Wong et al., 1985, Yew et al. 1997, Huang and Gorman (1990). In some embodiments, the intron is a chicken -actin (CBA) / rabbit P-globin hybrid intron. In some embodiments, intron is a chicken P-actin (CBA) / rabbit P-globin hybrid promoter and intron where all the ATG sites are removed to minimize false translation start sites. In some embodiments the intron is an MVM intron, a F IX truncated intron 1, a P-globin SD / immunoglobin heavy chain SA, an adenovirus SD / immunoglobin SA, a SV40 late SD / SA (19S / 16S), or a hybrid adenovirus SD / IgG SA. In some embodiments, the intron is a chicken P-actin (CBA) / rabbit P-globin hybrid intron.

[0092] In some embodiments, the expression cassette further comprises a polyadenylation signal. In some embodiments, the polyadenylation signal is a bovine growth hormone polyadenylation signal, an SV40 polyadenylation signal, or a HSV TK pA. In some embodiments, the polyadenylation signal is a synthetic polyadenylation signal as described in Levitt, N et al.(1989), Genes Develop. 3:1019-1025.27MF-365376951Attorney Reference: 15979-20193.40

[0093] In some embodiments, the expression cassette comprises a st ffer nucleic acid. In some embodiments, the st ffer nucleic acid may comprise a sequence that encodes a reporter polypeptide. As will be appreciated by those of skill in the art, the stuffer nucleic acid may be located in a variety of regions within the nucleic, and may be comprised of a continuous sequence (e.g., a single stuffer nucleic acid in a single location) or multiple sequences (e.g., more than one stuffer nucleic acid in more than one location (e.g., 2 locations, 3 locations, etc.) within the nucleic acid. In some embodiments, the stuffer nucleic acid may be located downstream of the transgene encoding the disorder-related polypeptide. In some embodiments, the stuffer nucleic acid may be located upstream of the transgene encoding the disorder-related polypeptide (e.g., between the promoter and the transgene). As will also be appreciated by those of skill in the art a variety of nucleic acids may be used as a stuffer nucleic acid. In some embodiments, the stuffer nucleic acid comprises all or a portion of a human alpha- 1- antitrypsin (AAT) stuffer sequence or a C16 Pl chromosome 16 Pl clone (human C16) stuffer sequence. In some embodiments, the stuffer sequence comprises all or a portion of a gene. For example, the stuffer sequence may comprise a portion of the human AAT sequence. One skilled in the art would recognize that different portions of a gene (e.g., the human AAT sequence) can be used as a stuffer fragment. For example, the stuffer fragment may be from the 5’ end of the gene, the 3’ end of the gene, the middle of a gene, a non-coding portion of the gene (e.g., an intron), a coding region of the gene (e.g., an exon), or a mixture of non-coding and coding portions of a gene. One skilled in the art would also recognize that all or a portion of stuffer sequence may be used as a stuffer sequence. In some embodiments, the stuffer sequence is modified to remove internal ATG codons.

[0094] In some embodiments, the expression cassette is incorporated into a vector. In some embodiments, the expression cassette is incorporated into a viral vector. In some embodiments, the viral vector is a rAAV vector as described herein.Non-viral Delivery Systems

[0095] Conventional non-viral gene transfer methods may also be used to introduce nucleic acids into cells or target tissues. Non-viral vector delivery systems include DNA plasmids, naked nucleic acid, and nucleic acid complexed to a delivery system. For example, the vector may be complexed to a lipid (e.g., a cationic or neutral lipid), a liposome, a polycation, a nanoparticle, or an agent that enhances the cellular uptake of nucleic acid. The vector may be complexed to an28MF-365376951Attorney Reference: 15979-20193.40agent suitable for any of the delivery methods described herein. In some embodiments, the nucleic acid comprises one or more viral ITRs (e.g., AAV ITRs).Viral Particles

[0096] In some embodiments, the vector comprising the expression cassette for expressing a disorder-related polypeptide (e.g., FXN) is a recombinant viral vector. Some examples of recombinant viral vectors comprise AAV, lenti virus, or adenovirus. In one aspect, the viral vector is a recombinant adeno-associated virus (rAAV) vector. In some embodiments, the expression cassette for expressing a disorder-related polypeptide may be flanked by one or more AAV inverted terminal repeat (ITR) sequences. In some embodiments, the viral particle is a recombinant AAV particle comprising an expression cassette for expressing a disorder-related polypeptide is flanked by one or two ITRs. In some embodiments, the expression cassette for expressing a disorder-related polypeptide is flanked by two AAV ITRs.

[0097] In some embodiments, the expression cassette for expressing a disorder-related polypeptide of the present disclosure comprises operatively linked components configured for transcription. In some embodiments, the expression cassette comprises control sequences further comprising transcription initiation, termination sequences, or a combination thereof. The expression cassette may be flanked on the 5' and 3' end by at least one functional AAV ITR sequence. By “functional AAV ITR sequences” it is meant that the ITR sequences function as intended for the rescue, replication and packaging of the AAV virion. See Davidson et al., PNAS, 2000, 97(7)3428-32; Passini et al., J. Virol., 2003, 77(12):7034-40; and Pechan et al., Gene Ther., 2009, 16:10-16, all of which are incorporated herein in their entirety by reference. For practicing some aspects of the disclosure, the recombinant vectors may comprise at least some or all of the sequences of AAV essential for encapsidation and the physical structures for infection by the rAAV. AAV ITRs for use in the vectors of the disclosure need not have a wild-type nucleotide sequence (e.g., as described in Kotin, Hum. Gene Ther., 1994, 5:793-801), and may be altered by the insertion, deletion or substitution of nucleotides or the AAV ITRs may be derived from any of several AAV serotypes. More than 40 serotypes of AAV are currently known, and new serotypes and variants of existing serotypes continue to be identified. See Gao et al., PNAS, 2002, 99(18): 11854-6; Gao et al., PNAS, 2003, 100(10):6081-6; andBossis et al., J. Virol., 2003, 77(12):6799-810.29MF-365376951Attorney Reference: 15979-20193.40

[0098] Use of any AAV serotype is considered within the scope of the present disclosure. In some embodiments, a rAAV vector is a vector derived from an AAV serotype, including without limitation, AAV ITRs are AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAV.rhlO, AAV11, AAV12, a goat AAV, bovine AAV, or mouse AAV ITRs or the like. In some embodiments, the nucleic acid in the AAV comprises an UR of AAV ITRs are AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrhlO, AAV11, AAV12, a goat AAV, bovine AAV, or mouse AAV or the like. In certain embodiments, the AAV ITRs are AAV2 ITRs.

[0099] In some embodiments, a vector may include a stuffer nucleic acid. In some embodiments, the stuffer nucleic acid may encode a green fluorescent protein (GFP). In some embodiments, the stuffer nucleic acid may be located 3’ to expression cassette for expressing a disorder- related polypeptide of the present disclosure.

[0100] In some embodiments, the disclosure provides viral particles comprising a singlestranded genome. In some aspects, the disclosure provides viral particles comprising a recombinant self-complementing genome. In some embodiments, the vector is a self-complementary vector. AAV viral particles with self-complementing genomes and methods of use of self-complementing AAV genomes are described in US Patent Nos. 6,596,535; 7,125,717; 7,765,583; 7,785,888; 7,790,154; 7,846,729; 8,093,054; and 8,361,457; and Wang Z„ et al., (2003) Gene Ther 10:2105-2111, each of which are incorporated herein by reference in its entirety. A rAAV comprising a self-complementing genome will quickly form a double stranded DNA molecule by virtue of its partially complementing sequences (e.g., complementing coding and non-coding strands of a transgene). In some embodiments, the disclosure provides an AAV viral particle comprising an AAV genome, wherein the rAAV genome comprises a first heterologous polynucleotide sequence (e.g., the coding strand of the disorder-related polypeptide of the disclosure) and a second heterologous polynucleotide sequence (e.g., the noncoding or antisense strand of the disorder-related polypeptide) wherein the first heterologous polynucleotide sequence can form intrastrand base pairs with the second polynucleotide sequence along most or all of its length.

[0101] In some embodiments, the first heterologous polynucleotide sequence and a second heterologous polynucleotide sequence are linked by a sequence that facilitates intrastrand basepairing; e.g., a hairpin DNA structure. Hairpin structures are known in the art, for example30MF-365376951Attorney Reference: 15979-20193.40in siRNA molecules. In some embodiments, the first heterologous polynucleotide sequence and a second heterologous polynucleotide sequence are linked by a mutated ITR (e.g., the right ITR). The mutated ITR may comprise a deletion of the D region comprising the terminal resolution sequence. As a result, on replicating an AAV viral genome, the rep proteins may not cleave the viral genome at the mutated ITR and as such, a recombinant viral genome comprising the following in 5' to 3' order may be packaged in a viral capsid: an AAV ITR, the first heterologous polynucleotide sequence including regulatory sequences, the mutated AAV ITR, the second heterologous polynucleotide in reverse orientation to the first heterologous polynucleotide and a third AAV ITR.

[0102] In some embodiments, the first heterologous nucleic acid sequence and a second heterologous nucleic acid sequence are linked by a mutated ITR (e.g., the right ITR). In some embodiments, the ITR comprises the polynucleotide sequence 5'-CACTCCCTCTCTGCGCGCT CGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCACGCCCGGGCTTTGCCCGG GCG - 3' (SEQ ID NO: 13). The mutated ITR may comprise a deletion of the D region comprising the terminal resolution sequence. As a result, on replicating an AAV viral genome, the rep proteins may not cleave the viral genome at the mutated ITR and as such, a recombinant viral genome comprising the following in 5' to 3' order may be packaged in a viral capsid: an AAV ITR, the first heterologous polynucleotide sequence including regulatory sequences, the mutated AAV ITR, the second heterologous polynucleotide in reverse orientation to the first heterologous polynucleotide and a third AAV ITR.

[0103] In some embodiments, the vector is encapsidated in a viral particle. In some embodiments, the viral particle is a recombinant AAV viral particle comprising a recombinant AAV vector. Different AAV serotypes may be used to optimize transduction of particular target cells or to target specific cell types within a particular target tissue (e.g., brain or spinal). A rAAV particle can comprise viral proteins and viral nucleic acids of the same serotype or a mixed serotype. For example, in some embodiments a rAAV particle can comprise modified AAV. SAN capsid proteins and at least one AAV2 ITR or it can comprise modified AAV. SAN capsid proteins and at least one AAV1 ITR. Any combination of AAV serotypes for production of a rAAV particle may be provided herein as if each combination had been expressly stated herein.31MF-365376951Attorney Reference: 15979-20193.40

[0104] The capsid (e.g., AAV-SAN) or the rAAV viral particle is known to include three capsid proteins: VP1, VP2, and VP3. These proteins contain significant amounts of overlapping amino acid sequence and unique N-terminal sequences. An AAV9 capsid includes 60 subunits arranged by icosahedral symmetry. AAV9 includes VP1 (SEQ ID NO: 14), VP2 (SEQ ID NO: 15), and VP3 (SEQ ID NO: 16), capsid proteins in a ratio of about 5:5:50. The VP proteins of AAV9 are products of the structural protein-encoding open reading frame of the genome, designated cap, VP1 (~82 kDa) and VP2 (~73 kDa), which are the minor capsid proteins, and VP3 (~61 kDa), the major capsid protein. Due to the utilization of both alternative splicing and leaky scanning, when expressed, the individual VPs share a C terminus that encompasses the entire VP3, while VP1 and VP2 are N-terminal VP3 extensions. VP1 and VP2 share a region of ~73 amino acids amino acids which is extended by an additional ~ 137 amino acids in VP1, designated the VP1 unique region (VPlu). See Penzes et al., (2021), Journal of Virology 95(19)e0084321. In some embodiments of the modified AAV9 capsid proteins disclosed herein, the targeting peptide (e.g., SEQ ID NO: 17) is incorporated into VP1. In some embodiments of the modified AAV9 capsid proteins disclosed herein, the targeting peptide (e.g., SEQ ID NO: 17) is incorporated into VP2. In some embodiments of the modified AAV9 capsid proteins disclosed herein, the targeting peptide (e.g., SEQ ID NO: 17) is incorporated into VP3. In some embodiments of the modified AAV9 capsid proteins disclosed herein, the targeting peptide (e.g., SEQ ID NO: 17) is incorporated into VP1, VP2, and VP3.

