Compounds for targeting ferredoxin 2 (FDX2) in friedreich ataxia (FRDA)
Modified antisense oligonucleotides targeting FDX2 gene expression provide a therapeutic avenue for Friedreich ataxia by reducing FDX2 levels, addressing the limited treatment options for this disorder and improving patient outcomes.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- THE GENERAL HOSPITAL CORP
- Filing Date
- 2025-11-12
- Publication Date
- 2026-05-21
AI Technical Summary
Friedreich ataxia (FRDA) is a progressive neurological and cardiac disorder with limited treatment options, primarily affecting frataxin expression, leading to severe symptoms and reduced lifespan.
Development of compounds, such as modified antisense oligonucleotides and siRNA, targeting the FDX2 gene to inhibit its expression, thereby modulating frataxin levels and mitigating the effects of FRDA.
The compounds effectively reduce FDX2 protein levels, potentially slowing disease progression and improving symptoms in FRDA patients, offering a therapeutic approach to this currently underserved condition.
Smart Images

Figure US2025055196_21052026_PF_FP_ABST
Abstract
Description
WSGRRef. 71197-702.601COMPOUNDS FOR TARGETING FERREDOXIN 2 (FDX2) IN FRIEDREICH ATAXIA (FRDA)CROSS-REFERENCE
[0001] This application claims the benefit of U.S. Provisional Application No. 63 / 719,938, filed November 13, 2024, and U.S. Provisional Application No. 63 / 774,543, filed March 19, 2025, which are each incorporated herein by reference in their entireties.FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT
[0002] This invention was made with Government support under Grant Nos. SI 24679, AGO 16636, and GM140217 awarded by the National Institutes of Health. The Government has certain rights in the invention.BACKGROUND OF THE DISCLOSURE
[0003] Friedreich (or Friedreich’s) ataxia (FRDA) is an autosomal recessive inherited disease that causes progressive damage primarily to the nervous system and heart, resulting in movement and cardiac problems. FRDA affects approximately 1 in 50,000 people, making it the most common Mendelian monogenic mitochondrial disease. Symptoms typically first appear at 5-15 years of age, followed by progressive neurodegeneration and decline. Typically, within 10 years following the onset of symptoms, the patient is wheelchair-bound. FRDA presents with ataxia, motor weakness, cardiomyopathy, and increased incidence of diabetes, and unfortunately patients have an average lifespan of 37.5 years with limited treatment options.INCORPORATION BY REFERENCE
[0004] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.SUMMARY OF THE DISCLOSURE
[0005] Provided herein are compounds (e.g., oligonucleotides, such as antisense oligonucleotides) and methods for treating a subject having a disorder associated with a mutation in the frataxin (FXN) gene and / or having reduced expression of frataxin protein. TheWSGRRef. 71197-702.601methods comprise administering to the subject a therapeutically effective amount of an inhibitor of human ferredoxin 2 (FDX2) that decreases FDX2 protein expression.
[0006] In some embodiments, the inhibitor of FDX2 comprises an inhibitory nucleic acid targeting the FDX2 gene. In some embodiments, the inhibitory nucleic acid comprises an antisense oligonucleotide targeting the FDX2 nucleic acid. In some embodiments, the inhibitory nucleic acid comprises a siRNA targeting the FDX2 nucleic acid.
[0007] In some embodiments, the subject has Friedreich ataxia (FRDA).
[0008] Provided herein, in some embodiments, is a compound that is a modified single -stranded antisense oligonucleotide. In some aspects, the modified antisense oligonucleotide comprises about 12 to about 30 linked nucleosides. In some aspects, the modified antisense oligonucleotide has a nucleobase sequence comprising about 8 to about 23 consecutive nucleobasesof any of the nucleobase sequences of SEQ ID NOs: 8-1997, 3978-4374 or 4375-4718, wherein eachT may be independently and optionally replaced with U. In some aspects, the modified antisense oligonucleotide comprises about 15 to about 25 linked nucleosides. In some aspects, the modified antisense oligonucleotide comprises 16, 17, 18, 19, or 20 linked nucleosides. In some aspects, at least one internucleoside linkage of the modified antisense oligonucleotide is a modified internucleoside linkage. In some aspects, at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage. In some aspects, the at least one nucleoside comprising a modified sugar moiety is selected from a group consisting of 2 ’-meth oxy ethyl (2’-M0E) modified nucleoside, 2’-O-ethyl (cEt) modified nucleoside, and locked nucleic acid (LNA). In some aspects, the modified antisense oligonucleoside comprises a gapmer represented by formula X-Y-Z, wherein X represents a 5’ wing, Y represents a gap region, and Z represents a 3’ wing. In some aspects, the 5’ wing comprises or consists of 3 to 5 nucleosides, the gap region comprises or consists of ten 2’-deoxynucleosides, and the 3’ wing comprises or consists of 3 to 5 nucleosides. In some aspects, the 5 ’ wing or 3 ’ wing comprises one or more 2 ’-MOE modified nucleoside, cEt modified nucleoside, or LNA. In some aspects, the 5’ wing comprises 5 nucleosides, the gap region comprises ten 2’ -deoxynucleosides, and the 3’ wing comprises 5 nucleosides. In some aspects, the 5’ wing comprises one or more 2’- MOE modified nucleoside and the 3’ wing comprises one or more 2 ’-MOE modified nucleosides. In some aspects, the 5’ wing comprises or consists of five 2’ -MOE modified nucleosides, and the 3’ wing comprises or consists of five 2’ -MOE modified nucleosides. In some aspects, the 5’ wing comprises or consists of 3 nucleosides, the gap region comprises or consists of ten 2’ -deoxynucleosides, and the 3 ’ wing comprises or consists of 3 nucleosides. In some aspects, the 5’ wing comprises or consists of a cEt modified nucleoside or an LNA, the gap region comprisesWSGRRef. 71197-702.601or consists of ten 2’ -deoxy nucleosides, and the 3’ wing comprises or consists of a cEt modified nucleoside or an LNA. In some aspects, the gap region comprises one or more 2 ’ -OMe modified nucleosides. In some aspects, the modified antisense oligonucleotide consists of 20 to 30 linked nucleosides and comprises 20 consecutive nucleobases from any one of the nucleobase sequences of SEQ ID NOs: 8-1000, 3978-4374 or 4375-4718 (wherein each T may be independently and optionally replaced with U). In some aspects, the 20 consecutive nucleobases form a 5-10-5 gapmer comprising a 5 ’ wing, 3’ wing, and a gap region, wherein the central gap region comprises ten 2’-deoxynucleosides and both of 5’ wing and 3’ wing comprise five 2’-MOE modified nucleosides. In some aspects, the 20 consecutive nucleobases comprises 5’-eeeeeddddddddddeeeee-3’, where each ‘d’ represents a 2’- deoxynucleoside and each ‘e’ represents a 2 ’-MOE modified nucleoside. In some aspects, each internucleoside linkage connecting the 20 consecutive nucleobases is a phosphorothioate internucleoside linkage. In some aspects, each cytosine residue within the gap region is a 5 -methyl cytosine. In some aspects, the modified antisense oligonucleotide consists of 16 to 30 linked nucleosides and comprises 16 consecutive nucleobases from any one of the nucleobase sequences of SEQ ID NOs: 1001-1997 (wherein each T may be independently and optionally replaced with U). In some aspects, the 16 consecutive nucleobases form a 3-10-3 gapmer comprising a 5’ wing, 3’ wing, and a gap region, wherein the gap region comprises ten 2’-deoxynucleosides and both the 5’ wing and the 3’ wing comprise three cEt modified nucleosides or three LNAs. In some aspects, the 16 consecutive nucleobases comprises 5’- lllddddddddddlll -3’, where each ‘d’ represents a 2’- deoxynucleoside and each T represents a cEt modified nucleoside or LNA. In some aspects, each internucleoside linkage connecting the 16 consecutive nucleobases is a phosphorothioate internucleoside linkage. In some aspects, each cytosine residue within the gap region is a 5 -methyl cytosine. In some aspects, the antisense oligonucleotide comprises or consists of a nucleic acid sequence in Table A-l, Table A-2, Table C-l, Table C-2, or Table 3 (wherein each T may be independently and optionally replaced with U). In some aspects, the nucleobase sequence of the modified antisense oligonucleotide is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary to SEQ ID NO: 1. In some aspects, the modified antisense oligonucleotide targets a region between nucleotide positions 205-352, 375-404, 412-551, or 650-690 of SEQ ID NO: 1 from its 5’ end. In some aspects, the modified antisense oligonucleotide targets a region between nucleotide positions 210-267, 269-290, 299-318, 328-347, 380-399, 417-440, 444-486, 488-516, 518-546, or 655-685 of SEQ ID NO: 1 from its 5’ end. In some aspects, the modified antisense oligonucleotideWSGRRef. 71197-702.601comprises a nucleobase sequence at least 80%, 85%, 90%, or 95% identical to or at least 13, 14, 15, 16, 17, or 18 contiguous nucleobase sequence of a reverse complementary sequence of nucleobase positions 205-352, 375-404, 412-551, or 650-690 of SEQ ID NO: 1 from its 5’ end. In some aspects, the modified antisense oligonucleotide comprises a nucleobase sequence at least 80%, 85%, 90%, or 95% identical to or at least 13, 14, 15, 16, 17, or 18 contiguous nucleobase sequence from a sequence in Table 6.
[0009] Provided herein, in some embodiments, is a pharmaceutical composition comprising any of the compounds described above or a salt thereof, and at least one pharmaceutically acceptable carrier or diluent.
[0010] Further provided herein, in some embodiments, is a method of preventing, treating, ameliorating, or slowing progression of a disorder associated with mutations in the FXN gene or reduced expression of frataxin protein, the method comprising administering to a subject any of the compounds described above or any of the pharmaceutical compositions described above, thereby preventing, treating, ameliorating, or slowing progression of the disorder. In some aspects, the subject is a human. In some aspects, the disorder is Friedreich’s Ataxia. In some aspects, the compound or the pharmaceutical composition is administered intrathecally or intracerebroventricularly.
[0011] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials are described herein for use in the present invention; other, suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control.
[0012] Other features and advantages of the invention will be apparent from the following detailed description and figures, and from the claims.BRIEF DESCRIPTION OF DRAWINGS
[0013] FIGs. 1A-1I: Mutations in NFS1 / NFS-1 or FDX2 / FDX-2 partially rescue the growth defect caused by Frataxin loss in C. elegans. FIG. 1A, A forward genetic screen using random chemical mutagenesis revealed mutations in other genes that can suppress the loss of Frataxin. FIG. IB, Multiple sequence alignment of NFS1 (C. elegans residues 239-251) andWSGRRef. 71197-702.601FDX2 (C. elegans residues 117-127) including homologs from mammals, fish, and invertebrates made using ClustalW. FIG. 1C, Synchronized Frataxin null animals grown at 7% oxygen with or without suppressor mutations in fdx-2 and nfs-1. FIG. ID, FIG. IE, FIG. IF, Growth of C. elegans at 7% oxygen (4 days) (FIG. ID), 7% oxygen (2 days) (FIG. IE), or 1% oxygen (2 days) (FIG. IF) quantified by body length measurements. For all panels statistical significance was calculated using one-way ANOVAfollowedby Tukey’s Multiple Comparison Test. N.s. = not significant, * =p value <0.05, ** =p value <0.01, *** =p value <0.001. FIG. 1G, Multiple sequence alignment of C. elegans mitochondrial FDX-2 with human FDX2 and FDX1.Sequences necessary and sufficient for the activity of FDX2 are boxed and noted with an asterisk, and a residue critical for the activity of FDX1 is boxed and noted with a plus sign. Schulz etal. 2023, Nat. Chem. Biol. 19:206-217. FIG. 1H, FIG. II, Growth of C. elegans for 2 days (FIG. 1H) or 3 days (FIG. II) at indicated oxygen tensions quantified by body length measurements. For all panels statistical significance was calculated using one-way ANOVA followed by Tukey’s Multiple Comparison Test. n.s. = not significant, * =pvalue <0.05, ** =p value <0.01, *** = p value <0.001.
[0014] FIGs. 2A-2D: Frataxin suppressor mutations restore levels of ISC -containing complex I. FIG. 2A, Quantitative TMT proteomics of complex I subunits in wild type animals, Frataxin mutants, and Frataxin mutants with suppressor mutations nfs-1 (R244K) or fdx-2 (Al 26V) grown continuously at 1% oxygen. Values are normalized to wild type; proteins shown from which at least two peptides were quantified. FIG. 2B, SDS-PAGE followed by western blot of whole worm lysate from animals exposed to continuous 1% oxygen. FIG. 2C, Growth of C. elegans at 1% or 10% oxygen for indicated durations. FIG. 2D, SDS-PAGE followed by western blot of whole worm lysate from animals shifted from 1% to 21% for 2 days. Statistical significance was calculated using one-way ANOVA followed by Tukey’s Multiple Comparison Test. n.s. = not significant, * =p value <0.05, ** =p value <0.01, *** = p value <0.001.
[0015] FIGs. 3A-3C: Excess FDX2 is detrimental to NFS1 activity and ISC biosynthesis. FIG. 3A, Growth of animals for 3 days at room temperature housed at 21% or 1% oxygen. The nfs-1 (R244K); fdx-2 (Al 26V) double mutants are synthetic sick at 21% oxygen and rescued by hypoxia. FIG.3B, 3 day growth assay with K562 or 293 T cells overexpressing GFP or FDX2 cDNA, grown in 21% or 1% oxygen tensions. FIG. 3C, Immunoblots for FDX2, Lipoic Acid, OXPHOS, NFS1 and loading control Tubulin on K562 (left) and 293T (right) cell lysates collected from (FIG.3B). ns = p > 0.05, * = p < 0.05, ** =p < 0.01, *** = p < 0.001. Two-way ANOVA with Bonferroni’s post-test.WSGRRef. 71197-702.601
[0016] FIGs. 4A-4I: Partial loss of wild type FDX2 activity suppresses Frataxin mutants. FIG. 4A, FDX-2 gene model with CRISPR / Cas9 -generated 8 bp deletion indicated, predicted to produce to non-functional protein. FIG.4B, Growth of animals for 3 days at 21% oxygen. All animals were healthy and fertile except FDX2 null homozygotes. FIG. 4C, Growth of animals for 3 days at 1% oxygen (left) or 6 days at 10% oxygen (right). Frataxin null animals (frh-1 in C. elegans) are rescued by a heterozygous null mutation in FDX2. FIG. 4D, Latency to fall on a rotarod test (left) and grip strength (right) in mice on Doxycycline treatment for 15 weeks. FIG.4E, Broodsize of wild type and fdx-2(null) animals grown continuously at 21% or 1% oxygen.FIG. 4F, SDS-PAGE followed by western blot of brain tissue from wild type mice or mice heterozygous for Fdx2 mutation (left), quantified using Fiji (right). FIG. 4G, Latency to fall on a rotarod test (left) and grip strength (right) in mice on Doxycycline treatment for 12 weeks.FIG. 4H, Body weight measurements of male (left) and female (right) mice following Doxycycline treatment. FIG. 41, Survival of mice following Doxycycline treatment. For all panels statistical significance was calculated using one-way ANOVA followed by Tukey’s Multiple Comparison Test. n.s. = not significant, * =p value <0.05, ** =p value <0.01, *** = p value <0.001.
[0017] FIG. 5: Exemplary workflow of ASO library design. Illustrated is an exemplary in silico selection process of FDX2 ASOs.
[0018] FIGs. 6A-6B: Results of control ASOs for exemplary dual dose screen. FIG. 6A depicts the relative remaining AHSA1 mRNA expression levels in SW1783 cells transfected with either 25 nM or 5 nM of a control AHSA1 -LNA ASO. FIG. 6B shows the relative remaining FDX2 mRNA expression in SW1783 cells transfected with either 25 nMor 5 nMof a mock control, a control AHSA1-LNA ASO, and a control AHSA1-MOE ASO.
[0019] FIG. 7: Results of exemplary dual dose screen of selected ASOs. FIG.7 depicts FDX2 levels in SW1783 cells transfected with either 25 nMof the candidate ASOs (y-axis) or 5 nM of the candidate ASOs (x-axis).
[0020] FIGs. 8A-8B: Relative positions of selected ASOs. FIG. 8A shows the number of ASOs that fall within a relative position of the FDX2 mRNA. FIG. 8B shows the number of ASOs that fall within positions of around 4800 to around 5600 of the FDX2 mRNA. The 52ASOs selected for further testing are depicted as black bars while the remaining ASOs are shown as white bars.
[0021] FIGs. 9A-9C: Results for 30 selected ASOs in exemplary dose-response screen. FIG. 9A depicts the dose response curves for the first 10 ASOs identified in an exemplary dose-WSGRRef. 71197-702.601response screen. FIG. 9B depicts the dose response curves for the 11thto 20thASOs identified in the exemplary dose-response screen. FIG.9C shows the dose response curves for the 21stto 30dlASOs identified in the exemplary dose-response screen.
[0022] FIGs. 10A-10B: Results for 30 selected ASOs in exemplary gymnotic update screen. FIG. 10A andFIG. 10B depict the relative FDX2 mRN A levels for the candidate ASOs following administration of each ASO (grey bars), mock control (white bar), and positive controls (black bars) under gymnotic (free-uptake) conditions absent any transfection reagents.DETAILED DESCRIPTION OF THE DISCLOSURE
[0023] The present disclosure provides, among other things, compounds that are oligonucleotides, e.g., antisense oligonucleotides (e.g., single-stranded antisense oligonucleotides (ASOs)), and siRNA (e.g., oligomeric duplexes), useful for inhibiting FDX2 expression or activity.Definitions
[0024] Unless otherwise indicated, the following terms have the following meanings:
[0025] “Approximately” or “about,” as applied to one or more values of interest, refers to a value that is similar to a stated reference value. In general, those skilled in the art, familiar within the context, will appreciate the relevant degree of variance encompassed by “about” or “approximately” in that context. For example, in some embodiments, the term “approximately” or “about” may encompass a range of values that are within (i.e., ±) 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less of the referred value.
[0026] “Alkyl”, used alone or as part of a larger moiety, refers to a saturated, optionally substituted straight or branched chain hydrocarbon group having (unless otherwise specified) 1 -12, 1-10, 1-8, 1-6, 1-4, 1-3, or 1-2 carbon atoms (e.g., Cl-12, Cl-10, Cl-8, Cl-6, Cl-4, Cl-3, or Cl -2). Exemplary alkyl groups include methyl, ethyl, propyl, butyl, pentyl, hexyl, and heptyl.
[0027] “2’-deoxynucleoside” means a nucleoside comprising a 2’-deoxy sugar moiety. Unless otherwise indicated, a 2 ’-deoxy nucleoside is a 2 ’-D-deoxy nucleoside which comprises a 2’-D-deoxyribosyl sugar moiety, which has the -D ribosyl configuration as found in naturally occurring deoxyribonucleic acid (DNA).
[0028] “2’-deoxy sugar moiety” means a 2’-H(H) deoxyribosyl sugar moiety. Unless otherwise indicated, a 2’-deoxy sugar moiety is a 2’-D-deoxyribosyl sugar moiety, which has the -DWSGRRef. 71197-702.601ribosyl configuration as found in naturally occurring deoxyribonucleic acids (DNA). Herein, in the context of an oligomeric compound comprising a ribonucleic acid oligonucleotide (e.g., an siRNA), a 2’-deoxy sugar moiety is considered e.g., a modified sugar moiety.
[0029] “2’-OMe nucleoside”, “2’-OMe” or “2’-OCH3” or “2’-O-methyl” each refers to a nucleoside comprising a sugar comprising an -OCH3 group at the 2’position of the sugar ring.
[0030] “2’ -F” means a 2’-fluoro group in place of the 2 ’-OH group of a furanosyl sugar moiety. A“2’-F sugar moiety” (i.e., a“2’-fluoro sugar moiety”) means a sugar moiety with a 2’-F (i.e., a 2’-fluoro) group in place of the 2’-OH group of a furanosyl sugar moiety. Unless otherwise indicated, a 2’-F sugar moiety is in the -D-ribosyl configuration.
[0031] “2’ -F nucleoside” means a nucleoside comprising a 2’-F sugar moiety.
[0032] “2’-O-methoxyethyl” (also 2’-M0E and 2’-OCH2CH2-OCH3 and MOE) refers to an O-methoxy-ethyl modification of the 2 ’-position of a furanose ring. A 2’-O-methoxy ethyl modified sugar is a modified sugar.
[0033] “2’ -MOE modified nucleoside” (also 2’-O-methoxy ethyl nucleoside) means a nucleoside comprising a 2 ’-MOE modified sugar moiety.
[0034] “2’ -substituted nucleoside” means a nucleoside comprising a substituent at the 2’-position of the furanose ring other than H or OH. In some embodiments, 2 ’-substituted nucleosides include nucleosides with bicyclic sugar modifications.
[0035] “5 -methylcytosine” means a cytosine modified with a methyl group attached at the 5 position. A 5 -methylcytosine is a modified nucleobase.
[0036] “Administering” means providing a pharmaceutical agent to an animal, and includes, but is not limited to administering by a medical professional and self -administering.
[0037] “ Amelioration” refers to a lessening, slowing, stopping, or reversing of at least one indicator of the severity of a syndrome or condition. The severity of indicators may be determined by subjective or objective measures, which are known to those skilled in the art.
[0038] “ Animal” refers to a human or non-human animal, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including, but not limited to, monkeys and chimpanzees.
[0039] “Antibody” refers to a molecule characterized by reacting specifically with an antigen in some way, where the antibody and the antigen are each defined in terms of the other. Antibody may refer to a complete antibody molecule or any fragment or region thereof, including antigen binding fragments such as the heavy chain, the light chain, Fab region, and Fv region.WSGRRef. 71197-702.601
[0040] “ Antisense activity” means any detectable or measurable activity attributable to the hybridization of an antisense compound to its target nucleic acid. In some embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid.
[0041] “ Antisense compound” means an oligomeric compound that is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding. Examples of antisense compounds include single-stranded and double-stranded compounds, such as, antisense oligonucleotides, siRNAs and shRNAs.
[0042] “ Antisense inhibition” or “inhibition” means reduction of target nucleic acid levels in the presence of an antisense compound complementary to a target nucleic acid compared to target nucleic acid levels or in the absence of the antisense compound.
[0043] “ Antisense oligonucleotide” means a single-stranded oligonucleotide having a nucleobase sequence that permits hybridization to a corresponding segment of a target nucleic acid.
[0044] “Bicyclic sugar” means a furanose ring modified by the bridging of two atoms. A bicyclic sugar is a modified sugar.
[0045] “Bicyclic nucleoside” (also BNA) means a nucleoside having a sugar moiety comprising a bridge connecting two carbon atoms of the sugar ring, thereby forming a bicyclic ring system. In some embodiments, the bridge connects the 4 ’ -carbon and the 2 ’-carb on of the sugar ring.
[0046] “Blunt” or “blunt ended” in reference to an oligomeric duplex means that there are no terminal unpaired nucleotides (i.e., no overhanging nucleotides). One or both ends of an oligomeric duplex can be blunt.
[0047] “Cap structure” or “terminal cap moiety” means chemical modifications, which have been incorporated at either terminus of an antisense compound.
[0048] “ cEt” or “constrained ethyl” means a bicyclic nucleoside having a sugar moiety comprising a bridge connecting the 4 ’-carbon and the 2 ’-carbon, wherein the bridge has the formula: 4’-CH(CH3)-O-2’.
[0049] “Chemically distinct region” refers to a region of an antisense compound that is in some way chemically differentthan another region of the same antisense compound. For example, a region having 2’-O-Methoxyethyl nucleosides is chemically distinct from a region having nucleosides without 2’ -O-Meth oxy ethyl modifications.WSGRRef. 71197-702.601
[0050] “ Chimeric antisense compound” means an antisense compound that has at least two chemically distinct regions, each position having a plurality of subunits.
[0051] “ Co-administration” means administration of two or more pharmaceutical agents to an individual. The two or more pharmaceutical agents may be in a single pharmaceutical composition or may be in separate pharmaceutical compositions. Each of the two or more pharmaceutical agents may be administered through the same or different routes of administration. Co-administration encompasses parallel or sequential administration.
[0052] “Complementary” in reference to an oligonucleotide or portion thereof means that at least 70% of the nucleobases of such oligonucleotide or portion thereof and the nucleobases of another nucleic acid or portion thereof are capable of hydrogen bonding with one another when the nucleobase sequence of the oligonucleotide and the other nucleic acid are aligned in opposing directions. As used herein, “complementary nucleobases” means nucleobases that are capable of forming hydrogen bonds with one another. Complementary nucleobase pairs include adenine (A) and thymine (T); adenine (A) and uracil (U); cytosine (C) and guanine (G); and 5 -methylcytosine (mC) and guanine (G). Certain modified nucleobases that pair with unmodified nucleobases or with other modified nucleobases are known in the art. For example, hypoxanthine (I), the nucleobase of the nucleoside inosine, can pair with adenine, cytosine, thymine, or uracil. Herein, hypoxanthine (I) is considered a complementary nucleobase to thymine (T), adenine (A), uracil (U), and cytosine (C). Complementary oligonucleotides and / or nucleic acids need not have nucleobase complementarity at each nucleoside. Rather, some mismatches are tolerated. As used herein, “fully complementary” or “100% complementary” in reference to an oligonucleotide, or a portion thereof, means that the oligonucleotide, or portion thereof, is complementary to another oligonucleotide or nucleic acid at each nucleobase of the shorter of the two oligonucleotides, or at each nucleoside if the oligonucleotides are the same length.
[0053] “Complementary region” in reference to an oligonucleotide or portion thereof is a range of nucleobases of the oligonucleotide that is complementary to a nucleobase sequence of an equal-length region of a second oligonucleotide or region thereof (e.g., an oligonucleotide and a target nucleic acid, or an antisense oligonucleotide and a sense oligonucleotide), or to a nucleobase sequence of an equal-length region within a second region of the oligonucleotide (e.g., in a “hairpin oligonucleotide”). A complementary region of an oligonucleotide may be a portion of an oligonucleotide or may include the entire oligonucleotide or may include substantially all of the oligonucleotide.WSGRRef. 71197-702.601
[0054] “Complementarity” means the capacity for pairing between nucleobases of a first nucleic acid and a second nucleic acid.
[0055] “Comprise,” “comprises,” and “comprising” will be understood to imply the inclusion of a stated step or element or group of steps or elements but not the exclusion of any other step or element or group of steps or elements.
[0056] “Contiguous nucleobases” means nucleobases immediately adjacent to each other. “Designing” or “designed to” refer to the process of designing an oligomeric compound that specifically hybridizes with a selected nucleic acid molecule.
[0057] “Diluent” means an ingredient in a composition that lacks pharmacological activity but is pharmaceutically necessary or desirable. For example, in drugs that are injected, the diluent may be a liquid, e.g., saline solution or artificial cerebrospinal fluid (aCSF).
[0058] “Dose” means a specified quantity of a pharmaceutical agent provided in a single administration, or in a specified time period. In some embodiments, a dose may be administered in one, two, or more boluses, tablets, or injections. For example, in some embodiments where subcutaneous administration is desired, the desired dose requires a volume not easily accommodated by a single injection, therefore, two or more injections may be used to achieve the desired dose. In some embodiments, the pharmaceutical agent is administered by infusion over an extended period of time or continuously. Doses may be stated as the amount of pharmaceutical agent per hour, day, week, or month.
[0059] “Effective amount” in the context of modulating an activity or of treating or preventing a condition means the administration of that amount of pharmaceutical agent to an individual in need of such modulation, treatment, or prophylaxis, either in a single dose or as part of a series, that is effective for modulation of that effect, or for treatment or prophylaxis or improvement of that condition. The effective amount may vary among individuals depending on the health and physical condition of the individual to be treated, the taxonomic group of the individuals to be treated, the formulation of the composition, assessment of the individual’s medical condition, and other relevant factors.
[0060] “Efficacy” means the ability to produce a desired effect.
[0061] “Expression” includes all the functions by which a gene’s coded information is converted into structures present and operating in a cell. Such structures include but are not limited to the products of transcription and translation.
[0062] “FDX2 antisense compound” means an antisense compound targeting FDX2.WSGRRef. 71197-702.601
[0063] “FDX2 nucleic acid” means any nucleic acid encoding FDX2. For example, in some embodiments, a FDX2 nucleic acid includes a DNA sequence encoding FDX2 (“FDX2 DNA”), an RNA sequence transcribed from DNA encoding FDX2 (including genomic DNA comprising introns and exons) (“FDX2 RNA”), and an mRNA sequence encoding FDX2.
[0064] “FDX2 mRNA” means any messenger RNA expression product of a DNA sequence encoding FDX2.
[0065] “FDX2 protein” means the polypeptide expression product of a FDX2 nucleic acid. “Mismatch” or “non-complementary nucleobase” refers to the case when a nucleobase of a first nucleic acid is not capable of pairing with the corresponding nucleobase of a second or target nucleic acid. “Modified intemucleoside linkage” refers to a substitution or any change from a naturally occurring internucleoside bond (i.e., a phosphodiester intemucleoside bond).
[0066] “Fully complementary” or “100% complementary” means each nucleobase of a first nucleic acid has a complementary nucleobase in a second nucleic acid. In some embodiments, a first nucleic acid is an antisense compound and a target nucleic acid is a second nucleic acid.
[0067] “Gapmer” means a chimeric antisense compound in which an internal region having a plurality of nucleosides that support RNase H cleavage is positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions. The internal region may be referred to as a “gap” and the external regions may be referred to as “wings.”
[0068] “Hybridization” means the annealing of complementary nucleic acid molecules. In some embodiments, complementary nucleic acid molecules include, but are not limited to, an antisense compound and a target nucleic acid. In some embodiments, complementary nucleic acid molecules include, but are not limited to, an antisense oligonucleotide and a nucleic acid target.
[0069] “Immediately adjacent” means there are no intervening elements between the immediately adjacent elements.
[0070] “ Individual” means a human or non-human animal selected for treatment or therapy.
[0071] “Inhibiting FDX2” means reducing the level or expression of a FDX2 mRNA and / or protein. In some embodiments, FDX2 mRNA and / or protein levels are inhibited in the presence of an antisense compound targeting FDX2, including an antisense oligonucleotide targeting FDX2, as compared to expression of FDX2 mRNA and / or protein levels in the absence of a FDX2 antisense compound, such as an antisense oligonucleotide targeting FDX2.WSGRRef. 71197-702.601
[0072] “Inhibiting the expression or activity” refers to a reduction or blockade of the expression or activity and does not necessarily indicate a total elimination of expression or activity.
[0073] “ Internucleoside linkage” refers to the chemical bond between nucleosides.
[0074] “Linked nucleosides” means adjacent nucleosides linked together by an intemucleoside linkage.
[0075] “Mismatch” or “non-complementary” means a nucleobase of a first nucleic acid sequence that is not complementary with the corresponding nucleobase of a second nucleic acid sequence when the firstand second nucleic acid sequences are aligned in opposing directions.
[0076] “Modified nucleobase” means any nucleobase other than adenine, cytosine, guanine, thymidine, or uracil. An “unmodified nucleobase” means the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U).
[0077] “Modified nucleoside” means a nucleoside having, independently, a modified sugar moiety and / or modified nucleobase.
[0078] “Modified nucleotide” means a nucleotide having, independently, a modified sugar moiety, modified internucleoside linkage, and / or modified nucleobase.
[0079] “Modified antisense oligonucleotide” means an oligonucleotide comprising at least one modified intemucleoside linkage, modified sugar, and / or modified nucleobase.
[0080] “Modified sugar” means substitution and / or any change from a sugar moiety found in DNA (2’-H) or RNA (2 ’-OH).
[0081] “Monomer” means a single unit of an oligomer. Monomers include, but are not limited to, nucleosides and nucleotides, whether naturally occurring or modified.
[0082] “Motif’ means the pattern of unmodified and modified nucleosides in an antisense compound.
[0083] “Naturally occurring intemucleoside linkage” means a 3 ’ to 5 ’ phosphodiester linkage.
[0084] “Non-complementary nucleobase” refers to a pair of nucleobases that do not form hydrogen bonds with one another or otherwise support hybridization.
