Methods to promote safety and efficacy of cell replacement therapy
A chemically defined differentiation framework for midbrain dopaminergic cells addresses standardization and variability issues in cell replacement therapies, achieving improved reproducibility and efficacy for Parkinson's disease treatment.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- THE MCLEAN HOSPITAL CORP
- Filing Date
- 2026-01-09
- Publication Date
- 2026-07-16
AI Technical Summary
Existing cell replacement therapies for Parkinson's disease face challenges in standardization, variability, and inefficiency due to reliance on recombinant morphogens and animal-derived supplements, which hinder good manufacturing practice compliance and predictability of clinical efficacy.
A chemically defined, xeno-free differentiation framework is developed using small-molecule modulators to generate midbrain dopaminergic cells from human pluripotent stem cells, optimizing conditions for reproducible yield and dopaminergic output, and incorporating a monolayer-based differentiation platform for enhanced homogeneity.
The method produces clinical-grade midbrain dopaminergic cells with improved reproducibility, reduced dependence on costly protein factors, and enhanced dopaminergic yield, providing a strong foundation for mechanistic studies and clinical translation of stem cell-based therapies.
Smart Images

Figure US2026010748_16072026_PF_FP_ABST
Abstract
Description
[0001] Attorney Docket No. 04843-0081W01
[0002] METHODS TO PROMOTE SAFETY AND EFFICACY OF CELL REPLACEMENT THERAPY
[0003] CLAIM OF PRIORITY
[0004] This application claims the benefit of U.S. Provisional Application Serial No. 63 / 743,284, filed on January 9, 2025. The entire contents of the foregoing are incorporated herein by reference.
[0005] SEQUENCE LISTING
[0006] This application contains a Sequence Listing that has been submitted electronically as an XML file named “04843-0081W01_SL_ST26.XML”. The XML file, created on January 9, 2026, is 73,528 bytes in size. The material in the XML file is hereby incorporated by reference in its entirety.
[0007] FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT
[0008] This invention was made with Government support under Grant Nos. NS127391 and NS 129188 awarded by the National Institutes of Health. The Government has certain rights in the invention.
[0009] TECHNICAL FIELD
[0010] The present disclosure relates to compositions and methods to enhance safety and efficacy of cell replacement therapy for Parkinson’s disease (PD).
[0011] BACKGROUND
[0012] Parkinson’s disease (PD) is the most prevalent neurodegenerative movement disorder, typically diagnosed later in life. As of 2016, it affected over 6.1 million people worldwide, with its incidence projected to rise alongside the aging population (Bloem et al., 2021; Kalia et al., 2015). Despite numerous treatment modalities aimed at alleviating its symptoms, existing interventions do not arrest or reverse disease progression (Stoker & Barker, 2020). Hence, there exists a substantial need for novel therapeutic approaches.Attorney Docket No. 04843-0081W01
[0013] A hallmark of Parkinson’s disease (PD) is the progressive degeneration of midbrain dopaminergic neurons (mDANs) within the substantia nigra, resulting in impaired dopamine neurotransmission and directly correlating with PD’s characteristic motor deficits (Meissner et al., 2011; Obeso et al., 2010; Poewe et al., 2017). This observation spurred the concept of cell replacement therapy (CRT) for PD, with investigations into dopamine- producing cell transplantation methods since the 1980s. Among these, human fetal brain tissue transplantation has shown promise in alleviating motor symptoms for extended periods, serving as a proof-of-concept for CRT (Lindvall & Bjorklund, 2011; Parmar et al., 2020; Sonntag et al., 2018; Barker et al., 2015; Park et al., 2024; Cha et al., 2023; Kim et al., 2020; Osborn et al., 2020). However, two doubleblind, sham controlled studies revealed variable and insignificant clinical benefits, alongside occasional graft-induced dyskinesia (Freed et al., 2001; Olanow et al., 2003). These earlier studies underscored the potential advantages of CRT using more defined and controlled cell products, which may offer superior benefits for PD. Consequently, researchers are investigating more practical cell sources, including human embryonic stem cells (hESCs) and human induced pluripotent stem cells (hiPSCs), as potential alternatives.
[0014] SUMMARY
[0015] Human induced pluripotent stem cell (hiPSC)-derived midbrain dopaminergic cells (mDACs) represent a promising source for autologous cell therapy in Parkinson’s disease (PD), but standardized regulatory criteria are essential for clinical translation. In the study described herein, multiple clinical-grade hiPSC lines were generated from freshly biopsied fibroblasts of four sporadic PD patients using episomal reprogramming and differentiated into mDACs using a refined 21 -day protocol. Rigorous evaluations included whole-genome / exome sequencing, RNA-seq, and in vivo studies, including a 39- week GLP-compliant mouse safety study. While mDACs from all lines met safety criteria, mDACs from one patient failed to improve rodent behavioral outcomes, underscoring inter-individual variability. Importantly, in vitro assessments did not reliably predict in vivo efficacy, identifying dopaminergic fiber density as a key efficacy criterion. These findings support comprehensive quality control guidelines forAttorney Docket No. 04843-0081W01
[0016] autologous cell therapy and pave the way for a clinical trial with eight sporadic PD patients.
[0017] Also described herein is a fully chemically defined, xeno-free differentiation framework for generating mDACs that organizes the process into early specification and late maturation phases and replaces protein factors with small-molecule modulators of key developmental pathways. The generation of mDACs from human pluripotent stem cells (hPSCs) offers a transformative strategy for cell replacement therapy in PD.
[0018] Existing differentiation methods, however, rely heavily on recombinant morphogens, neurotrophic factors, and animal-derived supplements, which introduce variability, complicate standardization, and hinder good manufacturing practice (GMP) compliance. In the early phase, systematic testing of basal media and supplements identified DMEM / F12+N2+B27 as a robust condition, supporting reproducible yields and generating mDACs with >95% FOXA2 / LMX1 A+identity and -10% TH+neurons across multiple hPSC lines. In the late phase, we demonstrated that 7,8-dihydroxyflavone (DHF) and BT13 could effectively substitute for BDNF and GDNF, respectively, with DHF promoting neuronal maturation and BT13 enhancing dopaminergic specification (up to -33% TH+cells). In contrast, the TGF0 pathway agonist SRI-011381 and prostaglandin E2 (PGE2) alone or in combination only partially supported dopaminergic differentiation, underscoring the unique role of TGF03. Finally, we established a monolayer-based differentiation platform incorporating the optimized early-phase protocol. By refining replating timing and density, we achieved homogeneous neuronal cultures with significantly enhanced dopaminergic yield (>30% TH+cells), representing a threefold increase relative to our validated spotting-based 1stgeneration protocol.
[0019] Together, these findings establish a chemically defined, scalable, and automationcompatible differentiation system that generates clinical-grade mDAPs with improved reproducibility, reduced dependence on costly protein factors, and enhanced dopaminergic output. This platform provides a strong foundation for mechanistic studies, cost-effective cell production, and the clinical translation of stem cell-based therapies for PD.
[0020] In one aspect, provided herein are methods of generating a population of midbrain dopaminergic cells (mDACs), the methods comprising: providing a population ofAttorney Docket No. 04843-0081W01
[0021] induced pluripotent stem cells (iPSCs); and maintaining the cells for 21 days under conditions sufficient for the iPSCs to differentiate into mDACs, wherein the maintaining comprises: (i) maintaining the cells in a basal medium supplemented with N2 and B27 for days 1-11 for floor plate induction and neural precursor induction, wherein the medium is further supplemented with one or more of non-essential amino acid (NEAA), 4- {6- [4-(Piperazin- 1 -yl)phenyl]pyrazolo[l ,5-a]pyrimidin-3-yl} quinoline (LDN 193189), 4- [4-(2H-l,3-Benzodioxol-5-yl)-5-(pyridin-2-yl)-lH-imidazol-2-yl]benzamide (SB431542), purmorphamine (PMN), 6-((2-((4-(2,4-Dichlorophenyl)-5-(4-methyl-lH-imidazol-2-yl)pyrimidin-2-yl)amino)ethyl)amino)nicotinonitrile (CHIR99021), and quercetin (QC); and (ii) maintaining the cells in a basal medium supplemented with N2 for days 12-21 for induction and maturation of mDACs, wherein the medium is further supplemented with one or more of 7,8-dihydroxyflavone (DHF), N,N-diethyl-3-(4-(4-fluoro-2-(trifluoromethyl)benzoyl)piperazin-l-yl)-4-methoxybenzenesulfonamide (BT13), N’-cyclohexyl-N-(phenylmethyl)-N-(4-piperidinylmethyl)-urea (SRI-011381), prostaglandin E2 (PGE2), dibutyryl cyclic AMP (dbcAMP), ascorbic acid (AA), and phenylglycine t-butyl ester (DAPT).
[0022] In some embodiments, step (i) comprises maintaining the cells in: the basal medium supplemented with 0.5-2X N2, 0.5-2X B27, 0.5-2X NEAA, 50-500 nM LDN193189, and 1-50 pM SB431542 on day 1; the basal medium supplemented with 0.5-2XN2, 0.5-2XB27, 0.5-2XNEAA, 50-500 nMLDNl 93189, 1-50 pM SB431542, and 0.1-5 pM PMN on day 2; the basal medium supplemented with 0.5-2X N2, 0.5-2X B27, 0.5-2XNEAA, 50-500 nMLDNl 93189, 1-50 pM SB431542, 0.1-5 pMPMN, and 0.1-5 pM CHIR99021 on days 4-6; the basal medium supplemented with 0.5-2X N2, 0.5-2XB27, 0.5-2XNEAA, 50-500 nM LDN193189, 0.1-5 pMPMN, and 0.1-5 pM CHIR99021 on day 8; the basal medium supplemented with 0.5-2X N2, 0.5-2X B27, 0.5-2XNEAA, 50-500 nMLDNl 93189, 0.1-5 pMPMN, 0.1-5 pM CHIR99021, and 1-100 pM QC on day 9; and the basal medium supplemented with 0.5-2X N2, 0.5-2X B27, 0.5-2XNEAA, 50-500 nMLDNl 93189, and 0.1-5 pMCHIR99021 on day 10.
[0023] In some embodiments, step (ii) comprises maintaining the cells in: the basal medium supplemented with 0.5-2X N2, 0.1-5 pMDHF, 1-50 pMBT13, 0.1-5 pM SRI-011381, 10-60 nMPGE2, 100-1000 pM dbcAMP, 50-500 pM AA, and 1-50 pMDAPT.Attorney Docket No. 04843-0081W01
[0024] In some embodiments, the methods comprise dissociation of the cells on day 15. In some embodiments, the methods comprise transplantation and / or freezing of the cells on day 21.
[0025] In some embodiments, the methods comprise, before step (i), plating the cells in discrete, individual areas with sufficient distance between the areas to maintain isolation between the areas, in a biomatrix hydrogel support, with a density of about 5,000-20,000 cells per area, preferably about 10,000 cells per area. In some embodiments, the biomatrix hydrogel support is a basement membrane extract or synthetic matrix. In some embodiments, the cells are suspended in the hydrogel before plating. In some embodiments, the areas are about 2-10 mm in diameter. In some embodiments, the distance between the areas is 1 -3 cm.