[0105] In some embodiments, the disclosure provides rAAV particles for intra-CSF administration of a disorder-related polypeptide that may comprise a modified AAV9 capsid protein comprising a targeting peptide that may target (e.g., direct) the rAAV particles to a particular tissue (e.g., the brain). In particular embodiments, the targeting peptide of the modified AAV9 capsids are inserted after residue 588 of the AAV9 structural protein. In some embodiments, the targeting peptide has SEQ ID NO: 17. In some embodiments, the targeting peptide is flanked by linker sequences on the N-terminal and the C-terminal end of the targeting peptide. In some embodiments, the linker sequence on the N-terminal side has the sequence AAA. In some embodiments, the linker sequence on the C-terminal side is AS. In some embodiments, the full sequence inserted after residue 588 of the AAV9 capsid structural protein has SEQ ID NO: 18. In some embodiments, the full modified AAV9 capsid structural protein has SEQ ID NO: 12. In some embodiments, the full modified AAV9 capsid structural protein that it32MF-365376951Attorney Reference: 15979-20193.40at least 90% (e.g., at least 92%, at least 95%, at least 98%, at least 98.5%, at least 99%, at least 99.2%, at least 99.5%, or at least 99.8%) identical to SEQ ID NO: 12, wherein the modified AAV9 structural capsid comprises the targeting peptide of SEQ ID NO: 17.Production of AAV particles

[0106] Numerous methods are known in the art for production of rAAV vectors, including transfection, stable cell line production, and infectious hybrid virus production systems which include adenovirus-AAV hybrids, herpesvirus-AAV hybrids (Conway, JE et al., (1997) J.Wro / ogy 71(11):8780-8789) and baculovirus-AAV hybrids (Urabe, M. et al., (2002) Human Gene Therapy 13(16): 1935-1943; Kotin, R. (2011) Hum Mol Genet. 2O(R1): R2-R6). rAAV production cultures for the production of rAAV virus particles all require; 1) suitable host cells, 2) suitable helper virus function, 3) AAV rep and cap genes and gene products; 4) a nucleic acid (such as a therapeutic nucleic acid) flanked by at least one AAV ITR sequences (e.g., an AAV genome encoding a peptide of interest); and 5) suitable media and media components to support rAAV production. In some embodiments, the suitable host cell is a primate host cell. In some embodiments, the suitable host cell is a human-derived cell lines such as HeLa, A549, 293, or Perc.6 cells. In some embodiments, the suitable helper virus function is provided by wild-type or mutant adenovirus (such as temperature sensitive adenovirus), herpes virus (HSV), baculovirus, or a plasmid construct providing helper functions. In some embodiments, the AAV rep and cap gene products may be from any AAV serotype. In general, but not obligatory, the AAV rep gene product is of the same serotype as the ITRs of the rAAV vector genome as long as the rep gene products may function to replicated and package the rAAV genome. Suitable media known in the art may be used for the production of rAAV vectors. These media include, without limitation, media produced by Hyclone Laboratories and JRH including Modified Eagle Medium (MEM), Dulbecco's Modified Eagle Medium (DMEM), custom formulations such as those described in U.S. Patent No. 6,566,118, and Sf-900 II SFM media as described in U.S. Patent No. 6,723,551, each of which is incorporated herein by reference in its entirety, particularly with respect to custom media formulations for use in production of recombinant AAV vectors. In some embodiments, the AAV helper functions are provided by adenovirus or HSV. In some embodiments, the AAV helper functions are provided by baculovirus and the host cell is an insect cell (e.g., Spodoptera frugiperda (Sf9) cells).33MF-365376951Attorney Reference: 15979-20193.40

[0107] One method for producing rAAV particles is the triple transfection method. Briefly, a plasmid containing a rep gene and a capsid gene, along with a helper adenoviral plasmid, may be transfected {e.g., using the calcium phosphate method) into a cell line {e.g., HEK-293 cells), and virus may be collected and optionally purified. As such, in some embodiments, the rAAV particle was produced by triple transfection of a nucleic acid encoding the rAAV vector, a nucleic acid encoding AAV rep and cap, and a nucleic acid encoding AAV helper virus functions into a host cell, wherein the transfection of the nucleic acids to the host cells generates a host cell capable of producing rAAV particles.

[0108] In some embodiments, rAAV particles may be produced by a producer cell line method see Martin et al., (2013) Human Gene Therapy Methods 24:253-269; U.S. PG Pub. No.US2004 / 0224411; and Liu, X.L. et al. Gene Ther. 6:293-299). Briefly, a cell line e.g., a HeLa, 293, A549, or Perc.6 cell line) may be stably transfected with a plasmid containing a rep gene, a capsid gene, and a vector genome comprising a promoter-heterologous nucleic acid sequence {e.g., a disorder-related polypeptide). Cell lines may be screened to select a lead clone for rAAV production, which may then be expanded to a production bioreactor and infected with a helper virus {e.g., an adenovirus or HSV) to initiate rAAV production. Virus may subsequently be harvested, adenovirus may be inactivated {e.g., by heat) and / or removed, and the rAAV particles may be purified. As such, in some embodiments, the rAAV particle was produced by a producer cell line comprising one or more of nucleic acid encoding the rAAV vector, a nucleic acid encoding AAV rep and cap, and a nucleic acid encoding AAV helper virus functions. As described herein, the producer cell line method may be advantageous for the production of rAAV particles with an oversized genome, as compared to the triple transfection method.

[0109] In some embodiments, the nucleic acid encoding AAV rep and cap genes and / or the rAAV genome are stably maintained in the producer cell line. In some embodiments, nucleic acid encoding AAV rep and cap genes and / or the rAAV genome is introduced on one or more plasmids into a cell line to generate a producer cell line. In some embodiments, the AAV rep, AAV cap, and rAAV genome are introduced into a cell on the same plasmid. In other embodiments, the AAV rep, AAV cap, and rAAV genome are introduced into a cell on different plasmids. In some embodiments, a cell line stably transfected with a plasmid maintains the plasmid for multiple passages of the cell line {e.g., 5, 10, 20, 30, 40, 50 or more than 50 passages of the cell). For example, the plasmid(s) may replicate as the cell replicates, or the plasmid(s)34MF-365376951Attorney Reference: 15979-20193.40may integrate into the cell genome. A variety of sequences that enable a plasmid to replicate autonomously in a cell (e.g., a human cell) have been identified (see, e.g., Krysan, P.J. et al. (1989) Mol. Cell Biol. 9:1026-1033). In some embodiments, the plasmid(s) may contain a selectable marker (e.g., an antibiotic resistance marker) that allows for selection of cells maintaining the plasmid. Selectable markers commonly used in mammalian cells include without limitation blasticidin, G418, hygromycin B, zeocin, puromycin, and derivatives thereof. Methods for introducing nucleic acids into a cell are known in the art and include without limitation viral transduction, cationic transfection (e.g., using a cationic polymer such as DEAE-dextran or a cationic lipid such as lipofectamine), calcium phosphate transfection, microinjection, particle bombardment, electroporation, and nanoparticle transfection (for more details, see e.g., Kim, T.K. andEberwine, J.H. (2010) Anal. Bioanal. Chem. 397:3173-3178).

[0110] In some embodiments, the nucleic acid encoding AAV rep and cap genes and / or the rAAV genome are stably integrated into the genome of the producer cell line. In some embodiments, nucleic acid encoding AAV rep and cap genes and / or the rAAV genome is introduced on one or more plasmids into a cell line to generate a producer cell line. In some embodiments, the AAV rep, AAV cap, and rAAV genome are introduced into a cell on the same plasmid. In other embodiments, the AAV rep, AAV cap, and rAAV genome are introduced into a cell on different plasmids. In some embodiments, the plasmid(s) may contain a selectable marker (e.g., an antibiotic resistance marker) that allows for selection of cells maintaining the plasmid. Methods for stable integration of nucleic acids into a variety of host cell lines are known in the art. For example, repeated selection (e.g., through use of a selectable marker) may be used to select for cells that have integrated a nucleic acid containing a selectable marker (and AAV cap and rep genes and / or a rAAV genome). In other embodiments, nucleic acids may be integrated in a site-specific manner into a cell line to generate a producer cell line. Several sitespecific recombination systems are known in the art, such as FLP / FRT (see, e.g., O’ Gorman, S. et al. (1991) Science 251:1351-1355), Cre / loxP (see, e.g., Sauer, B. and Henderson, N. (1988) Proc. Natl. Acad. Sci. 85:5166-5170), and phi C31-att (see, e.g., Groth, A.C. et al. (2000) Proc. Natl. Acad. Sci. 97:5995-6000).

[0111] In some embodiments, the producer cell line is derived from a primate cell line (e.g., a non-human primate cell line, such as a Vero or FRhL-2 cell line). In some embodiments, the cell line is derived from a human cell line. In some embodiments, the producer cell line is derived35MF-365376951Attorney Reference: 15979-20193.40from HeLa, 293, A549, or PERC.6® (Crucell) cells. For example, prior to introduction and / or stable maintenance / integration of nucleic acid encoding AAV rep and cap genes and / or the oversized rAAV genome into a cell line to generate a producer cell line, the cell line is a HeLa, 293, A549, or PERC.6® (Crucell) cell line, or a derivative thereof.

[0112] In some embodiments, the producer cell line is adapted for growth in suspension. As is known in the art, anchorage-dependent cells are typically not able to grow in suspension without a substrate, such as microcarrier beads. Adapting a cell line to grow in suspension may include, for example, growing the cell line in a spinner culture with a stirring paddle, using a culture medium that lacks calcium and magnesium ions to prevent clumping (and optionally an antifoaming agent), using a culture vessel coated with a siliconizing compound, and selecting cells in the culture (rather than in large clumps or on the sides of the vessel) at each passage. For further description, see, e.g., ATCC frequently asked questions document (available at www.atcc.org / Global / FAQs / 9 / l / Adapting%20a%20monolayer%20cell%201ine%20to%20suspen sion-40. aspx) and references cited therein.

[0113] In some aspects, a method is provided for producing any rAAV particle as disclosed herein comprising (a) culturing a host cell under a condition that rAAV particles are produced, wherein the host cell comprises (i) one or more AAV package genes, wherein each said AAV packaging gene encodes an AAV replication and / or encapsidation protein; (ii) a rAAV provector comprising a nucleic acid encoding a heterologous nucleic acid as described herein flanked by at least one AAV ITR, and (iii) an AAV helper function; and (b) recovering the rAAV particles produced by the host cell. In some embodiments, said at least one AAV ITR is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrhlO, AAV11, AAV12, a goat AAV, bovine AAV, or mouse AAV serotype ITRs or the like. For example, in some embodiments, the AAV serotype is AAV1, AAV2, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, or AAVrhlO. In certain embodiments, the nucleic acid in the AAV comprises an AAV2 ITR. In some embodiments, said encapsidation protein is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAVSAN, AAV10, AAVrhlO, AAV11, AAV12, AAV2R471A, AAV2 / 2-7m8, AAV DJ, AAV2 N587A, AAV2 E548A, AAV2 N708A, AAV V708K, goat AAV, AAV1 / AAV2 chimeric, bovine AAV, mouse AAV capsid, rAAV2 / HBoVl serotype, AAV-XL32, or AAV-XL32.1 capsid proteins or36MF-365376951Attorney Reference: 15979-20193.40mutants thereof. In some embodiments, the encapsidation protein is an AAV8 capsid protein. In some embodiments, the rAAV particles comprise an AAV9 capsid and a recombinant genome comprising AAV2 ITRs, and nucleic acid encoding a therapeutic transgene / nucleic acid (e.g., an expression cassette for expressing a disorder-related polypeptide). In some embodiments, the rAAV particles comprise an AAV. SAN capsid and a recombinant genome comprising AAV2 ITRs, and nucleic acid encoding a therapeutic transgene / nucleic acid (e.g., an expression cassette for expressing a disorder-related polypeptide).

[0114] Suitable rAAV production culture media of the present disclosure may be supplemented with serum or serum-derived recombinant proteins at a level of 0.5%-20% (v / v or w / v).Alternatively, as is known in the art, rAAV vectors may be produced in serum-free conditions which may also be referred to as media with no animal-derived products. One of ordinary skill in the art may appreciate that commercial or custom media designed to support production of rAAV vectors may also be supplemented with one or more cell culture components know in the art, including without limitation glucose, vitamins, amino acids, and or growth factors, in order to increase the titer of rAAV in production cultures.

[0115] rAAV production cultures can be grown under a variety of conditions (over a wide temperature range, for varying lengths of time, and the like) suitable to the particular host cell being utilized. As is known in the art, rAAV production cultures include attachment- dependent cultures which can be cultured in suitable attachment-dependent vessels such as, for example, roller bottles, hollow fiber filters, microcarriers, and packed-bed or fluidized-bed bioreactors. rAAV vector production cultures may also include suspension-adapted host cells such as HeLa, 293, and SF-9 cells which can be cultured in a variety of ways including, for example, spinner flasks, stirred tank bioreactors, and disposable systems such as the Wave bag system.

[0116] rAAV vector particles of the disclosure may be harvested from rAAV production cultures by lysis of the host cells of the production culture or by harvest of the spent media from the production culture, provided the cells are cultured under conditions known in the art to cause release of rAAV particles into the media from intact cells, as described more fully in U.S. Patent No. 6,566,118). Suitable methods of lysing cells are also known in the art and include for example multiple freeze / thaw cycles, sonication, microfluidization, and treatment with chemicals, such as detergents and / or proteases.37MF-365376951Attorney Reference: 15979-20193.40

[0117] In a further embodiment, the rAAV particles are purified. The term “purified” as used herein includes a preparation of rAAV particles devoid of at least some of the other components that may also be present where the rAAV particles naturally occur or are initially prepared from. Thus, for example, isolated rAAV particles may be prepared using a purification technique to enrich it from a source mixture, such as a culture lysate or production culture supernatant.Enrichment can be measured in a variety of ways, such as, for example, by the proportion of DNase-resistant particles (DRPs) or genome copies (gc) present in a solution, or by infectivity, or it can be measured in relation to a second, potentially interfering substance present in the source mixture, such as contaminants, including production culture contaminants or in-process contaminants, including helper virus, media components, and the like.

[0118] In some embodiments, the rAAV production culture harvest is clarified to remove host cell debris. In some embodiments, the production culture harvest is clarified by filtration through a series of depth filters including, for example, a grade DOHC Millipore Millistak+ HC Pod Filter, a grade A1HC Millipore Millistak+ HC Pod Filter, and a 0.2 pm Filter Opticap XE1O Millipore Express SHC Hydrophilic Membrane filter. Clarification can also be achieved by a variety of other standard techniques known in the art, such as, centrifugation or filtration through any cellulose acetate filter of 0.2 pm or greater pore size known in the art.

[0119] In some embodiments, the rAAV production culture harvest is further treated with Benzonase® to digest any high molecular weight DNA present in the production culture. In some embodiments, the Benzonase® digestion is performed under standard conditions known in the art including, for example, a final concentration of 1-2.5 units / ml of Benzonase® at a temperature ranging from ambient to 37 °C for a period of 30 minutes to several hours.

[0120] rAAV particles may be isolated or purified using one or more of the following purification steps: equilibrium centrifugation; flow-through anionic exchange filtration; tangential flow filtration (TFF) for concentrating the rAAV particles; rAAV capture by apatite chromatography; heat inactivation of helper virus; rAAV capture by hydrophobic interaction chromatography; buffer exchange by size exclusion chromatography (SEC); nanofiltration; and rAAV capture by anionic exchange chromatography, cationic exchange chromatography, or affinity chromatography. These steps may be used alone, in various combinations, or in different orders. In some embodiments, the method comprises all the steps in the order as described38MF-365376951Attorney Reference: 15979-20193.40below. Methods to purify rAAV particles are found, for example, in Xiao et al., (1998) Journal of Virology 72:2224-2232; US Patent Numbers 6,989,264 and 8,137,948; and WO 2010 / 148143.Methods of Treatment

[0121] Certain aspects of the present disclosure relate to methods of treating Friedrich’s ataxia, including the associate neurodegenerative and cardiac diseases in an individual in need thereof. In some embodiments, the disclosure provides methods of treating a neurodegenerative disease by administering an effective amount of a viral particle of the disclosure for expressing a disorder-related polypeptide. In some embodiments, the disorder-related polypeptide is human frataxin (FXN). In some embodiments, the disclosure provides methods of treating a disease by administering an effective amount of a viral particle of the disclosure for expressing FXN and a signal peptide. In some embodiments, the disclosure provides methods of treating a disease by administering an effective amount of a viral particle of the disclosure for expressing FXN and a cell-penetrating peptide. In some embodiments, the disclosure provides methods of treating a disease by administering an effective amount of a viral particle of the disclosure for expressing FXN, a signal peptide, and a cell-penetrating peptide. The viral particles may be administered through various routes.