[0085] “Nucleic acid” refers to molecules composed of monomeric nucleotides. A nucleic acid includes, but is not limited to, ribonucleic acids (RNA), deoxyribonucleic acids (DNA), single -stranded nucleic acids, double-stranded nucleic acids, and small interfering ribonucleic acids (siRNA).WSGRRef. 71197-702.601
[0086] “Nucleobase” means a heterocyclic moiety capable of pairing with a base of another nucleic acid.
[0087] “Nucleobase complementarity” refers to a nucleobase that is capable of base pairing with another nucleobase. For example, in DNA, adenine (A) is complementary to thymine (T). For example, in RNA, adenine (A) is complementary to uracil (U). In some embodiments, complementary nucleobase refers to a nucleobase of an antisense compound that is capable of base pairing with a nucleobase ofits target nucleic acid. For example, if a nucleobase at a certain position of an antisense compound is capable of hydrogen b onding with a nucleobase at a certain position of a target nucleic acid, then the position of hydrogen bonding between the oligonucleotide and the target nucleic acid is considered to be complementary at that nucleobase pair.
[0088] “Nucleobase sequence” means the order of contiguous nucleobases independent of any sugar, linkage, and / or nucleobase modification.
[0089] “Nucleoside” means a nucleobase linked to a sugar.
[0090] “Mimetic” refers to groups that are substituted for a sugar, a nucleobase, and / or internucleoside linkage. Generally, a mimetic is used in place of the sugar or sugarinternucleoside linkage combination, and the nucleobase is maintained for hybridization to a selected target.
[0091] “Nucleotide” means a nucleoside having a phosphate group covalently linked to the sugar portion of the nucleoside.
[0092] “ Off-target effect” refers to an unwanted or deleterious biological effect associated with modulation of RNA or protein expression of a gene other than the intended target nucleic acid.
[0093] “Oligomeric compound” or “oligomer” means a polymer of linked monomeric subunits which is capable of hybridizing to at least a region of a nucleic acid molecule.
[0094] “Oligonucleotide” means a polymer of linked nucleosides each of which can be modified or unmodified, independent one from another.
[0095] “Parenteral administration” means administration through injection (e.g., bolus injection) or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, e.g., intrathecal or intracerebroventricular administration.WSGRRef. 71197-702.601
[0096] “Peptide” means a molecule formed by linking at least two amino acids by amide bonds. Without limitation, as used herein, peptide refers to polypeptides and proteins.
[0097] “Pharmaceutical agent” means a substance that provides a therapeutic benefit when administered to an individual. For example, in some embodiments, an antisense oligonucleotide targeted to FDX2 is a pharmaceutical agent.
[0098] “Pharmaceutical composition” means a mixture of substances suitable for administering to an individual. For example, a pharmaceutical composition may comprise an antisense oligonucleotide and a sterile aqueous solution.
[0099] “Pharmaceutically acceptable salts” means physiologically and pharmaceutically acceptable salts of antisense compounds, i.e., salts that retain the desired biological activity of the parent oligonucleotide and do not impart undesired toxicological effects thereto.
[0100] “Phosphorothioate linkage” means a linkage between nucleosides where the phosphodiester bond is modified by replacing one of the non -bridging oxygen atoms with a sulfur atom. A phosphorothioate linkage is a modified internucleoside linkage.
[0101] “Portion” means a defined number of contiguous (i.e., linked) nucleobases of a nucleic acid. In some embodiments, a portion is a defined number of contiguous nucleobases of a target nucleic acid. In some embodiments, a portion is a defined number of contiguous nucleobases of an antisense compound.
[0102] “Prevent” or “preventing” refers to delaying or forestalling the onset or development of a disorder or syndrome for a period of time from minutes to days, weeks to months, or indefinitely.
[0103] “Prodrug” means a therapeutic agent that is prepared in an inactive form that is converted to an active form (i.e., drug) within the body or cells thereof by the action of endogenous enzymes or other chemicals and / or conditions.
[0104] “Prophylactically effective amount” refers to an amount of a pharmaceutical agent that provides a prophylactic or preventative benefit to an animal.
[0105] “Region” is defined as a portion of the target nucleic acid having at least one identifiable structure, function, or characteristic.
[0106] “Ribonucleotide” means a nucleotide having a hydroxy at the 2 ’position of the sugar portion of the nucleotide. Ribonucleotides maybe modified with any of a variety of substituents.WSGRRef. 71197-702.601
[0107] “ Salt” means a physiologically and pharmaceutically acceptable salt(s) of antisense compounds, i.e., salts that retain the desired biological activity of the parent oligonucleotide and do not impart undesired toxicological effects thereto.
[0108] “Segments” are defined as smaller or sub -portions of regions within a target nucleic acid. “Shortened” or “truncated” versions of antisense oligonucleotides taught herein have one, two or more nucleosides deleted.
[0109] “ Side effects” means physiological responses attributable to a treatment other than desired effects. In some embodiments, side effects include, without limitation, injection site reactions, liver function test abnormalities, renal function abnormalities, liver toxicity, renal toxicity, central nervous system abnormalities, and myopathies.
[0110] “Single-stranded antisense oligonucleotide” means an oligonucleotide which is not hybridized to a complementary strand. A single-stranded antisense oligonucleotide is not a siRNA.
[0111] “ Sites” as used herein, are defined as unique nucleobase positions within a target nucleic acid.
[0112] “ Slows progression” means decrease in the development of the disorder or syndrome.
[0113] “Specifically hybridizable” refers to an antisense compound having a sufficient degree of complementarity between an antisense oligonucleotide and a target nucleic acid to induce a desired effect, while exhibiting minimal or no effects on non -target nucleic acids under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays and therapeutic treatments.
[0114] “Stringent conditions” refers to conditions under which an oligomeric compound will hybridize to its target sequence, but to a minimal number of other sequences.
[0115] “Targeting” or “targeted” means the process of design and selection of an antisense compound that will specifically hybridize to a target nucleic acid and induce a desired effect.
[0116] “Target nucleic acid,” “target RNA,” and “target RNA transcript” and “nucleic acid target” all mean a nucleic acid capable of being targeted by antisense compounds. In some embodiments, the target nucleic acid is a FDX2 nucleic acid.
[0117] “Target region” means a portion of a target nucleic acid to which one or more antisense compounds is targeted.WSGRRef. 71197-702.601
[0118] “Target segment” means the sequence of nucleotides of a target nucleic acid to which an antisense compound is targeted. “5’ target site” refers to the 5 ’-most nucleotide of a target segment. “3’ target site” refers to the 3 ’-most nucleotide of a target segment.
[0119] “Therapeutically effective amount” means an amount of a pharmaceutical agent that provides a therapeutic benefit to an individual.
[0120] “ Treat” or “treating” or “treatment” refers administering a composition to effect an alteration or improvement of the disorder or syndrome.
[0121] “Unmodified nucleobases” mean the purinebases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).
[0122] “Unmodified nucleotide” means a nucleotide composed of naturally occurring nucleobases, sugar moieties, and internucleoside linkages. In some embodiments, an unmodified nucleotide is an RNA nucleotide (i.e. -D-ribonucleosides) or a DNA nucleotide (i.e. -D-deoxyribonucleoside).
[0123] “Wing segment” means a plurality of nucleosides modified to impart to an oligonucleotide properties such as enhanced inhibitory activity, increased binding affinity for a target nucleic acid, or resistance to degradation by in vivo nucleases.FDX2
[0124] In humans, FRDA is caused by a GAA»TTC triplet repeat expansion in the first intron of theFXN gene (NCBI RefSeqGeneNG_008845.2). FXN encodes a protein called frataxin, a ubiquitous, nuclear-encoded mitochondrial protein (Campuzano et al. 1996, Science 271 : 1423-1427). Unaffected individuals have 6-30 GAA»TTC repeats, whereas affected individuals have approximately 70-1000 repeats (Sharma et al. 2004, Ann Neurol 56:898-901; Pandolfo 2008, Arch Neurol 65:1296-1303). The GAA»TTC repeat expansion mutation represses FXN expression at the level of transcription, with the extent of FXN repression directly related to the length of the GAA»TTC repeat. Age of onset and disease severity are also correlated with the length of the GAA»TTC repeat (Chutake etal. 2014, Ann Neurol 76:522-528). Importantly, the TRE-FXN gene encodes functional frataxin, albeit at reduced levels.
[0125] The deficiency of frataxin is associated with impairment of iron -sulfur cluster (ISC)-containing enzymes, deficits of respiratory chain complex activities, and accumulation of iron (Bradley et al. 2000, Hum Mol Genet 9:275-282; Foury and Cazzalini 1997, FEBS Lett 411 :373-377; Waldvogel et al. 1999, Ann Neurol 46:123 -125; Koeppen et al. 2007, Acta Neuropathol. 114:163-173; Wong et al. 1999, Hum Mol Genet 8:425-430).WSGRRef. 71197-702.601
[0126] Iron sulfur clusters (ISCs) are ancient and essential cofactors necessary for the activity of dozens of proteins in the cell, including those involved in the electron transport chain, TCA cycle, DNA repair and protein translation (Andreini et al. 2016, J. Proteome Res. 15:1308-1322). Synthesis of ISCs occurs in the mitochondrial matrix by an enzyme -mediated pathway consisting of the scaffold protein ISCU, the cysteine desulfurase NFS1 which provides sulfur from cysteine, LYRM4 and NDUFAB1 (the acyl carrier protein) which stabilize NFS1, the ferredoxin FDX2 which conveys electrons from FDXR / NADPH, and Frataxin (FXN) (Lili and Freibert 2020, Annu. Rev. Biochem. 89:1-29; Maio et al. 2020, Trends Biochem. Sci. 45:411-426). Frataxin is an allosteric activator of NFS1 (Tsai and Barondeau 2010, Biochemistry 49:9132-9139) and accelerates the formation of 2Fe-2S clusters by promoting persulfide transfer from NSF1 to ISCU (Fox et al. 2015, Biochemistry 54:3880-3889; Schulz et al. 2024, Nat. Commun. 15:3269; Gervason et al. 2019, Nat. Commun. 10:3566).
[0127] Reduced levels of Frataxin underlies Friedreich’s ataxia (FA) (Campuzano et al. 1996, Science 271:1423-1427), which affects 1 in 50,000 people, making it the most common monogenic mitochondrial disease and the most common recessive ataxia. FA presents with ataxia, cardiomyopathy, and increased incidence of diabetes; patients have an average lifespan of 37.5 years with no effective therapies to date. The growth of yeast, C. elegans, and human cells lacking Frataxin can be rescued by hypoxia due to an increase in ISC synthesis (Ast et al.2019, Cell 177:1507-1521). Our ability to culture Frataxin null mutant C. elegans in “permissive” hypoxic environments affords us the unique opportunity to identify rare bypass mutations in a whole organism. Our approach is analogous to the use of temperature sensitive mutants that grow well in low temperature environments butthen experience fitness defects at non-permissive higher temperatures. Genetic suppressors may inform on the precise molecular action of hypoxia in restoring ISC biosynthesis as well as identify new pathways amenable to therapeutic interventions.
[0128] Through forward genetics in C. elegans we identified Frataxin suppressor mutations that map to the NFS1 / FDX2 interface: nfs-l(R244K), fdx-2(El 17K), fdx-2(A126V), and fdx-2(P127S). Screens in yeast have identified an intra -complex Frataxin suppressor mutation in the scaffold protein ISCU (Yoon etal. 2014, Biochem. J. 459:71-81) which bypasses the need for Frataxin by accelerating cluster formation on the glutaredoxin GRX5 (Das et al. 2019, J. Biol. Chem. 294:9276-9284). However, such bypass mutations have never before been reported in animals. Based on published cryo-EM structures nfs-l(R244K) and fdx-2(El 17K) likely disrupt salt-bridge interactions that stabilize the NFS1 / FDX2 interaction. fdx-2(A126V) and fdx-2(P127S) may also disrupt FDX2 binding through conformational changes or destabilize FDX-2WSGRRef. 71197-702.601leading to less overall protein, which we observed for the Al 26V mutation in our TMT proteomics and cell culture experiments. In principle any mutation that lowers FDX-2 levels could be a suppressor in this system, as heterozygous fdx-2(null) also partially rescued Frataxin loss.
[0129] Comprehensive genetic analysis from C. elegans nominates partial knockdown of FDX2 as a therapeutic approach to treating Friedreich’s ataxia. Genetic therapy approaches for Friedreich’s ataxia would naturally include replacing Frataxin, however overexpression of Frataxin has shown toxicity in mouse studies (Belbellaa et al. 2020, Mol. Ther. Methods Clin. Dev. 19:120-138; Huichalaf et al. 2022, Mol. Ther. Methods Clin. Dev. 24:367-378) and paradoxically causes ISC deficiency dependent on Frataxin binding to NFS1 (Huichalaf et al.2022, Mol. Ther. Methods Clin. Dev. 24:367-378). The ability of Frataxin to competitively inhibit FDX2 binding to NFS 1 (Uzarska et al. 2021, J. Biol. Chem. 298:101570) explains why Frataxin over-expression is toxic and motivates genetic therapies that restore the stoichiometric balance of Frataxin and FDX2. In this study we demonstrate that even in contexts of no Frataxin protein (e.g., C. elegans null mutant) or extremely low levels of Frataxin (e.g., Dox-inducible shFXN mouse), lowering FDX2 levels to 50% of wild type is beneficial. This may be due to FDX2 actively inhibiting the cysteine desulfurase and / or persulfide transfer activities of NFS1 that are normally activated by Frataxin.
[0130] Experiments in normoxia and hypoxia may also further illuminate the mechanism by which hypoxia rescues defects in iron sulfur cluster biosynthesis. In addition to rescuing Frataxin deficiency (Astetal. 2019, Cell 177:1507-1521), hypoxia rescues growth defects and ISC deficiencies caused by (1) over-expression of FDX2 or (2) weakening of the NFS1 -FDX2 interaction (Fig. 3). This rescue suggests that hypoxia circumvents the necessity of the FXN / FDX2 binding site altogether for iron sulfur cluster assembly, possibly through an alternative complex conformation. In support, the FDX2 binding site on the ISC assembly complex may vary with redox state or oxygenation (Uzarska et al. 2021, J. Biol. Chem.298:101570; Boniecki etal. 2017, Nat. Commun. 8:1287). Alternatively, hypoxia rescue could result from increased stability of ISCs in a low oxygen environment, such that mutations giving rise to very low (non-zero) levels of ISC are now viable. Indeed, the primary cellular defect associated with oxygen toxicity is loss of vulnerable ISC-containing proteins (Baik et al. 2023, Mol. Cell 83:942-960.e9).
[0131] The FDX2 protein is required for iron sulfur cluster synthesis, so it was surprising that knocking it down in the background of FXN mutation / deficiency was beneficial. This idea is further supported by the observation that although FDX2 loss causes a recessive disease inWSGRRef. 71197-702.601humans, the heterozygous parents are healthy, implying that some loss of FDX2 can be tolerated.
[0132] Thus, partial knockdown of FDX2, e.g., via inhibitory nucleic acids, e.g., antisense oligonucleotides (ASO) or RNAi (e.g., using small interfering RNA (siRNA) or short hairpin RNA (shRNA)) can be used as a therapeutic approach in subjects with disorders associated with mutations in the FXN gene, e.g., Friedreich ataxia (FRDA).Inhibitory Nucleic Acids
[0133] Inhibitory nucleic acids disclosed in the present methods and compositions include single-stranded antisense oligonucleotides, oligomeric duplexes such as siRNA compounds, single- or double-stranded RNA interference (RNAi) compounds such as siRNA compounds, modified bases / locked nucleic acids (LNAs), peptide nucleic acids (PNAs), and other oligomeric compounds or oligonucleotide mimetics that specifically hybridize to at least a portion of a target nucleic acid and modulate its function to reduce expression of the FDX2 protein. In some embodiments, the inhibitory nucleic acids include antisense RNA, antisense DNA, chimeric antisense oligonucleotides, antisense oligonucleotides comprising modified linkages, interference RNA (RNAi), short interfering RNA (siRNA), short hairpin RNA (shRNA), or combinations thereof.
[0134] In some embodiments, the inhibitory nucleic acids are 10 to 50, 10to20, 10to25, 13 to 50, or 13 to 30 nucleotides in length. In some instances, the inhibitory nucleic acids comprise complementary portions of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length, or any range therewithin. In some embodiments, the inhibitory nucleic acids are 15 nucleotides in length. In some embodiments, the inhibitory nucleic acids are 12 or 13 to 20, 25, or 30 nucleotides in length. One having ordinary skill in the art will appreciate that this embodies inhibitory nucleic acids having complementary portions of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23,24, 25,26, 27,28, 29 or 30 nucleotides in length, or any range therewithin (complementary portions refers to those portions of the inhibitory nucleic acids that are complementary to the target sequence).
[0135] The inhibitory nucleic acids disclosed herein are sufficiently complementary to the target RNA, i.e., hybridize sufficiently well and with sufficient specificity, to give the desired effect. In some instances, the inhibitory nucleic acids are sufficiently complementary to the target RNA where at least 75%, 80%, 85%, 90%, or 95% nucleobases of the inhibitory nucleic acids are complementary to the target nucleic acids in its equal length. In some instances, the inhibitory nucleic acids are sufficiently complementary to the target RNA where at least 7, 8, 9,WSGRRef. 71197-702.601or 10 consecutive nucleobases are complementary to the target nucleic acids in its equal length.100% complementarity is not required to be sufficiently complementary.
[0136] In some embodiments, inhibitory nucleic acids are designed using bioinformatics methods known in the art to identify regions of secondary structure, e.g., one, two, or more stem-loop structures, or pseudoknots, and selecting those regions to target with an inhibitory nucleic acid. For example, “gene walk” methods canbe used to optimize the inhibitory activity of the nucleic acid; for example, a series of oligonucleotides of 10-30 nucleotides spanning the length of a target RNA can be prepared, followed by testing for activity. Optionally, gaps, e.g., of 5-10 nucleotides or more, can be left between the target sequences to reduce the number of oligonucleotides synthesized and tested. In some embodiments, GC content is preferably between about 30-60%. Contiguous runs of three or more Gs or Cs should be avoided where possible (for example, it may not be possible with very short (e.g., about 9-10 nt) oligonucleotides).
[0137] In general, the inhibitory nucleic acids useful in the methods described herein have at least 80% sequence complementarity to a target region within the target nucleic acid, e.g., 90%, 95%, or 100% sequence complementarity to the target region within an RNA. For example, an antisense compound in which 18 of 20 nucleobases of the antisense oligonucleotide are complementary, and would therefore specifically hybridize, to a target region would represent 90 percent complementarity. Percent complementarity of an inhibitory nucleic acid with a region of a target nucleic acid can be determined routinely using basic local alignment search tools (BLAST programs) (Altschul et al. 1990, J. Mol. Biol. 215 :403 -410; Zhang and Madden 1997, Genome Res. 7:649-656). Inhibitory nucleic acids that hybridize to an RNA can be identified through routine experimentation. In general, the inhibitory nucleic acids must retain specificity for their target, i.e., mustnot directly bind to, or directly significantly affect expression levels of, transcripts other than the intended target.
[0138] For further disclosure regarding inhibitory nucleic acids, see US2010 / 0317718 (antisense oligos); US2010 / 0249052 (double -stranded ribonucleic acid (dsRNA));US2009 / 0181914 and US2010 / 0234451 (LNAs); US2007 / 0191294 (siRNA analogues); US2008 / 0249039 (modified siRNA); and WO2010 / 129746 and W02010 / 040112 (inhibitory nucleic acids).Antisense Compounds
[0139] In some embodiments, inhibitory nucleic acids are single stranded antisense oligonucleotides (ASOs) or double stranded oligomeric duplexes such as siRNA comprising at least one antisense oligonucleotide strand. Antisense oligonucleotides are typically designed toWSGRRef. 71197-702.601block expression of a DNA or RNA target by binding to a target (e.g., a target nucleic acid) and halting expression at the level of transcription, translation, or splicing. Antisense oligonucleotides of the present disclosure are complementary nucleic acid sequences designed to hybridize under stringent conditions to a target nucleic acid, such as a target RNA. Thus, oligonucleotides are chosen that are sufficiently complementary to the target, i.e., that hybridize sufficiently well and with sufficient specificity, to give the desired effect.
[0140] In some embodiments, an antisense compound has a nucleobase sequence that, when written in the 5’ to 3’ direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted. In certain such embodiments, an antisense oligonucleotide has a nucleobase sequence that, when written in the 5 ’ to 3 ’ direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted.
[0141] In some embodiments, an antisense compound targeting a target nucleic acid is 12 to 30 nucleotides in length. In some embodiments, an antisense compound is 12 to 25 nucleotides in length. In some embodiments, an antisense compound is 12 to 22 nucleotides in length. In some embodiments, an antisense compound nucleotides is 14 to 20 nucleotides in length. In some embodiments, an antisense compound nucleotides is 16 to 22 nucleotides in length. In some embodiments, an antisense compound is 15 to 25 nucleotides in length. In some embodiments, an antisense compound is 18 to 22 nucleotides in length. In some embodiments, an antisense compound is 19 to 21 nucleotides in length. In some embodiments, the antisense compound is 8 to 80, 12 to 50, 13 to 30, 13 to 50, 14 to 30, 14 to 50, 15 to 30, 15 to 50, 16 to 30, 16to 50, 17 to 30, 17 to 50, 18 to 30, 18 to 50, 19 to 30, 19 to 50, or 20 to 30 linked nucleosides in length.
[0142] In some embodiments, an antisense compound is about 12 nucleotides in length. In some embodiments, an antisense compound is about 13 nucleotides in length. In some embodiments, an antisense compound is about 14 nucleotides in length. In some embodiments, an antisense compound is about 15 nucleotides in length. In some embodiments, an antisense compound is about 16 nucleotides in length. In some embodiments, an antisense compound is about 17 nucleotides in length. In some embodiments, an antisense compound is about 18 nucleotides in length. In some embodiments, an antisense compound is about 19 nucleotides in length. In some embodiments, an antisense compound is about 20 nucleotides in length. In some embodiments, an antisense compound is about 21 nucleotides in length. In some embodiments, an antisense compound is about 22 nucleotides in length. In some embodiments, an antisense compound is about 23 nucleotides in length. In some embodiments, an antisense compound is about 24 nucleotides in length. In some embodiments, an antisense compound is about 25 nucleotides in length. In some embodiments, an antisense compound is about 26 nucleotides inWSGRRef. 71197-702.601length. In some embodiments, an antisense compound is about 27 nucleotides in length. In some embodiments, an antisense compound is about 28 nucleotides in length. In some embodiments, an antisense compound is about 29 nucleotides in length. In some embodiments, an antisense compound is about 30 nucleotides in length.
[0143] In some embodiments, antisense oligonucleotides targeting a target nucleic acid may be shortened or truncated. For example, a single nucleoside may be deleted from the 5’ end (5’ truncation), or alternatively from the 3’ end (3’ truncation). A shortened or truncated antisense compound targeted to a target nucleic acid may have two nucleosides deleted from the 5’ end, or alternatively may have two nucleosides deleted from the 3 ’ end, of the antisense compound. Alternatively, the deleted nucleosides maybe dispersed throughout the antisense compound, for example, in an antisense compound having one nucleoside deleted from the 5 ’ end and one nucleoside deleted from the 3’ end.
[0144] When a single additional subunit is present in a lengthened antisense compound, the additional nucleoside maybe located at the 5’ or 3’ end of the antisense compound. When two or more additional nucleosides are present, the added subunits maybe adjacent to each other, for example, in an antisense compound having two nucleosides added to the 5’ end (5’ addition), or alternatively to the 3’ end (3’ addition), of the antisense compound. Alternatively, the added subunits may be dispersed throughout the antisense compound, for example, in an antisense compound having one nucleoside added to the 5’ end and one subunit added to the 3’ end. In some instances, the added nucleoside is not complementary to the corresponding region of the target nucleic acid.
[0145] A person of skill in the art will understand that it is possible to increase or decrease the length of an antisense compound, such as an antisense oligonucleotide, and / or introduce mismatch bases without eliminating activity. See, for example, Woolf et al. 1992, Proc. Natl. Acad. Sci. USA 89:7305-7309; Gautschi et al. 2001, J. Natl. Cancer Inst. 93:463-471); and Maher and Dolnick 1988, Nuc. Acid. Res. 16:3341-3358.
[0146] In some embodiments, antisense oligonucleotides targeting a target nucleic acid have chemically modified subunits arranged in patterns, or motifs, to confer to the antisense oligonucleotide properties such as enhanced inhibitory activity, increased binding affinity for a target nucleic acid, or resistance to degradation by in vivo nucleases. Such modified antisense oligonucleotides are referred to as either antisense oligonucleotides or antisense compounds.
[0147] A nucleoside is a base-sugar combination. The nucleobase (also known as base) portion of the nucleoside is normally a heterocyclic base moiety (e.g., adenine, cytosine, guanine,WSGRRef. 71197-702.601thymine, and uracil, for the canonical nucleobases). Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to the 2 ’, 3’ or 5 ’ hydroxyl moiety of the sugar. Oligonucleotides are formed through the covalent linkage of adjacent nucleosides to one another, to form a linear polymeric oligonucleotide. Within the oligonucleotide structure, the phosphate groups are commonly referred to as forming the internucleoside linkages of the oligonucleotide.
[0148] Modifications to antisense compounds encompass substitutions or changes to internucleoside linkages, sugar moieties, or nucleobases. Modified antisense compounds are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target, increased stability in the presence of nucleases, or increased inhibitory activity.
[0149] Chemically modified nucleosides may also be employed to increase the binding affinity of a shortened or truncated antisense oligonucleotide for its target nucleic acid. Consequently, comparable results can often be obtained with shorter antisense compounds that have such chemically modified nucleosides.Modified Internucleoside Linkages
[0150] The naturally occurring intemucleoside linkage of RNA and DNA is a 3 ’ to 5’ phosphodiester linkage. Antisense compounds having one or more modified, i.e., non-naturally occurring, internucleoside linkages are often selected over antisense compounds having naturally occurring internucleoside linkages because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases.
[0151] Oligonucleotides having modified internucleoside linkages include internucleoside linkages that retain a phosphorus atom as well as internucleoside linkages that do not have a phosphorus atom. Representative phosphorus containing internucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidates, and phosphorothioates. Methods of preparation of phosphorous -containing and non-phosphorous-containing linkages are well known.
[0152] In some embodiments, antisense compounds targeted to a FDX2 nucleic acid comprise one or more modified internucleoside linkages. In some embodiments, the modified internucleoside linkages are interspersed throughout the antisense compound. In some embodiments, the modified internucleoside linkages are phosphorothioate linkages. In some embodiments, each internucleoside linkage of an antisense compound is a phosphorothioateWSGRRef. 71197-702.601internucleoside linkage. In some embodiments, the modified internucleoside linkages are phosphorodithioate linkages. In some embodiments, the modified internucleoside linkages are methoxypropyl phosphonate (MOP) linkages.
[0153] In some embodiments, an antisense compound described herein is a gapmer comprising a gap segment having modified internucleoside linkages. In some embodiments, a gap segment is modified at the linkage between the 2 and the 3 position with methoxypropyl phosphonate linkages.Modified Sugar Moieties
[0154] Antisense compounds can optionally contain one or more nucleosides wherein the sugar group has been modified. Such sugar modified nucleosides may impart enhanced nuclease stability, increased binding affinity, or some other beneficial biological property to the antisense compounds. In some embodiments, nucleosides comprise chemically modified ribofuranose ring moieties. Examples of chemically modified ribofuranose rings include without limitation, addition of substituent groups (including 5’ and 2’ substituent groups, bridging of non -geminal ring atoms to form bicyclic nucleic acids (BNA), replacement of the ribosyl ring oxygen atom with S, N(R), or C(R1)(R2) (R, R1 and R2 are each independently H, C1-C12 alkyl or a protecting group) and combinations thereof. Examples of chemically modified sugars include 2 ’-F-5’ -methyl substituted nucleoside (see W02008 / 101157 for other disclosed 5 ’,2’-bis substituted nucleosides) or replacement of the ribosyl ring oxygen atom with S with further substitution at the 2’-position (see US20050130923) or alternatively 5 ’-substitution of a BNA (see W02007 / 134181, wherein LNA is substituted with for example a 5 ’-methyl or a 5’-vinyl group).
[0155] Examples of nucleosides having modified sugar moieties include without limitation nucleosides comprising 5’-vinyl, 5’-methyl (R or S), 4’-S, 2’-F, 2’-OCH3, 2’-OCH2CH3, 2’-OCH2CH2F and 2’-O(CH2)2OCH3 substituent groups. The substituent at the 2’position can also be selected from allyl, amino, azido, thio, -O-allyl, -O-C1-C10 alkyl, -OCF3, -OCH2F, -O(CH2)2SCH3, -O(CH2)2O-N(Rm)(Rn), -O-CH2-C(=O)-N(Rm)(Rn), and -O-CH2-C(=O)-N(Rl)-(CH2)2-N(Rm)(Rn), where each Rl, Rm and Rn is, independently, H or substituted or unsubstituted Cl -CIO alkyl.
[0156] As used herein, “bicyclic nucleosides” refer to modified nucleosides comprising a bicyclic sugar moiety. Examples of bicyclic nucleosides include without limitation nucleosides comprising a bridge between the 4’ and the 2’-ribosyl ring atoms. In some embodiments, antisense compounds provided herein include one or more bicyclic nucleosides comprising a 4 ’ to 2’ bridge. Examples of such 4’ to 2’ bridged bicyclic nucleosides, include but are not limitedWSGRRef. 71197-702.601to one of the formulae: 4’-(CH2)-O-2’ (LNA); 4’-(CH2)-S-2’; 4’-(CH2)2-O-2’ (ENA); 4’-CH(CH3)-O-2’ and 4’-CH(CH2OCH3)-O-2’ (and analogs thereof see US7399845); 4’-C(CH3)(CH3)-O-2’ (and analogs thereof see W02009 / 006478); 4’-CH2-N(OCH3)-2’ (and analogs thereof see W02008 / 150729); 4’-CH2-O-N(CH3)-2’ (see US20040171570); 4’-CH2-N(R)-0-2’, wherein R is H, C1-C12 alkyl, or a protecting group (see US7427672); 4’-CH2-C(H)(CH3)-2’ (see Chattopadhyaya et al. 2009, J. Org. Chem. 74:118-134); and 4’-CH2-C-(=CH2)-2’ (and analogs thereof see W02008 / 154401).
[0157] For additional information regarding LNAs see US Patent Nos. US6268490;US6734291; US6770748; US6794499; US7034133; US7053207; US7060809; US7084125; and US7572582; and US Patent Publication Nos. US20100267018; US20100261175; and US20100035968; Koshkin et al. 1998, Tetrahedron 54:3607-3630; Obika et al. 1998, Tetrahedron Lett. 39:5401-5404; Jepsen et al. 2004, Oligonucleotides 14:130-146; Kauppinen et al. 2005, Drug Disc. Today 2(3):287-290; and Ponting et al. 2009, Cell 136(4):629-641.
[0158] Further reports related to bicyclic nucleosides can also be found in published literature (see for example: Singh et al. 1998, Chem. Commun. 4:455-456; Koshkin et al. 1998, Tetrahedron: 54:3607-3630; Wahlestedt et al. 2000, Proc. Natl. Acad. Sci. U S. A. 97:5633-5638; Kumar et al. 1998, Bioorg. Med. Chem. Lett. 8:2219-2222; Singh et al. 1998, J. Org. Chem. 63:10035-10039; Srivastava etal. 2007, J. Am. Chem. Soc. 129(26):8362-8379; Elayadi et al. 2001, Curr. Opinion Invest. Drugs 2:558-561; Braasch etal. 2001, Chem. Biol. 8:1-7; and Orum et al. 2001, Curr. Opinion Mol. Ther. 3:239-243; US Patent Nos. US6268490;US6525191; US6670461; US6770748; US6794499; US7034133; US7053207; US7399845; US7547684; andUS7696345;USPatentPublicationNos. US20080039618; US20090012281; Published PCT International application Nos. WO 1994 / 014226; W02004 / 106356;W02005 / 021570; W02007 / 134181; W02008 / 150729; W02008 / 154401; and W02009 / 006478. Each of the foregoing bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations including for example a-L-ribofuranose and -D-ribofuranose (see WO99 / 14226).