[0026] Also provided herein are methods of generating a population of midbrain dopaminergic cells (mDACs), the methods comprising: providing a population of induced pluripotent stem cells (iPSCs); seeding 100 x 103- 500 x 103cells from the population of cells at day 0; and maintaining the cells in a monolayer for 21 days under conditions sufficient for the iPSCs to differentiate into mDACs, wherein the maintaining comprises: (i) maintaining the cells in a basal medium supplemented with N2 and B27 for days 1-11 for floor plate induction and neural precursor induction, wherein the medium is further supplemented with one or more of non-essential amino acid (NEAA), 4-{6-[4-(Piperazin- 1 -yl)phenyl]pyrazolo[l ,5-a]pyrimidin-3-yl} quinoline (LDN 193189), 4- [4-(2H-l,3-Benzodioxol-5-yl)-5-(pyridin-2-yl)-lH-imidazol-2-yl]benzamide (SB431542), purmorphamine (PMN), 6-((2-((4-(2,4-Dichlorophenyl)-5-(4-methyl-lH-imidazol-2-yl)pyrimidin-2-yl)amino)ethyl)amino)nicotinonitrile (CHIR99021), and quercetin (QC); and (ii) maintaining the cells in a basal medium supplemented with N2 for days 12-21 for induction and maturation of mDACs, wherein the medium is further supplemented with one or more of brain-derived neurotrophic factor (BDNF), glial cell line-derived neurotrophic factor (GDNF), transforming growth factor beta 3 (TGF03), dibutyryl cyclic AMP (dbcAMP), ascorbic acid (AA), and N-[N-(3,5-difluorophenacetyl)-l-alanyl]-S-phenylglycine t-butyl ester (DAPT).
[0027] In some embodiments, step (i) comprises replating 1 x 106- 5 x 106cells on day 6.Attorney Docket No. 04843-0081W01
[0028] In some embodiments, step (i) comprises maintaining the cells in: the basal medium supplemented with 0.5-2X N2, 0.5-2X B27, 0.5-2X NEAA, 50-500 nM LDN193189, and 1-50 pM SB431542 on day 1; the basal medium supplemented with 0.5-2XN2, 0.5-2XB27, 0.5-2XNEAA, 50-500 nMLDNl 93189, 1-50 pM SB431542, and 0.1-5 pM PMN on day 2; the basal medium supplemented with 0.5-2X N2, 0.5-2X B27, 0.5-2XNEAA, 50-500 nMLDNl 93189, 1-50 pM SB431542, 0.1-5 pMPMN, and 0.1-5 pM CHIR99021 on days 4-6; the basal medium supplemented with 0.5-2X N2, 0.5-2XB27, 0.5-2XNEAA, 50-500 nM LDN193189, 0.1-5 pMPMN, and 0.1-5 pM CHIR99021 on day 8; the basal medium supplemented with 0.5-2X N2, 0.5-2X B27, 0.5-2XNEAA, 50-500 nMLDN193189, 0.1-5 pMPMN, 0.1-5 pM CHIR99021, and 1-100 pM QC on day 9; and the basal medium supplemented with 0.5-2X N2, 0.5-2X B27, 0.5-2XNEAA, 50-500 nMLDNl 93189, and 0.1-5 pMCHIR99021 on day 10.
[0029] In some embodiments, step (ii) comprises maintaining the cells in the basal medium supplemented with 0.5-2X N2, 5-50 ng / mL BDNF, 5-50 ng / mL GDNF, 0.1-5 ng / mL TGF03, 100-1000 pM dbcAMP, 50-500 pM AA, and 1-50 pMDAPT.
[0030] In some embodiments, the basal medium is further supplemented with 0.1-5 pM CHIR99021 on days 12-14.
[0031] In some embodiments, the population of iPSCs is a population of human iPSCs (hiPSCs).
[0032] In some embodiments, the population of iPSCs is generated by methods comprising: obtaining a population of primary somatic cells from a subject;
[0033] inducing expression of OCT4, KLF4, SOX2, and L-MYC in the cells; and maintaining the cells under conditions sufficient for the primary somatic cells to become iPSCs.
[0034] In some embodiments, inducing expression of OCT4, KLF4, SOX2, and L-MYC comprises transfecting the primary somatic cells with polycistronic episomal vector that comprises human Oct4 linked with 2A sequence of foot-and-mouth disease virus (OCT4-F2A), KLF4, SOX2 linked with 2A sequence of porcine teschovirus (SOX2-P2A), and L-MYC coding sequences.
[0035] In some embodiments, the population of iPSCs is generated by methods comprising expressing in the primary somatic cells one or more exogenous microRNAs (miRNAs) selected from the group consisting of miR-106a, -106b, -136s, -200c, -302s, -Attorney Docket No. 04843-0081W01
[0036] 369s, and -371 / 373. In some embodiments, the miRNAs comprise one or both of miR-302s and miR-200c. In some embodiments, the methods comprise introducing into the cells an episomal vector that comprises sequences coding for miR-302s and miR-200c.
[0037] In some embodiments, the population of iPSCs is generated by methods comprising expressing in the primary somatic cells all of OCT4, KLF4, SOX2, miR-302s and miR-200c. In some embodiments, the methods comprise introducing into the primary somatic cells (i) a vector, preferably a viral vector or polycistronic episomal vector, that comprises human Oct4 linked with 2A sequence of foot-and-mouth disease virus (OCT4-F2A), KLF4, SOX2 linked with 2A sequence of porcine teschovirus (SOX2-P2A), and L-MYC coding sequences, or mature RNAs of Oct4, KLF4, SOX2, and L-MYC, or corresponding proteins, and (ii) a vector, preferably a viral vector or episomal vector, that comprises sequences coding for miR-302s and miR-200c, or mature miR-302s and miR-200c.
[0038] In some embodiments, the primary somatic cells are fibroblasts, hair keratinocytes, blood cells, or bone marrow mesenchymal stem cells (MSCs).
[0039] Also provided herein are populations of cells comprising mDACs generated by the methods described hereinabove.
[0040] In some embodiments, the mDACs express FOXA2, LMX1 A, and TH at mRNA and / or protein level. In some embodiments, the mDACs do not express or have non-detectable expression of OCT4, NANOG, and SSEA-4. In some embodiments, the mDACs do not express or have non-detectable expression of PAX6, SOX1, FOXG1, H0XA2, and NKX6.1. In some embodiments, the mDACs do not express or have non-detectable expression of tryptophan hydroxylase (TPH) and dopamine b-hydroxylase (DBH). In some embodiments, the mDACs do not harbor Tier 1 cancer genes. In some embodiments, at least 70% of mDACs in the population are viable. In some embodiments, following implantation of the mDACs to a host brain, TH+ fiber density in grafted side of the brain is 20% or more than that in intact side of the brain.
[0041] Also provided herein are compositions comprising the populations of cells described hereinabove.Attorney Docket No. 04843-0081W01
[0042] Also provided herein are methods of treating a subject who has or is at risk of developing Parkinson’s Disease (PD), the methods comprising administering to the subject the populations of cells described hereinabove.
[0043] In some embodiments, the populations of cells are generated from primary somatic cells that are obtained from the same subject who is to be treated. In some embodiments, the populations of cells are generated from primary somatic cells that are obtained from a different subject who is of the same species as the subject who is to be treated. In some embodiments, the subject is human.
[0044] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials are described herein for use in the present invention; other, suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control.
[0045] Other features and advantages of the invention will be apparent from the following detailed description and figures, and from the claims.
[0046] DESCRIPTION OF DRAWINGS FIGs. 1A-1O. Improved in vitro differentiation procedure for pre-clinical studies.
[0047] (1A) Overview of manufacturing process and safety / efficacy assessment. (IB) Representative images of hNuc-stained grafted tissues derived from Short- and Long-DAPTD21 PD01-04-mDACs. Scale bars, 500 pm. (1C) Graft volume quantification. (ID) Ki67+cell quantification. (IE) TH-stained grafts from Short- and Long-DAPT D21 PD01-04-mDACs. Scale bars, 500 pm. (IF) Quantification of TH+cells per graft volume (mm3). (1G) Quantification of striatal TH+fiber density. (1H) Drug-induced rotation test for behavioral assessment. (II) Schematic overview of modified differentiation of hiPSCs to mDACs. Control, n = 4; Short-DAPT D21, n = 4; Long-DAPT D21, n = 8. Data: mean ± SEM (1C, ID, IF, 1G) or as a box-and-whisker plot (1H). * / ?<0.05, *** / ?<0.005; n.s.,Attorney Docket No. 04843-0081W01
[0048] not significant. G, graft; ST, striatum; CC, corpus callosum. (1J) Representative graph of cell viability for all three conditions, both cell lines. (IK) Representative graph of cell yield / dish for all three conditions, both cell lines. (IL) Representative graph of pH for all three conditions, both cell lines. (IM) Representative graph of cells positive for FOXA2 and LMX1 A for all three conditions, both cell lines. (IM) Representative graph of percentage of cells positive for FOXA2 and LMX1 A for all three conditions, both cell lines. (IN) Representative graph of percentage of cells positive for tyrosine hydroxylase (TH) for all three conditions, both cell lines. (IO) Representative graph of percentage of cells positive for Ki67 for all three conditions, both cell lines.
[0049] FIGs. 2A-2P. Generation and characterization of clinical-grade hiPSC lines from three additional PD patients. (2A-2C) mRNA levels of hPSC markers (OCT4, NANOG) in PD02 (2A)-, PD03 (2B)-, PD04 (2C)-hiPSCs relative to parental fibroblasts. (2D-2F) Immunocytochemical analysis of hPSC markers (OCT4, SSEA4) in PD02 (2D)-, PD03 (2E)-, PD04 (2F)-hiPSCs. (2G-2I) Quantification of OCT4- and SSEA4-positive populations inPD02 (2G)-, PD03 (2H)-, PD04 (2I)-hiPSCs. (2J-2L) mRNA levels of early differentiation markers of ectoderm (Pax6, Aadc), mesoderm (Brachyury-T (2B-2T), Msxl), and endoderm (Afp, Ckl8) in embryoid bodies derived from PD02 (2 J)-, PD03 (2K)-, PD04 (2L)-hiPSCs. (2M-2O) H&E-stained teratoma tissues images derived from PD02 (2M)-, PD03 (2N)-, PD04 (2O)-hiPSCs. (2P) Karyotype analysis PD02-PD04 hiPSC clones; the arrow indicates an anomaly. Scale bars, 100 pm. Data are shown as mean ± SEM (2A-2C, 2G-2L).
[0050] FIGs. 3A-3Z. Characterization of in vitro differentiated mDACs from PD02-PD04 hiPSCs. (3A-3F) Delta Cq values of mDAP markers (FOXA2, LMX1A, TH; 3A-3C), and undifferentiated hPSC markers (OCT4, NANOG; 3D-3F) in PD02 (3A, 3D)-, PD03 (3B, 3E)-, PD04 (3C, 3F)-D21 -mDACs. (3G-3I) Immunocytochemical analysis for mDAP markers (FOXA2, LMX1 A, TH) in D21-mDACs derived from PD02 (3G)-, PD03 (3H)-, PD04 (3I)-hiPSCs. (3J-3R) Quantification of FOXA2-, LMX1A-, and TH-positive cells in PD02 (3 J, 3M, 3P)-, PD03 (3K, 3N, 3Q)-, PD04 (3L, 30, 3R)-D21-mDACs. (3S) Summary of hPSC markers (OCT4, SSEA4), serotonergic (TPH), and noradrenergic (DBH) populations in PD02-PD04-D21 mDACs. (N.D., not detected). (3T-3Y) Cell viability pre-freezing (3T-3V) and post-thaw (3W-3Y) in PD02 (3T, 3W)-,Attorney Docket No. 04843-0081W01
[0051] PD03 (3U, 3X)-, PD04 (3V, 3Y)-D21 mDACs. (3Z) Karyotype analyses of PD02-25-, PD03-44-, and PD04-25-mDACs. Scale bars, 100 pm. Data are presented as mean ± SEM (3A-3F, 3T-3Y) or as floating bars plots (3J-3R).