[0122] In some embodiments, the administration of the viral particle includes direct spinal cord injection and / or intracerebral administration. In some embodiments, the administration is at a site selected from the cerebrum, medulla, pons, cerebellum, intracranial cavity, meninges surrounding the brain, dura mater, arachnoid mater, pia mater, cerebrospinal fluid (CSF) of the subarachnoid space surrounding the brain, deep cerebellar nuclei of the cerebellum, ventricular system of the cerebrum, subarachnoid space, striatum, cortex, septum, thalamus, hypothalamus, and the parenchyma of the brain. In some embodiments, the administration comprises intracerebroventricular injection into at least one cerebral lateral ventricle. In some embodiments, the administration comprises intrathecal injection in the cervical, thoracic, and / or lumbar region. In some embodiments, the administration comprises intrastriatal injection. In some embodiments, the administration comprises intrathalamic injection.

[0123] In some embodiments of the above aspects, the rAAV is administered via direct injection into the spinal cord, via intrathecal injection, or via intracisternal injection. In some embodiments, the rAAV is administered to more than one location of the spinal cord or cisterna magna. In some embodiments, the rAAV is administered to more than one location of the spinal39MF-365376951Attorney Reference: 15979-20193.40cord. In some embodiments, the rAAV is administered to one or more of a lumbar subarachnoid space, thoracic subarachnoid space, and a cervical subarachnoid space of the spinal cord. In some embodiments, the rAAV is administered to the cisterna magna.

[0124] An effective amount of rAAV (in some embodiments in the form of particles) may be administered, depending on the objectives of treatment. For example, where a low percentage of transduction can achieve the desired therapeutic effect, then the objective of treatment is generally to meet or exceed this level of transduction. In some instances, this level of transduction can be achieved by transduction of only about 1 to 5% of the target cells of the desired tissue type, in some embodiments at least about 20% of the cells of the desired tissue type, in some embodiments at least about 50%, in some embodiments at least about 80%, in some embodiments at least about 95%, in some embodiments at least about 99% of the cells of the desired tissue type. The rAAV composition may be administered by one or more administrations, either during the same procedure or spaced apart by days, weeks, months, or years. One or more of any of the routes of administration described herein may be used. In some embodiments, multiple vectors may be used to treat the human.

[0125] Methods to identify cells transduced by AAV viral particles are known in the art; for example, immunohistochemistry or the use of a marker such as enhanced green fluorescent protein can be used to detect transduction of viral particles; for example viral particles comprising a rAAV capsid with one or more substitutions of amino acids.

[0126] In some embodiments, an effective amount of rAAV particles is administered to more than one location simultaneously or sequentially. In other embodiments, an effective amount of rAAV particles is administered to a single location more than once (e.g., repeated). In some embodiments, multiple injections of rAAV viral particles are no more than one hour, two hours, three hours, four hours, five hours, six hours, nine hours, twelve hours, or 24 hours apart.

[0127] In some embodiments, the disclosure provides a method for treating a human with a disorder, for example neurodegenerative or cardio-degenerative, by administering an effective amount of a pharmaceutical composition comprising a recombinant viral vector encoding a disorder-related polypeptide (e.g., FXN). In some embodiments, the administered pharmaceutical composition comprising a recombinant viral vector encoding a disorder-related polypeptide (e.g., FXN) further comprises a signal peptide and a cell-penetrating peptide. In some embodiments, the administered pharmaceutical composition comprising a recombinant viral vector encoding a40MF-365376951Attorney Reference: 15979-20193.40disorder-related polypeptide (e.g., FXN) and a signal peptide. In some embodiments, the administered pharmaceutical composition comprising a recombinant viral vector encoding a disorder-related polypeptide (e.g., FXN) and a cell-penetrating peptide. In some embodiments, the pharmaceutical composition comprises one or more pharmaceutically acceptable excipients.

[0128] In some embodiments, the methods comprise administering an effective amount of a pharmaceutical composition comprising a recombinant viral vector encoding a disorder-related polypeptide of the present disclosure to treat a disorder, for example neurodegenerative or cardio-degenerative, in an individual in need thereof. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is at least about any of 5 x 1012, 6 x 1012, 7 x 1012, 8 x 1012, 9 x 1012, 10 x 1012, 11 x 1012, 15 x 1012, 20 x 1012, 25 x 1012, 30 x 1012, or 50 x 1012genome copies / mL. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is about any of 5 x 1012to 6 x 1012, 6 x 1012to 7 x 1012, 7 x 1012to 8 x 1012, 8 x 1012to 9 x 1012, 9 x 1012to 10 x 1012, 10 x 1012to 11 x 1012, 11 x 1012to 15 x 1012, 15 x 1012to 20 x 1012, 20 x 1012to 25 x 1012, 25 x 1012to 30 x 1012, 30 x 1012to 50 x 1012, or 50 x 1012to 100 x 1012genome copies / mL. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is about any of 5 x 1012to 10 x 1012, 10 x 1012to 25 x 1012, or 25 x 1012to 50 x 1012genome copies / mL. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is at least about any of 5 x 109, 6 x 109, 7 x 109, 8 x 109, 9 x 109, 10 x 109, 11 x 109, 15 x 109, 20 x 109, 25 x 109, 30 x 109, or 50 x 109transducing units / mL. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is about any of 5 x 109to 6 x 109, 6 x 109to 7 x 109, 7 x 109to 8 x 109, 8 x 109to 9 x 109, 9 x 109to 10 x 109, 10 x 109to 11 x 109, 11 x 109to 15 x 109, 15 x 109to 20 x 109, 20 x 109to 25 x 109, 25 x 109to 30 x 109, 30 x 109to 50 x 109or 50 x 109to 100 x 109transducing units / mL. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is about any of 5 x 109to 10 x 109, 10 x 109to 15 x 109, 15 x 109to 25 x 109, or 25 x 109to 50 x 109transducing units / mL. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is at least any of about 5 x IO10, 6 x IO10, 7 x IO10, 8 x IO10, 9 x IO10, 10 x IO10, 11 x IO10, 15 x IO10, 20 x IO10, 25 x IO10, 30 x IO10, 40 x IO10, or 50 x IO10infectious units / mL. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is at least any of about 5 x IO10to 6 x IO10, 6 x IO10to 7 x IO10, 7 x IO10to 8 x IO10, 8 x IO10to 9 x IO10, 9 x IO10to 10 x IO10, 10 x IO10to 11 x IO10, 11 x IO10to 15 x IO10, 15 x IO10to 20 x IO10, 20 x IO10to 25 x IO10, 25 x IO10to 30 x IO10, 30 x IO10to 40 x IO10, 40 x IO10to 5041MF-365376951Attorney Reference: 15979-20193.40x IO10, or 50 x IO10to 100 x IO10infectious units / mL. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is at least any of about 5 x IO10to 10 x IO10, 10 x IO10to 15 x 1010, 15 x IO10to 25 x IO10, or 25 x IO10to 50 x IO10infectious units / mL. In some embodiments, the viral particles are rAAV particles. In some embodiments, the rAAV particles comprise an AAV. SAN capsid protein.

[0129] In some embodiments, the dose of viral particles administered to the individual is at least about any of 1 x 108to about 6 x 1013genome copies / kg of body weight. In some embodiments, the dose of viral particles administered to the individual is about any of 1 x 108to about 6 x 1013genome copies / kg of body weight. In some embodiments, the dose of viral particles administered to the individual is about any of 1 x 1010, 2 x 1010, 3 x 1010, 4 x 1010, 5 x 1010, 6 x 1010, 7 x 1010, 8 x 1010, 9 x 1010, 1 x 1011, 2 x 1011, 3 x 1011, 4 x 1011, 5 x 1011, 6 x 1011, 7 x 1011, 8 x 1011, 9 x 1011, 1 x 1012, 2 x 1012, 13x 1012, 4 x 1012, 5 x 1012, 6 x 1012, 7 x 1012, 8 x 1012, 9 x 1012, or 1 x 1013genome copies / kg of body weight.

[0130] In some embodiments, the total amount of viral particles administered to the individual is at least about any of 1 x 109to about 1 x 1014genome copies. In some embodiments, the total amount of viral particles administered to the individual is about any of 1 x 109to about 1 x 1014genome copies. In some embodiments, the total amount of viral particles administered to the individual is about any of 1 x 1011, 2 x 1011, 3 x 1011, 4 x 1011, 5 x 1011, 6 x 1011, 7 x 1011, 8 x 1011, 9 x 1011, 1 x 1012, 2 x 1012, 3 x 1012, 4 x 1012, 5 x 1012, 6 x 1012, 7 x 1012, 8 x 1012, 9 x 1012, 1 x 1013, 2 x 1013, 13x 1013, 4 x 1013, 5 x 1013, 6 x 1013, 7 x 1013, 8 x 1013, 9 x 1013, or 1 x 1014genome copies.

[0131] Compositions of the disclosure (e.g., recombinant viral particles comprising a vector encoding a disorder-related polypeptide of the present disclosure) can be used either alone or in combination with one or more additional therapeutic agents for treating a disorder, for example neurodegenerative or cardio-degenerative. The interval between sequential administration can be in terms of at least (or, alternatively, less than) minutes, hours, or days.

[0132] An effective amount of rAAV (in some embodiments in the form of particles) is administered, depending on the objectives of treatment. For example, where a low percentage of transduction can achieve the desired therapeutic effect, then the objective of treatment is generally to meet or exceed this level of transduction. In some instances, this level of transduction can be achieved by transduction of only about 1 to 5% of the target cells, in some42MF-365376951Attorney Reference: 15979-20193.40embodiments at least about 20% of the cells of the desired tissue type, in some embodiments at least about 50%, in some embodiments at least about 80%, in some embodiments at least about 95%, in some embodiments at least about 99% of the cells of the desired tissue type. The rAAV composition may be administered by one or more administrations, either during the same procedure or spaced apart by days, weeks, months, or years. In some embodiments, multiple vectors may be used to treat the mammal (e.g., a human).

[0133] In some embodiments, a rAAV composition of the present disclosure may be used for administration to a human. In some embodiments, a rAAV composition of the present disclosure may be used for pediatric administration. In some embodiments, an effective amount of rAAV (in some embodiments in the form of particles) is administered to a patient that is less than one month, less than two months, less than three months, less than four months, less than five months, less than six months, less than seven months, less than eight months, less than nine months, less than ten months, less than eleven months, less than one year, less than 13 months, less than 14 months, less than 15 months, less than 16 months, less than 17 months, less than 18 months, less than 19 months, less than 20 months, less than 21 months, less than 22 months, less than two years, less than three years old, less than five years old or less than seven years old.

[0134] In some embodiments, a rAAV composition of the present disclosure may be used for administration to a young adult. In some embodiments, an effective amount of rAAV (in some embodiments in the form of particles) is administered to a patient that is less than 12 years old, less than 13 years old, less than 14 years old, less than 15 years old, less than 16 years old, less than 17 years old, less than 18 years old, less than 19 years old, less than 20 years old, less than 21 years old, less than 22 years old, less than 23 years old, less than 24 years old, or less than 25 years old.

[0135] In some embodiments, the viral particle for expressing a disorder-related polypeptide (e.g., FXN) may be administered through various routes as provided herein. In some embodiments, AAV administration may be either intra-CSF (intrathecal, intra-cisterna magna, or intraventricular) or intravenous.Cross-correction

[0136] Cross-correction relies on secretion of an AAV-expressed transgene from primary, transduced cells followed by uptake by secondary cells that did not take up AAV. This process can greatly increase the therapeutic footprint of a gene therapy. In some embodiments, an43MF-365376951Attorney Reference: 15979-20193.40exogenous signal peptide is added to the expression cassette from which a transgene is expressed. In some embodiments, the signal peptide and the transgene are expressed from primary transduced cells. In some embodiments, the expression of the signal peptide and transgene in the transduced cell or cells enables secretion of the transgene to secondary cells. In some embodiments, the secondary cells are untransduced, e.g., were not infected with an AAV particle.

[0137] In some aspects, the method of treatment and compositions provided herein increase the efficiency of AAV-mediated frataxin repletion by enabling cross-correction of the therapeutic transgene product. Current AAV-mediated therapeutics in pre-clinical development or clinical trials are limited by AAV biodistribution and only restore FXN protein and function to individual cells that have taken up and are expressing from the AAV vector genome. By engineering the human frataxin transgene, as described herein, secretion of frataxin from primary cells that are actively expressing the AAV vector genome as well as uptake of frataxin by secondary cells that may or may not be expressing the AAV vector genome is enabled.

[0138] In some embodiments, the methods provided herein provide an AAV vector encoding a human frataxin protein engineered for cross-correction by appending a signal peptide and cell penetrating peptide driven from a promoter. In some embodiments, the methods provided herein provide an AAV vector encoding a human frataxin protein engineered for cross-correction by appending a signal peptide and cell penetrating peptide driven from a tissue-selective promoter.

[0139] In some embodiments, a cell-penetrating peptide (CPP) is also encoded in the expression cassette. In some embodiments, the signal peptide, transgene, and CPP are encoded in the expression cassette, to facilitate uptake of the secreted protein product, a cell-penetrating peptide (CPP) that has been shown to enable uptake of recombinant and AAV-expressed proteins (see, e.g., Britti 2018 J Cell Mol Med; Vyas 2012 Hum Mol Genet).