[0159] In some embodiments, bicyclic sugar moieties of BNA nucleosides include, but are not limited to, compounds having at least one bridge between the 4 ’ and the 2’ position of the pentofuranosyl sugar moiety wherein such bridges independently comprises 1 or from 2 to 4 linked groups independently selected from -[C(Ra)(Rb)]n-, wherein n is 1, 2, 3, or 4; and each Ra and Rb is, independently, H, or Cl -Cl 2 alkyl.
[0160] In some embodiments, bicyclic nucleosides are further defined by isomeric configuration. For example, a nucleoside comprising a 4 ’-2’ methyleneoxy bridge, may be in theWSGRRef. 71197-702.601a-L configuration or in the -D configuration. Previously, a-L-methyleneoxy (4’-CH2-O-2’) BNAs have been incorporated into antisense oligonucleotides that showed antisense activity (Frieden et al. 2003, Nucleic Acids Research 21:6365-6372).
[0161] In some embodiments, bicyclic nucleosides include, but are not limited to, (A) a-L-methyleneoxy (4’-CH2-O-2’) BNA, (B) -D-methyleneoxy (4’-CH2-O-2’) BNA, (C) ethyleneoxy (4’ -(CH2)2-O-2’) BN A, (D) aminooxy (4’-CH2- O-N(R)-2’) BNA, (E) oxyamino (4’-CH2-N(R)-O-2’) BNA, and (F) methyl(methyleneoxy) (4’-CH(CH3)-O-2’) BNA, (G) methylene-thio (4’-CH2-S-2’) BNA, (H) methylene- amino (4’-CH2-N(R)-2’) BNA, (I) methyl carbocyclic (4’-CH2-CH(CH3)-2’)BNA, and (J) propylene carbocyclic (4’-(CH2)3-2’) BNA as depicted below.wherein Bx is the base moiety and R is independently H, a protecting group or C1-C12 alkyl.
[0162] As used herein, “2’-modified sugar moiety” or “2’-modified sugar” means a furanosyl sugar modified at the 2’ position. In some embodiments, such modifications include substituents selected from: a halide, including, but not limited to substituted and unsubstituted alkoxy, substituted and unsubstituted thioalkyl, substituted and unsubstituted amino alkyl, substituted and unsubstituted alkyl, substituted and unsubstituted allyl, and substituted and unsubstituted alkynyl. In some embodiments, 2’ modifications are selected from substituents including, but not limited to: -O[(CH2)nO]mCH3, -O(CH2)nNH2, -O(CH2)nCH3, -O(CH2)nF, -O(CH2)nONH2, -OCH2C(O)N(H)CH3, and -O(CH2)nON[(CH2)nCH3]2, where n and m are from 1 to about 10. Other 2 ’-substituent groups can also be selected from: C1-C12 alkyl, substituted alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, F, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl,WSGRRef. 71197-702.601heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving pharmacokinetic properties, or a group for improving the pharmacodynamic properties of an antisense compound, and other substituents having similar properties. In some embodiments, modified nucleosides comprise a 2’-M0E side chain (Baker et al. 1997, J. Biol. Chem. 272:11944-12000). Such 2’-M0E substitutions have been described as having improved binding affinity compared to unmodified nucleosides and to other modified nucleosides, such as 2’-O-methyl, O-propyl, and O-aminopropyl. Oligonucleotides having the 2’-M0E substituent also have been shown to be antisense inhibitors of gene expression with promising features for in vivo use (Martin 1995, Helv. Chim. Acta 78:486-504; Altmann et al. 1996, Chimia 50:168-176; Altmann et al. 1996, Biochem. Soc. Trans. 24:630-637; and Altmann et al. 1997, Nucleosides Nucleotides 16:917-926).
[0163] As used herein, “2’-modified” or “2 ’-substituted” refers to a nucleoside comprising a sugar comprising a substituent at the 2’ position other than H or OH. 2 ’-modified nucleosides, include, but are not limited to, bicyclic nucleosides wherein the bridge connecting two carbon atoms of the sugar ring connects the 2’ carbon and another carbon of the sugar ring; and nucleosides with non-bridging 2’ substituents, such as allyl, amino, azido, thio, O -allyl, O-Cl-C10 alkyl, -OCF3, O-(CH2)2-O-CH3, 2’-O(CH2)2SCH3, 0-(CH2)2-O-N(Rm)(Rn), or O-CH2-C(=0)-N(Rm)(Rn), where each Rm and Rn is, independently, H or substituted or unsubstituted Cl -CIO alkyl. 2 ’-modifed nucleosides may further comprise othermodifications, for example at other positions of the sugar and / or at the nucleobase.
[0164] In some embodiments, a sugar modification is an unlocked nucleic acid (UNA) or a glycerol nucleic acid (GNA). Exemplary sugar modifications are described by Hu et al. 2020, Signal Transduction and Targeted Therapy 5:101.
[0165] Many other bicyclo and tricyclo sugar surrogate ring systems are also known in the art that can be used to modify nucleosides for incorporation into antisense compounds (see for example Leumann 2002, Bioorg. Med. Chem. 10:841-854). Such ring systems can undergo various additional substitutions to enhance activity.
[0166] Methods for the preparations of modified sugars are well known to those skilled in the art.
[0167] In nucleotides having modified sugar moieties, the nucleobase moieties (natural, modified or a combination thereof) are maintained for hybridization with an appropriate nucleic acid target.WSGRRef. 71197-702.601
[0168] Chimeric antisense compounds typically contain at least one region modified so as to confer increased resistance to nuclease degradation, increased cellular uptake, increased binding affinity for the target nucleic acid, and / or increased inhibitory activity. A second region of a chimeric antisense compound may optionally serve as a substrate for the cellular endonuclease RNase H, which cleaves the RNA strand of an RNA:DNA duplex.Modified Nucleobases
[0169] In some embodiments, modified oligonucleotides comprise one or more nucleosides comprising an unmodified nucleobase. In some embodiments, modified oligonucleotides comprise one or more nucleosides comprising a modified nucleobase. In some embodiments, modified oligonucleotides comprise one or more nucleosides that do not comprise a nucleobase, referred to as an abasic nucleoside. In some embodiments, modified oligonucleotides contain no abasic nucleosides. In some embodiments, modified oligonucleotides comprise one or more inosine nucleosides (i.e., nucleosides comprising a hypoxanthine nucleobase). An “unmodified nucleobase” is unmodified adenine (A), unmodified thymine (T), unmodified cytosine (C), unmodified uracil (U), or unmodified guanine (G). A modified nucleobase is a group of atoms other than unmodified A, T, C, U, or G capable of pairing with atleast one other nucleobase. 5-methylcytosine and hypoxanthine are examples of modified nucleobases.
[0170] In some embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified sugar moiety or sugar surrogate. In some embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified nucleobase. In some embodiments, modified oligonucleotides comprise one or more modified internucleoside linkages. In certain such embodiments, the modified, unmodified, and differently modified sugar moieties, sugar surrogates, nucleobases, and / or intemucleoside linkages of a modified oligonucleotide define a pattern or motif. In some embodiments, the patterns of sugar moieties, sugar surrogates, nucleobases, and internucleoside linkages are each independent of one another. Thus, a modified oligonucleotide may be described by its sugar motif, nucleobase motif and / or internucleoside linkage motif (as used herein, nucleobase motif describes the modifications to the nucleobases independent of the nucleobase sequence). Examples of modifications for oligonucleotides are described in WO2024 / 209394.Modified Inhibitory Nucleic Acids
[0171] leanin some embodiments, the inhibitory nucleic acids used in the methods described herein are modified, e.g., comprise oneor more modified bonds or bases. A numb er of modified bases include phosphorothioate, methylphosphonate, peptide nucleic acids, or locked nucleic acid (LNA) molecules. Some inhibitory nucleic acids are fully modified, while others areWSGRRef. 71197-702.601chimeric and contain two or more chemically distinct regions, each made up of at least one nucleotide. These inhibitory nucleic acids typically contain at least one region of modified nucleotides that confers one or more beneficial properties (such as, for example, increased nuclease resistance, increased uptake into cells, increased binding affinity for the target) and a region that is a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids. Chimeric inhibitory nucleic acids of the invention may be formed as composite structures of two or more oligonucleotides, modified oligonucleotides, oligonucleosides and / or oligonucleotide mimetics as described above. Such compoundshave also been referred to in the art as hybrids or gapmers. Representative United States patents that teach the preparation of such hybrid structures comprise, but are not limited to, US Patent Nos. US5013830; US5149797;US5220007; US5256775; US5366878; US5403711; US5491133; US5565350; US5623065; US5652355; US5652356; and US5700922.
[0172] In some embodiments, the inhibitory nucleic acid comprises at least one nucleotide modified atthe 2’ position of the sugar, most preferably a 2’-O-alkyl, 2’-O-alkyl-O-alkyl or 2’-fluoro-modified nucleotide. In other preferred embodiments, RNA modifications include 2 fluoro, 2’-amino and 2’-O-methyl modifications on the ribose of pyrimidines, abasic residues or an inverted base at the 3 ’ end of the RNA. Such modifications are routinely incorporated into oligonucleotides and these oligonucleotides have been shown to have a higher Tm (i.e., higher target binding affinity) than 2 ’-deoxy oligonucleotides against a given target.
[0173] A number of nucleotide and nucleoside modifications have been shown to make the oligonucleotide into which they are incorporated more resistant to nuclease digestion than the native oligodeoxynucleotide; these modified oligos survive intact for a longer time than unmodified oligonucleotides. Specific examples of modified oligonucleotides include those comprising modified backbones, for example, phosphorothioates, phosphotriesters, methyl phosphonates, short chain alkyl or cycloalkyl intersugar linkages or short chain heteroatomic or heterocyclic intersugar linkages. Phosphorus-containing linkages include, but are not limited to, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates comprising 3 ’-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates comprising 3 ’-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3 ’-5’ linkages, 2’-5’ linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3’-5’ to 5’-3’ or2’-5’ to 5’-2’; see US PatentNos. US3687808; US4469863; US4476301; US5023243; US5177196; US5188897; US5264423;WSGRRef. 71197-702.601US5276019; US5278302; US5286717; US5321131; US5399676; US5405939; US5453496; US5455233; US5466677; US5476925; US5519126; US5536821; US5541306; US5550111 ; US5563253; US5571799; US5587361; and US5625050.
[0174] Morpholino-based oligomeric compounds are described in Braasch and Corey 2002, Biochemistry 41(14):4503 -4510; Heasman 2002, J. Dev. Biol. 243 :209-214; Nasevicius et al.2000, Nat. Genet. 26:216-220; Lacerra et al. 2000, Proc. Natl. Acad. Sci. 97:9591-9596; and US5034506.
[0175] Cyclohexenyl nucleic acid oligonucleotide mimetics are described in Wang et al. 2000, J. Am. Chem. Soc. 122:8595-8602.
[0176] Modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic intemucleoside linkages. These comprise those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioform acetyl backbones; methylene formacetyl andthioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts; see US Patent Nos. US5034506; US5166315; US5185444; US5214134; US5216141; US5235033;US5264562; US5264564; US5405938; US5434257; US5466677; US5470967; US5489677; US5541307; US5561225; US5596086; US5602240; US5610289; US5602240; US5608046; US5610289; US5618704; US5623070; US5663312; US5633360; US5677437; andUS5677439.
[0177] One or more substituted sugar moieties can also be included, e.g., one of the following at the 2’ position: -OH, -SH, -SCH3, -F, -OCN, -OCH3, -O(CH2)nCH3, -O(CH2)nNH2 or -O(CH2)nCH3 where n is from 1 to about 10; Cl to CIO lower alkyl, alkoxyalkoxy, substituted lower alkyl, alkaryl or aralkyl; -Cl; -Br; -CN; -CF3; -OCF3; -O-, -S-, or -N-alkyl; -O-, -S-, or -N-alkenyl; -SOCH3; -SO2CH3; -ONO2; -NO2; -N3; -NH2; heterocycloalkyl; heterocycloalkaryl; aminoalkylamino; poly alkylamino; substituted silyl; an RNA cleaving group; a reporter group; an intercalator; a group for improving the pharmacokinetic properties of an oligonucleotide; or a group for improving the pharmacodynamic properties of an oligonucleotide and other substituents having similar properties. A preferred modification includes 2 ’-meth oxy ethoxy [2’-O-CH2CH2OCH3, also known as 2 ’-O-(2 -methoxy ethyl)] (Martin et al. 1995, Helv. Chim. Acta 78:486-504). Other preferred modifications include 2’-methoxy (2’-0Me), 2’-propoxy (2’-OCH2CH2CH3) and2’-fluoro (2’-F). Similar modificationsWSGRRef. 71197-702.601may also be made at other positions on the oligonucleotide, particularly the 3 ’ position of the sugar on the 3’ terminal nucleotide and the 5’ position of 5’ terminal nucleotide.Oligonucleotides may also have sugar mimetics such as cyclobutyls in place of the pentofuranosyl group.
[0178] Inhibitory nucleic acids can also include, additionally or alternatively, nucleobase (often referred to in the art simply as “base”) modifications or substitutions. As used herein, “unmodified” or “natural” nucleobases include adenine (A), guanine (G), thymine (T), cytosine (C) and uracil (U). Modified nucleobases include nucleobases found only infrequently or transiently in natural nucleic acids, e.g., hypoxanthine, 6 -methyladenine, 5 -Me pyrimidines, particularly 5 -methylcytosine (also referred to as 5-methyl-2’ deoxy cytosine and often referred to in the art as 5-Me-C), 5-hydroxymethylcytosine (HMC), glycosyl HMC and gentobiosyl HMC, as well as synthetic nucleobases, e.g., 2 -aminoadenine, 2-(methylamino)adenine, 2-(imidazolylalkyl)adenine, 2-(aminoalklyamino)adenine or other heterosubstituted alkyladenines, 2-thiouracil, 2-thiothymine, 5 -bromouracil, 5- hydroxymethyluracil, 8 -azaguanine, 7-deazaguanine,N6 (6 -aminoh exyl)adenine and 2,6- diaminopurine (Gebeyehu et al. 1987, Nucl. Acids Res. 15:4513-4534). A “universal” base known in the art, e.g., inosine, can also be included. 5-Me-C substitutions havebeen shown to increase nucleic acid duplex stability by 0.6-1.2 oC. See Sanghvi, Y. S., in Crooke, S. T. and Lebleu, B., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278.
[0179] It is not necessary for all positions in a given oligonucleotide to be uniformly modified, and in fact more than one of the aforementioned modifications may be incorporated in a single oligonucleotide or even at within a single nucleoside within an oligonucleotide.
[0180] In some embodiments, both a sugar and an internucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with novel groups. The base units are maintained for hybridization with an appropriate nucleic acid target compound. One such oligomeric compound, an oligonucleotide mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar -backboneof an oligonucleotide is replaced with an amide containing backbone, for example, an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Exemplary PNA compounds are disclosed in US Patent Nos. US5539082, US5714331, US5719262, and Nielsen et al. 1991, Science 254:1497-1500.
[0181] Inhibitory nucleic acids can also include one or more nucleobase (often referred to in the art simply as “base”) modifications or substitutions. As used herein, “unmodified” orWSGRRef. 71197-702.601“natural” nucleobases comprise the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleobases comprise other synthetic and natural nucleobases such as 5 -methylcytosine (5-me-C), 5 -hydroxymethyl cytosine, xanthine, hypoxanthine, 2 -aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2 -thiouracil, 2-thiothymine and2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5 -uracil (pseudo -uracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8- thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5 -halo particularly 5-bromo, 5 -trifluoromethyl and other 5 -substituted uracils and cytosines, 7-methylquanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3 -deazaadenine.
[0182] Further, nucleobases comprise those disclosed in US Patent No. US3687808, those disclosed in ‘The Concise Encyclopedia of Polymer Science and Engineering’, pages 858-859, Kroschwitz, J. I., ed. John Wiley & Sons, 1990, and those disclosed by Sanghvi, Y. S., in Crooke, S. T. and Lebleu, B., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 28-302. Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds of the invention. These include 5 -substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, comprising 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. As noted above, 5-methylcytosine substitutions havebeen shown to increase nucleic acid duplex stability by 0.6-1.2 oC (Sanghvi, Y. S., in Crooke, S. T. and Lebleu, B., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are presently preferred base substitutions, even more particularly when combined with 2’-O-methoxy ethyl sugar modifications. Modified nucleobases are described in US Patent Nos. US3687808, as well as US4845205; US5130302; US5134066; US5175273; US5367066; US5432272; US5457187; US5459255; US5484908; US5502177; US5525711; US5552540; US5587469; US5596091; US5614617; US5750692; and US5681941.
[0183] In some embodiments, the inhibitory nucleic acids are chemically linked to one or more moieties or conjugates that enhance the activity, cellular distribution, or cellular uptake of the oligonucleotide. Such moieties comprise but are not limited to, lipid moieties such as a cholesterol moiety (Letsinger etal. 1989, Proc. Natl. Acad. Sci. USA 86:6553-6556), cholic acid (Manoharan et al. 1994, Bioorg. Med. Chem. Let. 4:1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan etal. 1992, Ann.N. Y. Acad. Sci. 660:306-309; Manoharan et al. 1993, Bioorg. Med. Chem. Let. 3:2765-2770), a thiocholesterol (Oberhauser et al. 1992, Nucl. AcidsWSGRRef. 71197-702.601Res. 20: 533-538), an aliphatic chain, e.g., dodecanediol or undecyl residues (Kabanov et al.1990, FEBS Lett. 259:327-330; Svinarchuk et al. 1993, Biochimie 75:49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium l,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan etal. 1995, Tetrahedron Lett. 36:3651-3654; Shea et al. 1990, Nucl. Acids Res. 18:3777-3783), a polyamine or a polyethylene glycol chain (Mancharan etal. 1995, Nucleosides & Nucleotides 14:969-973), or adamantane acetic acid (Manoharan et al. 1995, Tetrahedron Lett. 36:3651-3654), a palmityl moiety (Mishra etal. 1995, Biochim. Biophys. Acta 1264:229-237), or an octadecylamine or hexylamino-carbonyl-oxy cholesterol moiety (Crooke et al. 1996, J. Pharmacol. Exp. Ther. 277:923-937). See also US Patent Nos. US4828979;US4948882; US5218105; US5525465; US5541313; US5545730; US5552538; US5578717; US5580731; US5591584; US5109124; US5118802; US5138045; US5414077; US5486603; US5512439; US5578718; US5608046; US4587044; US4605735; US4667025; US4762779; US4789737; US4824941; US4835263; US4876335; US4904582; US4958013; US5082830; US5112963; US5214136; US5082830; US5112963; US5214136; US5245022; US5254469; US5258506; US5262536; US5272250; US5292873; US5317098; US5371241; US5391723; US5416203; US5451463; US5510475; US5512667; US5514785; US5565552; US5567810; US5574142; US5585481; US5587371; US5595726; US5597696; US5599923; US5599928 and US5688941. These moieties or conjugates can include conjugate groups covalently bound to functional groups such as primary or secondary hydroxyl groups. Conjugate groups of the invention include intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, poly ethers, groups that enhance the pharmacodynamic properties of oligomers, and groups that enhance the pharmacokinetic properties of oligomers. Typical conjugate groups include cholesterols, lipids, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes. Groups that enhance the pharmacodynamic properties, in the context of this invention, include groups that improve uptake, enhance resistance to degradation, and / or strengthen sequence-specific hybridization with the target nucleic acid. Groups that enhance the pharmacokinetic properties, in the context of this invention, include groups that improve uptake, distribution, metabolism or excretion of the compounds of the present invention. Representative conjugate groups are disclosed US6287860. Conjugate moieties include, but are not limited to, lipid moieties such as a cholesterol moiety, cholic acid, a thioether, e.g., hexyl -5 -tritylthiol, a thiocholesterol, an aliphatic chain, e.g., dodecanediol or undecyl residues, a phospholipid, e.g., di-hexadecyl-rac-glycerol or tri ethylammonium l,2-di-O-hexadecyl-rac-glycero-3-H-phosph onate, a poly amine or a polyethylene glycol chain, or adamantane acetic acid, a palmityl moiety, or an octadecylamine or hexylamino-carbonyl-oxy cholesterol moiety. See, e.g., US Patent Nos. US4828979;WSGRRef. 71197-702.601US4948882; US5218105; US5525465; US5541313; US5545730; US5552538; US5578717; US5580731; US5591584; US5109124; US5118802; US5138045; US5414077; US5486603; US5512439; US5578718; US5608046; US4587044; US4605735; US4667025; US4762779; US4789737; US4824941; US4835263; US4876335; US4904582; US4958013; US5082830; US5112963; US5214136; US5082830; US5112963; US5214136; US5245022; US5254469; US5258506; US5262536; US5272250; US5292873; US5317098; US5371241; US5391723; US5416203; US5451463; US5510475; US5512667; US5514785; US5565552; US5567810; US5574142; US5585481; US5587371; US5595726; US5597696; US5599923; US5599928 and US5688941.
[0184] In some embodiments, the inhibitory nucleic acids may be covalently linked to one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the resulting inhibitory nucleic acids. In the case of a single stranded antisense oligonucleotide (ASO) these moieties or conjugates may be covalently linked to either end or at an internal position. In the case of a double stranded oligomeric duplex such as siRNA these moieties or conjugates may be covalently linked to one or both ends and / or at an internal position of the antisense oligonucleotide strand and / or the sense oligonucleotide strand. In some embodiments, the inhibitory nucleic acids covalently linked one or more moieties or conjugates may be administered to a subject via a specific administration route (e.g., subcutaneously or intravenously).
[0185] Exemplary conjugate groups include cholesterol moietiesand lipid moieties. Additional conjugate groups include carbohydrates, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes. In some embodiments, an inhibitory nucleic acid may be covalently linked to one or more moieties thattarget the inhibitory nucleic acid to the central nervous system (CNS), e.g., via inclusion of a 2’-O-hexadecyl (Cl 6) moiety (e.g., see Brown et al. 2002, Nature Biotechnol. 40: 1500-1508). In some embodiments, the inhibitory nucleic acid is a double stranded oligomeric duplex such as siRNA and a saturated or unsaturated hydrocarbon chain (e.g., a C12-C22 hydrocarbon chain, such as a C12-C20 hydrocarbon chain, a C14-C22 hydrocarbon chain, a C16-C22 hydrocarbon chain, or a C16-C20 hydrocarbon chain) is conjugated to the sense oligonucleotide strand, e.g., at the 2’-0 position of a sugar ring. In some embodiments, the hydrocarbon chain is a saturated C16 hydrocarbon chain. In some embodiments, the inhibitory nucleic acid is a double stranded oligomeric duplex such as siRNA that includes 2’-O-hexadecyl (Cl 6) conjugated to the sense oligonucleotide strand.WSGRRef. 71197-702.601
[0186] In some embodiments, an inhibitory nucleic acid maybe covalently linked to a targeting moiety that targets the inhibitory nucleic acid to a particular tissue or cell type. In some embodiments, the inhibitory nucleic acid covalently linked to the targeting moiety can be administered to the subject to specifically deliver the inhibitory nucleic acid to the central nervous system (CNS) orto cardiac tissues. In some embodiments, a targeting moiety binds to one or more cellular membrane polypeptides. In some embodiments, a targeting moiety facilitates cellular uptake of an inhibitory nucleic acid. In some embodiments, a targeting moiety facilitates passage of an inhibitory nucleic acid across one or more membranes (e.g., cell membrane, blood-brain barrier). In some embodiments, a targeting moiety is or comprises a peptide, a protein, an aptamer, or an antibody or antigen binding fragment or region thereof, e.g, a single-domain antibody (e.g., VNAR, VHH), F(ab')2, Fab, Fab’, Fv, or scFv.
[0187] In some embodiments, a targeting moiety binds to human Transferrin receptor protein 1 (TfRl), also known as Cluster of Differentiation 71 (CD71). In some embodiments, a targeting moiety is or comprises an anti-TfRl antibody or antigen binding fragment or region thereof, e.g., a single-domain antibody (e.g., VNAR, VHH), F(ab')2, Fab, Fab’, Fv, or scFv. In some embodiments, the anti-TfRl antibody or antigen binding fragment or region thereof is any known in the art including but not limited to those described in WO1991 / 004753;W02013 / 103800; W02014 / 144060; WO2016 / 081643; WO2016 / 179257; WO2016 / 207240; WO2017 / 221883; WO2018 / 129384; WO2018 / 124121; WO2019 / 151539; WO2020 / 132584; W02020 / 028864; W02020 / 056327; US7208174; US9034329; and US10550188. In some embodiments, a targeting moiety is or comprises a peptide or protein that binds TfRl. In some embodiments, the peptide or protein that binds TfRl is any known in the art including but not limited to those described in W02019 / 140050; W02020 / 037150; W02020 / 124032; and US10138483. In certain embodiments, the peptide is a cyclic peptide, e.g., any known in the art including but not limited to those described in EP4108676; WO2023 / 027125; and WO2023 / 022234. In some embodiments, a targeting moiety is or comprises an aptamer that binds TfRl . In some embodiments, the aptamer capable of binding TfRl is any known in the art including but not limited to those described in WO2013 / 163303; W02019 / 033051; and WO2020 / 245198.
[0188] In some embodiments, a targeting moiety binds to CD98 heavy chain (CD98hc). In some embodiments, a targeting moiety is or comprises an anti-CD98hc antibody or antigen binding fragment or region thereof, e.g., a single-domain antibody (e.g., VNAR, VHH), F(ab')2, Fab, Fab’, Fv, or scFv. In some embodiments, the anti-CD98hc antibody or antigen binding fragment or region thereof is any known in the art including but not limited to those described inWSGRRef. 71197-702.601WO2024 / 026471A1; WO2019 / 246288A1; and WO2021 / 102276A1 . In some embodiments, a targeting moiety is or comprises a peptide or protein that binds CD98hc. In some embodiments, the peptide or protein that binds CD98hc is any known in the art including but not limited to those described in W02020 / 193316A1 and WO2023 / 114499A1 . In some embodiments, a targeting moiety is or comprises an aptamer that binds CD98hc.Antisense Oligonucleotides - Gapmer
[0189] Antisense compounds having a gapmer motif are considered chimeric antisense compounds. In a gapmer, an internal region (“gap”) having a plurality of nucleosides that supports RNaseH cleavage is positioned between external regions (“wings”) having a plurality of nucleotides that are chemically distinct from the nucleosides of the internal region. In the case of an antisense oligonucleotide having a gapmer motif, the gap segment generally serves as the substrate for endonuclease cleavage, while the wing segments comprise modified nucleosides. In some embodiments, the regions of a gapmer are differentiated by the types of sugar moieties comprising each distinct region. The types of sugar moieties that are used to differentiate the regions of a gapmer may in some embodiments include D-ribonucleosides, D-deoxyribonucleosides, 2 ’-modified nucleosides (such 2 ’-modified nucleosides may include 2’-MOE, and 2’-OMe among others), and bicyclic sugar modified nucleosides (such bicyclic sugar modified nucleosides may include those havinga4’-(CH2)n-O-2’ bridge, where n=l or n=2 and 4’-CH2-O-CH2-2’). In some embodiments, wings may include several modified sugar moieties, including, for example 2 ’-MOE, cEt, or locked nucleic acid (referred to as 2 ’-MOE modified nucleoside, cEt modified nucleoside, or LN A, respectively). In some embodiments, wings may include several modified and unmodified sugar moieties. In some embodiments, wings may include various combinations of 2 ’-MOE modified nucleoside, cEt modified nucleoside, LNAs, and 2’-deoxynucleosides.
[0190] In some embodiments, gapmers comprise one or more nucleosides having modified sugar moieties. In some embodiments, the modified sugar moiety is 2 ’-MOE. In some embodiments, the 2 ’-MOE modified nucleosides are arranged in a gapmer motif. In some embodiments, the modified sugar moiety is a bicyclic nucleoside having a (4’-CH(CH3)-O-2’) bridging group. In some embodiments, the (4’-CH(CH3)-O-2’) modified nucleosides are arranged throughout the wings of a gapmer motif.
[0191] In some embodiments, a gap segment (or a gap region) comprises a plurality of 2’-deoxynucleosides. In some embodiments, one or more 2’-deoxynucleosides of a gap region comprise a modified sugar moiety. In some embodiments, a 2’-deoxynucleoside is modified by 2’-OMe. In some embodiments, a gap segment is modified at the 2 or 3 position of the gapWSGRRef. 71197-702.601segment. In some embodiments, a gap segment comprises a plurality of 2 ’-deoxy nucleosides, wherein the 2 ’-deoxynucleoside at position 2 or 3 of the gap segment is modified by 2’-0Me modified nucleosides.
[0192] Each distinct region may comprise uniform sugar moieties, variant, or alternating sugar moieties.
[0193] The wing-gap-wing motif is frequently described as “X-Y-Z”, where “X” represents the length of the 5’ wing, “Y” represents the length of the gap, and “Z” represents the length of the 3’ wing. “X” and “Z” may comprise uniform, variant, or alternating sugar moieties. In some embodiments, “X” and “Y” may include one or more 2 ’-deoxynucleosides. In some embodiments, “Y”may comprise 2’-deoxynucleosides. As used herein, a gapmer described as “X-Y-Z” has a configuration such that the gap is positioned immediately adjacent to each of the 5’ wing and the 3’ wing. Thus, no intervening nucleotides exist between the 5’ wing and gap, or the gap and the 3’ wing. Any of the antisense compounds described herein can have a gapmer motif. In some embodiments, “X” and “Z” are the same length; in other embodiments they are different.
[0194] In some embodiments, gapmers provided herein include, for example 20-mers having a motif of 5-10-5. In some embodiments, gapmers provided herein include, for example 19-mers having a motif of 5-9-5. In some embodiments, gapmers provided herein include, for example 18-mers having a motif of 5-8-5. In some embodiments, gapmers provided herein include, for example, 18-mers having a motif of 4-10-4. In some embodiments, gapmers provided herein include, for example 18-mers having a motif of 4-8-6. In some embodiments, gapmers provided herein include, for example 18-mers having a motif of 6-8-4. In some embodiments, gapmers provided herein include, for example 18-mers having a motif of 5-7-6. In some embodiments, gapmers provided herein include, for example 16-mers having a motif of 3-10-3.
[0195] In some embodiments, a gapmer is represented by X-Y-Z, where X is a 5’ wing comprising three to five nucleosides, Y is a gap region comprising ten 2’-deoxynucleosides, and Z is a 3’ wing comprising three to five nucleosides. In some embodiments, a gapmer is represented by X-Y-Z, where X is a 5’ wing comprising three to five nucleosides, Y is a gap region comprising ten 2 ’-deoxynucleosides, and Z is a 3 ’ wing comprising three to five nucleosides, and wherein one or more nucleosides are 2 ’-MOE modified nucleoside, cEt modified nucleoside, or LNAs. In some embodiments, a gapmer is represented by X-Y-Z, where X is a 5’ wing comprising three to five nucleosides, Y is a gap region comprising ten 2’-deoxynucleosides, and Z is a 3 ’ wing comprising three to five nucleosides. In some embodiments, a gapmer is represented by X-Y-Z, where Xis a 5’ wing comprising three to fiveWSGRRef. 71197-702.601nucleosides, Y is a gap region comprising ten 2’-deoxynucleosides, and Z is a 3’ wing comprising three to five nucleosides, and wherein one or more nucleosides of X and Z are 2 MOE modified nucleoside, cEt modified nucleoside, or LNAs, and optionally, one or more 2’-deoxynucleosides of Y are 2’-0Me modified nucleoside.