[0052] FIGs. 4A-4L GLP safety study of D21 mDACs derived from PD01-04. (4A-4E) H&E- and hNuc-stained images of grafted tissues from (4A) Control, (4B) PD01-04-mDACs, (4C) Spiking 1% (mixed with 1% PD01-04-hiPSCs), (4D) Spiking 10% (mixed with 10% PD01-04-hiPSCs) and (4E) Positive (100% PD01-04-hiPSCs) on days 29, 85, and 274 post-grafting (T; Teratoma). (4F) Survival curves of grafted mice across groups: control, PD01-04-mDACs, spiking, and positive control (100% PD01-04-hiPSC). (4G-41) Human genome copy numbers in the brain and other organs measured by DNA qPCR on (4G) days 29, (4H) 85 and (41) 274 post-grafting in the biodistribution study. Scale bars, 1,000 pm (left panels) and 100 pm (right panels). Data shown as box-and- whisker plots (4G-4I).
[0053] FIGs. 5A-5M. Non-GLP safety studies of D21 mDACs derived from PD02-25, PD03-44 and PD04-25. (5A) H&E-stained grafted tissues from PD02-25-, PD03-44- and PD04-25-mDACs at day 274 post-grafting in NSG mice. (5B) hNuc+graft overview in the host brain from PD02-25-, PD03-44- and PD04-25-mDACs at days 274 post-grafting.
[0054] (5C) Stereological graft volume estimation for PD02-25-, PD03-44- and PD04-25-mDACs. (5D) Graft cell density for PD02-25-, PD03-44- and PD04-25-mDACs. (5E) TH+-staining in grafted tissues from PD02-25-, PD03-44- and PD04-25-mDACs. (5F) Stereological count of TH+dopamine neurons in PD02-25-, PD03-44- and PD04-25-mDACs grafts. (5G) TH+fiber density in PD02-25-, PD03-44- and PD04-25-mDACs graft. (5H) OCT4+-staining in grafted tissues from PD02-25-, PD03-44- and PD04-25-mDACs. (51) Percentage of OCT4+cells in grafts from PD02-25-, PD03-44- and PD04-25-mDACs. (5J) Ki67+-staining in grafted tissues from PD02-25-, PD03-44- and PD04-25-mDACs. (5K) Percentage of Ki67+cells in PD02-25-, PD03-44- and PD04-25-mDAC grafts. (5L) PAX6+ / SOXl+ / Ki67+-staining in grafted tissues from PD02-25-, PD03-44-and PD04-25-mDACs. (5M) Percentage of PAX6+ / SOXl+ / Ki67+triple-positive cells in PD02-25-, PD03-44- and PD04-25-mDACs grafts. Scale bars, 1,000 pm (5 A, 5B), 500 pm (5E) and 100 pm (5H, 5 J, 5L). PD02-25-mDAC: n = 5; PD03-44-mDAC: n = 6;Attorney Docket No. 04843-0081W01
[0055] PD04-25-mDAC: n = 6. Data are box-and-whisker plots (5C, 5D, 5F, 5G, 51, 5K, 5M). N.D., not detected.
[0056] FIGs. 6A-6N. Non-GLP in vivo studies of D21 mDACs derived from PD02-25, PD03-44 and PD04-25. (6A) Drug-induced rotation test results in 6-OHDA-lesioned athymic rats grafted with PD02-25-, PD03-44 and PD04-25-mDACs over 32 weeks. (6B) hNuc+ graft formation in the host brain at 32 weeks post-graft. (6C) Graft volume estimation for PD02-25, PD03-44 and PD04-25. (6D) Cell density in PD02-25, PD03-44 and PD04-25 grafts. (6E) TH+-staining in grafted tissues from PD02-25-, PD03-44- and PD04-25-mDACs. (6F) TH+ dopamine neuron counts in PD02-25, PD03-44 and PD04-25 grafts. (6G) TH+ fiber density in the host striatum. (6H) ALDH1 Al + / TH+- staining in grafted tissues from PD02-25-, PD03-44- and PD04-25-mDACs. (61) ALDH1A1+ cell percentage among TH+ cells. (6J) OCT4+-staining in grafted tissues from PD02-25-, PD03-44- and PD04-25-mDACs. (6K) Percentage of OCT4+ cells in PD02-25, PD03-44 and PD04-25 grafts. (6L) Ki67+-staining in grafted tissues from PD02-25-, PD03-44-and PD04-25-mDACs. (6M) Percentage of Ki67+ cells in PD02-25, PD03-44 and PD04-25 grafts. (6N) Percentage of PAX6+ / SOXl+ / Ki67+ triple-positive cells in PD02-25, PD03-44 and PD04-25 grafts. Scale bars: 1,000 pm (6B), 500 pm (6E) and 100 pm (6H, 6J, 6L). PD02-25, n = 7; PD03-44, n = 7; PD04-25, n = 6; Control, n = 7 Data shown as box-and-whisker plots (6A, 6C, 6D, 6F, 6G, 61, 6K, 6M, 6N).
[0057] FIGs. 7A-7O. Representative images and graphs showing characterization of PD02-PD04 hiPSC clones. (7A-7C) Mycoplasma test results of hiPSCs and mDACs derived from PD02 (7 A), PD03 (7B), PD04 (7C) patients. (7D-7F) DNA fingerprinting analyses of hiPSCs and mDACs derived from PD02 (7D), PD03 (7E), PD04 (7F) patients. (7G-7I) Determination of integrated plasmid DNAs in the host genome of PD02 (7G), PD03 (7H), PD04 (7I)-hiPSCs. (7J-7L) Delta Cq values of mDAP markers (FOXA2, LMX1A, TH) in PD02 (7J)-, PD03 (7K)-, PD04 (7L)-day 21 -mDACs. (7M-70) Comparison of relative mRNA levels of non-VM markers (PAX6, SOX1, FOXG1, H0XA2, NKX6.1) in PD02 (7M)-, PD03 (7N)-, PD04 (7O)-day 21-mDACs. Data are represented as mean ± SEM.Attorney Docket No. 04843-0081W01
[0058] FIGs. 8A-8J. Representative images and graphs of cell fate analyses conducted in animals receiving PD01-04-mDACs at 29- and 274 days post-transplantation in both brain hemispheres.
[0059] FIGs. 9A-9L. Representative images and graphs of in vivo studies of D21 mDACs derived from PD02-25, PD03-44, and PD04-25 at 28 days post-transplantation.
[0060] FIGs. 10A-10M. Representative images and graphs of in vivo studies of D21 mDACs derived from PD02-25, PD03-44, and PD04-25 at 56 days post-transplantation.
[0061] FIGs. 11A-11D. Representative images of immunostaining to detect cells positive for Collagen Type I Alpha 1 Chain (COL1 Al) and Transthyretin (TTR) in grafts from PD01-04, PD03-44, and PD04-25 at day 28, day 56, day 274, and 7-8 months.
[0062] FIGs. 12A-12M. Characterization of CF-hiPSCs and mDACs generated from CF-hiPSCs. (12A) Immunocytochemical analysis of pluripotency markers (OCT4, SSEA4) from CF-hiPSCs. (12B) Immunocytochemical analysis of specific markers for mDAP (FOXA2, LMX1A), serotonergic neurons (TPH), noradrenergic neurons (DBH), undifferentiated hPSCs (OCT4, SSEA4) in CF-mDACs. (12C-12E) Quantification of cell populations expressing (12C) mDAPs (FOXA2, LMX1A), (12D) serotonergic neurons (TPH) and noradrenergic neurons (DBH), and (12E) undifferentiated hPSCs (OCT4, SSEA4) markers in CF-mDACs. (12F and 12G) Karyotype analyses of CF-hiPSCs (12F) and -mDACs (12G). (12H) DNA fingerprinting analysis of CF-hiPSCs. (121) Determination of integrated plasmid DNAs in the host genome of CF-hiPSCs. (12J) DNA fingerprinting analysis of CF-mDACs. (12K) Mycoplasma test results of CF-mDACs. (12L) Whole genome sequencing analyses of PD01-04- and CF-hiPSCs. (12M) Representative images of H&E- and hNuc-stained grafted tissues derived from CF-mDACs on days 29, 85, and 180 post-grafting (T; Teratoma). Data are represented as mean ± SEM. N.D. not detected. Scale bars, 500 pm.
[0063] FIGs. 13A-13J. Representative images and graphs showing comparison of basal media on mDAP differentiation of hPSCs.
[0064] FIGs. 14A-14F. Representative images and graphs showing comparison of supplements on mDAP differentiation of hPSCs.
[0065] FIGs. 15A-15G. Representative images and graphs showing comparison of culture conditions on mDAP differentiation of hPSCs.Attorney Docket No. 04843-0081W01
[0066] FIGs. 16A-16H. (FIG. 16A) Schematic overview of the second-generation protocol. (FIGs. 16B-16H) Representative images and graphs showing effect of DHF as replacement for BDNF in late-stage mDAP differentiation.
[0067] FIGs. 17A-17I. Representative images and graphs showing effect of BT13 as a replacement of GDNF.
[0068] FIGs. 18A-18H. Representative images and graphs showing effect of SRI as a replacement of TGF03 on mDAP differentiation of C4 hiPSCs.
[0069] FIGs. 19A-19H. Representative images and graphs showing effect of PGE2 as a replacement of TGF03 on mDAP differentiation of C4 hiPSCs.
[0070] FIGs. 20A-20G. Representative images and graphs showing effect of combined treatment of SRI-011381 and PGE2 as a replacement of TGF03.
[0071] FIGs. 21A-21E. Representative images and graphs showing optimization of monolayer mDAC differentiation from hPSCs.
[0072] DETAILED DESCRIPTION
[0073] Described herein are compositions and methods for generating midbrain dopaminergic cells (mDACs) that show enhanced differentiation efficiency and maturation. Also described herein are chemically controlled differentiation systems for producing clinical-grade midbrain dopaminergic cells (mDACs) with reproducible identity, purity, and safety attributes.
[0074] Generating mDAPs with enhanced differentiation efficiency and maturation Human induced pluripotent stem cells (hiPSCs), derived from individual Parkinson’s disease (PD) patients, hold promise as cell sources for autologous, personalized cell replacement therapy (CRT) (Yamanaka, 2020; Takahashi & Yamanaka, 2006). To explore this potential, we have developed a comprehensive platform spanning molecular mechanisms underlying somatic cell reprogramming, identification of microRNA clusters involved in metabolic reprogramming, and refining of reprogramming and in vitro differentiation methods (Cha et al., 2017; Cha et al., 2021; Song et al., 2020; Kim et al., 2022). Additionally, we have established chemical methods to eliminate undifferentiated hiPSCs and improved surgical transplantation techniquesAttorney Docket No. 04843-0081W01
[0075] (Song et al., 2020; Lee et al., 2013; Schweitzer et al., 2020). Utilizing this platform, we successfully generated hiPSC lines from a sporadic PD patient, “PD01”, and differentiated them into midbrain dopaminergic cells (mDACs), which predominantly comprise midbrain dopaminergic progenitors (mDAPs) and early midbrain dopaminergic neurons (mDANs). After rigorous safety and efficacy assessments, we obtained U.S. Food and Drug Administration (FDA) approval for single-patient expanded access to treat patient PD01. In the pilot study, we generated mDACs in a Good Manufacturing Practice facility and transplanted them into the patient’s putamen without immunosuppression. Positron emission tomography scans using18F-DOPA indicated graft survival at 18-24 months (Schweitzer et al., 2020). The patient experienced no adverse effects and modest symptom improvement (Schweitzer et al., 2020).