[0140] In some instances, the genetic payload may comprise at least one additional nucleotide sequence. In some embodiments, the at least one additional nucleotide sequence may comprise a nucleotide sequence to facilitate nuclear export. In some embodiments, the at least one additional nucleotide sequence may comprise a nucleotide sequence to improve RNA stability. In some embodiments, the nucleotide sequence to improve RNA stability may comprise a polyA tail. In some embodiments, the nucleotide sequence to improve RNA stability may comprise WPRE. In44MF-365376951Attorney Reference: 15979-20193.40some embodiments, at least one additional nucleotide sequence may be configured to target expression from liver and / or DRG.

[0141] In some instances, the expression cassette may comprise at least one tagging nucleotide sequence. In some embodiments, at least one tagging nucleotide sequence may comprise FLAG, His, Myc, or any combination thereof.KITS OR ARTICLES OF MANUFACTURE

[0142] The expression cassettes (e.g., an expression cassette for expressing a disorder-related polypeptide, such as a wild type human disorder-related polypeptide), rAAV vectors, particles, and / or pharmaceutical compositions as described herein may be contained within a kit or article of manufacture, e.g., designed for use in one of the methods of the disclosure as described herein.

[0143] Generally, the system comprises a cannula, one or more syringes (e.g., 1, 2, 3, 4 or more), and one or more fluids (e.g., 1, 2, 3, 4 or more) suitable for use in the methods of the disclosure.

[0144] The syringe may be any suitable syringe, provided it is capable of being connected to the cannula for delivery of a fluid. In some embodiments, the system has one syringe. In some embodiments, the system has two syringes. In some embodiments, the system has three syringes. In some embodiments, the system has four or more syringes. The fluids suitable for use in the methods of the disclosure include those described herein, for example, one or more fluids each comprising an effective amount of one or more vectors as described herein, and one or more fluids comprising one or more therapeutic agents.

[0145] In some embodiments, the kit comprises a single fluid (e.g., a pharmaceutically acceptable fluid comprising an effective amount of the vector). In some embodiments, the kit comprises 2 fluids. In some embodiments, the kit comprises 3 fluids. In some embodiments, the kit comprises 4 or more fluids. A fluid may include a diluent, buffer, excipient, or any other liquid described herein or known in the art suitable for delivering, diluting, stabilizing, buffering, or otherwise transporting an expression cassette for expressing a disorder-related polypeptide or rAAV vector composition of the present disclosure. In some embodiments, the kit comprises one or more buffers, e.g., an aqueous pH buffered solution. Examples of buffers may include without limitation phosphate, citrate, Tris, HEPES, and other organic acid buffers.45MF-365376951Attorney Reference: 15979-20193.40

[0146] In some embodiments, the kit comprises a container. Suitable containers may include, e.g., vials, bags, syringes, and bottles. The container may be made of one or more of a material such as glass, metal, or plastic. In some embodiments, the container is used to hold a rAAV composition of the present disclosure. In some embodiments, the container may also hold a fluid and / or other therapeutic agent.

[0147] In some embodiments, the kit comprises an additional therapeutic agent with a rAAV composition of the present disclosure. In some embodiments, the rAAV composition and the additional therapeutic agent may be mixed. In some embodiments, the rAAV composition and the additional therapeutic agent may be kept separate. In some embodiments, the rAAV composition and the additional therapeutic agent may be in the same container. In some embodiments, the rAAV composition and the additional therapeutic agent may be in different containers. In some embodiments, the rAAV composition and the additional therapeutic agent may be administered simultaneously. In some embodiments, the rAAV composition and the additional therapeutic agent may be administered on the same day. In some embodiments, the rAAV composition may be administered within one day, two days, three days, four days, five days, six days, seven days, two weeks, three weeks, four weeks, two months, three months, four months, five months, or six months of administration of the additional therapeutic agent.

[0148] In some embodiments, the kit comprises a therapeutic agent to transiently suppress the immune system prior to AAV administration. In some embodiments, patients are transiently immune suppressed shortly before and after injection of the virus to inhibit the T cell response to the AAV particles (e.g., see Ferreira et al., Hum. Gene Ther. 25:180-188, 2014). In some embodiments, the kit further provides cyclosporine, mycophenolate mofetil, and / or methylprednisolone.

[0149] The rAAV particles and / or compositions of the disclosure may further be packaged into kits including instructions for use. In some embodiments, the kits further comprise a device for delivery (e.g., any type of parenteral administration described herein) of compositions of rAAV particles. In some embodiments, the instructions for use include instructions according to one of the methods described herein. In some embodiments, the instructions are printed on a label provided with (e.g., affixed to) a container. In some embodiments, the instructions for use include instructions for administering to an individual (e.g., a human) an effective amount of rAAV particles, e.g., for treating a neurodegenerative disease in an individual.46MF-365376951Attorney Reference: 15979-20193.40EXAMPLES

[0150] The invention will be more fully understood by reference to the following examples. They should not, however be construed as limiting the scope of the invention. It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modification or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended embodiments.General MethodsMouse Strains

[0151] PVFXN: Fxnflox / null::PV-Cre; JAX Stock# 029721; MCKFXN: Fxnflox / null::MCK-Cre; JAX Stock# 029720.Tissue homogenization

[0152] Tissues were homogenized with added cold lOmM Tris ImM EDTA buffer in 1.4mm ceramic bead homogenization tubes in refrigerated Omni bead ruptor - 20 second cycle 4.7 oscillation / sec. Following homogenization, aliquots were made for subsequent assay.Vector genome assessment

[0153] HT gDNA isolation: gDNA was isolated from non-human primates or mouse tissue homogenates using QIAmp 96 DNA QIAcube HT kit (Qiagen cat# 51331) according to manufacturer’s protocol. Tissue homogenates were treated with proteinase K at 56°C overnight then transferred to an S block. Samples were placed into QIAcube HT instrument for gDNA isolation with the QIAcube HT Prep Manager software. gDNA concentration was measured with NANODROP 8000 (Thermo Fisher Scientific).

[0154] Manual gDNA isolation: gDNA was isolated from select mouse tissues (DRG, Heart) using Zymo Quick-DNA / RNA Miniprep Plus Kit (cat# D7003) according to manufacturer protocol. Tissue homogenates were treated with proteinase K at room temp for 30 minutes then transferred to DNA isolation columns and centrifuged. Followed manufacturer instructions for DNA purification and elution from capture column. gDNA concentration was measured with NANODROP 8000 (Thermo Fisher Scientific).

[0155] dPCR via QIAcuity: Vector genome content was determined with dPCR via QIAcuity (QIAGEN). 1-7 mL of gDNA isolated from NHP or mouse tissue and 5 mL of master reaction mix containing probe PCR Master Mix (cat# 250103), primer-probe mixl (vector genome),47MF-365376951Attorney Reference: 15979-20193.40primer-probe mix2 (housekeeper gene), and 0.25U of Hindlll restriction enzyme was mixed in standard PCR plate and then transferred to 96-well 8.5k nanoplate (Qiagen, cat# 250021). Total reaction volume was 12 mL per well. The nanoplate was placed into QIAcuity instrument for dPCR using manufacture suggested cycling (lx [95°C for 2min], 40x[95°C for 15s, 60°C for 30 s]). Copies per mL for each gene in each sample was calculated automatically. Vector genomes per cell was calculated as vector genome copies divided by half of housekeeper gene copies. In some experiments, two primer-probe mixes targeting the vector genome were used; in these instances, the geometric mean of target copies / mL was used for downstream calculations.RNA expression analysis

[0156] HT total RNA isolation: Total RNA was isolated from NHP or mouse tissue homogenates using RNeasy 96 QiaCube HT kit (Qiagen cat# 74171) according to manufacturer’s protocol. Tissue homogenates were vortexed with Qiazol / chloroform and aqueous layers transferred to an S block. Samples were placed into QIAcube HT instrument for RNA isolation with the QIAcube HT Prep Manager software. RNA concentration was measured with NANODROP 8000 (Thermo Fisher Scientific).

[0157] Total RNA isolation via Zymo kit: Total RNA was isolated from select mouse tissues (DRG, Heart) using Zymo Quick-DNA / RNA Miniprep Plus Kit (cat# D7003) according to manufacturer protocol. Tissue homogenates were treated with proteinase K at room temp for 30 minutes then transferred to isolation columns and centrifuged. Flow-through was applied to RNA capture columns and manufacturer instructions were followed for RNA purification and elution. RNA concentration was measured with NANODROP 8000 (Thermo Fisher Scientific).

[0158] RT-dPCR via QIAcuity: RNA expression was determined with RT-dPCR via QIAcuity (QIAGEN). 1-7 mL of RNA isolated from NHP or mouse tissue and 5 mL of master reaction mix containing probe PCR Master Mix (cat# 250103), reverse transcriptase enzyme, primerprobe mixl (AAV transgene), and primer-probe mix2 (housekeeper gene) was mixed in standard PCR plate and then transferred to 96-well 8.5k nanoplate (Qiagen, cat# 250021). Total reaction volume was 12 mL per well. The nanoplate was placed into QIAcuity instrument for RT-dPCR using manufacture suggested cycling (lx [50°C for 40min], lx[95°C for 2min], 40x[95°C for 5s, 57°C for 30 s]). Copies per mL for each gene in each sample was calculated automatically. BCA Assay48MF-365376951Attorney Reference: 15979-20193.40

[0159] Total protein concentration determined by BCA (bicinchoninic acid) assay (Thermo Scientific 23227) using lOul supernatant diluted in water. Colorimetric detection of the cuprous cation (Cu1+) by bicinchoninic acid (BCA) by absorbance at 562 nm. Molecular Devices SpectraMax 340PC-384 with SoftMax Pro version 5.4.4 software was used to read 96 well microtiter plates.FXN ELISA

[0160] Measurement of FXN protein was completed using the Human FXN SimpleStep ELISA® Kit from Abeam (ab 176112). It is imperative to read the protocol insert provided with each kit lot as some reagent concentrations change with different lots, particularly the standard.

[0161] Prior to beginning, all kit components were equilibrated to room temperature (18-25°C), at least 30 minutes. An aliquot of protein-processed tissue homogenate was thawed on ice.Reagents and working standards were prepared fresh, as per kit instructions. Samples were diluted in complete cell extraction buffer. Diluted sample and standard were added to the appropriate wells, followed by antibody cocktail to each well. The plate was sealed, incubated at room temperature for 1 hour, shaking at 400 RPM. Wells were washed 3 times with wash buffer, and complete removal of liquid was ensured. TMB solution was added to each well and incubated in the dark for 15 minutes at room temperature, shaking at 400 RPM. Quickly after TMB incubation, stop solution was added to each well and mixed on a plate shaker for 1 minute. The plate was read at 450 nm on a SpectraMax plate reader (Molecular Devices) using Softmax software.Immunohistochemistry

[0162] Fixed tissue samples were embedded in paraffin and sectioned onto charged slides.Target proteins was detected in tissue sections using automated immunohistochemistry using a Leica Bond Rx Stainer and standard detection kits (red- Bond Polymer Refine Red Detection kit, Leica cat#DS9390; brown- Bond Polymer Refine Detection Kit, Leica cat# DS9800) and protocols. Antibodies for target detection included: human FXN (Abeam cat# abl 10328, dilute 1:200) and GFP (Abeam cat# abl 83734, dilute 1:500). Antibodies were diluted in Opal antibody diluent (Akoya cat# ARD1331EA). Standard IHC protocol pre-installed on Leica Bond Rx was modified to increase antibody incubation time to 30 min. Epitope retrieval was accomplished in ER1 or ER2 buffer, depending on target protein and tissue, at 95°C for 20min. Following staining completion, slides were removed from Leica Bond Rx, dehydrated in ethanol and49MF-365376951Attorney Reference: 15979-20193.40xylenes, and coverslip applied by Leica CV5030 coverslipper with Surgipath Micromount mounting medium (Leica, cat# 3801730). Images were collected using Leica Aperio AT2 brightfield slide scanner and analyzed using ImageJ (NIH).Image Analysis

[0163] Cardiac FXN repletion area in mouse: Images were analyzed in ImageJ (NIH, vl.53f51) for areas of mouse heart positive for human FXN immunoreactivity. Images were first segmented for detection of total tissue area. Then FXN signal was deconvolved from hematoxylin counterstain using three color deconvolution (FastRed, FastBlue, DAB). Area of FXN signal in five different intensity bands was measured within each tissue section. Positive FXN signal was determined as 8-bit luminance values greater than 31. Area of FXN-positive tissue slice was scaled to peripheral AAV biodistribution as vector genomes per cell within each animal and scaled values were then normalized to the median value of the group expressing WT-FXN.