[0196] In some embodiments, a gapmer is a 20-mer represented by X-Y-Z, where X is a 5’ wing comprising five nucleosides, Y is a gap region comprising ten 2’-deoxynucleosides, and Z is a 3’ wing comprising five nucleosides. In some embodiments, a gapmer is a 20-mer represented by X-Y-Z, where X is a 5 ’ wing comprising five nucleosides, wherein one or more nucleosides of X are 2’-M0E modified nucleosides, Y is a gap region comprising ten 2’-deoxynucleosides, and Z is a 3 ’ wing comprising five nucleosides, wherein one or more nucleosides ofZ are 2 ’-MOE modified nucleosides. In some embodiments, a gapmer is a 20-mer represented by X-Y-Z, where Xis a 5’ wing comprising five 2’-M0E modified nucleosides, Y is a gap region comprising ten 2 ’-deoxynucleosides, and Z is a 3 ’ wing comprising five 2’-M0E modified nucleosides.
[0197] In some embodiments, a gapmer is a 16-mer represented by X-Y-Z, where X is a 5’ wing comprising three nucleosides, Y is a gap region comprising ten 2’-deoxynucleosides, andZ is a 3’ wing comprising three nucleosides. In some embodiments, a gapmer is a 16-mer represented by X-Y-Z, where X is a 5 ’ wing comprising three nucleosides, wherein one or more nucleosides of X are cEt modified nucleoside or LNAs, Y is a gap region comprising ten 2’-deoxynucleosides, and Z is a 3 ’ wing comprising three nucleosides, wherein one or more nucleosides ofZ are cEt modified nucleoside or LNAs. In some embodiments, a gapmer is a 16-mer represented by X-Y-Z, where X is a 5 ’ wing comprising three nucleosides, Y is a gap region comprising ten 2’-deoxynucleosides, wherein one or more 2’-deoxynucleosides of Y are 2’-OMe modified nucleoside, and Z is a 3 ’ wing comprising three nucleosides. In some embodiments, a gapmer is a 16-mer represented by X-Y-Z, where X is a 5’ wing comprising three nucleosides, wherein one or more nucleosidesof X are cEt modified nucleoside or LNAs, Y is a gap region comprising ten 2’-deoxynucleosides, wherein one or more 2’-deoxynucleosides of Y are 2’-OMe modified nucleoside, and Z is a 3’ wing comprising three nucleosides, wherein one or more nucleosides of Z are cEt modified nucleoside or LNAs.
[0198] In some embodiments, at least one intemucleoside linkage of a gapmer is a modified internucleoside linkage. In some embodiments, at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage. In some embodiments, each modified internucleoside linkage is a phosphorothioate internucleoside linkage. In some embodiments, at least one internucleoside linkage is a phosphodiester internucleoside linkage. In some embodiments, atWSGRRef. 71197-702.601least one intemucleoside linkage is a phosphorothioate linkage and at least one internucleoside linkage is a phosphodiester linkage.
[0199] In some embodiments, in a 5-10-5 gapmer provided herein, the internucleoside linkage motif (from 5’ to 3’) is selected from sssssssssssssssssss, soooossssssssssooss, and ssooossssssssssooss wherein each ‘s’ is a phosphorothioate intemucleoside linkage and each ‘o’ is a phosphodiester intemucleoside linkage.
[0200] In some embodiments, in a 6-10-4 gapmer provided herein, the intemucleoside linkage motif (from 5’ to 3’) is selected from sssssssssssssssssss and sooooossssssssssoss, wherein each ‘s’ is a phosphorothioate intemucleoside linkage and each ‘o’ is a phosphodiester intemucleoside linkage.
[0201] In some embodiments, an antisense oligonucleotide (e.g., gapmer) comprises a sequence that targets the human FDX2 as shown in Table A (wherein each T may be independently and optionally replaced with U). In some embodiments, an antisense oligonucleotide (e.g., gapmer) does not comprise a sequence that targets the human FDX2 as shown in Table A.Table A - Exemplary ASOs 5’ to 3’ targeting the human FDX2 transcript
[0202] In some embodiments, an antisense oligonucleotide (e.g., gapmer) is or comprises about 12 or more nucleosides having a nucleobase sequence comprising at least 8 consecutive nucleobasesof any nucleobase sequences as provided in Table A-l, Table A-2, Table C-l, Table C-2, Table D, Table E, Table 3, or Table 4 (wherein each T may be independently and optionally replaced with U) (see section TABLES below). In some embodiments, an antisense oligonucleotide (e.g., gapmer) is or comprises about 12 or more nucleosides having a nucleobase sequence comprising at least 8 consecutive nucleobases of any nucleobase sequences as provided in Table A-l, Table A-2, Table C-l, Table C-2, Table D, Table E, Table 3, or Table 4 (wherein each T may be independently and optionally replaced with U), and wherein the antisense oligonucleotide is modified as described herein (and is referred to interchangeably as an antisense oligonucleotide and a modified antisense oligonucleotide).WSGRRef. 71197-702.601
[0203] In some embodiments, the present disclosure provides a compound that is a modified antisense oligonucleotide (e.g., gapmer) comprising about 12 to about 30 linked nucleosides and having a nucleobase sequence comprising about 8 to about 23 (e.g., about 8 to about 20) consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 8-1997, 3978-4374, 4375-4718, 4719-5096, 5097-5441, and 5442-5468 wherein each T may be independently and optionally replaced with U. In some embodiments, the modified antisense oligonucleotide (e.g., gapmer) comprises about 15 to about 25 linked nucleosides. In some embodiments, the modified antisense oligonucleotide (e.g., gapmer) comprises 16, 17, 18, 19, or 20 linked nucleosides.
[0204] In some embodiments, the present disclosure provides a compound that is a modified antisense oligonucleotide (e.g., gapmer) comprising about 12 to about30 linked nucleosides and having a nucleobase sequence comprising about 8 to about 23 (e.g., about 8 to about 20) consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 8-1997 wherein each T may be independently and optionally replaced with U. In some embodiments, the modified antisense oligonucleotide (e.g., gapmer) comprises about 15 to about 25 linked nucleosides. In some embodiments, the modified antisense oligonucleotide (e.g., gapmer) comprises 16, 17, 18, 19, or 20 linked nucleosides.
[0205] In some embodiments, the present disclosure provides a compound that is a modified antisense oligonucleotide (e.g., gapmer) comprising about 12 to about30 linked nucleosides and having a nucleobase sequence comprising about 8 to about 23 (e.g., about 8 to about 20) consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 3978-4374 wherein each T may be independently and optionally replaced with U. In some embodiments, the modified antisense oligonucleotide (e.g., gapmer) comprises about 15 to about 25 linked nucleosides. In some embodiments, the modified antisense oligonucleotide (e.g., gapmer) comprises 16, 17, 18, 19, or 20 linked nucleosides.
[0206] In some embodiments, the present disclosure provides a compound that is a modified antisense oligonucleotide (e.g., gapmer) comprising about 12 to about30 linked nucleosides and having a nucleobase sequence comprising about 8 to about 23 (e.g., about 8 to about 20) consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 4375-4718 wherein each T may be independently and optionally replaced with U. In some embodiments, the modified antisense oligonucleotide (e.g., gapmer) comprises about 15 to about 25 linked nucleosides. In some embodiments, the modified antisense oligonucleotide (e.g., gapmer) comprises 16, 17, 18, 19, or 20 linked nucleosides.WSGRRef. 71197-702.601
[0207] In some embodiments, the present disclosure provides a compound that is a modified antisense oligonucleotide (e.g., gapmer) comprising about 12 to about30 linked nucleosides and having a nucleobase sequence comprising about 8 to about 23 (e.g., about 8 to about 20) consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 4719-5096 wherein each T may be independently and optionally replaced with U. In some embodiments, the modified antisense oligonucleotide (e.g., gapmer) comprises about 15 to about 25 linked nucleosides. In some embodiments, the modified antisense oligonucleotide (e.g., gapmer) comprises 16, 17, 18, 19, or 20 linked nucleosides.
[0208] In some embodiments, the present disclosure provides a compound that is a modified antisense oligonucleotide (e.g., gapmer) comprising about 12 to about30 linked nucleosides and having a nucleobase sequence comprising about 8 to about 23 (e.g., about 8 to about 20) consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 5097-5441 wherein each T may be independently and optionally replaced with U. In some embodiments, the modified antisense oligonucleotide (e.g., gapmer) comprises about 15 to about 25 linked nucleosides. In some embodiments, the modified antisense oligonucleotide (e.g., gapmer) comprises 16, 17, 18, 19, or 20 linked nucleosides.
[0209] In some embodiments, the present disclosure provides a compound that is a modified antisense oligonucleotide (e.g., gapmer) comprising about 12 to about30 linked nucleosides and having a nucleobase sequence comprising about 8 to about 23 (e.g., about 8 to about 18) consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 5442-5468 wherein each T may be independently and optionally replaced with U. In some embodiments, the modified antisense oligonucleotide (e.g., gapmer) comprises about 15 to about 25 linked nucleosides. In some embodiments, the modified antisense oligonucleotide (e.g., gapmer) comprises 16, 17, or 18 linked nucleosides.
[0210] In some embodiments, the present disclosure provides a compound that is or comprises a modified antisense oligonucleotide (e.g., gapmer) consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11 , at least 12, atleast 13, atleast 14, atleast 15, atleast 16, atleast 17, atleast 18, atleast 19, or at least 20 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 8-1997, 3978-4374, 4375-4718, 4719-5096, 5097-5441, or 5442-5468 wherein each T may be independently and optionally replaced with U.
[0211] In some embodiments, the present disclosure provides a compound that is or comprises a modified antisense oligonucleotide (e.g., gapmer) consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, atleast 11, at leastWSGRRef. 71197-702.60112, atleast 13, atleast 14, atleast 15, atleast 16, atleast 17, atleast 18, atleast 19, or at least 20 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 8-1997 wherein each T may be independently and optionally replaced with U.
[0212] In some embodiments, the present disclosure provides a compound that is or comprises a modified antisense oligonucleotide (e.g., gapmer) consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, atleast 11, at least 12, atleast 13, atleast 14, atleast 15, atleast 16, atleast 17, atleast 18, atleast 19, or at least 20 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 3978-4374 wherein each T may be independently and optionally replaced with U.
[0213] In some embodiments, the present disclosure provides a compound that is or comprises a modified antisense oligonucleotide (e.g., gapmer) consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, atleast 11, at least 12, atleast 13, atleast 14, atleast 15, atleast 16, atleast 17, atleast 18, atleast 19, or at least 20 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 4375-4718 wherein each T may be independently and optionally replaced with U.
[0214] In some embodiments, the present disclosure provides a compound that is or comprises a modified antisense oligonucleotide (e.g., gapmer) consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, atleast 11, at least 12, atleast 13, atleast 14, atleast 15, atleast 16, atleast 17, atleast 18, atleast 19, or at least 20 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 4719-5096 wherein each T may be independently and optionally replaced with U.
[0215] In some embodiments, the present disclosure provides a compound that is or comprises a modified antisense oligonucleotide (e.g., gapmer) consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, atleast 11, at least 12, atleast 13, atleast 14, atleast 15, atleast 16, atleast 17, atleast 18, atleast 19, or at least 20 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 5097-5441 wherein each T may be independently and optionally replaced with U.
[0216] In some embodiments, the present disclosure provides a compound that is or comprises a modified antisense oligonucleotide (e.g., gapmer) consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, atleast 11, at least 12, atleast 13, atleast 14, at least 15, at least 16, atleast 17, or atleast 18 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 5442-5468 wherein each T may be independently and optionally replaced with U.WSGRRef. 71197-702.601
[0217] In some embodiments, the nucleobase sequence of the modified antisense oligonucleotide (e.g., gapmer) is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary to the human cDNA sequence of FDX2 (GenBank RefSeq ID. NM_001397406.1, SEQ ID NO: 1):GAGTCACGTGATGCATGTCATGGCCGCCTCCATGGCCCGGGGAGGCGTGAGTGCCA GGGTTCTACTGCAGGCTGCCAGGGGCACCTGGTGGAACAGACCTGGGGGCACTTCC GGGTCGGGGGAGGGGGTGGCGCTGGGGACAACCAGAAAGTTTCAAGCGACAGGCT CGCGCCCGGCTGGAGAGGAGGACGCGGGCGGCCCGGAGCGGCCCGGGGACGTGGT GAACGTGGTGTTCGTAGACCGCTCAGGCCAGCGGATCCCAGTGAGTGGCAGAGTCG GGGACAATGTTCTTCACCTGGCCCAGCGCCACGGGGTGGACCTGGAAGGGGCCTGT GAAGCCTCCCTGGCCTGCTCCACCTGCCATGTGTATGTGAGTGAAGACCACCTGGAT CTCCTGCCTCCTCCCGAGGAGAGGGAAGACGACATGCTAGACATGGCCCCCCTCCT CCAGGAGAACTCGCGGCTGGGCTGCCAGATTGTGCTGACACCGGAGCTGGAAGGAG CGGAATTCACCCTGCCCAAGATCACCAGGAACTTCTACGTGGATGGCCATGTCCCC AAGCCCCACTGACATGAACACCTGGACCATTCCACATTGCCATGGCCCCAGGGCCC AGATTGAGGGAATAGCCAGGTGCCAGCCCTGCCCAGAGTGCGGACAGGCCCGGGA GAGACGTGGAAGCCCCTGTGAAGGACAACACCCCTGCTTGGGAGAGAGTCCCATGT CCAGGCTCTGGTGGGGACAGGGCCCCTAGTGGGGTGGCCTTCCCCAGGCCCCTGAG AATCAGGGTTTGAGTAGGAGTGGACTCATATTGGAGCTGCAATAAATCGATAACAC AGGCCCCAGCATGTTGAGTGTCCTTGGGGGACAGATCTGGGGTCTACAGGTGGCTC ACACCTGTAATCCTAGCACTTTGGGAAGCCAAGATGGGAGGATCACTTGAGGCCAG GAGCTTAAGACCATCCTGGGCAACATGGCGAGACCTCGTCTCTATAAAAACAGTAA AAATTA (SEQ ID NO: 1)
[0218] In some embodiments, an antisense oligonucleotide (e.g., gapmer) consists of or comprises about 12 or more nucleosides having a nucleobase sequence comprising at least 8 consecutive nucleobases of any nucleobase sequences as provided in Table A-l (wherein each T maybe independently and optionally replaced with U) (see section TABLES below). In some embodiments, an antisense oligonucleotide (e.g., gapmer) is or comprises about 12 or more nucleosides having a nucleobase sequence comprising at least 8 consecutive nucleobases of any nucleobase sequences as provided in Table A-l (wherein each T may be independently and optionally replaced with U), and wherein the antisense oligonucleotide (e.g., gapmer) isWSGRRef. 71197-702.601modified as described herein (and is referred to interchangeably as an antisense oligonucleotide and a modified antisense oligonucleotide).
[0219] In some embodiments, the present disclosure provides a compound that is or comprises a modified antisense oligonucleotide (e.g., gapmer) consisting of 20 to 30 linked nucleosides and having a nucleobase sequence comprising 20 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 8-1000 wherein each T may be independently and optionally replaced with U. In some embodiments, the 20 consecutive nucleobases form a 5-10-5 gapmer motif, wherein the central gap segment comprises ten 2’ -deoxynucleosides and is flanked by wing segments on both the 5’ end and on the 3’ end comprising five 2’ -MOE modified nucleosides. The sugar motif for the gapmers is (from 5’ to 3’): eeeeeddddddddddeeeee; where each ‘d’ represents a 2’ -deoxynucleoside and each ‘e’ represents a 2’-M0E modified nucleoside. In some embodiments, each internucleoside linkage is a phosphorothioate internucleoside linkage (i.e., the internucleoside linkage motif (from 5’ to 3’) is sssssssssssssssssss wherein each ‘s’ is a phosphorothioate internucleoside linkage). In some embodiments, the internucleoside linkage motif (from 5’ to 3’) is soooossssssssssooss, wherein each ‘s’ is a phosphorothioate internucleoside linkage and each ‘o’ is a phosphodiester internucleoside linkage. In some embodiments, each cytosine residue is a 5 -methyl cytosine. In some embodiments, each cytosine residue within the gap region is a 5-methyl cytosine.
[0220] In some embodiments, the present disclosure provides a compound that is or comprises a modified antisense oligonucleotide (e.g., gapmer) consisting of 20 to 30 linked nucleosides and having a nucleobase sequence comprising 20 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 8-1000 wherein each T may be independently and optionally replaced with U. In some embodiments, the 20 consecutive nucleobases form a 5-10-5 gapmer motif, where the sugar motif for the gapmers is (from 5’ to 3’): eeeeedyddddddddeeeee; where each ‘d’ represents a 2’-deoxynucleoside, each ‘e’ represents a 2 ’-MOE modified nucleoside, and ‘y’ represents a 2’ -OMe sugar moiety. In some embodiments, each intemucleoside linkage is a phosphorothioate intemucleoside linkage (i.e., the internucleoside linkage motif (from 5’ to 3’) is sssssssssssssssssss wherein each ‘s’ is a phosphorothioate intemucleoside linkage). In some embodiments, the intemucleoside linkage motif (from 5’ to 3’) is soooossssssssssooss, wherein each ‘s’ is a phosphorothioate intemucleoside linkage and each ‘o’ is a phosphodiester intemucleoside linkage. In some embodiments, each cytosine residue is a 5-methyl cytosine.
[0221] In some embodiments, the present disclosure provides a compound that is or comprises a modified antisense oligonucleotide (e.g., gapmer) consisting of 20 to 30 linked nucleosidesWSGRRef. 71197-702.601and having a nucleobase sequence comprising 20 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 8-1000 wherein each T may be independently and optionally replaced with U. In some embodiments, the 20 consecutive nucleobases form a 6-10-4 gapmer motif, wherein the central gap segment comprises ten 2’ -deoxynucleosides and is flanked by wing segments on the 5’ end comprising six 2’ -MOE modified nucleosides and on the 3’ end comprising four 2’-M0E modified nucleosides. The sugar motif for the gapmers is (from 5’ to 3’): eeeeeeddddddddddeeee; where each ‘d’ represents a 2’-deoxynucleosides and each ‘e’ represents a 2 ’-MOE modified nucleoside. In some embodiments, each internucleoside linkage is a phosphorothioate internucleoside linkage (i.e., the internucleoside linkage motif (from 5’ to 3’) is sssssssssssssssssss wherein each ‘s’ is a phosphorothioate internucleoside linkage). In some embodiments, the intemucleoside linkage motif (from 5’ to 3’) is sooooossssssssssoss, wherein each ‘s’ is a phosphorothioate intemucleoside linkage and each ‘o’ is a phosphodiester intemucleoside linkage. In some embodiments, each cytosine residue is a 5-methyl cytosine.
[0222] In some embodiments, an antisense oligonucleotide (e.g., gapmer) is or comprises about 12 or more nucleosides having a nucleobase sequence comprising at least 8 consecutive nucleobases of any nucleobase sequences as provided in Table A -2 (wherein each T may be independently and optionally replaced with U) (see section TABLES below). In some embodiments, an antisense oligonucleotide (e.g., gapmer) is or comprises about 12 or more nucleosides having a nucleobase sequence comprising at least 8 consecutive nucleobases of any nucleobase sequences as provided in Table A -2 (wherein each T may be independently and optionally replaced with U), and wherein the antisense oligonucleotide (e.g., gapmer) is modified as described herein (and is referred to interchangeably as an antisense oligonucleotide and a modified antisense oligonucleotide).
[0223] In some embodiments, the present disclosure provides a compound that is a modified antisense oligonucleotide (e.g., gapmer) comprising about 12 to about 30 linked nucleosides and having a nucleobase sequence comprising about 8 to about 23 (e.g., about 8 to about 16) consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 1001-1997 wherein each T may be independently and optionally replaced with U. In some embodiments, the modified antisense oligonucleotide (e.g., gapmer) comprises about 15 to about 25 linked nucleosides. In some embodiments, the modified antisense oligonucleotide (e.g., gapmer) comprises 16, 17, 18, 19, or 20 linked nucleosides.
[0224] In some embodiments, the present disclosure provides a compound that is or comprises a modified antisense oligonucleotide (e.g., gapmer) consisting of 12 to 30 linked nucleosidesWSGRRef. 71197-702.601and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11 , at least 12, at least 13, at least 14, at least 15, or at least 16 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 1001-1997 wherein each T may be independently and optionally replaced with U.
[0225] In some embodiments, the nucleobase sequence of the modified antisense oligonucleotide (e.g., gapmer) is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary to SEQ ID NO: 1.
[0226] In some embodiments, the present disclosure provides a compound that is or comprises a modified antisense oligonucleotide (e.g., gapmer) consisting of 16 to 30 linked nucleosides and having a nucleobase sequence comprising 16 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 1001-1997 wherein each T may be independently and optionally replaced with U. In some embodiments, the 16 consecutive nucleobases form a 3-10-3 gapmer motif, wherein the central gap segment comprises ten 2’ -deoxynucleosides and is flanked by wing segments on both the 5’ end and on the 3’ end comprising three cEt modified nucleoside orLNA. The sugar motif for the gapmers is (from 5’ to 3’): lllddddddddddlll; where each ‘d’ represents a 2 ’-deoxy nucleoside and each T represents a cEt modified nucleoside or LNA. In some embodiments, each internucleoside linkage is a phosphorothioate internucleoside linkage. In some embodiments, each cytosine residue is a 5 -methyl cytosine. In some embodiments, each cytosine residue within the gap region is a 5 -methyl cytosine.
[0227] In some embodiments, an antisense oligonucleotide (e.g., gapmer) is or comprises about 12 or more nucleosides having a nucleobase sequence comprising at least 8 consecutive nucleobases of any nucleobase sequences as provided in Table C-l (wherein each T may be independently and optionally replaced with U) (see section TABLES below). In some embodiments, an antisense oligonucleotide (e.g., gapmer) is or comprises about 12 or more nucleosides having a nucleobase sequence comprising at least 8 consecutive nucleobases of any nucleobase sequences as provided in Table C-l (wherein each T may be independently and optionally replaced with U), and wherein the antisense oligonucleotide (e.g., gapmer) is modified as described herein (and is referred to interchangeably as an antisense oligonucleotide and a modified antisense oligonucleotide).
[0228] In some embodiments, the present disclosure provides a compound that is or comprises a modified antisense oligonucleotide (e.g., gapmer) consisting of 20 to 30 linked nucleosides and having a nucleobase sequence comprising 20 consecutive nucleobases of any of theWSGRRef. 71197-702.601nucleobase sequences of SEQ ID NOs: 3978-4374 wherein each T may be independently and optionally replaced with U. In some embodiments, the 20 consecutive nucleobases form a 5-10-5 gapmer motif, wherein the central gap segment comprises ten 2’ -deoxynucleosides and is flanked by wing segments on both the 5’ end and on the 3’ end comprising five 2’ -MOE modified nucleosides. The sugar motif for the gapmers is (from 5’ to 3’): eeeeeddddddddddeeeee; where each ‘d’ represents a 2’ -deoxynucleoside and each ‘e’ represents a 2’-M0E modified nucleoside. In some embodiments, each internucleoside linkage is a phosphorothioate internucleoside linkage (i.e., the internucleoside linkage motif is (from 5’ to 3 ’) sssssssssssssssssss wherein each ‘s’ is a phosphorothioate internucleoside linkage). In some embodiments, the internucleoside linkage motif is (from 5’ to 3’) soooossssssssssooss, wherein each ‘s’ is a phosphorothioate intemucleoside linkage and each ‘o’ is a phosphodiester internucleoside linkage. In some embodiments, the intemucleoside linkage motif is (from 5’ to 3 ’) ssooossssssssssooss, wherein each ‘s’ is a phosphorothioate intemucleoside linkage and each ‘o’ is a phosphodiester intemucleoside linkage. In some embodiments, each cytosine residue is a 5-methyl cytosine. In some embodiments, each cytosine residue within the gap region is a 5-methyl cytosine.
[0229] In some embodiments, an antisense oligonucleotide (e.g., gapmer) is or comprises about 12 or more nucleosides having a nucleobase sequence comprising at least 8 consecutive nucleobases of any nucleobase sequences as provided in Table C-2 (wherein each T may be independently and optionally replaced with U) (see section TABLES below). In some embodiments, an antisense oligonucleotide (e.g., gapmer) is or comprises about 12 or more nucleosides having a nucleobase sequence comprising at least 8 consecutive nucleobases of any nucleobase sequences as provided in Table C-2 (wherein each T may be independently and optionally replaced with U), and wherein the antisense oligonucleotide (e.g., gapmer) is modified as described herein (and is referred to interchangeably as an antisense oligonucleotide and a modified antisense oligonucleotide).
[0230] In some embodiments, the present disclosure provides a compound that is or comprises a modified antisense oligonucleotide (e.g., gapmer) consisting of 20 to 30 linked nucleosides and having a nucleobase sequence comprising 20 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 4375-4718 wherein each T may be independently and optionally replaced with U. In some embodiments, the 20 consecutive nucleobases form a 5-10-5 gapmer motif, wherein the central gap segment comprises ten 2’ -deoxynucleosides and is flanked by wing segments on both the 5’ end and on the 3’ end comprising five 2’ -MOE modified nucleosides. The sugar motif for the gapmers is (from 5’ to 3’):WSGRRef. 71197-702.601eeeeeddddddddddeeeee; where each ‘d’ represents a 2’ -deoxynucleoside and each ‘e’ represents a 2’-M0E modified nucleoside. In some embodiments, each internucleoside linkage is a phosphorothioate internucleoside linkage (i.e., the internucleoside linkage motif is (from 5’ to 3 ’) sssssssssssssssssss wherein each ‘s’ is a phosphorothioate internucleoside linkage). In some embodiments, the intemucleoside linkage motif is (from 5’ to 3’) soooossssssssssooss, wherein each ‘s’ is a phosphorothioate intemucleoside linkage and each ‘o’ is a phosphodiester internucleoside linkage. In some embodiments, the intemucleoside linkage motif is (from 5’ to 3 ’) ssooossssssssssooss, wherein each ‘s’ is a phosphorothioate intemucleoside linkage and each ‘o’ is a phosphodiester intemucleoside linkage. In some embodiments, each cytosine residue is a 5-methyl cytosine. In some embodiments, each cytosine residue within the gap region is a 5-methyl cytosine.
[0231] In some embodiments, an antisense oligonucleotide (e.g., gapmer) is or comprises about 12 or more nucleosides having a nucleobase sequence comprising at least 8 consecutive nucleobases of any nucleobase sequences as provided in Table D (wherein each T may be independently and optionally replaced with U) (see section Tables below). In some embodiments, an antisense oligonucleotide (e.g., gapmer) is or comprises about 12 or more nucleosides having a nucleobase sequence comprising at least 8 consecutive nucleobases of any nucleobase sequences as provided in Table D (wherein each T may be independently and optionally replaced with U), and wherein the antisense oligonucleotide (e.g., gapmer) is modified as described herein (and is referred to interchangeably as an antisense oligonucleotide and a modified antisense oligonucleotide).
[0232] In some embodiments, the present disclosure provides a compound that is or comprises a modified antisense oligonucleotide (e.g., gapmer) consisting of 20 to 30 linked nucleosides and having a nucleobase sequence comprising 20 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 4719-5096 wherein each T may be independently and optionally replaced with U. In some embodiments, the 20 consecutive nucleobases form a 5-10-5 gapmer motif, wherein the central gap segment comprises ten 2’ -deoxynucleosides and is flanked by wing segments on both the 5’ end and on the 3’ end comprising five 2’ -MOE modified nucleosides. The sugar motif for the gapmers is (from 5’ to 3’): eeeeeddddddddddeeeee; where each ‘d’ represents a 2’ -deoxynucleoside and each ‘e’ represents a 2’-M0E modified nucleoside. In some embodiments, each intemucleoside linkage is a phosphorothioate intemucleoside linkage (i.e., the intemucleoside linkage motif is (from 5’ to 3’) sssssssssssssssssss wherein each ‘s’ is a phosphorothioate intemucleoside linkage). In some embodiments, the intemucleoside linkage motif is (from 5’ to 3’) soooossssssssssooss, whereinWSGRRef. 71197-702.601each ‘s’ is a phosphorothioate intemucleoside linkage and each ‘o’ is a phosphodiester internucleoside linkage. In some embodiments, the intemucleoside linkage motif is (from 5’ to 3 ’) ssooossssssssssooss, wherein each ‘s’ is a phosphorothioate intemucleoside linkage and each ‘o’ is a phosphodiester intemucleoside linkage. In some embodiments, each cytosine residue is a 5-methyl cytosine. In some embodiments, each cytosine residue within the gap region is a 5-methyl cytosine.
[0233] In some embodiments, an antisense oligonucleotide (e.g., gapmer) is or comprises about 12 or more nucleosides having a nucleobase sequence comprising at least 8 consecutive nucleobases of any nucleobase sequences as provided in Table E (wherein each T may be independently and optionally replaced with U) (see section TABLES below). In some embodiments, an antisense oligonucleotide (e.g., gapmer) is or comprises about 12 or more nucleosides having a nucleobase sequence comprising at least 8 consecutive nucleobases of any nucleobase sequences as provided in Table E (wherein each T may be independently and optionally replaced with U), and wherein the antisense oligonucleotide (e.g., gapmer) is modified as described herein (and is referred to interchangeably as an antisense oligonucleotide and a modified antisense oligonucleotide).
[0234] In some embodiments, the present disclosure provides a compound that is or comprises a modified antisense oligonucleotide (e.g., gapmer) consisting of 20 to 30 linked nucleosides and having a nucleobase sequence comprising 20 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 5097-5441 wherein each T may be independently and optionally replaced with U. In some embodiments, the 20 consecutive nucleobases form a 5-10-5 gapmer motif, wherein the central gap segment comprises ten 2’ -deoxynucleosides and is flanked by wing segments on both the 5’ end and on the 3’ end comprising five 2’ -MOE modified nucleosides. The sugar motif for the gapmers is (from 5’ to 3’): eeeeeddddddddddeeeee; where each ‘d’ represents a 2’ -deoxynucleoside and each ‘e’ represents a 2’-M0E modified nucleoside. In some embodiments, each intemucleoside linkage is a phosphorothioate intemucleoside linkage (i.e., the intemucleoside linkage motif is (from 5’ to 3 ’) sssssssssssssssssss wherein each ‘s’ is a phosphorothioate intemucleoside linkage). In some embodiments, the intemucleoside linkage motif is (from 5’ to 3’) soooossssssssssooss, wherein each ‘s’ is a phosphorothioate intemucleoside linkage and each ‘o’ is a phosphodiester intemucleoside linkage. In some embodiments, the intemucleoside linkage motif is (from 5’ to 3 ’) ssooossssssssssooss, wherein each ‘s’ is a phosphorothioate intemucleoside linkage and each ‘o’ is a phosphodiester intemucleoside linkage. In some embodiments, each cytosine residue is aWSGRRef. 71197-702.6015-methyl cytosine. In some embodiments, each cytosine residue within the gap region is a 5-methyl cytosine.
[0235] In some embodiments, an antisense oligonucleotide (e.g., gapmer) is or comprises about 12 or more nucleosides having a nucleobase sequence comprising at least 8 consecutive nucleobases of any nucleobase sequences as provided in Table 3 (wherein each T may be independently and optionally replaced with U) (see section Examples below). In some embodiments, an antisense oligonucleotide (e.g., gapmer) is or comprises about 12 or more nucleosides having a nucleobase sequence comprising at least 8 consecutive nucleobases of any nucleobase sequences as provided in Table 3 (wherein each T may be independently and optionally replaced with U), and wherein the antisense oligonucleotide (e.g., gapmer) is modified as described herein (and is referred to interchangeably as an antisense oligonucleotide and a modified antisense oligonucleotide).