[0076] Building on this case and FDA recommendations, we present pre-clinical data to advance autologous CRT for PD. We generated multiple hiPSC lines from biopsied fibroblasts of three additional PD patients (PD02, PD03, and PD04) and conducted comprehensive safety and efficacy studies using mDACs derived from clinical-grade hiPSC lines under both Good Laboratory Practice (GLP) and non-GLP conditions (FIG.
[0077] 1A). We also investigated the impact of extended passaging on genomic integrity and safety. Based on our findings, we propose a refined definition of clinical-grade hiPSCs and establish standardized release criteria for autologous CRT in PD.
[0078] mDAPs generated by the methods described herein show enhanced differentiation efficiency and maturation. The disclosure is based, in part, on the discovery that modulation of the treatment period with specific chemicals, such as DAPT, significantly improves the efficiency of mDA neuron generation and enhances their maturation. This optimization ensures the production of robust, functionally mature mDAPs suitable for transplantation. Furthermore, the methods described herein eliminates tumorigenic potential of the mDAPS. To ensure safety, it is critical to confirm that the transplantable cell population does not contain undifferentiated iPSCs or transformed cells with tumorigenic potential. Tumorigenic cells can exhibit residual expression of pluripotency markers, such as OCT4, even after differentiation. In contrast, high-quality iPSC-derived mDAPs produced by the present methods do not have detectable expression of pluripotent genes following differentiation. Thus, to prevent tumor formation, final cellAttorney Docket No. 04843-0081W01
[0079] product for transplantation can be tested to ensure no detectable pluripotency marker expression both in vitro and in vivo. Moreover, the present disclosure addresses interindividual variability in clinical outcomes. As shown here, mDA neurons derived from certain patients failed to improve behavioral outcomes in rodent models. Importantly, these cells demonstrated poor dopaminergic fiber density after transplantation, indicating compromised functional integration. Based on this, the present disclosure proposes that assessing dopaminergic fiber density post-transplantation can serve as a convenient and reliable efficacy marker prior to clinical transplantation, especially since full-scale behavioral testing in animal models is impractical for every patient-specific cell product. Accordingly, this approach can provide a robust indication of the functional potential of the cells. Thus, by refining differentiation protocols, implementing stringent quality control (QC) measures, and addressing patient variability through preclinical efficacy markers, the present disclosure aims to improve the safety and therapeutic success of iPSC-derived cell replacement therapies for PD.
[0080] The methods described herein can provide the following advantages over previously known methods - (i) Modulation of certain chemical treatment, as described herein, significantly improve the efficiency of mDA neuron generation and enhances their maturation, resulting in better behavioral outcomes.
[0081] (ii) Tumorigenic cells exhibit residual expression of pluripotency markers, such as OCT4, even after differentiation, while clinical grade iPSC-derived mDA cells do not display any detectable pluripotent gene expression following differentiation. Thus, based on results described herein, residual expression of pluripotent genes can be used as a critical safety QC criterion for mDACs.
[0082] (iii) Since full-scale behavioral testing in animal models is impractical for every patient-specific cell product, the present disclosure proposes that assessing dopaminergic fiber density post-transplantation can serve as a convenient and reliable efficacy marker prior to clinical transplantation.Attorney Docket No. 04843-0081W01
[0083] Generation of autologous mDACs
[0084] Described herein are methods for generating mDACs, which can include mDAPs and mDANs. For example, described herein are methods for differentiation of induced pluripotent stem cells (iPSCs) into mDACs. Details regarding generation of mDACs is also provided in WO 2020 / 237104, the entire contents of which are incorporated herein by reference.
[0085] Generation of iPSCs
[0086] Generation of mDACs by the present methods can include generation of iPSCs, which can then be differentiated into mDACs. The iPSCs can be human iPSCs (hiPSCs). The iPSCs can be similar to neurogenic floor plate cells and can be generated using methods known in the art or described herein. For use in the present methods, iPSCs can be generated from primary somatic cells obtained from a subject. The subject can be a mammal, e.g., a human. The subject can be afflicted with PD and in need of treatment for PD. For example, for use in the present methods, hiPSCs can be generated from a population of primary somatic cells obtained from a human subject who has PD (e.g., has been diagnosed with PD and / or shows one or more symptoms of PD) and is in need of treatment for PD. The somatic cells can be fibroblasts. Fibroblasts can be obtained from connective tissue in the mammalian body, e.g., from the skin. The skin can be from the eyelid, back of the ear, a scar (e.g., an abdominal cesarean scar), or the groin (see, e.g., Fernandes et al., Cytotechnology. 2016 Mar; 68(2): 223-228), e.g., using known biopsy methods. Other sources of somatic cells for hiPSC can include, without limitation, hair keratinocytes (Raab et al., Stem Cells Int. 2014;2014:768391), blood cells, or bone marrow mesenchymal stem cells (MSCs) (Streckfuss-Bomeke et al., Eur Heart J. 2013 Sep;34(33):2618-29).
[0087] For use in the present methods, the somatic cells (e.g., fibroblasts) can be exposed to one or more factors to induce reprogramming to iPSCs. Although other protocols for programming can be used (e.g., as known in the art or described herein), in preferred embodiments, the methods can include introducing four transcription factors — also known as the Yamanaka four factors, i.e., Oct4, Sox2, Klf4, and L-Myc — into the cells. For example, the methods described herein can comprise transfecting the somatic cellsAttorney Docket No. 04843-0081W01
[0088] (e.g., fibroblasts) with polycistronic episomal vectors encoding the Yamanaka four factors (i.e., OCT4, SOX2, KLF4, L-MYC). The polycistronic episomal vectors can be non-genome integrating vectors. The polycistronic episomal vectors can comprise intervening sequences encoding ‘self-cleaving’ 2A peptides between the coding sequences. 2A peptides are 18-22 amino-acid-long viral peptides that mediate cleavage of polypeptides during translation in eukaryotic cells. 2A peptides can include F2A (foot-and-mouth disease virus), E2A (equine rhinitis A virus), P2A (porcine teschovirus- 1 2A), and T2A (thosea asigna virus 2A), and generally comprise the sequence GDVEXNPGP (SEQ ID NO:1) at the C-terminus. See, e.g., Liu etal., SciRep. 2017; 7: 2193.
[0089] Exemplary 2A sequences are provided in Table 1.
[0090] TABLE 1. Exemplary 2A sequences
[0091]
[0092] For example, the methods described herein can comprise transfecting the cells (e.g., fibroblasts) with polycistronic episomal vector that comprises human Oct4 linked with 2A sequence of foot-and-mouth disease virus (OCT4-F2A), KLF4, SOX2 linked with 2A sequence of porcine teschovirus (SOX2-P2A), and L-MYC coding sequences, for expression of OCT4, KLF4, SOX2, and L-MYC. References to exemplary sequences for OCT4, KLF4, SOX2, and L-MYC are provided in Table 2.Attorney Docket No. 04843-0081W01
[0093] TABLE 2. Reference to exemplary sequences for OCT4, KLF4, SOX2, and L-MYC > >
[0094] > >
[0095] >
[0096] >
[0097] >
[0098] >
[0099] >
[0100] >
[0101] >
[0102]
[0103] Additionally, or in the alternative, methods described herein can include expressing in the cells (e.g., fibroblasts) one or more exogenous microRNAs, e.g., one or more of miR-106a, -106b, -136s, -200c, -302s, -369s, and -371 / 373. miR-302s indicates the miR-302 cluster which encompasses five miRNAs including 302a, 302b, 302c, 302d, and 367; and any one or more of them can be used in the present methods. For example, the methods can include expressing in the cells miR-302s and miR-200c, e.g., from a single episomal vector. Thus, the methods can comprise introducing into the cells an episomal vector that comprises sequences coding for miR-302s and miR-200c.
[0104] Exemplary sequences for miRNAs for use in the present methods are provided in Table 3. The sequences in bold represent mature miRNAs.
[0105] TABLE 3. Exemplary sequences of miRNAs
[0106]
[0107] Attorney Docket No. 04843-0081W01
[0108]
[0109] The sequences used can be at least 80, 85, 90, 95, or 100% identical to the exemplary (reference) sequences provided herein, but should retain the desired activity of the exemplary (reference) sequence. Calculations of “identity” between two sequences can be performed as follows. The sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second nucleic acid sequence for optimal alignment and non-identical sequences can be disregarded for comparison purposes). The length of a sequence aligned for comparison purposes is at least 60% (e.g., at least 70%, 80%, 90% or 100%) of the length of the reference sequence. The nucleotides at corresponding nucleotide positions are then compared. When a position in the first sequence is occupied by the same nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences.Attorney Docket No. 04843-0081W01
[0110] The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. For example, the percent identity between two nucleotide sequences can be determined using the GAP program in the GCG software package, using a Blossum 62 scoring matrix with a gap penalty of 12, a gap extend penalty of 4, and a frameshift gap penalty of 5.
[0111] The methods described herein can comprise expressing in the cells all of OCT4, KLF4, SOX2, L-MYC, miR-302s and miR-200c. For example, the methods can comprise introducing into the cells a lentiviral vector or polycistronic episomal vector that comprises human Oct4 linked with 2A sequence of foot-and-mouth disease virus (OCT4-F2A), KLF4, SOX2 linked with 2A sequence of porcine teschovirus (SOX2-P2A), and L-MYC coding sequences, and a vector, e.g., lentiviral vector or episomal vector, that comprises sequences coding for miR-302s (e.g., as shown above) and miR-200c (e.g., a sequence as shown above or uaauacugccggguaaugaugga (SEQ ID NO: 21)).
[0112] The primary somatic cells can be transfected directly, or they can be cultured first, removed from the culture plate and resuspended before transfection is carried out. The cells can be combined with exogenous nucleic acid sequence, e.g., to stably integrate into their genomes, and treated in order to accomplish transfection. As used herein, the term “transfection” includes a variety of techniques for introducing an exogenous nucleic acid into a cell including calcium phosphate or calcium chloride precipitation, microinjection, DEAE-dextrin-mediated transfection, lipofection, or electroporation, all of which are known in the art). Where the vectors are viral vectors, transfection can include transducing the cells with viral particles. In some instances of the methods described herein, the cells (e.g., fibroblasts) can be electroporated with non-genome integrating episomal vectors encoding the Yamanaka four factors (i.e., OCT4, SOX2, KLF4, L-MYC) alongside episomal vectors encoding metabolic reprogramming microRNAs (miR-302s and -200c). The cells can be electroporated with specific electroporation parameters. Electroporation parameters for electroporation of the cells by the present methods can include the following - pulse voltage: 1,650V; pulse width: 10 ms; pulse number: 3.