[0164] Cardiac FXN repletion area in NHP: Images were analyzed in ImageJ (NIH, vl.53f51). First, FXN signal was deconvolved from hematoxylin counterstain using three color deconvolution (FastRed, FastBlue, DAB). Then, background signal was used to segment total tissue area and the image containing FXN signal was cropped to fit. FXN signal image was divided into discrete 200-pixel square regions and total signal intensity was measured in each region. Regions outside tissue were excluded based on signal intensity data from in images stained with no primary antibody. Distributions of FXN signal intensity were aligned across subjects using quantile-quantile (QQ)-analysis for quantification of FXN signal intensity in treated NHPs relative to buffer-treated subject at respective quantile bands.Simple Western blot

[0165] Protein-processed tissue homogenate was analyzed via Jess Automated Western Blot System (Bio-Techne) for analysis of human FXN protein processing in mouse and NHP tissues. Proteins were separated using the 2-40 kDa separation module (Bio-Techne cat# WM-W012) and detected using the anti-mouse detection module (Bio-Techne cat# DM-002). Total protein was quantified using the total protein detection module (Bio-Techne cat# DM-TP01) and FXN protein was detected using Abeam antibody abl 10328. RePlex module (Bio-Techne cat# RP-001) was used between FXN and total protein detection to strip primary and secondary antibodies. Data was analyzed using Compass for SW software (Bio-Techne v6.2).50MF-365376951Attorney Reference: 15979-20193.40Rotarod assay

[0166] Motor coordination of mice was assessed using the rotarod assay. For a typical single test, the mouse was placed on a rotating rod that starts at 4 rpm and increases linearly to a maximum rpm of 40 over a period of 300 seconds. Mice were assessed using the rotarod assay two consecutive days with three successive trials and with approximately one-hour inter-trial interval. The rod was cleaned between trials. Latency to fall was recorded for each mouse. Data collected from the second day was used in the analysis. At the conclusion of testing, mice were returned to their home cages. Between subjects, the rods, lanes, and floor were cleaned with 70% EtOH and sanitized with an approved agent (e.g., Virkon) at the end of the test session or between cohorts from different projects.NeuroScore assessment

[0167] Neurological score (NS) was assessed for each subject by observing the mouse under the following conditions performed sequentially: a) suspended by tail and b) freely walking in open arena. For the tail suspension test, the mouse was held approximately 1.5” from the base of the tail over the wire top of their home cage for 1-2 sec, away from the food basin, while observing the hindlimbs. Suspension test was repeated 3 times. For the walking test, the mouse was placed in a clean wean cage without shavings and allowed to freely move around cage for ~30 seconds. Following both tests, mice were scored according to the following scale: 0 = walking / behaving normally; full hindlimb extension in tail suspension test; 0.5 = normal walking; partial weakness or hindlimb trembling during tail suspension; 1 = normal walking; hindlimb clasping during tail suspension; 1.5 = Only one of conditions met for score 2; 2 = Any two conditions among the following: toes curl during walking, foot drags on cage bottom while walking, walk is unstably / wobbly (wide stance or high stepping), disturbed balance; 2.5 = Only one of conditions met for score 3; 3 = Any two conditions among the following: Staggering / erratic walk, occasional circling behavior, stargazing, tremors, head tilt, loss of spatial sense, loss of balance; 4 = Endpoint phenotype; frequently falls over, loss of control of hindlimbs, belly frequently on ground, head and tail move erratically to control balance.Example 1. Evaluating Biodistribution of AAV.SAN Virus Administered via Intra-CSF in Non-human Primates

[0168] This study was designed to evaluate biodistribution of the viral capsid AAV.SAN in the nervous system and in cardiac tissue of non-human primates (NHP). Several routes of viral51MF-365376951Attorney Reference: 15979-20193.40administration were compared, including intravenous (IV), intra-cisterna magna (ICM), and intracerebroventricular (ICV). Briefly, Cynomolgus monkeys (Macaca fascicularis) were dosed with AAV. SAN expressing GFP. Four weeks post-dosing, animals were euthanized, and samples were collected. Vector genome biodistribution was evaluated in peripheral tissue and in tissues from the central nervous system (CNS) and peripheral nervous system (PNS).Immunohistochemistry staining was used to evaluate GFP expression in cardiac tissues.

[0169] First, NHP received AAV. SAN intravenously at 2.5el3 vg / kg. IV delivery of the AAV relied on AAV diffusion into the blood stream to target peripheral tissues while retaining biodistribution in the CNS. AAV. SAN vector genome exposure (e.g., vector genome load) was quantified in the liver, heart, cerebellar cortex, cerebellar dentate, lumbar spinal cord, and lumbar dorsal root ganglion (DRG) of treated NHP. High levels of vector genomes were observed in the liver (e.g., over ten times more than other tissues) and poor distribution was observed in the cerebellar cortex and dentate nuclei (FIG. 1A and Table El). Robust biodistribution of the vector genomes was observed in samples from the heart, lumbar spinal cord, and lumbar DRG. Immunohistochemistry of GFP in heart tissue shows widespread GFP expression in cardiomyocytes, indicating that AAV. SAN can transduce primate cardiomyocytes (FIG. IB, AAV-GFP vs. buffer staining on the right).

[0170] Intra-CSF routes of viral administration were then compared to determine if intra-CSF delivery of AAV. SAN can transduce the heart and exhibit robust biodistribution in the CNS. Cynomolgus monkeys were administered AAV. SAN expressing GFP (2el3 total vg) via intracisterna magna (ICM, FIG.2A) or intra-cerebroventricular (ICV, FIG.2B) injections. Both 52MF-365376951Attorney Reference: 15979-20193.40intra-CSF routes of administration (FIGS.2A-2B) strongly increased biodistribution to the cerebellar cortex and dentate nuclei relative to intravenous administration (FIG. 1A), along with smaller increases in the spinal cord and DRG. Biodistribution to the liver was similar among all administration routes and distribution to the heart was only mildly reduced (FIGS.2A-2B). Surprisingly, with ICM administration, biodistribution to the heart and cerebellar structures, key Friedreich’s ataxia targets, was similar (Table E2). Immunohistochemistry revealed GFP expression in pockets of cardiomyocytes scattered throughout the heart (FIG.2C). These results indicate that ICM administration of AAV. SAN in NHP can enable robust, if sparse, biodistribution to the heart while maintaining an expected distribution to CNS and PNS structures.Example 2. Evaluating Biodistribution of AAV.SAN Virus Administered via Intra-CSF in Mouse

[0171] This study was designed to evaluate AAV.SAN biodistribution across different administration routes in mouse. Briefly, mice (Mus musculus) were dosed with AAV.SAN expressing GFP by one of four different intra-CSF routes of administration: intracerebroventricular (ICV), intra-cisterna magna (ICM), intrathecal (IT), and a combined ICM+IT route. For all routes, an equivalent total number of vector genomes (lei 1 total vg) was administered. At four weeks post-dosing, animals were euthanized, and tissues were collected. The vector genomes per cell were quantified in the cerebellum, spinal cord, dorsal root ganglia 53MF-365376951Attorney Reference: 15979-20193.40(DRG), and heart (FIG. 3A and Table E3). In situ hybridization (ISH) was used to visualize GFP mRNA expression in the cerebellum and cardiac tissues (FIGS. 3B-3C).

[0172] Within the brain, both ICM and ICM+IT routes (FIG.3A and Table E3) had the highest distribution to the cerebellum, greatly exceeding transduction levels observed in NHP cerebellum samples from animals that received viral constructs via ICM administration. Surprisingly, distribution to both the spinal cord and DRG was significantly lower in mouse relative to NHP across all routes of administration, with the greatest reduction seen in ICV administration samples (FIG. 3A). In heart samples, biodistribution was reduced relative to NHP (FIG.3A). In situ hybridization for GFP mRNA showed strong expression in cerebellar Purkinje neurons, granule cells, and deep cerebellar neurons (FIG.3B), as well as consistent expression in cardiomyocytes throughout the heart (FIG.3C). From these data, sufficient biodistribution of AAV to disease-relevant CNS structures in mouse with intra-CSF administration can be observed.

[0173] Together, these data indicate that AAV. SAN, when administered directly in the CSF, transduces Friedreich’s ataxia target tissues — cerebellum, DRG, and heart — in both mouse and primate models.Example 3: Evaluation of Muscle-selective Promoter Expression in Cardiomyocytes and Neurons

[0174] A muscle-selective promoter was tested to improve the lower viral biodistribution observed in the heart relative to the cerebellum and dorsal root ganglia tissue after intra-CSF54MF-365376951Attorney Reference: 15979-20193.40AAV delivery. The goal was to identify a promoter that could compensate for this biodistribution pattern and provide a more even repletion across target tissues.

[0175] Desmin is a muscle-enriched cytoskeletal protein with a well-annotated and validated promoter compatible with AAV expression. An engineered variant of the Desmin promoter (newDesmin) was developed in which a repressor element was replaced by a second copy of an enhancer element. This promoter was evaluated to test if AAV encoding newDesmin enabled efficient expression in cardiomyocytes and allowed sufficient leaky expression in neurons to provide similar levels of protein repletion at differing AAV transduction levels.

[0176] AAV. SAN viruses encoding a codon-optimized human frataxin (hFXN) transgene under the newDesmin promoter were administered via intra-CSF in mice lacking FXN expression specifically in muscle tissue (cardiac / skeletal muscle-specific Fxn mouse knockout; MCKFXN). Viruses were delivered by intrathecal administration. After delivering AAV. SAN viruses encoding newDesmin-hFXN, peripheral, CNS, and PNS tissues were collected. The mRNA and protein levels of hFXN were quantified in tissues, including the liver, heart, cerebellum, spinal cord, and DRG (e.g., refer to Table E4 for hFXN mRNA quantification corresponding to FIGS.4A-4B). The RNA expression levels of hFXN were normalized to the vector genome load (FIG.4A and FIG. 5A) or to an internal control (FIG. 4B). Lastly, immunohistochemistry staining was used to evaluate FXN expression in cerebellum and DRG samples.

[0177] MCKFXNmice injected with AAV. SAN encoding newDesmin-hFXN expressed high levels of FXN RNA, when normalized to vector genome load, in the heart (FIG.4A). Samples from the liver and cerebellum had approximately a 10-fold lower normalized expression of FXN,55MF-365376951Attorney Reference: 15979-20193.40and further decreases were observed in the spinal cord and DRG. In terms of overall hFXN RNA expression, samples from the liver and cerebellum had highest expression, with similar expression levels in the heart and DRG, and lower expression in the spinal cord (FIG.4B). Expression levels of hFXN were similar across tissue from atrium and ventricle samples (FIG.5A and Table E5). hFXN protein levels driven by the newDesmin promoter in the heart showed a robust increase from two to six weeks after treatment (FIG. 5B and Table E5). Further, hFXN mRNA expression levels under the newDesmin promoter were similar in the DRG across spinal segments (FIG.6A and Table E6) and DRG protein levels were maintained six weeks after treatment (FIG.6B and Table E7). Immunohistochemistry for hFXN revealed strong expression in cerebellar and DRG neurons (FIGS. 7A-7B). Based on these data, the newDesmin promoter was identified as a promising muscle-enriched promoter driving high levels of transgene expression in heart while also permitting repletion of the transgene in the cerebellum and DRG.56MF-365376951Attorney Reference: 15979-20193.40Example 4: Engineering hFXN for Improved Secretion and Reuptake

[0178] Cross-correction (i.e., transfer of a functional protein into other cells, including untransduced cells) of the AAV-encoded transgene relies on transgene secretion by transduced cells and subsequent uptake by untransduced cells. As endogenous FXN is rapidly localized to mitochondria due to the presence of a strong mitochondrial localization signal (MTS) in the N-terminus, the addition of an exogenous signal peptide was included to test if it could sufficiently enable secretion of FXN from transduced cells. Further, to facilitate uptake of secreted hFXN, a cell-penetrating peptide (CPP) that has been shown to enable uptake of recombinant hFXN and not interfere with mitochondrial localization was added to the transgene construct (see, e.g., Britti, et al. J Cell Mol Med. 2018 and Vyas, et al. Hum Mol Genet. 2012).

[0179] AAV. SAN encoding a codon-optimized hFXN transgene under the newDesmin promoter was administered via intra-CSF to WT C57B16 mice (lei 1 total vg). Tested AAV. SAN constructs encoded a CPP (e.g., TATk) and one of three signaling peptides (e.g., SP1, SP3, and SP5). Additionally, constructs encoding the WT-hFXN sequence were compared with constructs encoding the codon-optimized hFXN transgene. Four weeks after treatment, brain, spinal cord, and heart tissues were collected for immunohistochemistry (IHC) analysis of hFXN protein and in situ hybridization of hFXN RNA expression.

[0180] In cerebellum samples, individual cells expressing hFXN protein in the absence of hFXN RNA indicating cross-correction of hFXN protein were observed for all signaling peptides tested (FIGS. 8A-8C). In spinal cord samples, when using IHC to detect hFXN, protein was absent in samples with AAV. SAN virus encoding WT-hFXN (FIG.9A). However, in spinal cord sections from animals treated with engineered hFXN variants (FIGS. 9B-9D), hFXN in motor neurons was readily apparent. Further, cross-correction is evident as in situ hybridization (ISH) staining for hFXN RNA on consecutive sections revealed no RNA expression, indicating spread of secreted AAV-expressed hFXN to spinal cord neurons (FIG.9D).

[0181] In the heart, hFXN protein was detectable throughout the heart tissue for both WT-hFXN and engineered hFXN variants (FIGS. 10A-10B). The total area of heart sections expressing hFXN protein was quantified and an increase in cardiac hFXN signal was observed (FIG. 10C).An increase of FXN was observed by expressing an hFXN variant that is engineered to enable57MF-365376951Attorney Reference: 15979-20193.40cross-correction. The amount of FXN signal in the mouse heart increased by 1.5-2.5-fold with an intra-CSF administered AAV (FIG. IOC; quantification of FXN signal values is provided in Table E8).

[0182] To determine if engineered hFXN variants were trafficked to the mitochondria and processed, protein from mouse cerebellum was processed and capillary Western blot was performed for hFXN (FIG. 11). All viral constructs encoding CPP, signaling peptide, and engineered hFXN demonstrated some mitochondrial processing of hFXN to mature FXN.

[0183] These data demonstrate effective expression and protein processing of hFXN expressed by viral constructs encoding a cell-penetrating peptide, a signaling peptide, and hFXN transgene under a muscle-specific promoter. Further, cross-correction of hFXN can be detected in tissues of interest.Example 5: Engineered hFXN Increases Therapeutic Efficacy of AAV-FXN Therapy in Mouse

[0184] A study was performed to determine efficacy of AAV-FXN treatments in mice. AAV-FXN treatments encoding unmodified or engineered hFXN variants were directly compared in mouse models of Friedreich’s ataxia to demonstrate the increased therapeutic efficacy of crosscorrection enabled by AAV-FXN. No single mouse model can accurately replicate both the nervous system and cardiac dysfunction of Friedreich’s ataxia, thus, neuron-specific and musclespecific FXN-null mouse strains (PVFXNand MCKFXN, respectively) were used to compare the different AAV-FXN therapeutic strategies. PVFXNmice have parv albumin neuron-specific Fxn knockout and MCKFXNmice have cardiac / skeletal muscle-specific Fxn knockout. AAV. SAN58MF-365376951Attorney Reference: 15979-20193.40viruses (lei 1 vg per animal) encoding either WT-hFXN or engineered hFXN variants expressed from newDesmin promoters were administered via intra-cisterna magna (intra-CSF) dosing to PVFXNand MCKFXNmodel mice at five weeks of age.