[0236] In some embodiments, the present disclosure provides a compound that is or comprises a modified antisense oligonucleotide (e.g., gapmer) consisting of 18 to 30 linked nucleosides and having a nucleobase sequence comprising 18 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 5442-5468 wherein each T may be independently and optionally replaced with U. In some embodiments, the 20 consecutive nucleobases form a 4-10-4 gapmer motif, wherein the central gap segment comprises ten 2’ -deoxynucleosides and is flanked by wing segments on both the 5’ end and on the 3’ end comprising f our 2’-M0E modified nucleosides. The sugar motif for the gapmers is (from 5 ’ to 3 ’): eeeeddddddddddeeee; where each ‘d’ represents a 2’ -deoxynucleoside and each ‘e’ represents a 2’ -MOE modified nucleoside. In some embodiments, each internucleoside linkage is a phosphorothioate internucleoside linkage (i.e., the internucleoside linkage motif is (from 5’ to 3’) sssssssssssssssss wherein each ‘s’ is a phosphorothioate intemucleoside linkage). In some embodiments, the internucleoside linkage motif is (from 5’ to 3’) oooossssssssssoos, wherein each ‘s’ is a phosphorothioate internucleoside linkage and each ‘o’ is a phosphodiester internucleoside linkage. In some embodiments, the intemucleoside linkage motif is (from 5’ to 3’) sooossssssssssoos, wherein each ‘s’ is a phosphorothioate intemucleoside linkage and each ‘o’ is a phosphodiester intemucleoside linkage. In some embodiments, each cytosine residue is a 5-methyl cytosine. In some embodiments, each cytosine residue within the gap region is a 5-methyl cytosine.
[0237] In some embodiments, an antisense oligonucleotide (e.g., gapmer) is or comprises about 12 or more nucleosides having a nucleobase sequence comprising at least 8 consecutive nucleobases of any nucleobase sequences as provided in Table 4 (wherein each T may beWSGRRef. 71197-702.601independently and optionally replaced with U) (see Examples below). In some embodiments, an antisense oligonucleotide (e.g., gapmer) is or comprises about 12 or more nucleosides having a nucleobase sequence comprising at least 8 consecutive nucleobases of any nucleobase sequences as provided in Table 4 (wherein each T may be independently and optionally replaced with U), and wherein the antisense oligonucleotide (e.g., gapmer) is modified as described herein (and is referred to interchangeably as an antisense oligonucleotide and a modified antisense oligonucleotide).
[0238] In some embodiments, the present disclosure provides a compound that is or comprises a modified antisense oligonucleotide (e.g., gapmer) consisting of 20 to 30 linked nucleosides and having a nucleobase sequence comprising 20 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 143, 150-153, 227-234, 239-244, 248-255, 276-282, 303-304, 306, 308, 312-315, 332-350, 378-390, 420-428, 448-465, 471-474, 495-504, 525-534, 562, 662-673, 3994-4001, 4011-4012, 4014-4018, 4027-4028, 4033-4036, 4041, 4044, 4085-4088, 4091-4093, 4098-4103, 4109-4111, 4116-4121, 4123, 4125-4130, 4158, 4168-4169, 4172-4175, 4177-4188, 4190, 4214, 4218, 4222-4225, 4230-4233, 4250-4253, 4259-4260, 4267, 4271-4276, 4282-4295, 4312-4319, 4380-4383, 4391-4392, 4394, 4401, 4403, 4406, 4411, 4460-4462, 4469, 4473-4475, 4482-4492, 4494-4502, 4505, 4510-4515, 4517-4519, 4522, 4526-4529, 4531, 4544, 4548, 4557-4561, 4563, 4567, 4570, 4576-4577, 4580-4583, 4587-4589, 4593-4598, 4604-4605, 4641-4643, and 4646-4649 wherein each T may be independently and optionally replaced with U. In some embodiments, the 20 consecutive nucleobases form a 5 -10-5 gapmer motif, wherein the central gap segment comprises ten 2’-deoxynucleosides and is flanked by wing segments on both the 5’ end and on the 3’ end comprising five 2’-M0E modified nucleosides. The sugar motif for the gapmers is (from 5’ to 3’): eeeeeddddddddddeeeee; where each ‘d’ represents a 2’ -deoxynucleoside and each ‘e’ represents a 2’-M0E modified nucleoside. In some embodiments, each intemucleoside linkage is a phosphorothioate internucleoside linkage (i.e., the internucleoside linkage motif is (from 5’ to 3 ’) sssssssssssssssssss wherein each ‘s’ is a phosphorothioate internucleoside linkage). In some embodiments, the internucleoside linkage motif is (from 5’ to 3’) soooossssssssssooss, wherein each ‘s’ is a phosphorothioate intemucleoside linkage and each ‘o’ is a phosphodiester internucleoside linkage. In some embodiments, the intemucleoside linkage motif is (from 5’ to 3 ’) ssooossssssssssooss, wherein each ‘s’ is a phosphorothioate intemucleoside linkage and each ‘o’ is a phosphodiester intemucleoside linkage. In some embodiments, each cytosine residue is a 5 -methyl cytosine.WSGRRef. 71197-702.601
[0239] In some instances, the target region of a modified oligonucleotide (e.g., modified antisense oligonucleotide) described herein is located between nucleotides or nucleobases of positions from 210 to 267 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the target region of a modified oligonucleotide (e.g., modified antisense oligonucleotide) described herein is located between nucleotides or nucleobases of positions from 269 to 290 from the 5’ end ofNM_001397406.1 (SEQ ID NO: 1). In some instances, the target region of a modified oligonucleotide (e.g., modified antisense oligonucleotide) described herein is located between nucleotides or nucleobases of positions from 299 to 318 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the target region of a modified oligonucleotide (e.g., modified antisense oligonucleotide) described herein is located between nucleotides or nucleobases of positions from 328 to 347 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the target region of a modified oligonucleotide (e.g., modified antisense oligonucleotide) described herein is located between nucleotides or nucleobases of positions from 380 to 399 from the 5’ end ofNM OO 1397406.1 (SEQ ID NO: 1). In some instances, the target region of a modified oligonucleotide (e.g., modified antisense oligonucleotide) described herein is located between nucleotides or nucleobases of positions from 417 to 440 from the 5’ end ofNM_001397406.1 (SEQ ID NO: 1). In some instances, the target region of a modified oligonucleotide (e.g., modified antisense oligonucleotide) described herein is located between nucleotides or nucleobases of positions from 444 to 486 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the target region of a modified oligonucleotide (e.g., modified antisense oligonucleotide) described herein is located between nucleotides or nucleobases of positions from 488 to 516 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the target region of a modified oligonucleotide (e.g., modified antisense oligonucleotide) described herein is located between nucleotides or nucleobases of positions from 518 to 546 from the 5’ end ofNM OO 1397406.1 (SEQ ID NO: 1). In some instances, the target region of a modified oligonucleotide (e.g., modified antisense oligonucleotide) described herein is located between nucleotides or nucleobases of positions from 655 to 685 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1).
[0240] In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 70% identical to a reverse complementary sequence of nucleobase positions from 210 to 267 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 75% identical to a reverse complementary sequence of nucleobase positions from 210 to 267 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisenseWSGRRef. 71197-702.601oligonucleotide) (e.g., ASO) is at least or about 80% identical to a reverse complementary sequence of nucleobase positions from 210 to 267 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 85% identical to a reverse complementary sequence of nucleobase positions from 210 to 267 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 90% identical to a reverse complementary sequence of nucleobase positions from 210 to 267 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 95% identical to a reverse complementary sequence of nucleobase positions from 210 to 267 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 98% identical to a reverse complementary sequence of nucleobase positions from 210 to 267 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 100% identical to a reverse complementary sequence of nucleobase positions from 210 to 267 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1).
[0241] In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 70% identical to a reverse complementary sequence of nucleobase positions from 269 to 290 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 75% identical to a reverse complementary sequence of nucleobase positions from 269 to 290 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 80% identical to a reverse complementary sequence of nucleobase positions from 269 to 290 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 85% identical to a reverse complementary sequence of nucleobase positions from 269 to 290 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 90% identical to a reverse complementary sequence of nucleobase positions from 269 to 290 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 95% identical to a reverse complementaryWSGRRef. 71197-702.601sequence of nucleobase positions from 269 to 290 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 98% identical to a reverse complementary sequence of nucleobase positions from 269 to 290 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 100% identical to a reverse complementary sequence of nucleobase positions from 269 to 290 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1).
[0242] In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 70% identical to a reverse complementary sequence of nucleobase positions from 299 to 318 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 75% identical to a reverse complementary sequence of nucleobase positions from 299 to 318 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 80% identical to a reverse complementary sequence of nucleobase positions from 299 to 318 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 85% identical to a reverse complementary sequence of nucleobase positions from 299 to 318 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 90% identical to a reverse complementary sequence of nucleobase positions from 299 to 318 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 95% identical to a reverse complementary sequence of nucleobase positions from 299 to 318 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 98% identical to a reverse complementary sequence of nucleobase positions from 299 to 318 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 100% identical to a reverse complementary sequence of nucleobase positions from 299 to 318 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1).WSGRRef. 71197-702.601
[0243] In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 70% identical to a reverse complementary sequence of nucleobase positions from 328 to 347 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 75% identical to a reverse complementary sequence of nucleobase positions from 328 to 347 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 80% identical to a reverse complementary sequence of nucleobase positions from 328 to 347 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 85% identical to a reverse complementary sequence of nucleobase positions from 328 to 347 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 90% identical to a reverse complementary sequence of nucleobase positions from 328 to 347 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 95% identical to a reverse complementary sequence of nucleobase positions from 328 to 347 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 98% identical to a reverse complementary sequence of nucleobase positions from 328 to 347 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 100% identical to a reverse complementary sequence of nucleobase positions from 328 to 347 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1).
[0244] In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 70% identical to a reverse complementary sequence of nucleobase positions from 380 to 399 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 75% identical to a reverse complementary sequence of nucleobase positions from 380 to 399 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 80% identical to a reverse complementary sequence of nucleobase positions from 380 to 399 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisenseWSGRRef. 71197-702.601oligonucleotide) (e.g., ASO) is at least or about 85% identical to a reverse complementary sequence of nucleobase positions from 380 to 399 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 90% identical to a reverse complementary sequence of nucleobase positions from 380 to 399 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 95% identical to a reverse complementary sequence of nucleobase positions from 380 to 399 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 98% identical to a reverse complementary sequence of nucleobase positions from 380 to 399 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 100% identical to a reverse complementary sequence of nucleobase positions from 380 to 399 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1).
[0245] In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 70% identical to a reverse complementary sequence of nucleobase positions from 417 to 440 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 75% identical to a reverse complementary sequence of nucleobase positions from 417 to 440 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 80% identical to a reverse complementary sequence of nucleobase positions from 417 to 440 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 85% identical to a reverse complementary sequence of nucleobase positions from 417 to 440 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 90% identical to a reverse complementary sequence of nucleobase positions from 417 to 440 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 95% identical to a reverse complementary sequence of nucleobase positions from 417 to 440 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 98% identical to a reverse complementaryWSGRRef. 71197-702.601sequence of nucleobase positions from 417 to 440 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 100% identical to a reverse complementary sequence of nucleobase positions from 417 to 440 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1).
[0246] In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 70% identical to a reverse complementary sequence of nucleobase positions from 444 to 486 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 75% identical to a reverse complementary sequence of nucleobase positions from 444 to 486 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 80% identical to a reverse complementary sequence of nucleobase positions from 444 to 486 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 85% identical to a reverse complementary sequence of nucleobase positions from 444 to 486 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 90% identical to a reverse complementary sequence of nucleobase positions from 444 to 486 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 95% identical to a reverse complementary sequence of nucleobase positions from 444 to 486 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 98% identical to a reverse complementary sequence of nucleobase positions from 444 to 486 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 100% identical to a reverse complementary sequence of nucleobase positions from 444 to 486 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1).
[0247] In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 70% identical to a reverse complementary sequence of nucleobase positions from 488 to 516 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisenseWSGRRef. 71197-702.601oligonucleotide) (e.g., ASO) is at least or about 75% identical to a reverse complementary sequence of nucleobase positions from 488 to 516 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 80% identical to a reverse complementary sequence of nucleobase positions from 488 to 516 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 85% identical to a reverse complementary sequence of nucleobase positions from 488 to 516 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 90% identical to a reverse complementary sequence of nucleobase positions from 488 to 516 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 95% identical to a reverse complementary sequence of nucleobase positions from 488 to 516 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 98% identical to a reverse complementary sequence of nucleobase positions from 488 to 516 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 100% identical to a reverse complementary sequence of nucleobase positions from 488 to 516 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1).
[0248] In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 70% identical to a reverse complementary sequence of nucleobase positions from 518 to 546 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 75% identical to a reverse complementary sequence of nucleobase positions from 518 to 546 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 80% identical to a reverse complementary sequence of nucleobase positions from 518 to 546 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 85% identical to a reverse complementary sequence of nucleobase positions from 518 to 546 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 90% identical to a reverse complementaryWSGRRef. 71197-702.601sequence of nucleobase positions from 518 to 546 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 95% identical to a reverse complementary sequence of nucleobase positions from 518 to 546 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 98% identical to a reverse complementary sequence of nucleobase positions from 518 to 546 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 100% identical to a reverse complementary sequence of nucleobase positions from 518 to 546 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1).
[0249] In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 70% identical to a reverse complementary sequence of nucleobase positions from 655 to 685 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 75% identical to a reverse complementary sequence of nucleobase positions from 655 to 685 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 80% identical to a reverse complementary sequence of nucleobase positions from 655 to 685 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 85% identical to a reverse complementary sequence of nucleobase positions from 655 to 685 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 90% identical to a reverse complementary sequence of nucleobase positions from 655 to 685 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 95% identical to a reverse complementary sequence of nucleobase positions from 655 to 685 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 98% identical to a reverse complementary sequence of nucleobase positions from 655 to 685 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 100% identical to a reverse complementaryWSGRRef. 71197-702.601sequence of nucleobase positions from 655 to 685 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1).
[0250] In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) comprises at least a 10, 11, 12, 13, 14, 15, or 16 nucleotides consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 210 to 267 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) comprises at least a 17, 18, 19, or 20 nucleotides consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 210 to 267 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1).
[0251] In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) comprises at least a 10, 11, 12, 13, 14, 15, or 16 nucleotides consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 269 to 290 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) comprises at least a 17, 18, 19, or 20 nucleotides consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 269 to 290 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1).
[0252] In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) comprises at least a 10, 11, 12, 13, 14, 15, or 16 nucleotides consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 299 to 318 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) comprises at least a 17, 18, 19, or 20 nucleotides consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 299 to 318 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1).
[0253] In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) comprises at least a 10, 11, 12, 13, 14, 15, or 16 nucleotides consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 328 to 347 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) comprises at least a 17, 18, 19, or 20 nucleotides consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 328 to 347 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1).WSGRRef. 71197-702.601
[0254] In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) comprises at least a 10, 11, 12, 13, 14, 15, or 16 nucleotides consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 380 to 399 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) comprises at least a 17, 18, 19, or 20 nucleotides consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 380 to 399 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1).
[0255] In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) comprises at least a 10, 11, 12, 13, 14, 15, or 16 nucleotides consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 417 to 440 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) comprises at least a 17, 18, 19, or 20 nucleotides consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 417 to 440 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1).
[0256] In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) comprises at least a 10, 11, 12, 13, 14, 15, or 16 nucleotides consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 444 to 486 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) comprises at least a 17, 18, 19, or 20 nucleotides consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 444 to 486 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1).
[0257] In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) comprises at least a 10, 11, 12, 13, 14, 15, or 16 nucleotides consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 488 to 516 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) comprises at least a 17, 18, 19, or 20 nucleotides consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 488 to 516 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1).
[0258] In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) comprises at least a 10, 11, 12, 13, 14, 15, or 16 nucleotidesWSGRRef. 71197-702.601consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 518 to 546 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) comprises at least a 17, 18, 19, or 20 nucleotides consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 518 to 546 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1).
[0259] In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) comprises at least a 10, 11, 12, 13, 14, 15, or 16 nucleotides consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 655 to 685 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) comprises at least a 17, 18, 19, or 20 nucleotides consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 655 to 685 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1).
[0260] In some instances, the target region of a modified oligonucleotide (e.g., modified antisense oligonucleotide) described herein is located between nucleotides or nucleobases of positions from 205 to 352 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the target region of a modified oligonucleotide (e.g., modified antisense oligonucleotide) described herein is located between nucleotides or nucleobases of positions from 375 to 404 from the 5’ end ofNM_001397406.1 (SEQ ID NO: 1). In some instances, the target region of a modified oligonucleotide (e.g., modified antisense oligonucleotide) described herein is located between nucleotides or nucleobases of positions from 412 to 551 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the target region of a modified oligonucleotide (e.g., modified antisense oligonucleotide) described herein is located between nucleotides or nucleobases of positions from 650 to 690 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1).
[0261] In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 70% identical to a reverse complementary sequence of nucleobase positions from 205 to 352 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 75% identical to a reverse complementary sequence of nucleobase positions from 205 to 352 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 80% identical to a reverse complementaryWSGRRef. 71197-702.601sequence of nucleobase positions from 205 to 352 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 85% identical to a reverse complementary sequence of nucleobase positions from 205 to 352 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 90% identical to a reverse complementary sequence of nucleobase positions from 205 to 352 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 95% identical to a reverse complementary sequence of nucleobase positions from 205 to 352 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 98% identical to a reverse complementary sequence of nucleobase positions from 205 to 352 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 100% identical to a reverse complementary sequence of nucleobase positions from 205 to 352 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1).
[0262] In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 70% identical to a reverse complementary sequence of nucleobase positions from 375 to 404 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 75% identical to a reverse complementary sequence of nucleobase positions from 375 to 404 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 80% identical to a reverse complementary sequence of nucleobase positions from 375 to 404 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 85% identical to a reverse complementary sequence of nucleobase positions from 375 to 404 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 90% identical to a reverse complementary sequence of nucleobase positions from 375 to 404 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 95% identical to a reverse complementary sequence of nucleobase positions from 375 to 404 from the 5’ end of NM_001397406.1 (SEQWSGRRef. 71197-702.601ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 98% identical to a reverse complementary sequence of nucleobase positions from 375 to 404 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 100% identical to a reverse complementary sequence of nucleobase positions from 375 to 404 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1).
[0263] In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 70% identical to a reverse complementary sequence of nucleobase positions from 412 to 551 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 75% identical to a reverse complementary sequence of nucleobase positions from 412 to 551 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 80% identical to a reverse complementary sequence of nucleobase positions from 412 to 551 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 85% identical to a reverse complementary sequence of nucleobase positions from 412 to 551 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 90% identical to a reverse complementary sequence of nucleobase positions from 412 to 551 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 95% identical to a reverse complementary sequence of nucleobase positions from 412 to 551 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 98% identical to a reverse complementary sequence of nucleobase positions from 412 to 551 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 100% identical to a reverse complementary sequence of nucleobase positions from 412 to 551 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1).
[0264] In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 70% identical to a reverse complementaryWSGRRef. 71197-702.601sequence of nucleobase positions from 650 to 690 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 75% identical to a reverse complementary sequence of nucleobase positions from 650 to 690 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 80% identical to a reverse complementary sequence of nucleobase positions from 650 to 690 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 85% identical to a reverse complementary sequence of nucleobase positions from 650 to 690 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 90% identical to a reverse complementary sequence of nucleobase positions from 650 to 690 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 95% identical to a reverse complementary sequence of nucleobase positions from 650 to 690 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 98% identical to a reverse complementary sequence of nucleobase positions from 650 to 690 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) is at least or about 100% identical to a reverse complementary sequence of nucleobase positions from 650 to 690 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1).
[0265] In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) comprises at least a 10, 11, 12, 13, 14, 15, or 16 nucleotides consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 205 to 352 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) comprises at least a 17, 18, 19, or 20 nucleotides consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 205 to 352 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1).
[0266] In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) comprises at least a 10, 11, 12, 13, 14, 15, or 16 nucleotides consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobaseWSGRRef. 71197-702.601positions from 375 to 404 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) comprises at least a 17, 18, 19, or 20 nucleotides consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 375 to 404 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1).
[0267] In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) comprises at least a 10, 11, 12, 13, 14, 15, or 16 nucleotides consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 412 to 551 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) comprises at least a 17, 18, 19, or 20 nucleotides consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 412 to 551 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1).
[0268] In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) comprises at least a 10, 11, 12, 13, 14, 15, or 16 nucleotides consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 650 to 690 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the modified oligonucleotide (e.g., modified antisense oligonucleotide) (e.g., ASO) comprises at least a 17, 18, 19, or 20 nucleotides consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 650 to 690 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1).siRNA / shRNA
[0269] In some embodiments, an inhibitory nucleic acid is an oligomeric duplex comprising an antisense oligonucleotide strand and a sense oligonucleotide strand. Such a duplex can be referred to as siRNA.
[0270] In some embodiments, the nucleic acid sequence that is complementary to a target RNA can be an interfering RNA, including but not limited to a small interfering RNA (“siRNA”) or a small hairpin RNA (“shRNA”).
[0271] Methods for constructing interfering RN As are well known in the art. For example, the interfering RNA can be assembled from two separate oligonucleotides, where one strand is the sense strand and the other is the antisense strand, wherein the antisense and sense strands are self-complementary (i.e., each strand comprises nucleotide sequence that is complementary to nucleotide sequence in the other strand; such as where the antisense strand and sense strand form a duplex or double stranded structure); the antisense strand comprises nucleotide sequence thatWSGRRef. 71197-702.601is complementary to a nucleotide sequence in a target nucleic acid molecule or a portion thereof (i.e., an undesired gene) and the sense strand comprises nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof. Alternatively, interfering RNA is assembled from a single oligonucleotide, where the self -complementary sense and antisense regions are linked by means of nucleic acid based or non-nucleic acid-based linker(s). The interfering RNA can be a polynucleotide with a duplex, asymmetric duplex, hairpin or asymmetric hairpin secondary structure, having self-complementary sense and antisense regions, wherein the antisense region comprises a nucleotide sequence that is complementary to nucleotide sequence in a separate target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof. The interfering can be a circular single -stranded polynucleotide having two or more loop structures and a stem comprising self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof, and wherein the circular polynucleotide can be processed either in vivo or in vitro to generate an active siRNA molecule capable of mediating RNA interference.
[0272] In some embodiments, the interfering RNA coding region encodes a self-complementary RNA molecule having a sense region, an antisense region and a loop region. Such an RNA molecule when expressed desirably forms a “hairpin” structure and is referred to herein as an “shRNA.” The loop region is generally between about 2 and about 10 nucleotides in length. In some embodiments, the loop region is from about 6 to about 9 nucleotides in length. In some embodiments, the sense region and the antisense region are between about 15 and about 20 nucleotides in length. Following post -transcriptional processing, the small hairpin RNA is converted into a siRNA by a cleavage event mediated by the enzyme Dicer, which is a member of the RNase III family. The siRNA is then capable of inhibiting the expression of a gene with which it shares homology. For details, see Brummelkamp etal. 2002, Science 296:550-553; Lee et al. 2002, Nature Biotechnol. 20:500-505; Miyagishi and Taira 2002, Nature Biotechnol. 20:497-500; Paddison et al. 2002, Genes & Dev. 16:948-958; Paul 2002, Nature Biotechnol.20:505-508; Sui 2002, Proc. Natl. Acad. Sci. USA 99(6):5515-5520; Yu et al. 2002, Proc. Natl. Acad. Sci. USA 99:6047-6052.
[0273] The target RNA cleavage reaction guided by siRNAs is highly sequence specific. In general, siRNA containing a nucleotide sequence identical to a portion of the target nucleic acid are preferred for inhibition. However, 100% sequence identity between the siRNA and the targetWSGRRef. 71197-702.601gene is not required to practice the present invention. The siRNA has the advantage of being able to tolerate sequence variations that might be expected due to genetic mutation, strain polymorphism, or evolutionary divergence. For example, siRNA sequences with insertions, deletions, and single point mutations relative to the target sequence have also been found to be effective for inhibition. Alternatively, siRNA sequences with nucleotide analog substitutions or insertions can be effective for inhibition. In general, the siRNAs must retain specificity for their target, i.e., must not directly bind to, or directly significantly affect expression levels of, transcripts other than the intended target.
[0274] In some embodiments, a compound useful for inhibiting FDX2 is an oligomeric duplex (siRNA). In some embodiments, an siRNA is an oligomeric duplex comprising an antisense oligonucleotide (referred to as an “antisense strand”) and a complementary sense oligonucleotide (referred to as a “sense strand”), wherein the antisense strand and the sense strand are hybridized and thereby form a “duplex”. In some embodiments, an oligonucleotide (e.g., one or more both of an antisense strand and a sense strand) of an siRNA is modified (and referred to as a modified oligonucleotide, e.g., a modified antisense oligonucleotide or a modified sense oligonucleotide) as described herein. In some embodiments, at least one nucleoside of a modified oligonucleotide comprises a 2’-0Me sugar moiety (i.e., a 2’-0Me modified nucleoside). In some embodiments, at least 2 nucleosides comprise 2’-0Me sugar moieties. In some embodiments, at least 5 nucleosides comprise 2’-0Me sugar moieties. In some embodiments, at least 8 nucleosides comprise 2’-0Me sugar moieties. In some embodiments, atleast 10 nucleosides comprise 2’-OMe sugar moieties. In some embodiments, at least 12 nucleosides comprise 2’-OMe sugar moieties. In some embodiments, atleast 13 nucleosides comprise 2’-OMe sugar moieties. In some embodiments, at least 14 nucleosides comprise 2’-OMe sugar moieties. In some embodiments, at least 15 nucleosides comprise 2’-OMe sugar moieties. In some embodiments, at least 16 nucleosides comprise 2’-OMe sugar moieties. In some embodiments, at least 17 nucleosides comprise 2’-OMe sugar moieties. In certain such embodiments, at least 18 nucleosides comprise 2’-OMe sugar moieties. In certain such embodiments, at least 20 nucleosides comprise 2’-OMe sugar moieties. In certain such embodiments, at least 21 nucleosides comprise 2’-OMe sugar moieties. In certain such embodiments, at least 22 nucleosides comprise 2’-OMe sugar moieties.
[0275] In some embodiments, at least one nucleoside of a modified oligonucleotide comprises a 2’-F sugar moiety (i.e., a 2’-F modified nucleoside). In some embodiments, at least 2 nucleosides comprise 2’-F sugar moieties. In some embodiments, at least 3 nucleosides comprise 2’-F sugar moieties. In some embodiments, atleast4 nucleosides comprise 2’-F sugarWSGRRef. 71197-702.601moieties. In some embodiments, at least 6 nucleosides comprise 2’-F sugar moieties. In some embodiments, at least 8 nucleosides comprise 2’-F sugar moieties. In some embodiments, at least 10 nucleosides comprise 2 ’-F sugar moieties. In some embodiments, at least 11 nucleosides comprise 2’-F sugar moieties. In some embodiments, one, but not more than one nucleoside comprises a 2 ’-F sugar moiety. In some embodiments, 1 or 2 nucleosides comprise 2’-F sugar moieties. In some embodiments, 1-3 nucleosides comprise 2’-F sugar moieties. In some embodiments, at least 1-4 nucleosides comprise 2’-F sugar moieties. In certain embodiments, antisense oligonucleotides have a block of 2-4 contiguous 2’-F modified nucleosides. In some embodiments, 4 nucleosides of an antisense oligonucleotide are 2’-F modified nucleosides and 2 or 3 of those 2’-F modified nucleosides are contiguous. In some embodiments, 1, 2, 3, or 4 nucleosides of an antisense oligonucleotide are 2’-F modified nucleosides and each of those 2 ’-F modified nucleosides are non-contiguous. In certain such embodiments the remainder of the nucleosides are 2’-OMe modified nucleosides.
[0276] In some embodiments, at least one nucleoside of a modified oligonucleotide comprises a 2’-deoxy sugar moiety that has no additional modifications. In some embodiments, at least one nucleoside comprises a 2’-deoxy sugar moiety. In some embodiments, at least 2 nucleosides comprise a 2’-deoxy sugar moiety. In some embodiments, at least 3 nucleosides comprise a 2’-deoxy sugar moiety. In some embodiments, at least 4 nucleosides comprise a 2 ’-deoxy sugar moiety. In some embodiments, one, but not more than one nucleoside comprises a 2 ’-deoxy sugar moiety. In some embodiments, 1 or 2 nucleosides comprise a 2 ’-deoxy sugar moiety. In some embodiments, 1-3 nucleosides comprise a 2 ’-deoxy sugar moiety. In some embodiments, at least 1-4 nucleosides comprise a 2 ’-deoxy sugar moiety. In some embodiments, 1, 2, 3, or 4 nucleosides of an antisense oligonucleotide is / are a 2 ’-deoxynucleoside and each 2’-deoxynucleoside is not immediately adjacent to another 2 ’-deoxynucleoside. In some embodiments, 1, or 2 nucleosides of an antisense oligonucleotide are a 2 ’-deoxy nucleoside and each 2 ’-deoxynucleoside is not immediately adjacent to another 2 ’-deoxynucleoside. In some embodiments, 1, or 2 nucleosides of a sense oligonucleotide are a 2 ’-deoxy nucleoside and each 2 ’-deoxynucleoside is not immediately adjacent to another 2 ’-deoxynucleoside. In some embodiments, 2 nucleosides of an antisense oligonucleotide are 2’-deoxynucleosides and one nucleoside of a sense oligonucleotide is a 2’-deoxynucleoside. In some embodiments, 2 nucleosides of an antisense oligonucleotide are 2 ’-deoxynucleosides and no nucleoside of a sense oligonucleotide is a 2’-deoxynucleoside. In some embodiments, 2 nucleosides of an antisense oligonucleotide are 2 ’-deoxynucleosides.WSGRRef. 71197-702.601
[0277] In some embodiments, at least one nucleoside of an antisense oligonucleotide and / or a sense oligonucleotide comprises a modified sugar moiety as described herein. In some embodiments, a sugar moiety of an antisense oligonucleotide is modified, wherein the modified sugar modifications and / or sugar surrogate is selected from 2’-F, 2’-M0E, 2’-OMe, 2’-deoxy, UNA, or GNA. In some embodiments, a sugar motif (from 5’ to 3’) of the antisense oligonucleotide is selected from yfyfyfyfyfyfyfyfyfyfyyy, yfffyfyfyfyfyfyfyfyfyyy, yfyfffyfyfyyyfyfyfyyyyy, yfyfyfyfyfyyyfyfyfyfyfy, yfyfyfyfyfyyyfyfyfyfyyy, yfyyyfyffyyyyfyfyyyyyyy, yfyyyfyyyyyyyfyfyyyyyyy, and yfyyyfOffyyyyfyfyyyyyyy wherein each ‘y’ represents a 2’-OMe sugar moiety, each ‘f’ represents a 2’-F sugar moiety, and ‘0’ represents an unmodified sugar moiety. In some embodiments, a sugar moiety of a sense oligonucleotide is modified, wherein the modified sugar moiety is selected from 2 ’-F, 2’-M0E, 2’-OMe, and 2’-deoxy. In some embodiments, a sugar motif (from 5’ to 3’) of a sense oligonucleotide is selected from fyfyfyfyfyfyfyfyfyfyf, yyyyyyfyfyfyfyfyyyyyy, yyyyyyfyfydyyyyyyyyyy, fyfyfyfyfffyfyfyfyfyf, and yyyyyyfyfffyyyyyyyyyy, wherein each ‘y’ represents a2’-OMe sugar moiety, each ‘f’ represents a 2’-F sugar moiety, and ‘d’ represents a 2 ’-deoxy sugar moiety.
[0278] In some embodiments, a sugar motif (from 5’ to 3’) of the antisense oligonucleotide is yfyfyfyfyfyfyfyfyfyfyyy, and a sugar motif (from 5’ to 3’) of the sense oligonucleotide is fyfyfyfyfyfyfyfyfyfyf, wherein each ‘y’ represents a 2’-OMe sugar moiety, and each ‘f’ represents a 2’-F sugar moiety.
[0279] In some embodiments, a sugar motif (from 5’ to 3’) of the antisense oligonucleotide is yfffyfyfyfyfyfyfyfyfyyy, and a sugar motif (from 5’ to 3’) of the sense oligonucleotide is yyyyyyfyfyfyfyfyyyyyy, wherein each ‘y’ represents a 2’-OMe sugar moiety, and each ‘f’ represents a 2’-F sugar moiety.