[0113] After introducing these factors into the cells, the cells can be maintained in conditions and for a time sufficient for expression of the factors and induction ofAttorney Docket No. 04843-0081W01
[0114] reprogramming to iPSCs, e.g., cells that express alkaline phosphatase (AP) as well as the more stringent pluripotency marker, TRA-1-60 (Chan et al., 2009; Tanabe et al., 2013). A number of methods are known in the art; see, e.g., Malik and Rao, Methods Mol Biol. 2013;997:23-33. For example, following electroporation, the transfected cells can be plated (e.g., in 6-well plates) with fibroblast medium. The fibroblast medium can be supplemented with a ROCK inhibitor, such as Y-27632 (e.g., 10 pM Y-27632), to enhance the survival and / or maintain the pluripotency of the embryonic stem cells (ESCs). Starting the next day, the cells can be fed with a culture medium (e.g., Essential 8 medium or NUTRISTEM® hPSC XF medium) supplemented with Nicotinamide (NAM, e.g., 1 mM NAM), Sodium butyrate (NaB; e.g., 500 pM NaB), and Ascorbic acid (AA, e.g., 200 pM AA) daily until appearance of ESC-like colonies. The observed ESC-like colonies can be handpicked and transferred onto culture plates (e.g., 24-well plates) in culture medium (e.g., Essential 8 medium or NUTRISTEM® hPSC XF medium) supplemented with a ROCK inhibitor, such as Y-27632 (e.g., 10 pM Y-27632) to establish hiPSC lines. The cells can be maintained, passaged, and cryopreserved at 5-passage intervals (e.g., up to passage 20).
[0115] For cryopreservation, the cells can be dissociated with EDTA solution (e.g., 0.5 mM EDTA solution) and resuspended in cell freezing medium (e.g., at 1 million cells per mL). The cell freezing medium can comprise cell culture medium (e.g., Essential 8 medium or NUTRISTEM® hPSC XF medium) supplemented with DMSO (e.g., 10% DMSO). Subsequently, the cells can be aliquoted into cryovials and stored in a temperature-monitored vapor-phase nitrogen tank.
[0116] Once iPSCs are generated, they can be maintained as an iPSC line. For use in the present methods, multiple iPSC lines for each patient can be generated and characterized, and then the best lines (e.g., the best 1, 2, 3 or more lines) are chosen for cell replacement therapy (CRT).
[0117] For use in the methods described herein, the culture plates (e.g., 6-well plates, 24-well plates) and / or culture dishes (e.g., 6-cm dishes) can be coated with a basement membrane extract (e.g., a soluble extract of basement membrane proteins), such as MATRIGEL®, PATHCLEAR Grade Basement Membrane Extract (Amsbio), or otherAttorney Docket No. 04843-0081W01
[0118] synthetic alternatives, e.g., as described in Nguyen et al., Nat Biomed Eng. 2017;l. pii: 0096.
[0119] Differentiation of iPSCs into mDACs
[0120] Also provided herein are methods for differentiation of iPSCs (e.g., hiPSCs produced by the present methods) into mDACs. Clinical-grade hiPSCs (e.g., hiPSCs produced by the present methods) can be thawed and cultured on cell culture dishes (e.g., 6-cm cell culture dishes) in cell culture medium (e.g., Essential 8 medium or NUTRISTEM® hPSC XF medium). The cells can be plated in discrete, individual areas (also referred to herein as “spots”). The spots can be substantially circular or oval, of 2-10 mm, e.g., about 5 mm, diameter. The spots can be generated using a biomatrix hydrogel support, such as a basement membrane extract (e.g., MATRIGEL, PATHCLEAR Grade Basement Membrane Extract (Amsbio), or other synthetic alternatives). About 10 pl of the biomatrix hydrogel can be used to generate a spot on a culture plate or dish. The spots can be made, e.g., by placing droplets of the appropriate volume onto the plate with about 1-3 cm in between, e.g., on cross points of a 2 x 2 cm grid, to maintain isolation between spots (so that the spots do not touch each other). For example, about 10 pl of the hydrogel can be placed on the intersections of a grid on a gridded culture plate to make a spot of about 2-10 mm, e.g., about 5 mm, in diameter. After incubation for a sufficient time, e.g., about 10-60 minutes (e.g., about 25-45 minutes, or about 30 minutes), the hydrogel can be partially aspirated from the spot (stopping before it is completely dry), leaving a layer of hydrogel in the spot. Plates prepared in this manner (e.g., having gel spots as described herein) are also provided herein. After the plates are prepared, the cells can be plated on the spots, e.g., with a density of about 5,000-20,000, e.g., about 10,000, cells per spot, e.g., about 10 pl of the cell suspension with a density of 10,000 per pl. Thus, for differentiation of hiPSCs to mDACs by the present methods, culture plates with spots can be prepared by drawing grids on the bottom of new culture dishes and loading a hydrogel at one or more junctions of the grid to make a limited spot-coated area.
[0121] For example, on day 0 of differentiation, a grid with 2 horizontal and 3 vertical lines can be drawn on the bottom of new dishes (e.g., 6-cm dishes) yielding 6 junctions.Attorney Docket No. 04843-0081W01
[0122] About 10 pL of MATRIGEL can be loaded at each junction of the grid to make a limited spot-coated area. The spotted dishes can be incubated at 37°C (e.g., for at least 30 min). hiPSCs (e.g., hiPSCs prepared by the present methods) can be dissociated (e.g., using Accutase) and seeded onto these spotted dishes at 10,000 cells per 10 pL per spot in culture medium (e.g., Essential 8 medium or NUTRISTEM® hPSC XF medium) supplemented with a ROCK inhibitor (e.g., 10 pM Y-27632).
[0123] For the floor plate induction stage (days 1-5), the cells can be maintained in a cell culture medium (e.g., a basal medium, such as DMEM) supplemented with 15% (v / v) KSR, GlutaMAX, and P-mercaptoethanol (0-ME). For the neural precursor induction stage (days 6-11), the cells can be maintained in a cell culture medium (e.g., a basal medium, such as DMEM) supplemented with: 11.5% (v / v) KSR, 0.25% (v / v) N-2 supplement (N2; a chemically defined, optionally 100X concentrate of Bottenstein’s N-2 formulation (see, e.g., Bottenstein, J.E. (1985) Cell Culture in the Neurosciences, Bottenstein, J.E. and Harvey, A.L., editors, p. 3, Plenum Press: New York and London) (days 6-7); 7.5% (v / v) KSR, 0.5% (v / v) N2 (days 8-9); and 3.75% (v / v) KSR, 0.75% (v / v) N2 (days 10-11). The culture medium can be further supplemented with GlutaMAX, 0-ME and non-essential amino acid (NEAA). Dual SMAD inhibitors, such as 4- {6-[4-(Piperazin-l-yl)phenyl]pyrazolo[l,5-a]pyrimidin-3-yl} quinoline (LDN193189) (e.g., 50-500 nM (e.g., 50-150 nM, 100-200 nM, 150-250 nM, 200-300 nM, 250-350 nM, 300-400 nM, 350-450 nM, or 400-500 nM) LDN193189, such as 200 nM LDN193189) and 4-[4-(2H-l,3-Benzodioxol-5-yl)-5-(pyridin-2-yl)-lH-imidazol-2-yl]benzamide (SB431542) (e.g., 1-50 pM (e.g., 1-10 pM, 5-15 pM, 10-20 pM, 15-25 pM, 20-30 pM, 25-35 pM, 30-40 pM, 35-45 pM, or 40-50 pM) SB431542, such as 10 pM SB431542) can be added from days 1-11 and days 1-7, respectively. From days 2 to 9, the cells can be treated with Sonic Hedgehog (SHH) (e.g., 10-500 ng / mL (e.g., 10-100 ng / mL, 50-150 ng / mL, 100-200 ng / mL, 150-250 ng / mL, 200-300 ng / mL, 250-350 ng / mL, 300-400 ng / mL, 350-450 ng / mL, or 400-500 ng / mL) SHH, such as 100 ng / mL SHH), Fibroblast growth factor 8 (FGF8) (e.g., 10-500 ng / mL (e.g., 10-100 ng / mL, 50-150 ng / mL, 100-200 ng / mL, 150-250 ng / mL, 200-300 ng / mL, 250-350 ng / mL, 300-400 ng / mL, 350-450 ng / mL, or 400-500 ng / mL) FGF8, such as 100 ng / mL FGF8), and Purmorphamine (e.g., 0.1-5 pM (e.g., 0.1-1 pM, 0.5-1.5 pM, 1-2 pM, 1.5-2.5 pM, 2-3Attorney Docket No. 04843-0081W01
[0124] pM, 2.5-3.5 pM, 3-4 pM, 2.5-4.5 pM, or 4-5 pM) purmorphamine, such as 2 pM purmorphamine). Additionally, a Wnt signaling activator and / or chemical inhibitor of glycogen synthase kinase 3 (GSK-3), such as 6-((2-((4-(2,4-Dichlorophenyl)-5-(4-methyl-lH-imidazol-2-yl)pyrimidin-2-yl)amino)ethyl)amino)nicotinonitrile (CHIR99021) (e.g., 0.1-5 pM(e.g., 0.1-1 pM, 0.5-1.5 pM, 1-2 pM, 1.5-2.5 pM, 2-3 pM, 2.5-3.5 pM, 3-4 pM, 2.5-4.5 pM, or 4-5 pM) CHIR99021, such as 1 pM CHIR99021) can be added from days 4-11. On day 9, the cells can be treated with quercetin (e.g., 1-100 pM (e.g., 1-20 pM, 10-30 pM, 20-40 pM, 30-50 pM, 40-60 pM, 50-70 pM, 60-80 pM, 70-90 pM, or 90-100 pM) quercetin, such as 40 pM quercetin), e.g., for 16 hrs.