[0185] Various assessments of ataxia phenotypes in pvFXNwere performed after treatment with AAV-FXN. PVFXNmice were treated with buffer, WT-FXN, or engineered FXN AAV treatments encoding one of three signaling peptides: SPl-TATk-FXN, SP3-TATk-FXN, or SP5-TATk-FXN. Deficits in motor coordination can be observed in the rotarod assay beginning at 12 weeks of age and progressing to 16 weeks of age (FIG. 12A, “Buffer” conditions, and Table E9). In animals treated with any of the AAV-SP-hFXN treatments, the motor coordination deficit was completely rescued at 12 weeks of age (FIG. 12A, “12 weeks”). For WT-hFXN and two of three engineered hFXN variants (e.g., AAV constructs encoding SP1 and SP5), the motor coordination deficits were also completely rescued at 16 weeks of age (FIG. 12A and Table E9).PVFXNmice also demonstrate an ataxia phenotype with stereotyped characteristics that can be easily assessed by a trained evaluator (see methods). All pvFXNanimals developed progressive ataxia during the study duration and all AAV-FXN treatments significantly reduced the overall severity of ataxia (FIG. 12B and Table E10). hFXN protein levels were quantified in cerebellum and lumbar DRG of treated mice. Similar repletion of hFXN protein was detected across all treatment groups (FIG. 12C and Table Ell). These data demonstrate that in tissues where FXN repletion is high due to strong biodistribution and expression, cross-correction neither does not change therapeutic efficacy.59MF-365376951Attorney Reference: 15979-20193.40

[0186] In MCKFXNmice, cardiac dysfunction leads to a reduced lifespan (FIG. 13A, “Buffer”). Treatment with AAV encoding WT-hFXN was insufficient to significantly prolong lifespan in this model (FIG. 13A, “WT-FXN”), but treatment with AAV encoding two of three engineered hFXN variants significantly increased lifespan (FIG. 13A, AAV constructs with SP1-FXN and SP5-FXN). Quantification of survival probability of data in FIG. 13A is included in Table E12 below. hFXN protein expression in the heart and liver of treated animals was also quantified and similar expression levels across groups within each tissue were detected (FIG. 13B). Protein expression in heart samples was notably lower than in liver, cerebellum, or DRG samples (FIG.12C, FIG. 13B, and Table E13), which indicates that in tissues where protein expression is low, cross-correction can compensate for low biodistribution.60MF-365376951Attorney Reference: 15979-20193.40Example 6: Cross-correction Evaluation of Engineered hFXN AAV Therapy in Nonhuman Primates (NHPs)

[0187] In this example, a study was performed to determine efficacy and clinical applicability of AAV-FXN treatments enabling cross-correction in non-human primates (NHPs). AAV. SAN vectors encoding SPl-TATk-FXN and SP3-TATk-FXN under the newDesmin promoter were tested. AAV-FXN treatments were administered via intra-cisterna magna (ICM) injection (1.5el3 total vg) to cynomolgus monkeys.

[0188] AAV treatment was well tolerated, with no clinical signs observed over the course of the 6-week period. Vector genomes per cell were quantification in several NHP tissues, including the brain, spinal cord, DRG, heart, muscle, and peripheral tissue. Biodistribution of AAV. SAN was highest in the liver, DRG, and spinal cord for both AAV-FXN treatments (FIG. 14A and Table E14; purple dots reflect tissues of particular interest for Friedreich’s ataxia). There was low, but detectable distribution to heart and skeletal muscles for both treat as well (FIG. 14A) Each point represents an individual tissue punch with n=l NHP per group. The vector genome biodistribution and FXN RNA expression in the several tissues was compared. Expression of 61MF-365376951Attorney Reference: 15979-20193.40hFXN RNA was linearly correlated with vector genome biodistribution, and the heart showed high expression with low vector genome copies (FIG. 14B; purple dots show heart tissue with strongly increased expression per vector genome due to the newDesmin promoter). The linear fit parameters for FIG. 14B are slope = 0.048, T-value = 13.1, p-value< 2el6, and intercept = -0.030, T-value = -1.44, p-value = 0.153.

[0189] Further, cyno-specific RT-dPCR primers and probes were also used to quantify expression of endogenous FXN (cynoFXN). Expression of hFXN was compared with tissuespecific levels of cynoFXN expression for AAV-SP1-FXN and AAV-SP3-FXN treatments (FIG. 15 and Table E15). Each point represents an individual tissue punch with n=l NHP per group and purple dots reflect tissues of particular interest for Friedreich’s ataxia. The dashed grey line shows the endogenous expression level of cynoFXN per tissue (FIG. 15 and Table E15). Toxicities related to FXN overexpression in the heart and liver have been observed at greater than 9-fold overexpression (see, e.g., Belbellaa, et al. Mol Ther Methods Clin Dev. 2020 and Huichalaf, et al. Mol Ther Methods Clin Dev. 2022) and expression quantified in these samples was well below levels reported for toxicity.62MF-365376951Attorney Reference: 15979-20193.40

[0190] Immunohistochemistry was used to evaluate hFXN protein distribution in the heart. hFXN antibodies detected cynoFXN protein in heart sections from buffer treated subjects (FIG.16A). However, an increase in FXN signal in heart tissue from A AV-treated animals relative to a buffer-treated animal was observed (FIGS. 16B-16C). FXN protein signal was quantified in 2-3 representative sections from six heart regions: left / right ventricle, left / right atrium, apex, and the interventricular septum. To quantify the increase in FXN signal, images of the six heart regions were divided into discrete segments encompassing about five to seven cardiomyocytes and FXN signal was measured in each segment (FIG. 17A). Each image was divided into discrete segments encompassing ~5-7 cardiomyocytes (see methods) and each dot reflects an individual segment. A quantile-quantile analysis was used to align FXN intensity distributions from each subject and quantify the percentage of cardiac area that exhibited an increase in FXN signal (FIG. 17B) Each distribution was divided into 100 quantiles and the quantile intensity was scaled to the quantile intensity for the buffer-treated animal. Thresholds of 30% and 60% increases in FXN signal were identified as clinically relevant for reducing or eliminating symptoms, respectively (FIG. 17B, vertical lines represent FXN signal intensity of 30% and 60% above the signal intensity of buffer-treated animals, quantified in Table E16). 40-60% of the heart expressed at a least a 60% increase in FXN protein and >85% of the heart expressed at 63MF-365376951Attorney Reference: 15979-20193.40least a 30% increase. To verify that this protein is likely to be functional, capillary Western blot was performed and the processing of AAV-expressed hFXN in heart was evaluated (FIG. 18).Only mature hFXN was present, indicating successful mitochondrial localization and cleavage (FIG. 18, “mature”). Together, these data demonstrate clinically meaningful repletion of hFXN in the NHP heart via intra-CSF administration of an AAV that enables cross-correction.64MF-365376951Attorney Reference: 15979-20193.40SEQUENCES65MF-365376951Attorney Reference: 15979-20193.4066MF-365376951Attorney Reference: 15979-20193.4067MF-365376951Attorney Reference: 15979-20193.4068MF-365376951Attorney Reference: 15979-20193.4069MF-365376951Attorney Reference: 15979-20193.4070MF-365376951Attorney Reference: 15979-20193.4071MF-365376951Attorney Reference: 15979-20193.4072MF-365376951Attorney Reference: 15979-20193.4073MF-365376951Attorney Reference: 15979-20193.4074MF-365376951

Claims

1. Attorney Reference: 15979-20193.40CLAIMSWhat is claimed is:

1. A polynucleotide construct comprising an expression cassette encoding:a) a signal peptide, andb) a Frataxin (FXN) protein.

2. The polynucleotide construct of claim 1, wherein the expression cassette encodes in order from N-terminus to C-terminus the signal peptide and the FXN protein.

3. The polynucleotide construct of claim 1 or 2, wherein the expression cassette comprises a gene encoding from 5’ to 3’ the signal peptide and the FXN protein, wherein the gene is operably linked to a promoter.

4. The polynucleotide construct of any one of claims 1 to 3, wherein the promoter is a tissue-specific promoter.

5. The polynucleotide construct of claim 4, wherein the tissue-specific promoter is a muscle- specific promoter.

6. The polynucleotide construct of claim 5, wherein the muscle- specific promoter is a human desmin promoter.

7. The polynucleotide construct of claim 6, wherein the human desmin promoter comprises a nucleotide sequence of SEQ ID NO: 11.

8. The polynucleotide construct of claim 6, wherein the human desmin promoter comprises a nucleotide sequence with at least 90% homology to the nucleotide sequence of SEQ ID NO: 11.

9. The polynucleotide construct of any one of claims 1 to 8, wherein the expression cassette comprises a gene encoding the signal peptide, wherein the signal peptide is encoded by a nucleotide sequence selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 5, and SEQ ID NO: 7.

10. The polynucleotide construct of claim 9, wherein the signal peptide is encoded by a nucleotide sequence of SEQ ID NO: 3.

11. The polynucleotide construct of claim 9, wherein the signal peptide is encoded by a nucleotide sequence with at least 90% homology to the nucleotide sequence of SEQ ID NO: 3.75MF-365376951Attorney Reference: 15979-20193.4012. The polynucleotide construct of claim 9, wherein the signal peptide is encoded by a nucleotide sequence of SEQ ID NO: 5.

13. The polynucleotide construct of claim 9, wherein the signal peptide is encoded by a nucleotide sequence with at least 90% homology to the nucleotide sequence of SEQ ID NO: 5.

14. The polynucleotide construct of claim 9, wherein the signal peptide is encoded by a nucleotide sequence of SEQ ID NO: 7.

15. The polynucleotide construct of claim 9, wherein the signal peptide is encoded by a nucleotide sequence with at least 90% homology to the nucleotide sequence of SEQ ID NO: 7.

16. The polynucleotide construct of any one of claims 1 to 15, wherein the signal peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 4, SEQ ID NO: 6, and SEQ ID NO: 8.

17. The polynucleotide construct of claim 16, wherein the signal peptide comprises an amino acid sequence of SEQ ID NO: 4.

18. The polynucleotide construct of claim 16, wherein the signal peptide comprises an amino acid sequence with at least 90% homology to the amino acid sequence of SEQ ID NO: 4.

19. The polynucleotide construct of claim 16, wherein the signal peptide comprises an amino acid sequence of SEQ ID NO: 6.

20. The polynucleotide construct of claim 16, wherein the signal peptide comprises an amino acid sequence with at least 90% homology to the amino sequence of SEQ ID NO:

6.

21. The polynucleotide construct of claim 16, wherein the signal peptide comprises an amino acid sequence of SEQ ID NO: 8.

22. The polynucleotide construct of claim 16, wherein the signal peptide comprises an amino acid sequence with at least 90% homology to the amino sequence of SEQ ID NO:

8.

23. The polynucleotide construct of any one of claims 1 to 22, wherein the expression cassette comprises a gene encoding the FXN protein, wherein the FXN protein is encoded by a nucleotide sequence of SEQ ID NO: 2.

24. The polynucleotide construct of any one of claims 1 to 22, wherein the expression cassette comprises a gene encoding the FXN protein, wherein the FXN protein is encoded76MF-365376951Attorney Reference: 15979-20193.40by a nucleotide sequence with at least 90% homology to the nucleotide sequence of SEQ ID NO: 2.

25. The polynucleotide construct of any one of claims 1 to 22, wherein the FXN protein comprises an amino acid sequence of SEQ ID NO: 1.

26. The polynucleotide construct of any one of claims 1 to 22, wherein the expression cassette comprises a gene encoding the FXN protein, wherein the FXN protein is encoded by a nucleotide sequence with at least 90% homology to the nucleotide sequence of SEQ ID NO: 1.

27. The polynucleotide construct of claim 1, wherein the expression cassette encodes in order from N-terminus to C-terminus the signal peptide comprising an amino acid sequence of SEQ ID NO: 4, and the FXN protein comprising an amino acid sequence of SEQ ID NO: 1.

28. The polynucleotide construct of claim 1, wherein the expression cassette encodes in order from N-terminus to C-terminus the signal peptide comprising an amino acid sequence with at least 90% homology to the amino acid sequence of SEQ ID NO: 4, and the FXN protein comprising an amino acid sequence with at least 90% homology to the amino acid sequence of SEQ ID NO: 1.

29. The polynucleotide construct of claim 1, wherein the expression cassette encodes in order from N-terminus to C-terminus the signal peptide comprising an amino acid sequence with at least 80% homology to the amino acid sequence of SEQ ID NO: 4, and the FXN protein comprising an amino acid sequence with at least 80% homology to the amino acid sequence of SEQ ID NO: 1.

30. The polynucleotide construct of claim 1, wherein the expression cassette encodes in order from N-terminus to C-terminus the signal peptide comprising an amino acid sequence of SEQ ID NO: 6, and the FXN protein comprising an amino acid sequence of SEQ ID NO: 1.

31. The polynucleotide construct of claim 1, wherein the expression cassette encodes in order from N-terminus to C-terminus the signal peptide comprising an amino acid sequence with at least 90% homology to the amino acid sequence of SEQ ID NO: 6, and the FXN protein comprising an amino acid sequence with at least 90% homology to the amino acid sequence of SEQ ID NO: 1.77MF-365376951Attorney Reference: 15979-20193.4032. The polynucleotide construct of claim 1, wherein the expression cassette encodes in order from N-terminus to C-terminus the signal peptide comprising an amino acid sequence with at least 80% homology to the amino acid sequence of SEQ ID NO: 6, and the FXN protein comprising an amino acid sequence with at least 80% homology to the amino acid sequence of SEQ ID NO: 1.

33. The polynucleotide construct of claim 1, wherein the expression cassette encodes in order from N-terminus to C-terminus the signal peptide comprising an amino acid sequence of SEQ ID NO: 8, and the FXN protein comprising an amino acid sequence of SEQ ID NO: 1.

34. The polynucleotide construct of claim 1, wherein the expression cassette encodes in order from N-terminus to C-terminus the signal peptide comprising an amino acid sequence with at least 90% homology to the amino acid sequence of SEQ ID NO: 8, and the FXN protein comprising an amino acid sequence with at least 90% homology to the amino acid sequence of SEQ ID NO: 1.