[0280] In some embodiments, a sugar motif (from 5’ to 3’) of the antisense oligonucleotide is yfyfffyfyfyyyfyfyfyyyyy, and a sugar motif (from 5 ’ to 3’) of the sense oligonucleotide is yyyyyyfyfydyyyyyyyyyy, wherein each ‘y’ represents a 2’-OMe sugar moiety, each ‘f’ represents a 2’-F sugar moiety, and ‘d’ represents a 2’-deoxy sugar moiety.
[0281] In some embodiments, a sugar motif (from 5’ to 3’) of the antisense oligonucleotide is yfyfyfyfyfyyyfyfyfyfyfy, and a sugar motif (from 5’ to 3’) of the sense oligonucleotide is fyfyfyfyfffyfyfyfyfyf, wherein each ‘y’ represents a 2’-OMe sugar moiety, and each ‘f’ represents a 2’-F sugar moiety.WSGRRef. 71197-702.601
[0282] In some embodiments, a sugar motif (from 5’ to 3’) of the antisense oligonucleotide is yfyfyfyfyfyyyfyfyfyfyyy, and a sugar motif (from 5 ’ to 3’) of the sense oligonucleotide is fyfyfyfyfffyfyfyfyfyf, wherein each ‘y’ represents a 2’-OMe sugar moiety, and each ‘f’ represents a 2’-F sugar moiety.
[0283] In some embodiments, a sugar motif (from 5’ to 3’) of the antisense oligonucleotide is yfyyyfyffyyyyfyfyyyyyyy, and a sugar motif (from 5 ’ to 3’) of the sense oligonucleotide is yyyyyyfyfffyyyyyyyyyy, wherein each ‘y’ represents a 2’-OMe sugar moiety, and each ‘f’ represents a 2’-F sugar moiety.
[0284] In some embodiments, a sugar motif (from 5’ to 3’) of the antisense oligonucleotide is yfyyyfyyyyyyyfyfyyyyyyy, and a sugar motif (from 5 ’ to 3’) of the sense oligonucleotide is yyyyyyfyfffyyyyyyyyyy, wherein each ‘y’ represents a 2’-OMe sugar moiety, and each ‘f’ represents a 2’-F sugar moiety.
[0285] In some embodiments, a sugar motif (from 5’ to 3’) of the antisense oligonucleotide is yfyyyfOffyyyyfyfyyyyyyy, and a sugar motif (from 5 ’ to 3’) of the sense oligonucleotide is yyyyyyfyfffyyyyyyyyyy, wherein each ‘y’ represents a 2’-OMe sugar moiety, each ‘f’ represents a 2’-F sugar moiety, and ‘0’ represents an unmodified sugar moiety.
[0286] It is possible to increase or decrease the length of an oligonucleotide without eliminating activity.
[0287] As described in Woolf et al. 1992, Proc. Natl. Acad. Sci. USA 89:7305-7309, a series of oligonucleotides 13-25 nucleobases in length were tested fortheir ability to induce cleavage of a target RNA in an oocyte injection model. Oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the oligonucleotides were able to direct specific cleavage of the target RNA, albeit to a lesser extent than the oligonucleotides that contained no mismatches. Similarly, target specific cleavage was achieved using 13 nucleobase oligonucleotides, including those with 1 or 3 mismatches.
[0288] In some embodiments, modified oligonucleotides (including, e.g., antisense oligonucleotides, sense oligonucleotides) comprise 16 linked nucleosides having no more than 1 to 3 mismatches to a target sequence. In some embodiments, modified oligonucleotides (including, e.g., antisense oligonucleotides, sense oligonucleotides) comprise 17 linked nucleosides having no more than 1 to 3 mismatches to a target sequence. In some embodiments, modified oligonucleotides (including, e.g., antisense oligonucleotides, sense oligonucleotides) comprise 18 linked nucleosides having no more than 1 to 3 mismatches to a target sequence. In some embodiments, modified oligonucleotides (including, e.g., antisense oligonucleotides, senseWSGRRef. 71197-702.601oligonucleotides) comprise 19 linked nucleosides having no more than 1 to 3 mismatches to a target sequence. In some embodiments, modified oligonucleotides (including, e.g., antisense oligonucleotides, sense oligonucleotides) comprise 20 linked nucleosides having no more than 1 to 3 mismatches to a target sequence. In some embodiments, modified oligonucleotides (including, e.g., antisense oligonucleotides, sense oligonucleotides) comprise 21 linked nucleosides having no more than 1 to 3 mismatches to a target sequence. In some embodiments, modified oligonucleotides (including, e.g., antisense oligonucleotides, sense oligonucleotides) comprise 22 linked nucleosides having no more than 1 to 3 mismatches to a target sequence. In some embodiments, modified oligonucleotides (including, e.g., antisense oligonucleotides, sense oligonucleotides) comprise 23 linked nucleosides having no more than 1 to 3 mismatches to a target sequence.
[0289] In some embodiments, modified oligonucleotides (including, e.g., antisense oligonucleotides, sense oligonucleotides) consist of 16 linked nucleosides. In some embodiments, modified oligonucleotides (including antisense oligonucleotides) consist of 17 linked nucleosides. In some embodiments, modified oligonucleotides (including, e.g., antisense oligonucleotides, sense oligonucleotides) consist of 18 linked nucleosides. In some embodiments, modified oligonucleotides (including, e.g., antisense oligonucleotides, sense oligonucleotides) consist of 19 linked nucleosides. In some embodiments, modified oligonucleotides (including, e.g., antisense oligonucleotides, sense oligonucleotides) consist of 20 linked nucleosides. In some embodiments, modified oligonucleotides (including, e.g., antisense oligonucleotides, sense oligonucleotides) consist of 21 linked nucleosides. In some embodiments, modified oligonucleotides (including, e.g., antisense oligonucleotides, sense oligonucleotides) consist of 22 linked nucleosides. In some embodiments, modified oligonucleotides (including, e.g., antisense oligonucleotides, sense oligonucleotides) consist of 23 linked nucleosides.
[0290] In some embodiments, antisense oligonucleotides consist of 12-30 linked nucleosides. In some embodiments, antisense oligonucleotides consist of 17-25 linked nucleosides. In some embodiments, antisense oligonucleotides consist of 17-23 linked nucleosides. In some embodiments, antisense oligonucleotides consist of 17-21 linked nucleosides. In some embodiments, antisense oligonucleotides consist of 18-30 linked nucleosides. In some embodiments, antisense oligonucleotides consist of 20-30 linked nucleosides. In some embodiments, antisense oligonucleotides consist of 21-30 linked nucleosides. In some embodiments, antisense oligonucleotides consist of 23-30 linked nucleosides. In some embodiments, antisense oligonucleotides consist of 18-25 linked nucleosides. In someWSGRRef. 71197-702.601embodiments, antisense oligonucleotides consist of 20-22 linked nucleosides. In some embodiments, antisense oligonucleotides consist of 21-23 linked nucleosides. In some embodiments, antisense oligonucleotides consist of 23-24 linked nucleosides. In some embodiments, antisense oligonucleotides consist of 20 linked nucleosides. In some embodiments, antisense oligonucleotides consist of 21 linked nucleosides. In some embodiments, antisense oligonucleotides consist of 22 linked nucleosides. In some embodiments, antisense oligonucleotides consist of 23 linked nucleosides. In some embodiments, antisense oligonucleotides consist of 20 linked nucleosides having no more than 1 to 3 mismatches to a target sequence. In some embodiments, antisense oligonucleotides consist of 21 linked nucleosides having no more than 1 to 3 mismatches to a target sequence. In some embodiments, antisense oligonucleotides consist of 22 linked nucleosides having no more than 1 to 3 mismatches to a target sequence. In some embodiments, antisense oligonucleotides consist of 23 linked nucleosides having no more than 1 to 3 mismatches to a target sequence.
[0291] In some embodiments, sense oligonucleotides consist of 12-30 linked nucleosides. In some embodiments, sense oligonucleotides consist of 16-25 linked nucleosides. In some embodiments, sense oligonucleotides consist of 16-23 linked nucleosides. In some embodiments, sense oligonucleotides consist of 16-21 linked nucleosides. In some embodiments, sense oligonucleotides consist of 16-30 linked nucleosides. In some embodiments, sense oligonucleotides consist of 18-30 linked nucleosides. In some embodiments, sense oligonucleotides consist of 19-30 linked nucleosides. In some embodiments, sense oligonucleotides consist of 19-25 linked nucleosides. In some embodiments, sense oligonucleotides consist of 18-25 linked nucleosides. In some embodiments, sense oligonucleotides consist of 18-20 linked nucleosides. In some embodiments, sense oligonucleotides consist of 19-21 linked nucleosides. In some embodiments, sense oligonucleotides consist of 18 linked nucleosides. In some embodiments, sense oligonucleotides consist of 19 linked nucleosides. In some embodiments, sense oligonucleotides consist of 20 linked nucleosides. In some embodiments, sense oligonucleotides consist of 21 linked nucleosides. In some embodiments, sense oligonucleotides consist of 18 linked nucleosides having no more than 1 to 3 mismatches to a target sequence. In some embodiments, sense oligonucleotides consist of 19 linked nucleosides having no more than 1 to 3 mismatches to a target sequence. In some embodiments, sense oligonucleotides consist of 20 linked nucleosides having no more than 1 to 3 mismatches to a target sequence. In some embodiments, sense oligonucleotides consist of 21 linked nucleosides having no more than 1 to 3 mismatches to a target sequence.WSGRRef. 71197-702.601
[0292] In some embodiments, an antisense oligonucleotide is selected from Table B (see section TABLES below). In some embodiments, a sense oligonucleotide is selected from Table B (see section TABLES below).
[0293] In some embodiments, an antisense oligonucleotide is selected from Table B and a sense oligonucleotide is selected from Table B. In some embodiments an antisense oligonucleotide and a sense oligonucleotide are selected from the same row in Table B (e.g., SEQ ID NOs: 1998 and 2988, etc.) to form an oligomeric duplex of the present disclosure.
[0294] In some embodiments, an oligomeric compound provided herein comprises a first modified oligonucleotide having a nucleobase sequence complementary to a sequence in a FDX2 target nucleic acid paired with a second modified oligonucleotide to form an oligomeric duplex. Such oligomeric duplex comprises a first oligomeric compound comprising a modified oligonucleotide having a portion complementary to a sequence in a FDX2 target nucleic acid and a second oligomeric compound comprising a modified oligonucleotide having a portion complementary to the first modified oligonucleotide. In some embodiments, the first oligomeric compound of an oligomeric duplex comprises or consists of a first modified oligonucleotide and optionally a conjugate group and / or terminal group; and the second oligomeric compound of the oligomeric duplex comprises or consists of a second modified oligonucleotide and optionally a terminal group and / or a conjugate group. Either or both oligomeric compounds of an oligomeric duplex may comprise a conjugate group. In some embodiments the sense oligomeric compound of an oligomeric duplex comprises a conjugate group attached at the 5 ’ or 3’ end of the sense oligomeric compound. Either or both oligomeric compounds of an oligomeric duplex may comprise a terminal group. In some embodiments the antisense oligomeric compound of an oligomeric duplex comprises a 5 ’-terminal group. One or both oligonucleotides of each oligomeric compound of an oligomeric duplex may include one or more (e.g., one, two, three, or more) terminal nucleosides that form an overhang at one (i.e., the 5 ’ end or 3 ’ end) or both ends of the oligomeric duplex. In some embodiments an overhang is one or two nucleosides (e.g., of an antisense oligomeric compound, sense oligomeric compound, antisense oligonucleotide, sense oligonucleotide) of an oligomeric duplex. In certain embodiments the terminal one or two nucleosides at the 3’ end or at the 5’ end of an antisense or sense oligomeric compound or an antisense or sense oligonucleotide are overhang nucleosides of an oligomeric duplex. In some embodiments the overhang nucleosides are adenosine, inosine, or thymidine. In some embodiments one or both ends of the oligomeric duplex are blunt ends. In some embodiments, the two oligonucleotides have at least one mismatch relative to one another. In some embodiments, the oligomeric duplex is an antisense compound.WSGRRef. 71197-702.601
[0295] In some embodiments, an overhang is one or two nucleosides of a first oligomeric compound or first modified oligonucleotide of an oligomeric duplex. In some embodiments the last two 3 ’-nucleosides (i.e., the 3 ’-terminal nucleoside and the nucleoside immediately 5 ’ of the 3 ’-terminal nucleoside) of a first oligomeric compound or first modified oligonucleotide of an oligomeric duplex are overhang nucleosides. In some embodiments, a 3’ overhang nucleoside of a first oligomeric compound or first modified oligonucleotide of an oligomeric duplex comprises an unmodified adenine, unmodified thymine, unmodified uracil or hypoxanthine nucleobase. In some embodiments, a 3’ overhang of a first oligomeric compound or first modified oligonucleotide of an oligomeric duplex comprises two nucleosides, each comprising a nucleobase independently selected from an unmodified adenine, an unmodified thymine, an unmodified uracil and a hypoxanthine. In some embodiments, the last two nucleosides at the 3 ’ end of a first oligomeric compound or first modified oligonucleotide of an oligomeric duplex havinga 3’ overhang each comprise a nucleobase independently selected from an unmodified adenine, unmodified thymine, unmodified uracil and hypoxanthine. In some embodiments, a 3’-overhang nucleoside of a first oligomeric compound or first modified oligonucleotide of an oligomeric duplex comprises an unmodified adenine nucleobase or hypoxanthine nucleobase. In some embodiments, a 3’ overhang of a first oligomeric compound or first modified oligonucleotide of an oligomeric duplex comprises two nucleosides, each comprising a nucleobase independently selected from an unmodified adenine nucleobase or a hypoxanthine nucleobase. In some embodiments, the last two terminal nucleosides at the 3’ end of a first oligomeric compound or first modified oligonucleotide of an oligomeric duplex having a 3 ’ overhang each independently comprise an unmodified adenine nucleobase or a hypoxanthine nucleobase. In some embodiments, the last two terminal nucleosides at the 3’ end of a first oligomeric compound or first modified oligonucleotide of an oligomeric duplex having a 3 ’ overhang comprise an unmodified adenine nucleobase. In some embodiments, the last two terminal nucleosides at the 3 ’ end of a first oligomeric compound or first modified oligonucleotide of an oligomeric duplex having a 3 ’ overhang each comprise a hypoxanthine nucleobase. In some embodiments, the 3 ’-terminal nucleoside and the nucleoside immediately 5’ of the 3 ’-terminal nucleoside of a first oligomeric compound or first modified oligonucleotide of an oligomeric duplex havinga 3 ’ overhang comprise an unmodified adenine nucleobase and a hypoxanthine nucleobase, respectively. In some embodiments, the 3’- terminal nucleoside and the nucleoside immediately 5’ of the 3 ’-terminal nucleoside of a first oligomeric compound or first modified oligonucleotide of an oligomeric duplex having a 3 ’ overhang comprise a hypoxanthine nucleobase and an unmodified adenine nucleobase, respectively.WSGRRef. 71197-702.601
[0296] In some embodiments an overhang of an oligomeric duplex is the 3 ’-terminal nucleoside of a first oligomeric compound or first modified oligonucleotide of the oligomeric duplex. In some embodiments the 3 ’-terminal nucleoside of a first oligomeric compound or first modified oligonucleotide of the oligomeric duplex having a 3 ’ overhang comprises an unmodified adenine, unmodified thymine, unmodified uracil or hypoxanthine nucleobase. In some embodiments the 3 ’-terminal nucleoside of a first oligomeric compound or first modified oligonucleotide of the oligomeric duplex having a 3 ’ overhang comprises an unmodified adenine nucleobase or hypoxanthine nucleobase. In some embodiments the 3 ’-terminal nucleoside of a first oligomeric compound or first modified oligonucleotide of the oligomeric duplex having a 3 ’ overhang comprises an unmodified adenine nucleobase. In some embodiments the 3’-terminal nucleoside of a first oligomeric compound or first modified oligonucleotide of the oligomeric duplex having a 3’ overhang comprises a hypoxanthine nucleobase.
[0297] In some embodiments, one or both ends of an oligomeric duplex are blunt ends. In some embodiments, one end of an oligomeric duplex is blunt. In some embodiments, both ends of an oligomeric duplex are blunt. In some embodiments, the 5 ’-terminal nucleoside of a first oligomeric compound or a first modified oligonucleotide of an oligomeric duplex having at least one blunt end comprises an unmodified thymine nucleobase. In some embodiments, the 3’-terminal nucleoside of a first oligomeric compound or a first modified oligonucleotide of an oligomeric duplex having at least one blunt end comprises an unmodified guanine or unmodified uracil nucleobase. In some embodiments, the 5 ’-terminal nucleoside of a first oligomeric compound or a first modified oligonucleotide of an oligomeric duplex having two blunt ends comprises an unmodified thymine nucleobase and the 3 ’-terminal nucleoside of the first oligomeric compound or first modified oligonucleotide comprises an unmodified guanine or unmodified uracil nucleobase.
[0298] In some embodiments, an oligomeric duplex comprises a first oligomeric compound / second oligomeric compound pair in which the nucleobase sequence of the first modified oligonucleotide and the nucleobase sequence of the second modified oligonucleotide are a duplex comprising any one of the following pairs of SEQ ID NOs: 1998-3977 wherein each T may be independently and optionally replaced with U.
[0299] In some embodiments, an oligomeric duplex comprises: a first oligomeric compound comprising a first modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the first modified oligonucleotide comprises a region having a nucleobase sequence comprising at least 8, atleast 9, atleast 10, at least 11, atleast 12, atleast 13, at least 14, at least 15, at least 16, atleast 17, atleast 18, atleast 19, at least 20, atleast 21, at least 22, or at least 23 contiguousWSGRRef. 71197-702.601nucleobasesof the nucleobase sequence of any one of SEQ IDNOs: 1998-2987 (wherein eachT may be independently and optionally replaced with U); and a second oligomeric compound comprising a second modified oligonucleotide consisting of 12 to 50 linked nucleosides that contains a region of at least 12 contiguous nucleosides, wherein the nucleobase sequence of the region of atleast 12 contiguous nucleosidesis atleast80%, atleast90%, atleast95%, oratleast 99% or 100% complementary to the nucleobase sequence of an equal length region of the first modified oligonucleotide. In some embodiments, the nucleobase sequence of the region of the first modified oligonucleotide having a nucleobase sequence comprising at least 8, at least 9, at least 10, atleast 11, atleast 12, atleast 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of the nucleobase sequence of any one of SEQ ID NOs: 1998-2987 (wherein each T may be independently and optionally replaced with U) is at least 80% complementary to the nucleobase sequence of an equal length region of a FDX2 nucleic acid. In some embodiments, the nucleobase sequence of the second modified oligonucleotide comprises at least 8, at least 9, at least 10, atleast 11, atleast 12, atleast 13, atleast 14, at least 15, at least 16, at least 17, at least 18, atleast 19, atleast 20, or at least 21 contiguous nucleobases of the nucleobase sequence of any one of SEQ ID NOs: 2988-3977 wherein each T may be independently and optionally replaced with U. In some embodiments, the first oligomeric compound of the oligomeric duplex is an
[0300] antisense compound, wherein the first modified oligonucleotide is an antisense oligonucleotide. In some embodiments, the second oligomeric compound of the oligomeric duplex is a sense compound, wherein the second modified oligonucleotide is a sense oligonucleotide. In some embodiments, the first modified oligonucleotide is an antisense RNAi oligonucleotide. In some embodiments, the second modified oligonucleotide is a sense RNAi oligonucleotide.
[0301] In some embodiments, an oligomeric duplex comprises: a first oligomeric compound comprising a first modified oligonucleotide consisting of 15 to 30 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 8, at least 9, at least 10, atleast 11, atleast 12, atleast 13, atleast 14, at least 15, at least 16, at least 17, at least 18, atleast 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of the nucleobase sequence of any one of SEQ ID NOs: 1998-2987 (wherein each T may be independently and optionally replaced with U) and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 29 linked nucleosides, wherein the nucleobase sequence of the second modified oligonucleotide comprises at least 8, at least 9, atWSGRRef. 71197-702.601least 10, atleast 11, atleast 12, atleast 13, atleast 14, at least 15, at least 16, at least 17, at least 18, atleast 19, at least 20, or at least 21 contiguous nucleobases of the nucleobase sequence of any one of SEQ ID NOs: 2988-3977 wherein each T may be independently and optionally replaced with U. In some embodiments, the oligomeric duplex is an antisense compound. In some embodiments, the first oligomeric compound of the oligomeric duplex is an antisense compound, wherein the first modified oligonucleotide is an antisense oligonucleotide. In some embodiments, the second oligomeric compound of the oligomeric duplex is a sense compound, wherein the second modified oligonucleotide is a sense oligonucleotide. In some embodiments, the first modified oligonucleotide is an antisense RNAi oligonucleotide. In some embodiments, the second modified oligonucleotide is a sense RNAi oligonucleotide. In some embodiments, the nucleobase sequence of the second modified oligonucleotide is atleast 90%, 95% or 100% complementary to the nucleobase sequence of an equal length portion of the first modified oligonucleotide.
[0302] In some embodiments, an oligomeric duplex comprises a first oligomeric compound comprising a first modified oligonucleotide consisting of 18 to 30 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, atleast 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 contiguous nucleobases of the nucleobase sequence of any one of SEQ ID NOs: 1998-2987 (wherein each T may be independently and optionally replaced with U) and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 29 linked nucleosides, wherein the nucleobase sequence of the second modified oligonucleotide comprises atleast 12, at least 13, at least 14, atleast 15, at least 16, atleast 17, at least 18, at least 19, at least 20, or at least 21 contiguous nucleobases of the nucleobase sequence of any one of SEQ ID NOs: 2988-3977 (wherein each T may be independently and optionally replaced with U).
[0303] In some embodiments, the first oligomeric compound is an antisense compound, wherein the first modified oligonucleotide is an antisense oligonucleotide. In some embodiments, the second oligomeric compound is a sense compound, wherein the second modified oligonucleotide is a sense oligonucleotide. In some embodiments, the first modified oligonucleotide is an antisense RNAi oligonucleotide. In some embodiments, the second modified oligonucleotide is a sense RNAi oligonucleotide. In some embodiments, the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 9, at least 10, atleast 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or 21 contiguous nucleobases that is 100%WSGRRef. 71197-702.601complementary to the nucleobase sequence of an equal length portion of the first modified oligonucleotide. In some embodiments, the nucleobase sequence of the second modified oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the nucleobase sequence of an equal length portion of the first modified oligonucleotide. In some embodiments, the oligomeric duplex is an antisense compound. In some embodiments, the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 9, at least 10, at least 11, at least 12, atleast 13, atleast 14, atleast 15, atleast 16, atleast 17, atleast 18, atleast 19, atleast 20, or 21 contiguous nucleobases that is 100% complementary to the nucleobase sequence of an equal length portion of the first modified oligonucleotide; and the nucleobase sequence of the second modified oligonucleotide is atleast 80%, atleast 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the nucleobase sequence of an equal length portion of the first modified oligonucleotide. In some embodiments, the oligomeric duplex is an antisense compound.
[0304] In some embodiments, an oligomeric duplex comprises a first oligomeric compound comprising a first modified oligonucleotide consisting of 19 to 25 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 10, at least 11, at least 12, at least 13, at least 14, atleast 15, at least 16, at least 17, atleast 18, at least 19, at least 20, or at least 21 contiguous nucleobases of the nucleobase sequence of any one of SEQ ID NOs: 1998-2987 (wherein each T may be independently and optionally replaced with U); and a second oligomeric compound comprising a second modified oligonucleotide consisting of 16 to 24 linked nucleosides, wherein the nucleobase sequence of the second modified oligonucleotide comprises at least 9, atleast 10, atleast 11, atleast 12, atleast 13, atleast 14, at least 15, at least 16, atleast 17, at least 18, at least 19, or at least 20 contiguous nucleobases of the nucleobase sequence of any one of SEQ ID NOs: 2988-3977 (wherein each T may be independently and optionally replaced with U).
[0305] In some embodiments, the first oligomeric compound is an antisense compound, wherein the first modified oligonucleotide is an antisense oligonucleotide. In some embodiments, the second oligomeric compound is a sense compound, wherein the second modified oligonucleotide is a sense oligonucleotide. In some embodiments, the first modified oligonucleotide is an antisense RNAi oligonucleotide, and the second modified oligonucleotide is a sense RNAi oligonucleotide. In some embodiments, the nucleobase sequence of the second modified oligonucleotide is at least 95% or 100% complementary to the nucleobase sequence ofWSGRRef. 71197-702.601an equal length portion of the first modified oligonucleotide. In some embodiments, the oligomeric duplex is an antisense compound.
[0306] In some embodiments, an oligomeric duplex comprises a first oligomeric compound comprising a first modified oligonucleotide, wherein the first modified oligonucleotide consists of 23, 22 or 21 linked nucleosides and has nucleobase sequence comprising at least a 19-mer nucleobase sequence of any one of SEQ ID NOs: 1998-2987 (wherein each T may be independently and optionally replaced with U) having 0, 1 , 2 or 3 nucleobases that are different from the corresponding nucleotide in any of SEQ ID NOs: 1998-2987 (wherein each T may be independently and optionally replaced with U); and a second oligomeric compound comprising a second modified oligonucleotide wherein the second modified oligonucleotide consists of 21 linked nucleosides and has a nucleobase sequence comprising at least a 16-mer nucleobase sequence of any one of SEQ ID NOs: 2988-3977 (wherein each T may be independently and optionally replaced with U) having 0, 1, 2 or 3 nucleobases that are different from the corresponding nucleotide in any of SEQ ID NOs: 2988-3977 (wherein each T may be independently and optionally replaced with U). In some embodiments, the first oligomeric compound is an antisense compound, wherein the first modified oligonucleotide is an antisense oligonucleotide. In some embodiments, the second oligomeric compound is a sense compound, wherein the second modified oligonucleotide is a sense oligonucleotide. In some embodiments, the first modified oligonucleotide is an antisense RNAi oligonucleotide and the second modified oligonucleotide is a sense RNAi oligonucleotide. In some embodiments, the nucleobase sequence of the second modified oligonucleotide is at least 95% or 100% complementary to the nucleobase sequence of an equal length portion of the first modified oligonucleotide. In some embodiments, the oligomeric duplex is an antisense compound. In some embodiments, the oligomeric duplex comprises one or two unpaired nucleosides at either or both ends, forming one or two overhang ends. In some embodiments an overhang end is one or two nucleosides of the antisense oligonucleotide. In some embodiments an overhang end is one or two 3 ’-nucleosides of the antisense oligonucleotide. In some embodiments the last two 3 ’-nucleosides of the antisense oligonucleotide are overhang nucleosides not paired with the sense oligonucleotide. In some embodiments the last one or two 3 ’-unpaired overhang nucleosides comprise an adenine nucleobase. In some embodiments the last one ortwo 3’-unpaired overhang nucleosides comprise a hypoxanthine nucleobase. In some embodiments the last one or two 3 ’-unpaired overhang nucleosides comprise a thymine nucleobase.
[0307] In some embodiments, an oligomeric duplex comprises a first oligomeric compound comprising a first modified oligonucleotide, wherein the first modified oligonucleotide consistsWSGRRef. 71197-702.601of 21 , 20 or 19 linked nucleosides and has a nucleobase sequence comprising at least a 19 -mer nucleobase sequence of any one of SEQ ID NOs: 1998-2987 wherein each T may be independently and optionally replaced with U) having 0, 1, 2 or 3 mismatches with a sequence in a target FDX2 nucleic acid sequence; and a second oligomeric compound comprising a second modified oligonucleotide wherein the second modified oligonucleotide consists of 19 linked nucleosides, comprising at least a 19 -mer nucleobase sequence of any one of SEQ ID NOs: 2988-3977 (wherein each T may be independently and optionally replaced with U) having 0, 1, 2 or 3 mismatches to the first modified oligonucleotide.
[0308] In some embodiments, the first oligomeric compound is an antisense compound, wherein the first modified oligonucleotide is an antisense oligonucleotide. In some embodiments, the second oligomeric compound is a sense compound, wherein the second modified oligonucleotide is a sense oligonucleotide. In some embodiments, the first modified oligonucleotide is an antisense RNAi oligonucleotide and the second modified oligonucleotide is a sense RNAi oligonucleotide. In some embodiments, the nucleobase sequence of the second modified oligonucleotide is at least 95% or 100% complementary to the nucleobase sequence of an equal length portion of the first modified oligonucleotide. In some embodiments, the oligomeric duplex is an antisense compound. In some embodiments, the oligomeric duplex comprises one or two unpaired nucleosides at either or both ends, forming one or two overhang ends. In some embodiments an overhang end is one or two nucleosides of the antisense oligonucleotide. In some embodiments an overhang end is one or two 3 ’-nucleosides of the antisense oligonucleotide. In some embodiments the last two 3 ’-nucleosides of the antisense oligonucleotide are overhang nucleosides not paired with the sense oligonucleotide. In some embodiments the last one or two 3 ’-unpaired overhang nucleosides comprise an adenine nucleobase. In some embodiments the last one or two 3 ’-unpaired overhang nucleosides comprise a hypoxanthine nucleobase. In some embodiments the last one or two 3 ’-unpaired overhang nucleosides comprise a thymine nucleobase.
[0309] In some embodiments, an oligomeric duplex comprises a first oligomeric compound comprising a first modified oligonucleotide, wherein the first modified oligonucleotide consists of 23, 22 or 21 linked nucleosides and has a nucleobase sequence comprising at least a 19 -mer nucleobase sequence of any one of SEQ ID NOs: 1998-2987 (wherein each T may be independently and optionally replaced with U); and a second oligomeric compound comprising a second modified oligonucleotide wherein the second modified oligonucleotide consists of 21 linked nucleosides and has a nucleobase sequence comprising at least a 19 -mer nucleobaseWSGRRef. 71197-702.601sequence of any one of SEQ ID NOs: 2988-3977 (wherein each T may be independently and optionally replaced with U).
[0310] In some embodiments, the first oligomeric compound is an antisense compound, wherein the first modified oligonucleotide is an antisense oligonucleotide. In some embodiments, the second oligomeric compound is a sense compound, wherein the second modified oligonucleotide is a sense oligonucleotide. In some embodiments, the first modified oligonucleotide is an antisense RNAi oligonucleotide and the second modified oligonucleotide is a sense RNAi oligonucleotide. In some embodiments, the nucleobase sequence of the second modified oligonucleotide is at least 95% or 100% complementary to the nucleobase sequence of an equal length portion of the first modified oligonucleotide. In some embodiments, the oligomeric duplex is an antisense compound. In some embodiments, the oligomeric duplex comprises one or two unpaired nucleosides at either or both ends, forming one or two overhang ends. In some embodiments an overhang end is one or two nucleosides of the antisense oligonucleotide. In some embodiments an overhang end is one or two 3 ’-nucleosides of the antisense oligonucleotide. In some embodiments the last two 3 ’-nucleosides of the antisense oligonucleotide are overhang nucleosides not paired with the sense oligonucleotide. In some embodiments the last one or two 3 ’-unpaired overhang nucleosides comprise an adenine nucleobase. In some embodiments the last one or two 3 ’-unpaired overhang nucleosides comprise a hypoxanthine nucleobase. In some embodiments the last one or two 3 ’-unpaired overhang nucleosides comprise a thymine nucleobase.
[0311] In some embodiments, an oligomeric duplex comprises a first oligomeric compound comprising a first modified oligonucleotide, wherein the first modified oligonucleotide consists of 21 linked nucleosides and has a nucleobase sequence comprising at least a 19 -mer nucleobase sequence of any one of SEQ ID NOs: 1998-2987 (wherein each T may be independently and optionally replaced with U); and a second oligomeric compound comprising a second modified oligonucleotide wherein the second modified oligonucleotide consists of 19 linked nucleosides and has a nucleobase sequence comprising at least a 16 -mer nucleobase sequence of any one of SEQ ID NOs: 2988-3977 (wherein each T may be independently and optionally replaced with U), wherein the nucleobase sequence of the second modified oligonucleotide is at least 90% complementary to the nucleobase sequence of an equal length portion of the first modified oligonucleotide.