[0125] For the mDAP induction and maturation stage (days 12-20), the cells can be maintained in a cell culture medium (e.g., a basal medium, such as DMEM / F12 medium) supplemented with N2, brain-derived neurotrophic factor (BDNF) (e.g., 5-50 ng / mL (e.g., 5-15 ng / mL, 10-20 ng / mL, 15-25 ng / mL, 20-30 ng / mL, 25-35 ng / mL, 30-40 ng / mL, 35-45 ng / mL, or 40-50 ng / mL) BDNF, such as 20 ng / mL BDNF), glial cell line-derived neurotrophic factor (GDNF) (e.g., 5-50 ng / mL (e.g., 5-15 ng / mL, 10-20 ng / mL, 15-25 ng / mL, 20-30 ng / mL, 25-35 ng / mL, 30-40 ng / mL, 35-45 ng / mL, or 40-50 ng / mL) GDNF, such as 20 ng / mL GDNF), transforming growth factor beta 3 (TGF03) (e.g., 0.1-50 ng / mL (e.g., 0.1-5 ng / mL, 0.25-2.5 ng / mL, 0.5-5 ng / mL, 0.1-10 ng / mL, 0.5-15 ng / mL, 1-2 ng / mL, 1.5-2.5 ng / mL, 2-3 ng / mL, 2.5-3.5 ng / mL, 3-4 ng / mL, 3.5-4.5 ng / mL, or 4-5 ng / mL) TGF03, such as 1 ng / mL TGF03), dibutyryl cyclic AMP (dbcAMP) (e.g., 100-1000 pM (e.g., 100-300 pM, 200-400 pM, 300-500 pM, 400-600 pM, 500-700 pM, 600-800 pM, 700-900 pM, or 800-1000 pM) dbcAMP, such as 500 pM dbcAMP), ascorbic acid (AA) (e.g., 50-500 pM (e.g., 50-150 pM, 100-200 pM, 150-250 pM, 200-300 pM, 250-350 pM, 300-400 pM, 350-450 pM, or 400-500 pM) AA, such as 200 pM AA), and N-[N-(3,5-difluorophenacetyl)-l-alanyl]-S-phenylglycine t-butyl ester (DAPT) (e.g., 1-50 pM (e.g., 1-10 pM, 5-15 pM, 10-20 pM, 15-25 pM, 20-30 pM, 25-35 pM, 30-40 pM, 35-45 pM, or 40-50 pM) DAPT, such as 10 pM DAPT). Additionally, a Wnt signaling activator, such as CHIR99021 (e.g., 0.1-5 pM(e.g., 0.1-1 pM, 0.5-1.5 pM, 1-2 pM, 1.5-2.5 pM, 2-3 pM, 2.5-3.5 pM, 3-4 pM, 2.5-4.5 pM, or 4-5 pM) CHIR99021, such as 1 pM CHIR99021) can be added on days 12-14. On day 15, the cells can be dissociated (e.g., with Accutase), and a single-cell suspension can be plated onto culture dishes (e.g., 6-cmAttorney Docket No. 04843-0081W01
[0126] dishes), e.g., at a density of 3 million per dish. The culture dishes can be coated with poly-L-ornithine / fibronectin / laminin. In contrast to previous methods (see, e.g., WO 2020 / 237104, the entire contents of which are incorporated herein by reference), where hiPSCs were differentiated into mDACS for a longer period (e.g., 28 days), the present methods describe differentiation of hiPSCs into mDACs for a shorter period (e.g., 21 days). Moreover, while a gamma secretase inhibitor (e.g., DAPT) was used for a shorter period (e.g., for 3 days, such as days 12-15) in the previous methods (see, e.g., WO 2020 / 237104), the present methods describe the use of a gamma secretase inhibitor (e.g., DAPT) for a longer period (e.g., for 9 days, such as days 12-21). Gamma-secretase inhibitors, such as N-{(3S)-l-[({(2S)-2-methyl-2-(2-methylphenyl)propanoyl}amino)methyl]-2-methylpropyl}-2-phenylacetamide (DAPT), can block the Notch signaling pathway, which regulates differentiation and maturation of cells (e.g., neuronal cells). Thus, use of a gamma secretase inhibitor (e.g., DAPT) for a longer period (e.g., for 9 days, such as days 12-21) rendered the mDACs generated by the present methods more mature, although those mDACS were differentiated for a shorter period of time, as compared to previous methods. As shown in the results described herein (see, e.g., Example 1), compared to mDACS differentiated for longer period (e.g., for 28 days) with short-term DAPT treatment (e.g., for 3 days), mDACS generated by the present methods, i.e., mDACS differentiated for shorter period (e.g., for 21 days) with long-term DAPT treatment (e.g., for 9 days), had several surprising advantages, including, but not limited to - (i) maintaining stable cell numbers; (ii) maintain stable pH level in culture medium; (iii) higher expression of mDAN markers (e.g., TH); and / or (iv) lower expression of proliferation markers (e.g., ki-67).
[0127] Following differentiation, on day 21, the mDACS can be dissociated (e.g., with Accutase), collected in cryogenic vials containing 3 million cells in 1 mL of CS10 cry opreservation medium, and stored in a temperature-monitored vapor-phase nitrogen tank at McLean Hospital. Prior to freezing and post-thaw, cell viability can be assessed.
[0128] One of skill in the art will appreciate that other reagents and concentrations can be used in the present methods. For example, instead of or along with Purmorphamine, other Sonic Hedgehog agonist (SHH agonists), such as oxysterols and SmoothenedAttorney Docket No. 04843-0081W01
[0129] Agonist (SAG) can be used in the present methods. Also, for use in the present methods, one or more of the Wnt agonists provided in Table 4 can be used.
[0130] TABLE 4. Wnt Agonists
[0131]
[0132] Attorney Docket No. 04843-0081W01
[0133]
[0134] Also, gamma secretase inhibitors that can be used in the present methods include those selected from the group consisting of: RO4929097; DAPT (N-[(3,5-Difluorophenyl)acetyl]-L-alanyl-2-phenyl]glycine-l,l -dimethylethyl ester); L-685458 ((5S)-(t-Butoxycarbonylamino)-6-phenyl-(4R)hydroxy-(2R)benzylhexanoyl)-L-leu-L-phe-amide); BMS-708163 (Avagacestat); BMS-299897 (2-[(lR)-l-[[(4-Chlorophenyl)sulfonyl] (2, 5 -difluorophenyl)amino] ethyl-5 -fluorobenzenebutanoic acid) ; MK-0752; YO-01027; MDL28170 (Sigma); LY411575 (N-2((2S)-2-(3,5-difhrorophenyl)-2-hydroxyethanoyl)-Nl-((7S)-5-methyl-6-oxo-6,7-dihydro-5H-dibenzo[b,d]azepin-7-yl)-l-alaninamide, see US 6,541,466); ELN-46719 (2-hydroxy-valeric acid amide analog of LY411575 (where LY411575 is the 3,5-difluoro-mandelic acid amide) (US Patent No 6,541,466)); PF-03084014 ((S)-2-((S)-5,7-difluoro-l, 2,3,4-tetrahydronaphthalen-3 -ylamino)-N-(l -(2-methyl- 1 -(neopentylamino)propan-2-yl)- 1 H-imidazol-4-yl)pentanamide, Samon et al., Mol Cancer Ther 2012;11:1565-1575);
[0135] Compound E ( (2S)-2-{[(3,5-Difhrrophenyl)acetyl]amino}-N-[(3S)-l-methyl-2-oxo-5-phenyl-2,3-dihydro-lH-l,4-benzodiazepin-3-yl]propanamide; see WO 98 / 28268 and Samon et al., Mol Cancer Ther 2012;11:1565-1575); and Semagacestat (LY450139; (2S)- 2-hydroxy-3-methyl-N-((lS)-l-methyl-2-{[(lS)-3-methyl-2-oxo-2,3,4,5-tetrahydro-lH- 3-benzazepin-l-yl]amino}-2-oxoethyl)butanamide), or pharmaceutically acceptable salts thereof.
[0136] Also provided herein are cells produced by a method described herein, e.g., mDAP or mDAN cells, and compositions comprising the cells.
[0137] Quality control criteria for mDACs
[0138] Also described herein are quality control criteria that can determine the standards of safety and efficacy for generation of clinical-grade mDACs. Clinical-grade mDACs can meet one or more of the quality control criteria described herein, e.g., one orAttorney Docket No. 04843-0081W01
[0139] more of the quality control criteria listed in Table 5. For example, described herein are clinical-grade mDACs and methods for generation thereof, wherein the mDACs meet all of the quality control criteria listed in Table 5.
[0140] Clinical-grade mDACs produced by the present methods are viable. For example, more than 70% (e.g., more than 75%, more than 80%, more than 85%, more than 90%, more than 95%, more than 97%, or more than 99%) cells produced by the present methods are viable prior to freezing and / or after thawing. Viability of the cells can be tested by methods described herein (e.g., by using LUNA-FX7™ Automated Cell Counter), or by methods known in the art.
[0141] Clinical-grade mDACs produced by the present methods are free of mycoplasma. For example, mycoplasma is not detected when the cells are tested by methods described herein (e.g., by PCR), or by methods known in the art.
[0142] Clinical-grade mDACs produced by the present methods are sterile. For example, bacterial growth is not detected when the cells are tested by methods described herein (e.g., by using automated microbial detection systems, such as BACT / ALERT®), or by methods known in the art.
[0143] Clinical-grade mDACs produced by the present methods are free of bacterial endotoxins. For example, <0.2 EU / Kg body weight / hr endotoxin is detected when the cells are tested by methods described herein (e.g., by using Limulus Amebocyte Lysate (LAL) test), or by methods known in the art.
[0144] Clinical-grade mDACs produced by the present methods test negative for Gram staining (e.g., negative for Crystal violet / iodine staining).
[0145] Clinical-grade mDACs produced by the present methods maintain an intact karyotype, e.g., as compared to the donor. For example, cells produced by the present methods maintained an intact karyotype and showed no anomaly as compared to donor karyotype when tested by methods described herein (e.g., by using KARYOSTAT™), or by methods known in the art.
[0146] Clinical-grade mDACs produced by the present methods showed DNA fingerprinting matching with donor fibroblasts. For example, mDACs produced by the present methods showed DNA fingerprinting matching with donor fibroblasts, when tested by methods described herein (e.g., by PCR), or by methods known in the art.Attorney Docket No. 04843-0081W01
[0147] Clinical-grade mDACs produced by the present methods express mDAC markers (e.g., FOXA2, LMX1A, TH) at mRNA and / or protein level. For example, more than 50% (e.g., more than 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, or 99%) of the mDACs produced by the present methods can express FOXA2 and LMX1A. Also, more than 5% (e.g., about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%) of the mDACs produced by the present methods can express TH. mRNA expression of these markers can be tested by qRT-PCR or other methods known in the art. Protein expression of these markers can be tested by immunocytochemistry or other methods known in the art.
[0148] Clinical-grade mDACs produced by the present methods have low (e.g., non-detectable) expression of pluripotent hPSC markers (e.g., OCT4, NANOG, SSEA-4) at mRNA and / or protein level, showing effective loss of pluripotency in these cells, thus indicating successful removal of undifferentiated hiPSCs. For example, mDACs produced by the present methods can have non-detectable expression of OCT4, NANOG, and / or SSEA-4. mRNA expression of these markers can be tested by qRT-PCR or other methods known in the art. Protein expression of these markers can be tested by immunocytochemistry or other methods known in the art.
[0149] Clinical-grade mDACs produced by the present methods have low (e.g., non-detectable) expression of non-ventral midbrain (non-VM) marker genes, including forebrain (e.g., PAX6, SOX1, FOXG1) and hindbrain markers (e.g., H0XA2, NKX6.1), further supporting the midbrain-specific identity of these cells. For example, mDACs produced by the present methods can have non-detectable expression of one or more of PAX6, SOX1, FOXG1, H0XA2, and NKX6.1. mRNA expression of these markers can be tested by qRT-PCR or other methods known in the art. Protein expression of these markers can be tested by immunocytochemistry or other methods known in the art.
[0150] Clinical-grade mDACs produced by the present methods have low (e.g., non-detectable) expression of markers associated with serotonergic neurons (e.g., tryptophan hydroxylase (TPH)) or noradrenergic neurons (e.g., dopamine b-hydroxylase (DBH)). For example, mDACs produced by the present methods can have non-detectable expression of TPH and / or DBH. mRNA expression of these markers can be tested byAttorney Docket No. 04843-0081W01
[0151] qRT-PCR or other methods known in the art. Protein expression of these markers can be tested by immunocytochemistry or other methods known in the art.
[0152] Clinical-grade mDACs produced by the present methods do not harbor Tier 1 cancer genes, e.g., genes listed in Table 6. For example, whole genome sequencing (WGS) / whole exome sequencing (WES) of mDACs produced by the present methods show no Tier 1 mutations in these cells.