35. The polynucleotide construct of claim 1, wherein the expression cassette encodes in order from N-terminus to C-terminus the signal peptide comprising an amino acid sequence with at least 80% homology to the amino acid sequence of SEQ ID NO: 8, and the FXN protein comprising an amino acid sequence with at least 80% homology to the amino acid sequence of SEQ ID NO: 1.

36. The polynucleotide construct of any one of claims 1 to 35, wherein the gene encoding the FXN protein is a codon-optimized gene.

37. A polynucleotide construct comprising an expression cassette encoding:a) a signal peptide,b) a Frataxin (FXN) protein, andc) a cell-penetrating peptide (CPP).

38. The polynucleotide construct of claim 37, wherein the expression cassette encodes in order from N-terminus to C-terminus the signal peptide, the FXN protein, and the CPP.

39. The polynucleotide construct of claim 37, wherein the expression cassette encodes in order from N-terminus to C-terminus the signal peptide, the CPP, and the FXN protein.78MF-365376951Attorney Reference: 15979-20193.4040. The polynucleotide construct of any one of claims 37 to 39, wherein the expression cassette comprises a gene encoding from 5’ to 3’ the signal peptide and the FXN protein, wherein the gene is operably linked to a promoter.

41. The polynucleotide construct of any one of claims 37 to 40, wherein the promoter is a tissue-specific promoter.

42. The polynucleotide construct of claim 41, wherein the tissue-specific promoter is a muscle- specific promoter.

43. The polynucleotide construct of claim 42, wherein the muscle-specific promoter is a human desmin promoter.

44. The polynucleotide construct of claim 43, wherein the human desmin promoter comprises a nucleotide sequence of SEQ ID NO: 11.

45. The polynucleotide construct of claim 43, wherein the human desmin promoter comprises a nucleotide sequence with at least 90% homology to the nucleotide sequence of SEQ ID NO: 11.

46. The polynucleotide construct of any one of claims 37 to 45, wherein the expression cassette comprises a gene encoding the signal peptide, wherein the signal peptide is encoded by a nucleotide sequence selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 5, and SEQ ID NO: 7.

47. The polynucleotide construct of claim 46, wherein the signal peptide is encoded by a nucleotide sequence of SEQ ID NO: 3.

48. The polynucleotide construct of claim 46, wherein the signal peptide is encoded by a nucleotide sequence with at least 90% homology to the nucleotide sequence of SEQ ID NO: 3.

49. The polynucleotide construct of claim 46, wherein the signal peptide is encoded by a nucleotide sequence of SEQ ID NO: 5.

50. The polynucleotide construct of claim 46, wherein the signal peptide is encoded by a nucleotide sequence with at least 90% homology to the nucleotide sequence of SEQ ID NO: 5.

51. The polynucleotide construct of any one of claims 37 to 50, wherein the signal peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 4, SEQ ID NO: 6, and SEQ ID NO: 8.79MF-365376951Attorney Reference: 15979-20193.4052. The polynucleotide construct of claim 51, wherein the signal peptide comprises an amino acid sequence of SEQ ID NO: 4.

53. The polynucleotide construct of claim 51, wherein the signal peptide comprises an amino acid sequence with at least 90% homology to the amino acid sequence of SEQ ID NO: 4.

54. The polynucleotide construct of claim 51, wherein the signal peptide comprises an amino acid sequence of SEQ ID NO: 6.

55. The polynucleotide construct of claim 51, wherein the signal peptide comprises an amino acid sequence with at least 90% homology to the amino sequence of SEQ ID NO:

6.

56. The polynucleotide construct of any one of claims 37 to 55, wherein the expression cassette comprises a gene encoding the CPP, wherein the CPP is encoded by a nucleotide sequence of SEQ ID NO: 10.

57. The polynucleotide construct of any one of claims 37 to 56, wherein the expression cassette comprises a gene encoding the CPP, wherein the CPP is encoded by a nucleotide sequence with at least 90% homology to the nucleotide sequence of SEQ ID NO:

10.

58. The polynucleotide construct of any one of claims 37 to 57, wherein the CPP comprises an amino sequence of SEQ ID NO: 9.

59. The polynucleotide construct of any one of claims 37 to 57, wherein the CPP comprises an amino sequence with at least 90% homology to the amino acid sequence of SEQ ID NO: 9.

60. The polynucleotide construct of any one of claims 37 to 59, wherein the expression cassette comprises a gene encoding the FXN protein, wherein the FXN protein is encoded by a nucleotide sequence of SEQ ID NO: 2.

61. The polynucleotide construct of any one of claims 37 to 59, wherein the expression cassette comprises a gene encoding the FXN protein, wherein the FXN protein is encoded by a nucleotide sequence with at least 90% homology to the nucleotide sequence of SEQ ID NO: 2.

62. The polynucleotide construct of any one of claims 37 to 61, wherein the FXN protein comprises an amino acid sequence of SEQ ID NO: 1.

63. The polynucleotide construct of any one of claims 37 to 61, wherein the expression cassette comprises a gene encoding the FXN protein, wherein the FXN protein is encoded80MF-365376951Attorney Reference: 15979-20193.40by a nucleotide sequence with at least 90% homology to the nucleotide sequence of SEQ ID NO: 1.

64. The polynucleotide construct of claim 37, wherein the expression cassette encodes in order from N-terminus to C-terminus the signal peptide comprising an amino acid sequence of SEQ ID NO: 4, the FXN protein comprising an amino acid sequence of SEQ ID NO: 1, and the CPP comprising an amino acid sequence of SEQ ID NO: 9.

65. The polynucleotide construct of claim 37, wherein the expression cassette encodes in order from N-terminus to C-terminus the signal peptide comprising an amino acid sequence with at least 90% homology to the amino acid sequence of SEQ ID NO: 4, the FXN protein comprising an amino acid sequence with at least 90% homology to the amino acid sequence of SEQ ID NO: 1, and the CPP comprising an amino acid sequence with at least 90% homology to the amino acid sequence of SEQ ID NO: 9.

66. The polynucleotide construct of claim 37, wherein the expression cassette encodes in order from N-terminus to C-terminus the signal peptide comprising an amino acid sequence with at least 80% homology to the amino acid sequence of SEQ ID NO: 4, the FXN protein comprising an amino acid sequence with at least 80% homology to the amino acid sequence of SEQ ID NO: 1, and the CPP comprising an amino acid sequence with at least 90% homology to the amino acid sequence of SEQ ID NO: 9.

67. The polynucleotide construct of claim 37, wherein the expression cassette encodes in order from N-terminus to C-terminus the signal peptide comprising an amino acid sequence of SEQ ID NO: 6, the FXN protein comprising an amino acid sequence of SEQ ID NO: 1, and the CPP comprising an amino acid sequence of SEQ ID NO: 9.

68. The polynucleotide construct of claim 37, wherein the expression cassette encodes in order from N-terminus to C-terminus the signal peptide comprising an amino acid sequence with at least 90% homology to the amino acid sequence of SEQ ID NO: 6, the FXN protein comprising an amino acid sequence with at least 90% homology to the amino acid sequence of SEQ ID NO: 1, and the CPP comprising an amino acid sequence with at least 90% homology to the amino acid sequence of SEQ ID NO: 9.

69. The polynucleotide construct of claim 37, wherein the expression cassette encodes in order from N-terminus to C-terminus the signal peptide comprising an amino acid sequence with at least 80% homology to the amino acid sequence of SEQ ID NO: 6, the81MF-365376951Attorney Reference: 15979-20193.40FXN protein comprising an amino acid sequence with at least 80% homology to the amino acid sequence of SEQ ID NO: 1, and the CPP comprising an amino acid sequence with at least 90% homology to the amino acid sequence of SEQ ID NO: 9.

70. The polynucleotide construct of claim 37, wherein the expression cassette encodes in order from N-terminus to C-terminus the signal peptide comprising an amino acid sequence of SEQ ID NO: 8, the FXN protein comprising an amino acid sequence of SEQ ID NO: 1, and the CPP comprising an amino acid sequence of SEQ ID NO: 9.

71. The polynucleotide construct of claim 37, wherein the expression cassette encodes in order from N-terminus to C-terminus the signal peptide comprising an amino acid sequence with at least 90% homology to the amino acid sequence of SEQ ID NO: 8, the FXN protein comprising an amino acid sequence with at least 90% homology to the amino acid sequence of SEQ ID NO: 1, and the CPP comprising an amino acid sequence with at least 90% homology to the amino acid sequence of SEQ ID NO: 9.

72. The polynucleotide construct of claim 37, wherein the expression cassette encodes in order from N-terminus to C-terminus the signal peptide comprising an amino acid sequence with at least 80% homology to the amino acid sequence of SEQ ID NO: 8, the FXN protein comprising an amino acid sequence with at least 80% homology to the amino acid sequence of SEQ ID NO: 1, and the CPP comprising an amino acid sequence with at least 90% homology to the amino acid sequence of SEQ ID NO: 9.

73. The polynucleotide construct of any one of claims 33 to 72, wherein the gene encoding the FXN protein is a codon-optimized gene.

74. A recombinant adeno-associated virus (rAAV) particle comprising: (1) a rAAV vector comprising an expression cassette encoding: a) a signal peptide, and b) a Frataxin (FXN) protein, wherein the expression cassette is operably linked to a promoter, and (2) a capsid protein.

75. The rAAV particle of claim 74, wherein the expression cassette encodes in order from N- terminus to C-terminus the signal peptide and the FXN protein.

76. The rAAV particle of claim 74 or claim 75, wherein the promoter is a tissue-specific promoter.

77. The rAAV particle of claim 76, wherein the tissue-specific promoter is a muscle-specific promoter.82MF-365376951Attorney Reference: 15979-20193.4078. The rAAV particle of claim 77, wherein the muscle-specific promoter is a human desmin promoter.

79. The rAAV particle of claim 78, wherein the human desmin promoter comprises a nucleotide sequence of SEQ ID NO: 11.

80. The rAAV particle of claim 78, wherein the human desmin promoter comprises a nucleotide sequence with at least 90% homology to the nucleotide sequence of SEQ ID NO: 11.

81. The rAAV particle of any one of claims 74 to 80, wherein the expression cassette comprises a gene encoding the signal peptide, wherein the signal peptide is encoded by a nucleotide sequence selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 5, and SEQ ID NO: 7.

82. The rAAV particle of any one of claims 74 to 81, wherein the signal peptide is encoded by a nucleotide sequence of SEQ ID NO: 3.

83. The rAAV particle of any one of claims 74 to 81, wherein the signal peptide is encoded by a nucleotide sequence with at least 90% homology to the nucleotide sequence of SEQ ID NO: 3.

84. The rAAV particle of any one of claims 74 to 81, wherein the signal peptide is encoded by a nucleotide sequence of SEQ ID NO: 5.

85. The rAAV particle of any one of claims 74 to 81, wherein the signal peptide is encoded by a nucleotide sequence with at least 90% homology to the nucleotide sequence of SEQ ID NO: 5.

86. The rAAV particle of any one of claims 74 to 81, wherein the signal peptide is encoded by a nucleotide sequence of SEQ ID NO: 7.

87. The rAAV particle of any one of claims 74 to 81, wherein the signal peptide is encoded by a nucleotide sequence with at least 90% homology to the nucleotide sequence of SEQ ID NO: 7.

88. The rAAV particle of any one of claims 74 to 87, wherein the expression cassette comprises a gene encoding the FXN protein, wherein the FXN protein is encoded by a nucleotide sequence of SEQ ID NO: 2.

89. The rAAV particle of any one of claims 74 to 87, wherein the expression cassette comprises a gene encoding the FXN protein, wherein the FXN protein is encoded by a83MF-365376951Attorney Reference: 15979-20193.40nucleotide sequence with at least 90% homology to the nucleotide sequence of SEQ ID NO: 2.

90. The rAAV particle of any one of claims 74 to 89, wherein the FXN protein comprises an amino acid sequence of SEQ ID NO: 1.

91. The rAAV particle of any one of claims 74 to 89, wherein the expression cassette comprises a gene encoding the FXN protein, wherein the FXN protein is encoded by a nucleotide sequence with at least 90% homology to the nucleotide sequence of SEQ ID NO: 1.

92. The rAAV particle of any one of claims 74 to 91, wherein the capsid protein is a braintargeting capsid protein, allowing for transduction of one or more cells in a central nervous system (CNS).

93. The rAAV particle of claim 92, wherein the capsid protein comprises an AAV serotype.

94. The rAAV particle of claim 93, wherein the AAV serotype is 1, 2, 5, 8, 9, or recombinant human (rh)10.

95. The rAAV particle of any one of claims 74 to 94, wherein the capsid protein is a modified capsid protein.

96. The rAAV particle of claim 95, wherein the modified capsid protein comprises SEQ ID NO: 12.

97. The rAAV particle of claim 95 or claim 96, wherein the modified capsid protein has a sequence that is at least 98.5% identical to SEQ ID NO: 12.

98. The rAAV particle of any one of claims 74 to 97, wherein the rAAV vector comprises a 5’ AAV2 ITR of SEQ ID NO: 19 and a 3’ AAV2 ITR of SEQ ID NO: 20.

99. The rAAV particle of any one of claims 74 to 98, wherein the expression cassette comprises a CMV enhancer element comprising SEQ ID NO: 21.

100. The rAAV particle of any one of claims 74 to 99, wherein the expression cassette comprises a chicken b-actin promoter comprising SEQ ID NO: 22.

101. The rAAV particle of any one of claims 74 to 100, wherein the rAAV vector further comprises a WPRE element.

102. The rAAV particle of claim 101, wherein the WPRE element comprises a sequence of SEQ ID NO: 23.84MF-365376951Attorney Reference: 15979-20193.40103. The rAAV particle of any one of claims 74 to 102, wherein the rAAV vector comprises a sequence of SEQ ID NOS: 14, 15, and 16.

104. A recombinant adeno-associated virus (rAAV) particle comprising: a rAAV vector comprising an expression cassette encoding: a) a signal peptide, b) a Frataxin (FXN) protein, and c) a cell-penetrating peptide (CPP), wherein the expression cassette is operably linked to a promoter, and (2) a capsid protein.

105. The rAAV particle of claim 104, wherein the expression cassette encodes in order from N-terminus to C-terminus the signal peptide, the FXN protein, and the CPP.