[0312] In some embodiments, the first oligomeric compound is an antisense compound, wherein the first modified oligonucleotide is an antisense oligonucleotide. In some embodiments, the second oligomeric compound is a sense compound, wherein the secondWSGRRef. 71197-702.601modified oligonucleotide is a sense oligonucleotide. In some embodiments, the first modified oligonucleotide is an antisense RNAi oligonucleotide and the second modified oligonucleotide is a sense RNAi oligonucleotide. In some embodiments, the nucleobase sequence of the second modified oligonucleotide is at least 95% or 100% complementary to the nucleobase sequence of an equal length portion of the first modified oligonucleotide. In some embodiments, the oligomeric duplex is an antisense compound. In some embodiments, the oligomeric duplex comprises one or two unpaired nucleosides at either or both ends, forming one or two overhang ends. In some embodiments an overhang end is one or two nucleosides of the antisense oligonucleotide. In some embodiments an overhang end is one or two 3 ’-nucleosides of the antisense oligonucleotide. In some embodiments the last two 3 ’-nucleosides of the antisense oligonucleotide are overhang nucleosides not paired with the sense oligonucleotide. In some embodiments the last one or two 3 ’-unpaired overhang nucleosides comprise an adenine nucleobase. In some embodiments the last one or two 3 ’-unpaired overhang nucleosides comprise a hypoxanthine nucleobase. In some embodiments the last one or two 3 ’-unpaired overhang nucleosides comprise a thymine nucleobase.
[0313] In some embodiments, an oligomeric duplex comprises a first oligomeric compound comprising a first modified oligonucleotide consisting of 19 to 25 linked nucleosides and a second oligomeric compound comprising a second modified oligonucleotide consisting of 16 to 24 linked nucleosides. In some embodiments, the first oligomeric compound is an antisense compound. In some embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In some embodiments, the second oligomeric compound is a sense compound. In some embodiments, the second modified oligonucleotide is a sense oligonucleotide. In some embodiments, the first modified oligonucleotide is an antisense RNAi oligonucleotide. In some embodiments, the second oligomeric compound is a sense compound. In some embodiments, the second modified oligonucleotide is a sense RNAi oligonucleotide. In some embodiments, the oligomeric duplex comprises one or two unpaired nucleosides at either or both ends, forming one or two overhang ends. In some embodiments an overhang end is one or two 3 ’-nucleosides of the antisense oligonucleotide. In some embodiments the last two 3 ’-nucleosides of the antisense oligonucleotide are overhang nucleosides not paired with the sense oligonucleotide. In some embodiments the last one or two 3 ’-unpaired overhang nucleosides comprise an adenine nucleobase. In some embodiments the last one or two 3 ’-unpaired overhang nucleosides comprise a hypoxanthine nucleobase. In some embodiments the last one or two 3 ’-unpaired overhang nucleosides comprise a thymine nucleobase.WSGRRef. 71197-702.601
[0314] In some embodiments, an oligomeric duplex comprises a first oligomeric compound comprising a first modified oligonucleotide consisting of 21 or 23 linked nucleosides and a second oligomeric compound comprising a second modified oligonucleotide consisting of 19 or 21 linked nucleosides. In some embodiments, the first oligomeric compound is an antisense compound. In some embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In some embodiments, the second Oligomeric compound is a sense compound. In some embodiments, the second modified oligonucleotide is a sense oligonucleotide. In some embodiments, the first modified oligonucleotide is an antisense RNAi oligonucleotide. In some embodiments, the second oligomeric compound is a sense compound. In some embodiments, the second modified oligonucleotide is a sense RNAi oligonucleotide. In some embodiments, the oligomeric duplex comprises one or two unpaired nucleosides at either or both ends, forming one or two overhang ends. In some embodiments an overhang end is one or two 3 ’-nucleosides of the antisense oligonucleotide. In some embodiments the last two 3’- nucleosides of the antisense oligonucleotide are overhang nucleosides not paired with the sense oligonucleotide. In some embodiments the last one or two 3 ’-unpaired overhang nucleosides comprise an adenine nucleobase. In some embodiments the last one or two 3 ’-unpaired overhang nucleosides comprise a hypoxanthine nucleobase. In some embodiments the last one or two 3 ’-unpaired overhang nucleosides comprise a thymine nucleobase. In some embodiments, the oligomeric duplex comprises one blunt end at either end, or two blunt ends.
[0315] In any of the oligomeric duplexes described herein, at least one nucleoside of the first modified oligonucleotide and / or the second modified oligonucleotide comprises a modified sugar moiety as described herein. Examples of suitable modified sugar moieties include, but are not limited to, a bicyclic sugar moiety, e.g., a modified furanosyl sugar moiety containing a 2 ’-4’ bridge selected from -O-CH2-; and -O-CH(CH3)-, and anon-bicyclic sugar moiety, e.g., a 2’-MOE sugar moiety, a 2’-F sugar moiety, a2’-OMe sugar moiety, or a2’-NMA sugar moiety. In some embodiments, at least one nucleoside of the first modified oligonucleotide and / or the second modified oligonucleotide comprises a modified 2 ’-deoxy sugar moiety. In some embodiments, at least 80%, at least 90%, or 100% of the nucleosides of the first modified oligonucleotide and / or the second modified oligonucleotide comprises a modified sugar moiety independently selected from 2’-F, 2’-M0E, 2’-OMe, and 2’-deoxy. In some embodiments, at least 80%, at least 90%, or 100% of the nucleosides of the first modified oligonucleotide and the second modified oligonucleotide comprises a modified sugar moiety independently selected from 2’-F, 2’-M0E, 2’-OMe, and 2’-deoxy.WSGRRef. 71197-702.601
[0316] In some embodiments, in an oligomeric duplex provided herein, at least one internucleoside linkage of the first modified oligonucleotide and / or the second modified oligonucleotide comprises a modified intemucleoside linkage. In some embodiments, the modified internucleoside linkage is a phosphorothioate internucleoside linkage. In some embodiments, at least one of the first, second, or third internucleoside linkages from the 5 ’ end and / or the 3 ’ end of the first modified oligonucleotide comprises a phosphorothioate linkage. In some embodiments, at least one of the first, second, or third internucleoside linkages from the 5 ’ end and / or the 3 ’ end of the second modified oligonucleotide comprises a phosphorothioate linkage. In some embodiments, the modified internucleoside linkage is a mesyl phosphoramidate internucleoside linkage. In some embodiments, at least one of the intemucleoside linkages of the first modified oligonucleotide comprises a mesyl phosphoramidate intemucleoside linkage. In some embodiments, at least one of the intemucleoside linkages of the second modified oligonucleotide comprises a mesyl phosphoramidate intemucleoside linkage.
[0317] In some embodiments, in an oligomeric duplex provided herein, each intemucleoside linkage of the first modified oligonucleotide is independently selected from a phosphodiester, a phosphorothioate, or a mesyl phosphoramidate intemucleoside linkage, and each intemucleoside linkage of the second modified oligonucleotide is independently selected from a phosphodiester, a phosphorothioate, or a mesyl phosphoramidate intemucleoside linkage.
[0318] In some embodiments, in an oligomeric duplex provided herein, each intemucleoside linkage of the first modified oligonucleotide is independently selected from a phosphodiester or a phosphorothioate intemucleoside linkage and each intemucleoside linkage of the second modified oligonucleotide is independently selected from a phosphodiester or a phosphorothioate intemucleoside linkage.
[0319] In some embodiments, in an oligomeric duplex provided herein, at least one intemucleoside linkage of the first modified oligonucleotide (e.g., antisense oligonucleotide) is a modified intemucleoside linkage. In some embodiments, in an oligomeric duplex provided herein, an intemucleoside linkage of the first modified oligonucleotide is modified, wherein the 5 ’-most intemucleoside linkage (i.e., linking the first nucleoside from the 5 ’-end to the second nucleoside from the 5 ’-end) is modified. In some embodiments, in an oligomeric duplex provided herein, the intemucleoside linkage motif (from 5’ to 3’) of the first modified oligonucleotide is selected from 5’-ssooooooooooooooooooss-3’, 5’ -ooooooooooooooooooooss-3’, 5’-SSOOOOOOOOOOOOOOOOOSS-3’, 5’ -oooooooooooooooooooss-3’ , 5’-ssooooooooooooooooss-3 ’ , 5 ’ -ooooooooooooooooooss-3 ’ , 5 ’ -ssoooooooooooooooss-3 ’ , and 5 ’ -oooooooooooooooooss-3’, wherein each ‘s’ is a phosphorothioate intemucleoside linkage and each ‘o’ is aWSGRRef. 71197-702.601phosphodiester intemucleoside linkage. In some embodiments, in an oligomeric duplex provided herein, the internucleoside linkage motif (from 5’ to 3’) of the first modified oligonucleotide is selected from 5’-ssooooooooooooooooooss-3’ and 5 ’-ooooooooooooooooooooss-3 ’wherein each ‘s’ is a phosphorothioate internucleoside linkage and each ‘o’ is a phosphodiester internucleoside linkage. In some embodiments, in an oligomeric duplex provided herein, an internucleoside linkage of the second modified oligonucleotide is modified, wherein the 5 ’-most internucleoside linkage (i.e., linking the first nucleoside from the 5 ’-end to the second nucleoside from the 5 ’-end) is modified. In some embodiments, in an oligomeric duplex provided herein, the intemucleoside linkage motif (from 5’ to 3’) of the second modified oligonucleotide is selected from 5’ -ssoooooooooooooooooo-3’, 5’-ssooooooooooooooooss-3’, 5’ -ssooooooooooooooooo-3’ , 5’-ssoooooooooooooooss-3’, 5’ -ssoooooooooooooooo-3’ , 5’-ssooooooooooooooss-3’, 5’ -ssooooooooooooooo-3’ , and 5’-ssoooooooooooooss-3’, wherein each ‘o’ represents a phosphodiester intemucleoside linkage and each ‘s’ represents a phosphorothioate intemucleoside linkage. In some embodiments, in an oligomeric duplex provided herein, the intemucleoside linkage motif (from 5’ to 3’) of the second modified oligonucleotide is selected from 5 ’-ssoooooooooooooooooo-3’ and 5’-ssooooooooooooooooss-3 ’ wherein each ‘o’ represents a phosphodiester intemucleoside linkage and each ‘s’ represents a phosphorothioate intemucleoside linkage. In some embodiments, the two 5 ’-most intemucleoside linkages of a first modified oligonucleotide and / or second modified oligonucleotide of an oligomeric duplex are modified. In some embodiments, the first one or 2 intemucleoside linkages from the 3 ’-end of a first modified oligonucleotide and / or second modified oligonucleotide of an oligomeric duplex are modified. In some embodiments, the two 5 ’-most intemucleoside linkages of a first modified oligonucleotide and / or second modified oligonucleotide of an oligomeric duplex are modified and the first two intemucleoside linkages from the 3 ’-end of the first modified oligonucleotide and / or second modified oligonucleotide are modified. In some embodiments, the modified intemucleoside linkage is a phosphorothioate linkage. In some embodiments, the modified intemucleoside linkage is a mesyl phosphoramidate linkage.
[0320] In some embodiments, the present disclosure provides an oligomeric duplex that comprises a modified antisense oligonucleotide consisting of 23 to 30 linked nucleosides and having a nucleobase sequence comprising 23 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 1998-2987 wherein each T may be independently and optionally replaced with U and a modified sense oligonucleotide consisting of 21 to 29 linked nucleosides and having a nucleobase sequence comprising 21 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 2988-3977 wherein each T may be independently andWSGRRef. 71197-702.601optionally replaced with U, wherein the modified antisense oligonucleotide and modified sense oligonucleotide are complementary. In some embodiments, the modified antisense oligonucleotide is 23 nucleotides in length and has a sugar motif (from 5’ to 3’) selected from: y fy fyfy fyfy fyfy fyfy fyyy , y fffyfy fy fyfy fyfy fyfyyy , yfy fffyfy fyyy fyfy fyyyyy , yfyfyfyfyfyyyfyfyfyfyfy, yfyfyfyfyfyyyfyfyfyfyyy, yfyyyfyffyyyyfyfyyyyyyy, yfyyyfyyyyyyyfyfyyyyyyy, and yfyyyfOffyyyyfyfyyyyyyy (e.g., yfyfyfyfyfyfyfyfyfyfyyy); wherein each ‘y’ represents a 2’ -OMe sugar moiety, each ‘f’ represents a 2’-F sugar moiety, and ‘0’ represents an unmodified sugar moiety. In some embodiments, the modified antisense oligonucleotide also has an internucleoside linkage motif (from 5’ to 3’) selected from: ssooooooooooooooooooss and ooooooooooooooooooooss (e.g., ssooooooooooooooooooss); wherein each ‘o’ represents a phosphodiester internucleoside linkage and each ‘s’ represents a phosphorothioate internucleoside linkage. In some embodiments, each cytosine residue is a nonmethylated cytosine. In some embodiments, each antisense oligonucleotide has a terminal phosphate at the 5’-end. In some embodiments, the modified sense oligonucleotide is 21 nucleotides in length and has a sugar motif (from 5’ to 3’) selected from: fyfyfyfyfyfyfyfyfyfyf, yyyyyyfyfyfyfyfyyyyyy, yyyyyyfyfydyyyyyyyyyy, fyfyfyfyfffyfyfyfyfyf, and yyyyyyfyfffyyyyyyyyyy (e.g., fyfyfyfyfyfyfyfyfyfyf); wherein each ‘y’ represents a 2’-OMe sugar moiety, each ‘f’ represents a 2’-F sugar moiety, and ‘d’ represents a 2’-deoxy sugar moiety. In some embodiments, the modified sense oligonucleotide also has an internucleoside linkage motif (from 5’ to 3’) selected from: ssooooooooooooooooss and ssoooooooooooooooooo (e.g., ssooooooooooooooooss); wherein each ‘o’ represents a phosphodiester internucleoside linkage and each ‘s’ represents a phosphorothioate internucleoside linkage. In some embodiments, each cytosine residue is a non-methylated cytosine. In some embodiments, the modified antisense oligonucleotide and the modified sense oligonucleotide are based on a pair of anti sen se / sense sequences that are in the same row of Table B (e.g., a modified antisense oligonucleotide based on the sequence of SEQ ID NO: 1998 and a modified sense oligonucleotide based on the sequence of SEQ ID NO: 2988, etc.).
[0321] In some embodiments, an oligomeric compound comprises at least two oligomeric duplexes linked together. In some embodiments, an oligomeric compound comprises two oligomeric duplexes wherein at least one oligomeric duplex comprises an oligonucleotide comprising a portion having a nucleobase sequence complementary to a nucleobase sequence in a FDX2 nucleic acid (i.e., is targeted to FDX2 RNA) as described herein. In some embodiments, an oligomeric compound comprises two or more of the same oligomeric duplex, which is any of the oligomeric duplexes described herein. In some embodiments, the two or more oligomeric duplexes are covalently linked together. In some embodiments, the second modifiedWSGRRef. 71197-702.601oligonucleotides of the two or more oligomeric duplexes are covalently linked together. In some embodiments, the second modified oligonucleotides of two or more oligomeric duplexes are covalently linked together at their 3 ’ ends. In some embodiments, the second modified oligonucleotides of two or more oligomeric duplexes are covalently linked together at the 3 ’ end of one to the 5 ’ end of the other. In some embodiments, the two or more oligomeric duplexes are covalently linked together by a glycol linker, e.g., a tetraethylene glycol linker. A structure of oligomeric duplexes covalently linked by a glycol linker is described in, e.g., Alterman et al.2019, Nature Biotech. 37:844-894. In some embodiments, an oligomeric compound comprises two or more oligomeric duplexes linked, e.g., covalently linked, together in a branched structure, e.g., a di-branched, tri-branched or tetra-branched structure (see, e.g., WO2022 / 256565). In some such embodiments, the structure contains a linker (e.g., one or more subunits of an ethylene glycol, alkyl, carbohydrate, block copolymer, peptide, ester, amide, carbamate, triazole) and optionally one or more branch point moieties (e.g., phosphoroamidite, tosylated solketal, 1,3 -diaminopropanol, pentaerythritol).
[0322] In some embodiments, an oligomeric duplex comprises two or more regions each of which has a nucleobase sequence complementary to the nucleobase sequence of a different target region of the same nucleic acid target (FDX2 nucleic acid), or one of which has a nucleobase sequence complementary to the nucleobase sequence of a target region of a FDX2 nucleic acid (e.g., a FDX2 RNA such as described herein) and the other having a nucleobase sequence complementary to the nucleobase sequence of a target region of a different nucleic acid target (i.e., other than a FDX2 nucleic acid target). In some embodiments, the nucleobase sequence(s) complementary to a target region of a FDX2 nucleic acid targets a FDX2 nucleic acid region as described herein and / or comprises at least 8, at least 9, at least 10, at least 11, at least 12, atleast 13, atleast 14, atleast 15, atleast 16, at least 17, at least 18, at least 19, at least 20, at least 21, atleast 22, or at least 23 contiguous nucleobases of the nucleobase sequence of any one of SEQ ID NOs: 1998-2987 (wherein each T may be independently and optionally replaced with U). In some embodiments, such an oligomeric duplex comprises a first modified oligonucleotide comprising (1) a first region having a nucleobase sequence complementary to a first sequence in a FDX2 target nucleic acid and (2) a second region having a nucleobase sequence complementary to (a) a different (i.e., second) sequence in a FDX2 target nucleic acid, or (b) a sequence in a target nucleic acid other than a FDX2 nucleic acid. In some such embodiments, the second modified oligonucleotide of the oligomeric duplex comprises (1) a region having a nucleobase sequence complementary to the first region of the first modified oligonucleotide and (2) a region having a nucleobase sequence complementary to the second region of the first modified oligonucleotide. In some embodiments, an oligomeric duplexWSGRRef. 71197-702.601comprises a first modified oligonucleotide comprising a first region having a nucleobase sequence complementary to a first sequence in a FDX2 target nucleic acid and a second modified oligonucleotide comprising a second region having a nucleobase sequence complementary to: (a) the nucleobase sequence of a different (i.e., second) sequence in a FDX2 target nucleic acid, or (b) a sequence in a target nucleic acid other than a FDX2 nucleic acid. In some such embodiments, the first modified oligonucleotide further comprises a region having a nucleobase sequence complementary to the nucleobase sequence of the second region in the second modified oligonucleotide. In some such embodiments, the second modified oligonucleotide further comprises a region having a nucleobase sequence complementary to the nucleobase sequence of the first region in the first modified oligonucleotide (see, e.g., W02020 / 065602).Target Nucleic Acids, Target Regions and Nucleotide Sequences
[0323] Nucleotide sequences that encode FDX2 are described herein, for example as SEQ ID NO: 1. It is understood that the sequence set forth in each SEQ ID NO in the present disclosure contained herein is independent of any modification to a sugar moiety, an internucleoside linkage, or a nucleobase. As such, antisense compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase. In addition, whenever a sequence set forth in a SEQ ID NO includes a thymidine (T) it is to be understood that each T may be independently and optionally replaced with a uracil (U), e.g., some or all of the Ts may be replaced with Us.
[0324] In some embodiments, a target region is a structurally defined region of the target nucleic acid. The structurally defined regions for FDX2 can be obtained by accession number from sequence databases such as NCBI and such information is incorporated herein by reference. In some embodiments, a target region may encompass the sequence from a 5 ’ target site of one target segment within the target region to a 3 ’ target site of another target segment within the same target region.
[0325] Targeting includes determination of at least one target segment to which an antisense compound hybridizes, such that a desired effect occurs. In some embodiments, the desired effect is a reduction in mRNA target nucleic acid levels. In some embodiments, the desired effect is reduction of levels of protein encoded by the target nucleic acid or a phenotypic change associated with the target nucleic acid.
[0326] A target region may contain one or more target segments. Multiple target segments within a target region may be overlapping. Alternatively, they maybe non-overlapping. In some embodiments, target segments within a target region are separated by no more than about 300WSGRRef. 71197-702.601nucleotides. In some embodiments, target segments within a target region are separated by a number of nucleotides that is, is about, is no more than, is no more than about, 250, 200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 nucleotides on the target nucleic acid, or is a range defined by any two of the preceding values. In some embodiments, target segments within a target region are separated by no more than, or no more than about, 5 nucleotides on the target nucleic acid. In some embodiments, target segments are contiguous.
[0327] The determination of suitable target segments may include a comparison of the sequence of a target nucleic acid to other sequences throughout the genome. For example, the BLAST algorithm may be used to identify regions of similarity amongst different nucleic acids. This comparison can prevent the selection of antisense compound sequences that may hybridize in a non-specific manner to sequences other than a selected target nucleic acid (i.e., non-target or off-target sequences).
[0328] There may be variation in activity (e.g., as defined by percent reduction of target nucleic acid levels) of the antisense compounds within an active target region. In some embodiments, reductions in FDX2 mRNA levels are indicative of inhibition of FDX2 expression. Reductions in levels of an FDX2 protein are also indicative of inhibition of target mRNA expression. Phenotypic changes are indicative of inhibition of FDX2 expression. Improvement in neurological function is indicative of inhibition of FDX2 expression. Improved motor function, activity, social behavior, and memory are indicative of inhibition of FDX2 expression.Reduction of anxiety -like behaviors is indicative of inhibition of FDX2 expression.Hybridization
[0329] In some embodiments, hybridization occurs between an antisense compound disclosed herein and an FDX2 nucleic acid. The most common mechanism of hybridization involves hydrogen bonding (e.g., Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding) between complementary nucleobases of the nucleic acid molecules.
[0330] Hybridization can occur under varying conditions. Stringent conditions are sequence -dependent and are determined by the nature and composition of the nucleic acid molecules to be hybridized.
[0331] Methods of determining whether a sequence is specifically hybridizable to a target nucleic acid are well known in the art. In some embodiments, the antisense compounds provided herein are specifically hybridizable with a FDX2 nucleic acid.WSGRRef. 71197-702.601Complementarity
[0332] An antisense compound and a target nucleic acid are complementary to each other when a sufficient number of nucleobases of the antisense compound can hydrogen bond with the corresponding nucleobases of the target nucleic acid, such that a desired effect will occur (e.g., antisense inhibition of a target nucleic acid, such as a FDX2 nucleic acid).
[0333] Non-complementary nucleobases between an antisense compound and a target nucleic acid may be tolerated provided that the antisense compound remains able to specifically hybridize to a target nucleic acid.
[0334] Moreover, an antisense compound may hybridize over one or more segments of a target nucleic acid such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure, mismatch or hairpin structure).
[0335] In some embodiments, the antisense compounds provided herein, ora specified portion thereof, are, or are atleast, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to a FDX2 nucleic acid (FDX2 mRNA or pre-mRNA), a target region, target segment, or specified portion thereof. Percent complementarity of an antisense compound with a target nucleic acid can be determined using routine methods.
[0336] For example, an antisense compound in which 18 of 20 nucleobases of the antisense compound are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity. In this example, the remaining noncom pl emen tary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases. As such, an antisense compound which is 18 nucleobases in length having 4 (four) noncomplementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid and would thus fall within the scope of the present invention. Percent complementarity of an antisense compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al. 1990, J. Mol. Biol.215:403-410; Zhang and Madden 1997, Genome Res. 7:649-656). Percent homology, sequence identity or complementarity, can be determined by, for example, the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison WI), using default settings, which uses the algorithm of Smith and Waterman 1981, Adv. Appl. Math. 2:482-489.WSGRRef. 71197-702.601
[0337] In some embodiments, the antisense compounds provided herein, or specified portions thereof, are fully complementary (i.e., 100% complementary) to a target nucleic acid, or specified portion thereof. For example, an antisense compound may be fully complementary to a FDX2 nucleic acid, or a target region, or a target segment or target sequence thereof. As used herein, “fully complementary” means each nucleobaseof an antisense compound is capable of precise base pairing with the corresponding nucleobases of a target nucleic acid. For example, a 20 nucleobase antisense compound is fully complementary to a target sequence that is 400 nucleobases long, so long as there is a corresponding 20 nucleobase portion of the target nucleic acid that is fully complementary to the antisense compound. Fully complementary can also be used in reference to a specified portion of the first and / or the second nucleic acid. For example, a 20 nucleobase portion of a 30 nucleobase antisense compound can be “fully complementary” to a target sequence that is 400 nucleobases long. The 20 nucleobase portion of the 30 nucleobase oligonucleotide is fully complementary to the target sequence if the target sequence has a corresponding 20 nucleobase portion wherein each nucleobase is complementary to the 20 nucleobase portion of the antisense compound. At the same time, the entire 30 nucleobase antisense compound may or may notbe fully complementary to the target sequence, depending on whether the remaining 10 nucleobases of the antisense compound are also complementary to the target sequence.
[0338] The location of a non-complementary nucleobase may be at the 5 ’ end or 3 ’ end of the antisense compound. Alternatively, the non-complementary nucleobase or nucleobases may be at an internal position of the antisense compound. When two or more non-complementary nucleobases are present, they may be contiguous (i.e., linked) or non-contiguous. In one embodiment, a non-complementary nucleobase is located in the wing segment of a gapmer antisense oligonucleotide.
[0339] In some embodiments, antisense compounds that are, or are up to 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases in length comprise no more than 4, no more than 3 , no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, or specified portion thereof.
[0340] In some embodiments, antisense compounds that are, or are up to 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22,23, 24,25, 26,27, 28,29, or 30 nucleobases in length comprise no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, or specified portion thereof.
[0341] The antisense compounds provided herein also include those which are complementary to a portion of a target nucleic acid. As used herein, “portion” refers to a defined number ofWSGRRef. 71197-702.601contiguous (i.e., linked) nucleobases within a region or segment of a target nucleic acid. A “portion” can also refer to a defined number of contiguous nucleobases of an antisense compound. In some embodiments, the antisense compounds, are complementary to at least an 8 nucleobase portion of a target segment. In some embodiments, the antisense compounds are complementary to at least a 9 nucleobase portion of a target segment. In some embodiments, the antisense compounds are complementary to at least a 10 nucleobase portion of a target segment. In some embodiments, the antisense compounds, are complementary to at least an 11 nucleobase portion of a target segment. In some embodiments, the antisense compounds, are complementary to at least a 12 nucleobase portion of a target segment. In some embodiments, the antisense compounds, are complementary to at least a 13 nucleobase portion of a target segment. In some embodiments, the antisense compounds, are complementary to at least a 14 nucleobase portion of a target segment. In some embodiments, the antisense compounds, are complementary to at least a 15 nucleobase portion of a target segment. Also contemplated are antisense compounds that are complementary to at least a 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleobase portion of a target segment, or a range defined by any two of these values.Identity
[0342] The antisense compounds provided herein may also have a defined percent identity to a particular nucleotide sequence, SEQ ID NO, or portion thereof. As used herein, an antisense compound is identical to the sequence disclosed herein if it has the same nucleobase pairing ability. For example, an RNA which contains uracil in place of thymidine in a disclosed DNA sequence would be considered identical to the DNA sequence since both uracil and thymidine pair with adenine. Shortened and lengthened versions of the antisense compounds described herein as well as compounds having non-identical bases relative to the antisense compounds provided herein also are contemplated. The non-identical bases may be adjacent to each other or dispersed throughout the antisense compound. Percent identity of an antisense compound is calculated according to the number of bases that have identical base pairing relative to the sequence to which it is being compared.
[0343] In some embodiments, the antisense compounds, or portions thereof, are at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to one or more of the antisense compounds or SEQ ID NOs, 8-1997 and 3978-5468 or a portion thereof, disclosed herein.
[0344] In some embodiments, a portion of the antisense compound is compared to an equal length portion of the target nucleic acid. In some embodiments, an 8, 9, 10, 11, 12, 13, 14, 15,WSGRRef. 71197-702.60116, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid.
[0345] In some embodiments, a portion of the antisense oligonucleotide is compared to an equal length portion of the target nucleic acid. In some embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20,21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid.
[0346] Thus, in some instances, the antisense compounds or antisense oligonucleotide as disclosed herein comprises at least 10, 11, 12, 13, 14, 15, 16 consecutive nucleobases selected from SEQ ID NOs: 8-1997 and 3978-5468 , with no more than 1, 2, 3 mismatches. In some instances, the antisense compounds or antisense oligonucleotide as disclosed herein comprises at least 10, 11, 12, 13, 14, 15, 16 consecutive nucleobases selected from SEQ ID NOs: 229, 231-232, 243, 254-255, 276-278, 306, 335, 387, 424-425, 427-428, 451, 454, 456-460, 462, 465, 471-474, 495-499, 501-504, 525, 533-534, 662-673, 4041-4042, 4411, and 4587, with no more than 1, 2, 3 mismatches. In some instances, the antisense compounds or antisense oligonucleotide as disclosed herein comprises at least 10, 11, 12, 13, 14, 15, 16 consecutive nucleobases selected from SEQ ID NOs: 232, 255, 335, 451, 454, 456-457, 459, 471-473, 495-497, 502-504, 534, and 662-673, with no more than 1, 2, 3 mismatches.
[0347] In some instances, the antisense compounds or antisense oligonucleotide as disclosed herein comprises at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 100% identical nucleobase sequence to one of SEQ ID NOs: 8-1997 and 3978-5468, with no more than 1, 2, 3 mismatches. In some instances, the antisense compounds or antisense oligonucleotide as disclosed herein comprises at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 100% identical nucleobase sequence SEQ ID NOs: 229, 231-232, 243, 254-255, 276-278, 306, 335, 387, 424-425, 427-428, 451, 454, 456-460, 462, 465, 471-474, 495-499, 501-504, 525, 533-534, 662-671, 673, 4041-4042, 4411, and 4587, with no more than 1, 2, 3 mismatches. In some instances, the antisense compounds or antisense oligonucleotide as disclosed herein at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 100% identical nucleobase sequence SEQ ID NOs: 232, 255, 335, 451, 454, 456-457, 459, 471-473, 495-497, 502-504, 534, and 662-673, with no more than 1, 2, 3 mismatches.Compositions and Methods for Formulating Pharmaceutical Compositions
[0348] Antisense compounds may be admixed with pharmaceutically acceptable active or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disorder, or dose to be administered.WSGRRef. 71197-702.601
[0349] An antisense compound targeted to a FDX2 nucleic acid can be utilized in pharmaceutical compositions by combining the antisense compound with a suitable pharmaceutically acceptable diluent or carrier (e.g., artificial cerebrospinal fluid). In some embodiments, a pharmaceutical composition comprises an antisense compound described herein and artificial cerebrospinal fluid (aCSF). In some embodiments, a pharmaceutically acceptable diluent includes phosphate-buffered saline (PBS). PBS is a diluent suitable for use in compositions to be delivered parenterally. In some embodiment, employed in the methods described herein is a pharmaceutical composition comprising an antisense compound targeted to a FDX2 nucleic acid and a pharmaceutically acceptable diluent. In some embodiments, the pharmaceutically acceptable diluent is PBS. In some embodiments, the antisense compound is an antisense oligonucleotide.
[0350] Pharmaceutical compositions comprising antisense compounds encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other oligonucleotide which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of antisense compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.
[0351] A prodrug can include the incorporation of additional nucleosides at one or both ends of an antisense compound which are cleaved by endogenous nucleases within the body, to form the active antisense compound.Conjugated Antisense Compounds
[0352] Antisense compounds may be covalently linked to one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the resulting antisense oligonucleotides. Typical conjugate groups include cholesterol moieties and lipid moieties. Additional conjugate groups include carbohydrates, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes. In some embodiments, an antisense compound may be covalently linked to one or more moieties thattarget the antisense compound to the central nervous system (CNS), e.g., via conjugation to 2’-O-hexadecyl (C16) (e.g., see Brown et al. 2002, Nature Biotechnol. 40:1500-1508).