[0153] Dopaminergic fiber density as efficacy marker
[0154] Also described herein is use of dopaminergic fiber density as a reliable efficacy marker of clinical-grade mDACs prior to clinical transplantation of the cells. For example, dopaminergic fiber density can indicate the ability of mDACS to mature and innervate host brains. Dopaminergic fiber density can be quantified by methods described herein. For example, brain sections from grafted striatal regions can be subjected to tyrosine hydroxylase (TH) immunostaining (e.g., using the avidin-biotin complex method with diaminobenzidine (TH-ABC-DAB)). Images from randomly selected areas on both the grafted and intact sides can be captured, e.g., by bright-field microscopy. Intensity of the brown DAB staining can be measured by inverting the images. Fiber density in the grafted striatum can be determined by subtracting the background intensity from the measured TH+ signal. This value can be normalized to the TH+ fiber density of the intact side on the same section (e.g., by setting TH+ fiber density of the intact side at 100%). The resulting data were expressed as a percentage of the intact side’s fiber density. Since full-scale behavioral testing in animal models is impractical for every patient-specific cell product, assessing dopaminergic fiber density, as described herein, can serve as a convenient and reliable efficacy marker prior to clinical transplantation. For example, mDACS resulting in TH+fiber density that is 20% or more (e.g., 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more) of the intact side can be used for clinical transplantation.
[0155] Chemically defined differentiation method for generating mDACs
[0156] Also described herein are chemically defined differentiation methods for generating mDACs.Attorney Docket No. 04843-0081W01
[0157] The generation of midbrain dopaminergic progenitor (mDAP) cells from human pluripotent stem cells (hPSCs) has emerged as a transformative strategy for cell replacement therapy in PD (Parmar et al., 2020). Over the past decade, numerous protocols have been developed to direct hPSCs into midbrain dopamine cells (mDACs) and their mature neuronal derivatives, and early clinical studies have begun to evaluate their safety and therapeutic potential (Doi et al., 2020; Kirkeby et al., 2023; Park et al., 2024; Kim et al., 2025; Jeon et al., 2025). Despite these advances, nearly all in vitro differentiation workflows remain heavily dependent on recombinant morphogens and neurotrophic factors, as well as compositionally undefined, animal-derived materials or complex supplements. Such inputs are difficult to standardize, introduce substantial batch-to-batch variability in culture performance, and compromise alignment with good manufacturing practice (GMP). For example, widely used serum replacement substitutes such as KnockOut Serum Replacement (KSR) are not fully chemically defined and contribute to lot-to-lot variability (Tchieu et al., 2017).
[0158] Accordingly, there is a pressing need for fully defined, chemically controlled differentiation systems that produce clinical-grade mDACs with reproducible identity, purity, and safety attributes (Christiansen and Kirkeby, 2024; Kirkeby et al., 2025). A chemistry-forward approach that replaces protein-based inducers and animal-derived supplements with small molecules and fully characterized reagents offers multiple advantages: improved lot-to-lot consistency, precise temporal control of signaling pathways, scalability and cost efficiency, and stronger compatibility with regulatory and GMP standards (Chen et al., 2014; Ozawa et al., 2023). Constraining inputs to defined components further minimizes confounding effects from proprietary mixtures and facilitates more reliable mapping between in vitro readouts and downstream functional outcomes. Critically, by minimizing dependence on costly recombinant proteins, chemically defined protocols have the potential to substantially lower production costs, thereby broadening accessibility for large-scale clinical translation and expanding the feasibility of mD AC-based biological and mechanistic research.
[0159] Herein, we present a robust, fully chemically defined differentiation framework for differentiating hPSCs into mDACs which contain mDA progenitors (mDAPs) and mDA neurons (mDANs). This approach replaces protein growth factors and animal-Attorney Docket No. 04843-0081W01
[0160] derived components with small-molecule modulators of key developmental pathways that govern ventral midbrain specification, and organizes the workflow into distinct early specification and late maturation phases under defined media conditions. The protocol is optimized to ensure reproducibility across diverse hPSC lines, maintain low proliferative activity with minimal off-target lineage contamination, and align with quantitative, clinically relevant quality-control and release criteria. By establishing a xeno-free, analytically tractable, and GMP-compatible culture environment, this work provides a foundation for scalable, standardized production of high-quality, clinical-grade mDACs for both mechanistic studies and therapeutic application in PD and other neurological diseases.
[0161] In the early phase of in vitro differentiation, we tested multiple basal media and supplements and identified DMEM / F12+N2+B27 as a robust condition, supporting reproducible yields and generating mDACs. This protocol thus completely removed animal derived supplements and protein factors such as SHH and FGF8. Furthermore, we established a new chemical method that replaces BDNF with optimal concentrations of 7,8-dihydroxyflavone (DHF). Also, we established a new chemical method that replaces GDNF with optimal concentration of N,N-diethyl-3-(4-(4-fluoro-2-(trifluoromethyl)benzoyl)piperazin-l-yl)-4-methoxybenzenesulfonamide (BT13).
[0162] Furthermore, we showed that SRI-011381 and prostaglandin E2 (PGE2) can partially replace TGF0. However, the final production of dopamine neurons was lower than when using TGF0. Still, the proportion of TH+cells is similar to that of the 1stgeneration method. Also, we established a monolayer-based differentiation platform incorporating the optimized early-phase protocol. By refining replating timing and cell density, we achieved homogeneous neuronal cultures with significantly enhanced dopaminergic yield (>30% TH+cells), representing a threefold increase relative to our validated spottingbased 1stgeneration protocol. Overall, these findings establish a chemically defined, scalable, and automation-compatible differentiation system that generates clinical-grade mDAPs with improved reproducibility, reduced dependence on costly protein factors, and enhanced dopaminergic output. This platform provides a strong foundation for mechanistic studies, cost-effective cell production, and the clinical translation of stem cell-based therapies for PD.Attorney Docket No. 04843-0081W01
[0163] The methods described herein can provide several advantages over previously known methods. At present, nearly all in vitro differentiation workflows remain heavily dependent on recombinant morphogens and neurotrophic factors, as well as compositionally undefined, animal-derived materials or complex supplements. Such inputs are difficult to standardize, introduce substantial batch-to-batch variability in culture performance, and compromise alignment with good manufacturing practice (GMP). For example, widely used serum replacement substitutes such as KnockOut Serum Replacement (KSR) are not fully chemically defined and contribute to lot-to-lot variability. As the result, the current protocols are very expensive and unreliable. In contrast, the present disclosure provides methods for producing mDACs using chemicals that target developmental pathways without using protein factors. Thus, the methods described herein have improved reproducibility, reduced dependence on costly protein factors, and enhanced dopaminergic output. This platform provides a strong foundation for mechanistic studies, cost-effective cell production, and the clinical translation of stem cell-based therapies for PD.
[0164] Second-generation protocol for differentiation of mDACs
[0165] Also described herein is a second-generation protocol (also referred to herein as “2ndgeneration protocol”) for differentiation of mDACs. The 2ndgeneration protocol is a chemically defined method for differentiation of mDACs (e.g., mDA neuronal cells). Details of the 2ndgeneration protocol are provided in Examples 6-10 and FIG. 16A. This protocol was developed to advance toward a fully chemically defined system. The methods under this protocol can: replace serum replacement substitutes such as KnockOut Serum Replacement (KSR) with chemically defined supplements; substitute animal derived supplements and protein factors such as SHH and FGF8 with small molecules; replace BDNF with optimal concentration of 7,8-dihydroxyflavone (DHF); replace GDNF with optimal concentration of N,N-diethyl-3-(4-(4-fluoro-2-(trifluoromethyl)benzoyl)piperazin-l-yl)-4-methoxybenzenesulfonamide (BT13); and / or replace (e.g., partially replace) TGF03 with N’-cyclohexyl-N-(phenylmethyl)-N-(4-piperidinylmethyl)-urea (SRI-011381) and prostaglandin E2 (PGE2).Attorney Docket No. 04843-0081W01
[0166] The 1stgeneration protocol (e.g., as described in the foregoing sections and in the “Materials and Methods for Examples 1-5” section) can be divided into two distinct phases, using day 12, when mDA neuron induction begins, as the boundary: early specification or early-stage phase (days 1-11), and late maturation or late-stage phase (days 12 onward, e.g., days 12-21). For the early-stage phase of the 2ndgeneration protocol (e.g., days 1-11): KSR can be replaced with chemically defined supplements; and / or recombinant proteins such as SHH and FGF8 can be substituted with small molecules. For the late-stage phase of the 2ndgeneration protocol (e.g., days 12 onwards, such as days 12-21): BDNF can be replaced with DHF (e.g., 0.1-5 pM (e.g., 0.1-1 pM, 0.5-1.5 pM, 1-2 pM, 1.5-2.5 pM, 2-3 pM, 2.5-3.5 pM, 3-4 pM, 2.5-4.5 pM, or 4-5 pM) DHF, such as 1 pMDHF); GDNF can be replaced with BT13 (e.g., 1-50 pM (e.g., 1-10 pM, 5-15 pM, 10-20 pM, 15-25 pM, 20-30 pM, 25-35 pM, 30-40 pM, 35-45 pM, or 40-50 pM) BT13, such as 10 pMBT13); and / or TGF03 can be replaced (e.g., partially replaced) with SRI-011381 (e.g., 0.1-5 pM (e.g., 0.1-1 pM, 0.5-1.5 pM, 1-2 pM, 1.5-2.5 pM, 2-3 pM, 2.5-3.5 pM, 3-4 pM, 2.5-4.5 pM, or 4-5 pM) SRI-011381, such as 1 pM SRI-011381) and PGE2 (e.g., 10-60 nM (e.g., 10-20 nM, 15-25 nM, 20-30 nM, 25-35 nM, 30-40 nM, 35-45 nM, 40-50 nM, 45-55 nM, or 50-60 nM) PGE2, such as 30 nM PGE2).