106. The rAAV particle of claim 104, wherein the expression cassette encodes in order from N-terminus to C-terminus the signal peptide, the CPP, and the FXN protein.

107. The rAAV particle of any one of claims 104 to 106, wherein the promoter is a tissuespecific promoter.

108. The rAAV particle of claim 107, wherein the tissue-specific promoter is a musclespecific promoter.

109. The rAAV particle of claim 108, wherein the muscle-specific promoter is a human desmin promoter.

110. The rAAV particle of claim 109, wherein the human desmin promoter comprises a nucleotide sequence of SEQ ID NO: 11.

111. The rAAV particle of claim 109, wherein the human desmin promoter comprises a nucleotide sequence with at least 90% homology to the nucleotide sequence of SEQ ID NO: 11.

112. The rAAV particle of any one of claims 104 to 111, wherein the expression cassette comprises a gene encoding the signal peptide, wherein the signal peptide is encoded by a nucleotide sequence selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 5, and SEQ ID NO: 7.

113. The rAAV particle of any one of claims 104 to 111, wherein the signal peptide is encoded by a nucleotide sequence of SEQ ID NO: 3.

114. The rAAV particle of any one of claims 104 to 111, wherein the signal peptide is encoded by a nucleotide sequence with at least 90% homology to the nucleotide sequence of SEQ ID NO: 3.85MF-365376951Attorney Reference: 15979-20193.40115. The rAAV particle of any one of claims 104 to 111, wherein the signal peptide is encoded by a nucleotide sequence of SEQ ID NO: 5.

116. The rAAV particle of any one of claims 104 to 111, wherein the signal peptide is encoded by a nucleotide sequence with at least 90% homology to the nucleotide sequence of SEQ ID NO: 5.

117. The rAAV particle of any one of claims 104 to 111, wherein the signal peptide is encoded by a nucleotide sequence of SEQ ID NO: 7.

118. The rAAV particle of any one of claims 104 to 111, wherein the signal peptide is encoded by a nucleotide sequence with at least 90% homology to the nucleotide sequence of SEQ ID NO: 7.

119. The rAAV particle of any one of claims 104 to 118, wherein the expression cassette comprises a gene encoding the CPP, wherein the CPP is encoded by a nucleotide sequence of SEQ ID NO: 10.

120. The rAAV particle of any one of claims 104 to 118, wherein the expression cassette comprises a gene encoding the CPP, wherein the CPP is encoded by a nucleotide sequence with at least 90% homology to the nucleotide sequence of SEQ ID NO:

10.

121. The rAAV particle of any one of claims 104 to 118, wherein the CPP comprises an amino sequence of SEQ ID NO: 9.

122. The rAAV particle of any one of claims 104 to 118, wherein the CPP comprises an amino sequence with at least 90% homology to the amino acid sequence of SEQ ID NO: 9.

123. The rAAV particle of any one of claims 104 to 122, wherein the expression cassette comprises a gene encoding the FXN protein, wherein the FXN protein is encoded by a nucleotide sequence of SEQ ID NO: 2.

124. The rAAV particle of any one of claims 104 to 123, wherein the expression cassette comprises a gene encoding the FXN protein, wherein the FXN protein is encoded by a nucleotide sequence with at least 90% homology to the nucleotide sequence of SEQ ID NO: 2.

125. The rAAV particle of any one of claims 104 to 124, wherein the FXN protein comprises an amino acid sequence of SEQ ID NO: 1.86MF-365376951Attorney Reference: 15979-20193.40126. The rAAV particle of any one of claims 104 to 124, wherein the expression cassette comprises a gene encoding the FXN protein, wherein the FXN protein is encoded by a nucleotide sequence with at least 90% homology to the nucleotide sequence of SEQ ID NO: 1.

127. The rAAV particle of claim 104, wherein the expression cassette encodes in order from N-terminus to C-terminus the signal peptide comprising an amino acid sequence of SEQ ID NO: 4, the FXN protein comprising an amino acid sequence of SEQ ID NO: 1, and the CPP comprising an amino acid sequence of SEQ ID NO: 9.

128. The rAAV particle of claim 104, wherein the expression cassette encodes in order from N-terminus to C-terminus the signal peptide comprising an amino acid sequence with at least 90% homology to the amino acid sequence of SEQ ID NO: 4, the FXN protein comprising an amino acid sequence with at least 90% homology to the amino acid sequence of SEQ ID NO: 1, and the CPP comprising an amino acid sequence with at least 90% homology to the amino acid sequence of SEQ ID NO: 9.

129. The rAAV particle of claim 104, wherein the expression cassette encodes in order from N-terminus to C-terminus the signal peptide comprising an amino acid sequence with at least 80% homology to the amino acid sequence of SEQ ID NO: 4, the FXN protein comprising an amino acid sequence with at least 80% homology to the amino acid sequence of SEQ ID NO: 1, and the CPP comprising an amino acid sequence with at least 90% homology to the amino acid sequence of SEQ ID NO: 9.

130. The rAAV particle of claim 104, wherein the expression cassette encodes in order from N-terminus to C-terminus the signal peptide comprising an amino acid sequence of SEQ ID NO: 6, the FXN protein comprising an amino acid sequence of SEQ ID NO: 1, and the CPP comprising an amino acid sequence of SEQ ID NO: 9.

131. The rAAV particle of any one of claims 104 to 130, wherein the capsid protein is a brain-targeting capsid protein, allowing for transduction of one or more cell in a central nervous system (CNS).

132. The rAAV particle of claim 104, wherein the capsid protein comprises an AAV serotype.

133. The rAAV particle of claim 132, wherein the AAV serotype is 1, 2, 5, 8, 9, or recombinant human (rh)10.87MF-365376951Attorney Reference: 15979-20193.40134. The rAAV particle of any one of claims 104 to 133, wherein the capsid protein is a modified capsid protein.

135. The rAAV particle of claim 134, wherein the modified capsid protein comprises SEQ ID NO: 12.

136. The rAAV particle of claim 134 or claim 135, wherein the modified capsid protein has a sequence that is at least 98.5% identical to SEQ ID NO: 12.

137. The rAAV particle of any one of claims 104 to 136, wherein the rAAV vector comprises a 5’ AAV2 ITR of SEQ ID NO: 19 and a 3’ AAV2 ITR of SEQ ID NO: 20.

138. The rAAV particle of any one of claims 104 to 137, wherein the expression cassette comprises a CMV enhancer element comprising SEQ ID NO: 21.

139. The rAAV particle of any one of claims 104 to 138, wherein the expression cassette comprises a chicken b-actin promoter comprising SEQ ID NO: 22.

140. The rAAV particle of any one of claims 104 to 139, wherein the rAAV vector further comprises a WPRE element.

141. The rAAV particle of claim 140, wherein the WPRE element comprises a sequence of SEQ ID NO: 23.

142. The rAAV particle of any one of claims 104 to 141, wherein the rAAV vector comprises a sequence of SEQ ID NO: 14, 15, and 16.

143. A recombinant adeno-associated virus (rAAV) particle comprising: (1) a rAAV vector comprising an expression cassette encoding: a) a signal peptide, b) a Frataxin (FXN) protein, and c) a cell-penetrating peptide (CPP), wherein the expression cassette is operably linked to a promoter, and (2) a modified AAV9 capsid protein.

144. The rAAV particle of claim 143, wherein the modified capsid protein comprises a sequence that is at least 98.5% identical to SEQ ID NO: 12.

145. The rAAV particle of claim 143, wherein the modified capsid protein comprises SEQ ID NO: 12.

146. A recombinant adeno-associated virus (rAAV) particle comprising: (1) a rAAV vector comprising an expression cassette encoding: a) a signal peptide, b) a Frataxin (FXN) protein, and c) a cell-penetrating peptide (CPP), wherein the expression cassette is operably linked to a promoter, and (2) a modified AAV9 capsid protein comprising a targeting peptide comprising SEQ ID NO: 17.88MF-365376951Attorney Reference: 15979-20193.40147. The rAAV particle of claim 146, wherein the targeting peptide is flanked by linker sequences on its N-terminal end and the C-terminal end.

148. The rAAV particle of claim 146, wherein the combined targeting peptide and linker sequences comprise SEQ ID NO: 18.

149. A recombinant adeno-associated virus (rAAV) particle comprising: (1) a rAAV vector comprising an expression cassette encoding: a) a Frataxin (FXN) protein, wherein the expression cassette is operably linked to a promoter, and (2) a modified AAV9 capsid protein.

150. The rAAV particle of claim 149, wherein the modified capsid protein comprises a sequence that is at least 98.5% identical to SEQ ID NO: 12.

151. The rAAV particle of claim 149, wherein the modified capsid protein comprises SEQ ID NO: 12.

152. The rAAV particle of any one of claims 149 to 151, wherein the modified AAV9 capsid protein comprises a targeting peptide.

153. The rAAV particle of claim 152, wherein the targeting peptide comprises SEQ ID NO:17.

154. The rAAV particle of claim 152 or claim 153, wherein the targeting peptide is flanked by linker sequences on its N-terminal end and the C-terminal end.

155. The rAAV particle of claim 154, wherein the combined targeting peptide and linker sequences comprise SEQ ID NO: 18.

156. The rAAV particle of any one of claims 149 to 155, wherein the expression cassette comprises a gene encoding the FXN protein, wherein the FXN protein is encoded by a nucleotide sequence of SEQ ID NO: 2.

157. The rAAV particle of any one of claims 149 to 156, wherein the expression cassette comprises a gene encoding the FXN protein, wherein the FXN protein is encoded by a nucleotide sequence with at least 90% homology to the nucleotide sequence of SEQ ID NO: 2.

158. The rAAV particle of any one of claims 149 to 157, wherein the FXN protein comprises an amino acid sequence of SEQ ID NO: 1.

159. The rAAV particle of any one of claims 149 to 158, wherein the expression cassette comprises a gene encoding the FXN protein, wherein the FXN protein is encoded by a89MF-365376951Attorney Reference: 15979-20193.40nucleotide sequence with at least 90% homology to the nucleotide sequence of SEQ ID NO: 1.

160. A method of preventing, reducing risk, or treating an individual having Friedrich’s ataxia, comprising administering to an individual in need thereof a therapeutically effective amount of a recombinant adeno-associated virus (rAAV) particle comprising: a rAAV vector comprising an expression cassette encoding: a) a signal peptide, and b) Frataxin (FXN) protein, wherein the expression cassette is operably linked to a promoter.

161. A method of preventing, reducing risk, or treating an individual having Friedrich’s ataxia, comprising administering to an individual in need thereof a therapeutically effective amount of a recombinant adeno-associated virus (rAAV) particle comprising: a rAAV vector comprising an expression cassette encoding: a) a signal peptide, b) a Frataxin (FXN) protein, and c) a cell-penetrating peptide (CPP), wherein the expression cassette is operably linked to a promoter.

162. A method of preventing, reducing risk, or treating an individual having Friedrich’s ataxia, comprising administering to an individual in need thereof a therapeutically effective amount of a recombinant adeno-associated virus (rAAV) particle comprising: a rAAV vector comprising an expression cassette encoding: a) a Frataxin (FXN) protein, wherein the expression cassette is operably linked to a promoter.

163. A method of preventing, reducing risk, or treating an individual having Friedrich’s ataxia, comprising administering to an individual in need thereof a therapeutically effective amount of recombinant adeno-associated virus (rAAV) particle of any of claims 1 - 159.

164. A method of treating Friedrich’s ataxia in a human patient in need thereof, comprising administering to the cerebrospinal fluid (CSF) of the patient a composition comprising an effective amount of recombinant adeno-associated virus (rAAV) viral particle of any one of claims 1 - 159.

165. The method of any one of claims 160 to 164, wherein the composition is administered directly to the CSF of the patient via intracerebroventricular (ICV) administration.

166. The method of any one of claims 160 to 165, wherein the composition is administered directly to the CSF of the patient via direct cisterna magna (dCM) administration.90MF-365376951Attorney Reference: 15979-20193.40167. The method of any one of claims 160 to 166, wherein the composition is administered only once over the lifetime of the patient.

168. The method of any one of claims 160 to 167, the composition is administered only once yearly to the patient.

169. The method of any one of claims 160 to 168, wherein said administering increases FXN protein by at least 5% in the patient.

170. The method of any one of claims 160 to 169, wherein said administering increases FXN protein by at least 10% in the patient.

171. The method of any one of claims 160 to 170, wherein said administering increases FXN protein by at least 20% in the patient.

172. The method of any one of claims 160 to 171, wherein said administering increases FXN protein by at least 30% in the patient.

173. The method of any one of claims 160 to 172, wherein said administering increases FXN protein by at least 50% in the patient.

174. Use of a recombinant adeno-associated virus (rAAV) viral particle of any one of claims 1-159 to treat Friedrich’s ataxia or reduced symptoms associated with Friedrich’s ataxia.

175. The method of any one of claims 160 to 174, wherein the signal peptide comprises an amino acid sequence of SEQ ID NO: 4, the FXN protein comprises an amino acid sequence of SEQ ID NO: 2, and the CPP comprises an amino acid sequence of SEQ ID NO: 9.

176. The method of any one of claims 160 to 175, wherein the signal peptide comprises an amino acid sequence of SEQ ID NO: 6, the FXN protein comprises an amino acid sequence of SEQ ID NO: 2, and the CPP comprises an amino acid sequence of SEQ ID NO: 9.

177. The method of any one of claims 160 to 176, wherein the signal peptide comprises an amino acid sequence of SEQ ID NO: 8, the FXN protein comprises an amino acid sequence of SEQ ID NO: 2, and the CPP comprises an amino acid sequence of SEQ ID NO: 9.

178. The method of any one of claims 160 to 177, wherein the FXN protein is mature human FXN protein.91MF-365376951Attorney Reference: 15979-20193.40179. A plasmid comprising nucleic acid sequences selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 10, and SEQ ID NO: 11.

180. A plasmid comprising nucleic acid sequences selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 5, SEQ ID NO: 10, and SEQ ID NO: 11.

181. A plasmid comprising nucleic acid sequences selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 7, SEQ ID NO: 10, and SEQ ID NO: 11.92MF-365376951