[0353] Antisense compounds can also be modified to have one or more stabilizing groups that are generally attached to one or both termini of antisense compounds to enhance properties such as, for example, nuclease stability. Included in stabilizing groups are cap structures. These terminal modifications protect the antisense compound having terminal nucleic acid fromWSGRRef. 71197-702.601exonuclease degradation and can help in delivery and / or localization within a cell. The cap can be present at the 5 ’-terminus (5 ’-cap), or at the 3 ’-terminus (3 ’-cap) or can be present on both termini. Cap structures are well known in the art and include, for example, inverted deoxy abasic caps. Further 3 ’ and 5 ’-stabilizing groups that can be used to cap one or both ends of an antisense compound to impart nuclease stability include those disclosed in W003 / 004602.Cell culture and antisense compounds treatment
[0354] The effects of antisense compounds on the level, activity or expression of FDX2 nucleic acids can be tested in vitro in a variety of cell types. Cell types used for such analyses are available from commercial vendors (e.g., American Type Culture Collection, Manassas, VA; Zen-Bio, Research Triangle Park, NC; Clonetics, Walkersville, MD) and are cultured according to the vendor’s instructions using commercially available reagents (e.g., Invitrogen, Carlsbad, CA). Illustrative cell types include, but are not limited to, HepG2 cells, Hep3B cells, SW1783 cells, Panc-1 cells, and primary hepatocytes. In some embodiments, cells are patient cells, such as B-lymphoblast cells.In vitro testing of antisense oligonucleotides
[0355] Described herein are methods for treatment of cells with antisense oligonucleotides, which can be modified appropriately for treatment with other antisense compounds.
[0356] Cells may be treated with antisense oligonucleotides when the cells reach approximately 60-80% confluency in culture.
[0357] One reagent commonly used to introduce antisense oligonucleotides into cultured cells includes the cationic lipid transfection reagent LIPOFECTIN (Invitrogen, Carlsbad, CA). Antisense oligonucleotides may be mixed with LIPOFECTIN in OPTI-MEM 1 (Invitrogen, Carlsbad, CA) to achieve the desired final concentration of antisense oligonucleotide and a LIPOFECTIN concentration that may range from 2 to 12 ug / mL per 100 nM antisense oligonucleotide.
[0358] Another reagent used to introduce antisense oligonucleotides into cultured cells includes LIPOFECTAMINE (Invitrogen, Carlsbad, CA). Antisense oligonucleotide is mixed with LIPOFECTAMINE in OPTI-MEM 1 reduced serum medium (Invitrogen, Carlsbad, CA) to achieve the desired concentration of antisense oligonucleotide and a LIPOFECTAMINE concentration that may range from 2 to 12 ug / mL per 100 nM antisense oligonucleotide.
[0359] Another reagent used to introduce antisense oligonucleotides into cultured cells includes TURBOFECT (Thermo Scientific, Carlsbad, CA).WSGRRef. 71197-702.601
[0360] Another technique used to introduce antisense oligonucleotides into cultured cells includes electroporation.
[0361] Cells are treated with antisense oligonucleotides by routine methods. Cells may be harvested 16-24 hours after antisense oligonucleotide treatment, at which time RNA or protein levels of target nucleic acids are measured by methods known in the art and described herein. In general, when treatments are performed in multiple replicates, the data are presented as the average of the replicate treatments.
[0362] The concentration of antisense oligonucleotide used varies from cell line to cell line. Methods to determine the optimal antisense oligonucleotide concentration for a particular cell line are well known in the art. Antisense oligonucleotides are typically used at concentrations ranging from 1 nM to 300 nM when transfected with LIPOFECTAMINE. Antisense oligonucleotides are used at higher concentrations ranging from 625 to 20,000 nM when transfected using electroporation.RNA Isolation
[0363] RNA analysis can be performed on total cellular RNA or poly(A)+mRNA. Methods of RNA isolation are well known in the art. RNA is prepared using methodswell known in the art, for example, using the TRIZOL Reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s recommended protocols.Analysis of inhibition of target levels or expression
[0364] Inhibition of levels or expression of aFDX2nucleic acid can be assayed in a variety of ways known in the art. For example, target nucleic acid levels can be quantitated by, e.g., Northern blot analysis, competitive polymerase chain reaction (PCR), or quantitative real-time PCR. RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are well known in the art. Northern blot analysis is also routine in the art. Quantitative real-time PCR can be conveniently accomplished using the commercially available ABI PRISM 7600, 7700, or 7900 Sequence Detection System, available from Applied Biosystems, Foster City, CA and used according to manufacturer’s instructions.Quantitative Real-Time PCR Analysis of Target RNA Levels
[0365] Quantitation of target RNA levels may be accomplished by quantitative real-time PCR using the ABI PRISM 7600, 7700, or 7900 Sequence Detection System (Applied Biosystems, Foster City, CA) according to manufacturer’s instructions. Methods of quantitative real-time PCR are well known in the art.WSGRRef. 71197-702.601
[0366] Prior to real-time PCR, the isolated RNA is subjected to a reverse transcriptase (RT) reaction, which produces complementary DNA (cDNA) that is then used as the substrate for the real-time PCR amplification. The RT and real-time PCR reactions are performed sequentially in the same sample well. RT and real-time PCR reagents may be obtained from Invitrogen (Carlsbad, CA). RT real-time-PCR reactions are carried out by methods well known to those skilled in the art.
[0367] Gene (or RNA) target quantities obtained by real time PCR are normalized using either the expression level of a gene whose expression is constant, such as cyclophilin A, or by quantifying total RNA using RIBOGREEN (Invitrogen, Carlsbad, CA). Cyclophilin A expression is quantified by real time PCR, by being run simultaneously with the target, multiplexing, or separately. Total RNA is quantified using RIBOGREEN RNA quantification reagent (Invitrogen, Carlsbad, CA). Methods of RNA quantification by RIBOGREEN are taught in oneset al. 1998, Analytical Biochemistry 265:368-374. A CYTOFLUOR 4000 instrument (Applied Biosystems, Foster City, CA) is used to measure RIBOGREEN fluorescence.
[0368] Probes and primers are designed to hybridize to a FDX2nucleic acid. Methods for designing real-time PCR probes and primers are well known in the art and may include the use of software such as PRIMER EXPRESS Software (Applied Biosystems, Foster City, CA). Analysis of Protein Levels
[0369] Antisense inhibition of FDX2 nucleic acidscan be assessed by measuring FDX2 protein levels. Protein levels of FDX2can be evaluated or quantitated in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), enzyme-linked immunosorbent assay (ELISA), quantitative protein assays, protein activity assays (for example, caspase activity assays), immunohistochemistry, immunocytochemistry or fluorescence-activated cell sorting (FACS). Antibodies directed to a target can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Corporation, Birmingham, MI), or can be prepared via conventional monoclonal or polyclonal antibody generation methods well known in the art.In vivo testing of antisense compounds
[0370] Antisense compounds, for example, antisense oligonucleotides, are tested in animals to assess their ability to inhibit expression of FDX2 and produce phenotypic changes, such as, improved behavior, motor function, and cognition. In some embodiments, motor function is measured by walking initiation analysis, rotarod, grip strength, pole climb, open field performance, balance beam, hindpaw footprint testing in the animal. In some embodiments, behavior is measuredby elevated plus maze and three-chamber social interaction. Testing mayWSGRRef. 71197-702.601be performed in normal animals, or in experimental models. For administration to animals, antisense oligonucleotides are formulated in a pharmaceutically acceptable diluent, such as e.g., phosphate-buffered saline, e.g., artificial cerebrospinal fluid (aCSF). Administration includes parenteral routes of administration, such as intraperitoneal, intravenous, subcutaneous, and intrathecal. Calculation of antisense oligonucleotide dosage and dosing frequency is within the abilities of those skilled in the art and depends upon factors such as route of administration and animal body weight. Fallowing a period of treatment with antisense oligonucleotides, RNA is isolated from CNS tissue or CSF and changes in FDX2 nucleic acid expression are measured.Methods of Treatment
[0371] The methods described herein include methods for the treatment of disorders associated with mutations in the FXN gene. In some embodiments, the disorder is Friedreich ataxia (FRDA). Generally, the methods include administering a therapeutically effective amount of an agent that decreases levels of FDX2 protein as described herein, to a subject who is in need of, or who has been determined to be in need of, such treatment. Methods known in the art can be used to diagnose or identify a subject as having a disorder associated with a mutation in the FXN gene that reduces expression of the frataxin protein, e.g., sequencing or identification of the presence of trinucleotide repeat expansion, e.g., using a commercially available assay such as the Friedreich ataxia (FXN) Repeat Expansion Test (Athena Diagnostics); a quantitative immunoassay to measure frataxin levels, e.g., as described in Plasterer et al. 2013, PLoS One 8(5):e63958, or a lateral flow test as described in Willis et al. 2008, Mol. Genet. Metab.94(4):491-497 or commercially available kits such as the dipstick kit from Abeam (abl09881); MRI to detect atrophy of the cervical spinal cord with minimal evidence of cerebellar atrophy; transcranial sonography for assessment of both cerebellar andnoncerebellar abnormalities, e.g., dentate hyperechogenicity. Typically, subjects present with gait ataxia (e.g., tabetocerebellar gait), with ataxia progressing to the legs, trunk, and arms; development of tremors; titubation; and trembling. To determine severity, any of three scales can be used, e.g., The International Cooperative Ataxia Rating Scale (ICARS), the Friedreich Ataxia Rating Scale (FARS), and the Scale for the Assessment and Rating of Ataxia (SARA), see, e.g., Burk et al. 2013, J.Neurochem. 126 Suppl. 1:118-24.
[0372] As used in this context, to “treat” means to ameliorate at least one symptom of the disorder associated with mutations in the FXN gene that reduce expression. FRDA is an autosomal recessive neurodegenerative disorder that results in progressive gait and limb ataxia with associated limb muscle weakness, absent lower limb reflexes, extensor plantar responses, dysarthria, and decreased vibratory sense and proprioception, as well as cardiac manifestationsWSGRRef. 71197-702.601including cardiac dysfunction and heart failure; visual field defects; and diabetes. Thus, a treatment can result in a reduction in the severity of these deficits or a reduction in the rate of decline or degeneration. Administration of a therapeutically effective amount of an antisense compound described herein for the treatment of a condition associated with mutations in the FXN gene that reduce expression, e.g., FRDA, will result in improvement in one or more symptoms, e.g., reduction in the severity or rate of decline in gait and limb ataxia, limb muscle weakness, deficits in lower limb reflexes, extensor plantar responses, dysarthria, and vibratory sense and proprioception, and a return or approach to normal gait and limb movements, a return or approach to normal muscle strength and reflexes, a return or approach to normal (flexor) plantar responses, reduced dysarthria / improved speech, and a return or approach to normal vibratory sense and proprioception, as well as a reduction in the severity or risk of cardiac dysfunction and / or heart failure or diabetes. In some embodiments, the treatment results in decreased morbidity or mortality, e.g., a delayed loss of ambulation, an increased life span (average age of death is 37.7 ± 14.4 years, range 21-69, Harding et al. 1981, J. Med Genet.18(4):285-287) and / or an improved quality of life. In some embodiments, the treatment results in an improvement or long-term stabilization in the Friedreich Ataxia Rating Scale, see, e.g., Friedman et al. 2010, Mov. Disord. 25(4):426-432.
[0373] Thus, in some embodiments, provided herein is a method of preventing, treating, ameliorating, or slowing progression of a disorder associated with mutations in the FXN gene or reduced expression of frataxin protein. In some aspects, the method comprises administering to a subject a compound that is a modified single -stranded antisense oligonucleotide comprising about 12 to about 30 linked nucleosides and having a nucleobase sequence comprising about 8 to about 23 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 8-1997, 3978-4374, 4375-4718, 4719-5441, or 5442-5468, wherein each T may be independently and optionally replaced with U. In some aspects, the method comprises administering to the subject a pharmaceutical composition comprising a compound that is a modified single -stranded antisense oligonucleotide comprising about 12 to about 30 linked nucleosides and having a nucleobase sequence comprising about 8 to about 23 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 8-1997, 3978-4374, 4375-4718, 4719-5441, or 5442-5468, wherein eachT may be independently and optionally replaced with U, or a salt thereof, and at least one pharmaceutically acceptable carrier or diluent. In some aspects, administrating the compound or the pharmaceutical composition comprising the compound thereby prevents, treats, ameliorates, or slows progression of the disorder. In some aspects, the subject is a human. In some aspects, the disorder is Friedreich’s Ataxia. In some aspects, the compound or the pharmaceutical composition is administered intrathecally or intracerebroventricularly. In someWSGRRef. 71197-702.601aspects, the modified antisense oligonucleotide comprises about 15 to about 25 linked nucleosides. In some aspects, the modified antisense oligonucleotide comprises 16, 17, 18, 19, or 20 linked nucleosides. In some aspects, at least one internucleoside linkage of the modified antisense oligonucleotide is a modified internucleoside linkage. In some aspects, at least one modified intemucleoside linkage is a phosphorothioate internucleoside linkage. In some aspect, at least one nucleoside of the modified antisense oligonucleotide comprises a modified sugar moiety. In some aspects, the at least one nucleoside comprising a modified sugar moiety is selected from a group consisting of 2 ’-methoxy ethyl (2’-M0E) modified nucleoside, 2’-O-ethyl (cEt) modified nucleoside, and locked nucleic acid (LNA). In some aspects, the modified antisense oligonucleoside comprises a gapmer represented by formula X-Y-Z, wherein X represents a 5’ wing, Y represents a gap region, and Z represents a 3’ wing. In some aspects, the 5’ wing comprises or consists of three to five nucleosides, the gap region comprises or consists of ten 2’-deoxynucleosides, and the 3’ wing comprises or consists of three to five nucleosides. In some aspects, the 5’ wing or 3’ wing comprises one or more 2’-M0E modified nucleoside, cEt modified nucleoside, or LNA. In some aspects, the 5’ wing comprises five nucleosides, the gap region comprises ten 2’-deoxynucleosides, and the 3 ’ wing comprises five nucleosides. In some aspects, the 5’ MOE modified nucleoside and the 3’ wing comprise one or more 2’-M0E modified nucleosides. In some aspects, the 5’ wing comprises or consists of five 2’-M0E modified nucleosides, and the 3’ wing comprises or consists of five 2’-M0E modified nucleosides. In some aspects, the 5’ wing comprises or consists of three nucleosides, the gap region comprises or consists of ten 2’-deoxynucleosides, and the 3’ wing comprises or consists of three nucleosides. In some aspects, the 5’ wing comprises or consists of four nucleosides, the gap region comprises or consists of ten 2’-deoxynucleosides, and the 3’ wing comprises or consists of four nucleosides. In some aspects, the 5’ wing comprises or consists of four 2’ -MOE modified nucleosides, and the 3’ wing comprises or consists of four 2’ -MOE modified nucleosides. In some aspects, the 5’ wing comprises or consists of a cEt modified nucleoside or an LNA, the gap region comprises or consists of ten 2’-deoxynucleosides, and the 3’ wing comprises or consists of a cEt modified nucleoside or an LNA. In some aspects, the gap region comprises one or more 2’ -OMe modified nucleosides. In some aspects, the modified antisense oligonucleotide consists of 20 to 30 linked nucleosides and comprises 20 consecutive nucleobasesfrom any one of the nucleobase sequences of SEQ ID NOs: 8-1000, 3978-4374, 4375-4718, or 4719-5441, (wherein each T may be independently and optionally replaced with U). In some aspects, the 20 consecutive nucleobases form a 5-10-5 gapmer comprising a 5’ wing, 3’ wing, and a gap region, wherein the central gap region comprises ten 2’-deoxynucleosides and both of 5’ wing and 3’ wing comprise five 2’-M0E modified nucleosides.WSGRRef. 71197-702.601In some aspects, the 20 consecutive nucleobases comprises 5’-eeeeeddddddddddeeeee-3’, where each ‘d’ represents a 2’- deoxynucleoside and each ‘e’ represents a 2’ -MOE modified nucleoside. In some aspects, each internucleoside linkage connecting the 20 consecutive nucleobases is a phosphorothioate internucleoside linkage. In some aspects, each cytosine residue within the gap region is a 5 -methyl cytosine. In some aspects, the modified antisense oligonucleotide consists of 18 to 30 linked nucleosides and comprises 18 consecutive nucleobases from any one of the nucleobase sequences of SEQ ID NOs: 5442-5468 (wherein each T may be independently and optionally replaced with U). In some aspects, the 18 consecutive nucleobases fora 4-10-4 gapmer comprising a 5’ wing, 3’ wing, and a gap region, the gap region comprising ten 2 ’-deoxynucleosides and both the 5’ wing and 3’ wing comprising four cEt modified nucleosides or four LNAs. In some aspects, the 18 consecutive nucleobases comprises 5’-eeeeddddddddddeeee-3’, where each ‘d’ represents a 2’- deoxynucleoside and each ‘e’ represents a 2’-M0E modified nucleoside. In some aspects, the 18 consecutive nucleobases comprises 5’ - llllddddddddddllll -3’, where each ‘d’ represents a 2’- deoxynucleoside and each T represents a cEt modified nucleoside orLNA. In some aspects, each intemucleoside linkage connecting the 18 consecutive nucleobases is a phosphorothioate intemucleoside linkage. In some aspects, the modified antisense oligonucleotide consists of 16 to 30 linked nucleosides and comprises 16 consecutive nucleobases from any one of the nucleobase sequences of SEQ ID NOs: 1001-1997 (wherein each T may be independently and optionally replaced with U). In some aspects, the 16 consecutive nucleobases form a 3-10-3 gapmer comprising a 5’ wing, 3’ wing, and a gap region, the gap region comprises ten 2’-deoxynucleosides and both the 5’ wing and the 3 ’ wing comprise three cEt modified nucleosides or three LNAs. In some aspects, the 16 consecutive nucleobases comprises 5’ - lllddddddddddlll -3’, where each ‘d’ represents a 2’-deoxynucleoside and each T represents a cEt modified nucleoside orLNA. In some aspects, each intemucleoside linkage connecting the 16 consecutive nucleobases is a phosphorothioate intemucleoside linkage. In some aspects, each cytosine residue within the gap region is a 5-methyl cytosine. In some aspects, the antisense oligonucleotide comprises or consists of a nucleic acid sequence in Table A-l, Table A-2, Table C-l, Table C-2, or Table 3 (wherein each T may be independently and optionally replaced with U). In some aspects, the nucleobase sequence of the modified antisense oligonucleotide is at least 80%, at least 81 %, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary to SEQ ID NO: 1.WSGRRef. 71197-702.601Pharmaceutical Compositions
[0374] The methods described herein can include the administration of pharmaceutical compositions and formulations comprising inhibitory nucleic acids to target a FDX2 nucleic acid.
[0375] In some embodiments, the compositions are formulated with a pharmaceutically acceptable carrier. The pharmaceutical compositions and formulations can be administered parenterally (e.g., intrathecal), topically, orally or by local administration, such as by aerosol or transdermally. The pharmaceutical compositions can be formulated in any way and can be administered in a variety of unit dosage forms depending upon the condition or disease and the degree of illness, the general medical condition of each patient, the resulting preferred method of administration and the like. Details on techniques for formulation and administration of pharmaceuticals are well described in the scientific and patent literature, see, e.g., Remington: The and Practice of Pharmacy, 21st ed., 2005.
[0376] In some embodiments, a pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal, intracerebroventricular, etc.).
[0377] In some embodiments, a pharmaceutical composition comprises a composition described herein and artificial cerebrospinal fluid (aCSF).
[0378] The inhibitory nucleic acids can be administered alone or as a component of a pharmaceutical formulation (composition). The compounds may be formulated for administration, in any convenient way for use in human or veterinary medicine. Wetting agents, emulsifiers and lubricants, such as sodium lauryl sulfate and magnesium stearate, as well as coloring agents, release agents, coating agents, sweetening, flavoring and perfuming agents, preservatives and antioxidants can also be present in the compositions.
[0379] Formulations of the compositions can include those suitable for intradermal, inhalation, oral / nasal, topical, parenteral, rectal, and / or intravaginal administration. The formulations may conveniently be presented in unit dosage form and may be prepared by any methods well known in the art of pharmacy. The amount of active ingredient (e.g., nucleic acid sequences of this invention) which can be combined with a carrier material to produce a single dosage form will vary depending upon the host being treated, the particular mode of administration, e.g., intradermal or inhalation. The amount of active ingredient which can be combined with a carrier material to produce a single dosage form will generally be that amount of the compound that produces a therapeutic effect.WSGRRef. 71197-702.601
[0380] Pharmaceutical formulations can be prepared according to any method known to the art for the manufacture of pharmaceuticals. Such drugs can contain sweetening agents, flavoring agents, coloring agents and preserving agents. A formulation can be admixtured with nontoxic pharmaceutically acceptable excipients which are suitable for manufacture. Formulations may comprise one or more diluents, emulsifiers, preservatives, buffers, excipients, etc. and may be provided in such forms as liquids, powders, emulsions, lyophilized powders, sprays, creams, lotions, controlled release formulations, tablets, pills, gels, on patches, in implants, etc.
[0381] Pharmaceutical formulations for oral administration can be formulated using pharmaceutically acceptable carriers well known in the art in appropriate and suitable dosages. Such carriers enable the pharmaceuticals to be formulated in unit dosage forms as tablets, pills, powder, dragees, capsules, liquids, lozenges, gels, syrups, slurries, suspensions, etc., suitable for ingestion by the patient. Pharmaceutical preparations for oral use can be formulated as a solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable additional compounds, if desired, to obtain tablets or dragee cores. Suitable solid excipients are carbohydrate or protein fillers include, e.g., sugars, including lactose, sucrose, mannitol, or sorbitol; starch from corn, wheat, rice, potato, or other plants; cellulose such as methyl cellulose, hydroxypropylmethyl-cellulose, or sodium carboxy-methylcellulose; and gums including arabic and tragacanth; and proteins, e.g., gelatin and collagen. Disintegrating or solubilizing agents may be added, such as the cross-linked polyvinyl pyrrolidone, agar, alginic acid, or a salt thereof, such as sodium alginate. Push -fit capsules can contain active agents mixed with a filler or binders such as lactose or starches, lubricants such as talc or magnesium stearate, and, optionally, stabilizers. In soft capsules, the active agents can be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycol with or without stabilizers.
[0382] Aqueous suspensions can contain an active agent (e.g., nucleic acid sequences or RNPs as described herein) in admixture with excipients suitable for the manufacture of aqueous suspensions, e.g., for aqueous intradermal injections. Such excipients include a suspending agent, such as sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethylcellulose, sodium alginate, polyvinylpyrrolidone, gum tragacanth and gum acacia, and dispersing or wetting agents such as a naturally occurring phosphatide (e.g., lecithin), a condensation product of an alkylene oxide with a fatty acid (e.g., polyoxyethylene stearate), a condensation product of ethylene oxide with a long chain aliphatic alcohol (e.g., heptadecaethylene oxycetanol), a condensation product of ethylene oxide with a partial ester derived from a fatty acid and a hexitol (e.g., polyoxyethylene sorbitol mono-oleate), or a condensation product of ethyleneWSGRRef. 71197-702.601oxide with a partial ester derived from fatty acid and a hexitol anhydride (e.g., polyoxyethylene sorbitan mono-oleate). The aqueous suspension can also contain one or more preservatives such as ethyl or n-propyl p -hydroxy benzoate, one or more coloring agents, one or more flavoring agents and one or more sweetening agents, such as sucrose, aspartame or saccharin.Formulations can be adjusted for osmolarity.
[0383] In some embodiments, oil-based pharmaceuticals are used for administration of nucleic acid sequences orRNPs. Oil-based suspensions can be formulated by suspending an active agent in a vegetable oil, such as arachis oil, olive oil, sesame oil or coconut oil, or in a mineral oil such as liquid paraffin; or a mixture of these. See e.g., US5716928 describing using essential oils or essential oil components for increasing bioavailability and reducing inter- and intra-individual variability of orally administered hydrophobic pharmaceutical compounds (see also US5858401). The oil suspensions can contain athickening agent, such asbeeswax, hard paraffin or cetyl alcohol. Sweetening agents can be added to provide a palatable oral preparation, such as glycerol, sorbitol or sucrose. These formulations can be preserved by the addition of an antioxidant such as ascorbic acid. As an example of an injectable oil vehicle, see Minto 1997, J. Pharmacol. Exp. Ther. 281:93-102.
[0384] Pharmaceutical formulations can also be in the form of oil-in-water emulsions. The oily phase can be a vegetable oil or a mineral oil, described above, or a mixture of these. Suitable emulsifying ...
Claims
WSGRRef. 71197-702.601CLAIMS1. A compound that is a modified single-stranded antisense oligonucleotide comprising about 12 to about 30 linked nucleosides and having a nucleobase sequence comprising about 8 to about 23 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 8-1997, 3978-4374 or 4375-4718, wherein each T may be independently and optionally replaced with U.
2. The compound of claim 1, wherein the modified antisense oligonucleotide comprises about 15 to about 25 linked nucleosides.
3. The compound of claims 1 or 2, wherein the modified antisense oligonucleotide comprises 16, 17, 18, 19, or 20 linked nucleosides.
4. The compound of any one of claims 1 -3, wherein at least one intemucleoside linkage of the modified antisense oligonucleotide is a modified internucleoside linkage.
5. The compound of claim 4, wherein at least one modified intemucleoside linkage is a phosphorothioate intemucleoside linkage.
6. The compound of any one of claims 1 -5, wherein at least one nucleoside of the modified antisense oligonucleotide comprises a modified sugar moiety.
7. The compound of claim 6, wherein the at least one nucleoside comprising a modified sugar moiety is selected from a group consisting of 2 ’-meth oxy ethyl (2’-M0E) modified nucleoside, 2’-O-ethyl (cEt) modified nucleoside, and locked nucleic acid (LNA).
8. The compound of any one of claims 1 -3, wherein the modified antisense oligonucleoside comprises a gapmer represented by formula X-Y-Z, wherein X represents a 5’ wing, Y represents a gap region, and Z represents a 3 ’ wing.
9. The compound of claim 8, wherein the 5’ wing comprises or consists of 3 to 5 nucleosides, the gap region comprises or consists of ten 2’-deoxynucleosides, and the 3’ wing comprises or consists of 3 to 5 nucleosides.
10. The compound of claim 9, wherein the 5’ wing or 3’ wing comprises one or more 2’- MOE modified nucleoside, cEt modified nucleoside, or LNA.
11. The compound of any one of claims 8-10, wherein the 5’ wing comprises five nucleosides, the gap region comprises ten 2 ’-deoxynucleosides, and the 3’ wing comprises five nucleosides.WSGRRef. 71197-702.60112. The compound of claim 11, wherein the 5’ wing comprises one or more 2 ’-MOE modified nucleoside and the 3’ wing comprises one or more 2’-M0E modified nucleosides.
13. The compoundof claim 12, wherein the 5’ wing comprises or consists of five 2’-M0E modified nucleosides, and the 3’ wing comprises or consists of five 2 ’-MOE modified nucleosides.
14. The compoundof any one of claims 8-10, wherein the 5’ wing comprises or consists of 3 nucleosides, the gap region comprises or consists of ten 2’-deoxynucleosides, and the 3’ wing comprises or consists of 3 nucleosides.
15. The compound of claim 14, wherein the 5 ’ wing comprises or consists of a cEt modified nucleoside or an LNA, the gap region comprises or consists of ten 2’-deoxynucleosides, and the 3’ wing comprises or consists of a cEt modified nucleoside or an LNA.
16. The compound of claim 15, wherein the gap region comprises one or more 2’-OMe modified nucleosides.
17. The compound of any one of claims 1-13, wherein the modified antisense oligonucleotide consists of 20 to 30 linked nucleosides and comprises 20 consecutive nucleobases from any oneofthenucleobase sequences of SEQ ID NOs: 8-1000, 3978- 4374 or 4375-4718 (wherein eachT may be independently and optionally replaced with U).
18. The compound of claim 17, wherein the 20 consecutive nucleobases form a 5-10-5 gapmer comprising a 5’ wing, 3’ wing, and a gap region, wherein the central gap region comprises ten 2’ -deoxynucleosides and both of 5’ wing and 3’ wing comprise five 2’- MOE modified nucleosides.
19. The compound of claim 18, wherein the 20 consecutive nucleobases comprise 5’- eeeeeddddddddddeeeee-3’, where each ‘d’ represents a 2’- deoxynucleoside and each ‘e’ represents a 2’-M0E modified nucleoside.
20. The compoundof claim 18 or 19, wherein each internucleoside linkage connecting the 20 consecutive nucleobases is a phosphorothioate intemucleoside linkage.
21. The compound of any one of claims 17-20, wherein each cytosine residue within the gap region is a 5-methyl cytosine.
22. The compound of any one of claims 1-10 and 14-16, wherein the modified antisense oligonucleotide consists of 16 to 30 linked nucleosides and comprises 16 consecutiveWSGRRef. 71197-702.601nucleobases from any one of the nucleobase sequences of SEQ ID NOs: 1001-1997 (wherein each T may be independently and optionally replaced with U).
23. The compound of claim 22, wherein the 16 consecutive nucleobases form a 3-10-3 gapmer comprising a 5’ wing, 3’ wing, and a gap region,, wherein the gap region comprises ten 2’ -deoxynucleosides and both the 5’ wing and the 3’ wing comprise three cEt modified nucleosides or three LNAs.
24. The compound of claim 23, wherein the 16 consecutive nucleobases comprise 5’- lllddddddddddlll -3’, where each ‘d’ represents a 2’- deoxynucleoside and each T represents a cEt modified nucleoside or LNA.
25. The compound of claims 23 or 24, wherein each internucleoside linkage connecting the 16 consecutive nucleobases is a phosphorothioate intemucleoside linkage.
26. The compound of any one of claims 23-25, wherein each cytosine residue within the gap region is a 5-methyl cytosine.
27. The compound of any one of claims 1-26, wherein the antisense oligonucleotide comprises or consists of a nucleic acid sequence in Table A-l, Table A -2, Table C-l, Table C-2, or Table 3 (wherein each T may be independently and optionally replaced with U).
28. The compound of any one of claims 1-27, wherein the nucleobase sequence of the modified antisense oligonucleotide is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary to SEQ ID NO: 1.
29. The compound of any one of claims 1-28, wherein the modified antisense oligonucleotide targets a region between nucleotide positions 205-352, 375-404, 412- 551, or 650-690 of SEQ ID NO: 1 from its 5’ end.
30. The compound of any one of claims 1-29, wherein the modified antisense oligonucleotide targets a region between nucleotide positions 210-267, 269-290, 299- 318, 328-347, 380-399, 417-440, 444-486, 488-516, 518-546, or 655-685 of SEQ ID NO: 1 from its 5’ end.
31. The compound of any one of claims 1-30, wherein the modified antisense oligonucleotide comprises a nucleobase sequence at least 80%, 85%, 90%, or 95%WSGRRef. 71197-702.601identical to or at least 13, 14, 15, 16, 17, or 18 contiguous nucleobase sequence of a reverse complementary sequence of nucleobase positions 205-352, 375-404, 412-551, or 650-690 of SEQ ID NO: 1 from its 5’ end.
32. The compound of any one of claims 1-31, wherein the modified antisense oligonucleotide comprises a nucleobase sequence at least 80%, 85%, 90%, or 95% identical to or at least 13, 14, 15, 16, 17, or 18 contiguous nucleobase sequence of a reverse complementary sequence of nucleobase positions 210-267, 269-290, 299-318, 328-347, 380-399, 417-440, 444-486, 488-516, 518-546, or 655-685 of SEQ ID NO: 1 from its 5’ end.
33. The compound of any one of claims 1-32, wherein the modified antisense oligonucleotide comprises a nucleobase sequence at least 80%, 85%, 90%, or 95% identical to oratleast 13, 14, 15, 16, 17, or 18 contiguous nucleobase sequence from a sequence in Table 6.
34. A pharmaceutical composition comprising the compound of any one of claims 1-33, or a salt thereof, and at least one pharmaceutically acceptable carrier or diluent.
35. A method of preventing, treating, ameliorating, or slowing progression of a disorder associated with mutations in the FXN gene or reduced expression of frataxin protein, comprising administering to a subject the compound of any one of claims 1-33, or the pharmaceutical composition of claim 34, thereby preventing, treating, ameliorating, or slowing progression of the disorder.
36. The method of claim 35, wherein the subject is a human.
37. The method of claim 35 or 36, wherein the disorder is Friedreich’s Ataxia.
38. The method of any one of claims 35-37, wherein the compound or the pharmaceutical composition is administered intrathecally or intracerebroventricularly.