[0167] Various embodiments of the early-stage phase of the 2ndgeneration protocol are provided in Table 12. For example, described herein is a chemically defined mDAC differentiation protocol, where, for differentiation into mDACs, hiPSCs can be cultured in a basal medium (e.g., DMEM / F12 medium) supplemented with N-2 supplement (N2; a chemically defined, optionally 100X concentrate of Bottenstein’s N-2 formulation (see, e.g., Bottenstein, J.E. (1985) Cell Culture in the Neurosciences, Bottenstein, J.E. and Harvey, A.L., editors, p. 3, Plenum Press: New York and London) and B27 supplement (B27; a serum-free additive for neuronal cell culture medium) in the early-stage phase (e.g., at days 1-11), wherein N2 is present at a final concentration of 0.5-2X (e.g., 0.5-1.5X, 0.75-1.75X, or 1X-2X; such as IX), and wherein, when N2 is provided as a 100X stock solution, 0.5-2X corresponds to 0.5-2% (v / v) (e.g., 1% (v / v)); and wherein B27 is present at a final concentration of 0.5-2X (e.g., 0.5-1.5X, 0.75-1.75X, or 1X-2X; such as IX), and wherein, when B27 is provided as a 50X stock solution, 0.5-2X corresponds toAttorney Docket No. 04843-0081W01
[0168] 1-4% (v / v) (e.g., 2% (v / v)). This culture medium can be referred to herein as DMEM / F12 + N2 + B27 medium. The DMEM / F12 + N2 + B27 medium can be further supplemented with one or more of: non-essential amino acids (NEAA) at a final concentration of 0.5-2X (e.g., 0.5-1.5X, 0.75-1.75X, or IX- 2X; such as IX), and wherein, when NEAA is provided as a 100X stock solution, 0.5-2X corresponds to 0.5-2% (v / v); a small molecule inhibitor of bone morphogenetic protein (BMP), such as LDN-193189 (4-(6-(4-(piperazin-l-yl)phenyl)pyrazolo[l,5-a]pyrimidin-3-yl)quinoline hydrochloride; also referred to herein as LDN or LDN193189); a small molecule inhibitor to control stem cell differentiation, such as SB431542 (also referred to herein as SB); purmorphamine (also referred to herein as PMN); a Wnt signaling activator and / or chemical inhibitor of glycogen synthase kinase 3 (GSK-3), such as CHIR99021 (also referred to herein as CHIR); and quercetin (also referred to herein as QC). The cells can be cultured in this medium for one or more days from days 1-11 (e.g., at days 1-10). For example, the cells can be cultured in:
[0169] DMEM / F12 + N2 + B27 medium supplemented with NEAA (e.g., 0.5-2X (e.g., 0.5-1.5X, 0.75-1.75X, or 1X-2X) NEAA, such as IX NEAA; and wherein, when NEAA is provided as a 100X stock solution, 0.5-2X NEAA corresponds to 0.5-2% (v / v) NEAA), LDN193189 (e.g., 50-500 nM (e.g., 50-150 nM, 100-200 nM, 150-250 nM, 200-300 nM, 250-350 nM, 300-400 nM, 350-450 nM, or 400-500 nM) LDN193189, such as 200 nM LDN193189), and SB431542 (e.g., 1-50 pM(e.g., 1-10 pM, 5-15 pM, 10-20 pM, 15-25 pM, 20-30 pM, 25-35 pM, 30-40 pM, 35-45 pM, or 40-50 pM) SB431542, such as 10 pM SB431542) on day 1;
[0170] DMEM / F12 + N2 + B27 medium supplemented with NEAA (e.g., 0.5-2X (e.g., 0.5-1.5X, 0.75-1.75X, or 1X-2X) NEAA, such as IX NEAA; and wherein, when NEAA is provided as a 100X stock solution, 0.5-2X NEAA corresponds to 0.5-2% (v / v) NEAA), LDN193189 (e.g., 50-500 nM (e.g., 50-150 nM, 100-200 nM, 150-250 nM, 200-300 nM, 250-350 nM, 300-400 nM, 350-450 nM, or 400-500 nM) LDN193189, such as 200 nM LDN193189), SB431542 (e.g., 1-50 pM (e.g., 1-10 pM, 5-15 pM, 10-20 pM, 15-25 pM, 20-30 pM, 25-35 pM, 30-40 pM, 35-45 pM, or 40-50 pM) SB431542, such as 10 pM SB431542), and purmorphamine (e.g., 0.1-5 pM (e.g., 0.1-1 pM, 0.5-1.5 pM, 1-2 pM,Attorney Docket No. 04843-0081W01
[0171] 1.5-2.5 pM, 2-3 pM, 2.5-3.5 pM, 3-4 pM, 2.5-4.5 pM, or 4-5 pM) purmorphamine, such as 2 pM purmorphamine) on day 2;
[0172] DMEM / F12 + N2 + B27 medium supplemented with NEAA (e.g., 0.5-2X (e.g., 0.5-1.5X, 0.75-1.75X, or 1X-2X) NEAA, such as IX NEAA; and wherein, when NEAA is provided as a 100X stock solution, 0.5-2X NEAA corresponds to 0.5-2% (v / v) NEAA), LDN193189 (e.g., 50-500 nM (e.g., 50-150 nM, 100-200 nM, 150-250 nM, 200-300 nM, 250-350 nM, 300-400 nM, 350-450 nM, or 400-500 nM) LDN193189, such as 200 nM LDN193189), SB431542 (e.g., 1-50 pM (e.g., 1-10 pM, 5-15 pM, 10-20 pM, 15-25 pM, 20-30 pM, 25-35 pM, 30-40 pM, 35-45 pM, or 40-50 pM) SB431542, such as 10 pM SB431542), purmorphamine (e.g., 0.1-5 pM (e.g., 0.1-1 pM, 0.5-1.5 pM, 1-2 pM, 1.5-2.5 pM, 2-3 pM, 2.5-3.5 pM, 3-4 pM, 2.5-4.5 pM, or 4-5 pM) purmorphamine, such as 2 pM purmorphamine), and CHIR99021 (e.g., 0.1-5 pM(e.g., 0.1-1 pM, 0.5-1.5 pM, 1-2 pM, 1.5-2.5 pM, 2-3 pM, 2.5-3.5 pM, 3-4 pM, 2.5-4.5 pM, or 4-5 pM) CHIR99021, such as 1 pM CHIR99021) on days 4-6;
[0173] DMEM / F12 + N2 + B27 medium supplemented with NEAA (e.g., 0.5-2X (e.g., 0.5-1.5X, 0.75-1.75X, or 1X-2X) NEAA, such as IX NEAA; and wherein, when NEAA is provided as a 100X stock solution, 0.5-2X NEAA corresponds to 0.5-2% (v / v) NEAA), LDN193189 (e.g., 50-500 nM (e.g., 50-150 nM, 100-200 nM, 150-250 nM, 200-300 nM, 250-350 nM, 300-400 nM, 350-450 nM, or 400-500 nM) LDN193189, such as 200 nM LDN193189), purmorphamine (e.g., 0.1-5 pM(e.g., 0.1-1 pM, 0.5-1.5 pM, 1-2 pM, 1.5-2.5 pM, 2-3 pM, 2.5-3.5 pM, 3-4 pM, 2.5-4.5 pM, or 4-5 pM) purmorphamine, such as 2 pM purmorphamine), and CHIR99021 (e.g., 0.1-5 pM(e.g., 0.1-1 pM, 0.5-1.5 pM, 1-2 pM, 1.5-2.5 pM, 2-3 pM, 2.5-3.5 pM, 3-4 pM, 2.5-4.5 pM, or 4-5 pM) CHIR99021, such as 1 pM CHIR99021) on day 8;
[0174] DMEM / F12 + N2 + B27 medium supplemented with NEAA (e.g., 0.5-2X (e.g., 0.5-1.5X, 0.75-1.75X, or 1X-2X) NEAA, such as IX NEAA; and wherein, when NEAA is provided as a 100X stock solution, 0.5-2X NEAA corresponds to 0.5-2% (v / v) NEAA), LDN193189 (e.g., 50-500 nM (e.g., 50-150 nM, 100-200 nM, 150-250 nM, 200-300 nM, 250-350 nM, 300-400 nM, 350-450 nM, or 400-500 nM) LDN193189, such as 200 nM LDN193189), purmorphamine (e.g., 0.1-5 pM(e.g., 0.1-1 pM, 0.5-1.5 pM, 1-2 pM, 1.5-2.5 pM, 2-3 pM, 2.5-3.5 pM, 3-4 pM, 2.5-4.5 pM, or 4-5 pM) purmorphamine, such as 2Attorney Docket No. 04843-0081W01
[0175] pM purmorphamine), CHIR99021 (e.g., 0.1-5 pM (e.g., 0.1-1 pM, 0.5-1.5 pM, 1-2 pM, 1.5-2.5 pM, 2-3 pM, 2.5-3.5 pM, 3-4 pM, 2.5-4.5 pM, or 4-5 pM) CHIR99021, such as 1 pM CHIR99021), and quercetin (e.g., 1-100 pM (e.g., 1-20 pM, 10-30 pM, 20-40 pM, 30-50 pM, 40-60 pM, 50-70 pM, 60-80 pM, 70-90 pM, or 90-100 pM) quercetin, such as 40 pM quercetin) on day 9; and / or
[0176] DMEM / F12 + N2 + B27 medium supplemented with NEAA (e.g., 0.5-2X (e.g., 0.5-1.5X, 0.75-1.75X, or 1X-2X) NEAA, such as IX NEAA; and wherein, when NEAA is provided as a 100X stock solution, 0.5-2X NEAA corresponds to 0.5-2% (v / v) NEAA), LDN193189 (e.g., 50-500 nM (e.g., 50-150 nM, 100-200 nM, 150-250 nM, 200-300 nM, 250-350 nM, 300-400 nM, 350-450 nM, or 400-500 nM) LDN193189, such as 200 nM LDN193189), and CHIR99021 (e.g., 0.1-5 pM (e.g., 0.1-1 pM, 0.5-1.5 pM, 1-2 pM, 1.5-2.5 pM, 2-3 pM, 2.5-3.5 pM, 3-4 pM, 2.5-4.5 pM, or 4-5 pM) CHIR99021, such as 1 pM CHIR99021) on day 10.
[0177] Late-stage phase of the 2ndgeneration protocol is described in Table 12 and FIG.
[0178] 16A. For example, described herein is a chemically defined mDAC differentiation protocol, where, for differentiation into mDACs, hiPSCs can be cultured in basal medium (e.g., DMEM / F12 medium) supplemented with N2 at a final concentration of 0.5-2X (e.g., 0.5-1.5X, 0.75-1.75X, or IX- 2X; such as IX) in the late-stage phase (e.g., at days 12-21), wherein, when N2 is provided as a 100X stock solution, 0.5-2X corresponds to 0.5-2% (v / v) (e.g., 1% (v / v), such as a 1:100 dilution of a 100X stock solution). This culture medium can be referred to herein as DMEM / F12 + N2 medium. The DMEM / F12 + N2 medium can be further supplemented with one or more of: BDNF (e.g., 5-50 ng / mL (e.g., 5-15 ng / mL, 10-20 ng / mL, 15-25 ng / mL, 20-30 ng / mL, 25-35 ng / mL, 30-40 ng / mL, 35-45 ng / mL, or 40-50 ng / mL) BDNF, such as 20 ng / mL BDNF), GDNF (e.g., 5-50 ng / mL (e.g., 5-15 ng / mL, 10-20 ng / mL, 15-25 ng / mL, 20-30 ng / mL, 25-35 ng / mL, 30-40 ng / mL, 35-45 ng / mL, or 40-50 ng / mL) GDNF, such as 20 ng / mL GDNF), dbcAMP (e.g., 100-1000 pM (e.g., 100-300 pM, 200-400 pM, 300-500 pM, 400-600 pM, 500-700 pM, 600-800 pM, 700-900 pM, or 800-1000 pM) dbcAMP, such as 500 pM dbcAMP), AA (e.g., 50-500 pM (e.g., 50-150 pM, 100-200 pM, 150-250 pM, 200-300 pM, 250-350 pM, 300-400 pM, 350-450 pM, or 400-500 pM) AA, such as 200 pM AA), TGF03 (e.g., 0.1-5 ng / mL (e.g., 0.1-1 ng / mL, 0.5-1.5 ng / mL, 1-2 ng / mL, 1.5-2.5 ng / mL,Attorney Docket No. 04843-0081W01
[0179] 2-3 ng / mL, 2.5-3.5 ng / mL, 3-4 ng / mL, 3.5-4.5 ng / mL, or 4-5 ng / mL) TGF03, such as 1 ng / mL TGF03), DAPT (e.g., 1-50 pM (e.g., 1-10 pM, 5-15 pM, 10-20 pM, 15-25 pM, 20-30 pM, 25-35 pM, 30-40 pM, 35-45 pM, or 40-50 pM) DAPT, such as 10 pM DAPT), and CHIR99021 (e.g., 0.1-5 pM(e.g., 0.1-1 pM, 0.5-1.5 pM, 1-2 pM, 1.5-2.5 pM, 2-3 pM, 2.5-3.5 pM, 3-4 pM, 2.5-4.5 pM, or 4-5 pM) CHIR99021, such as 1 pM CHIR99021). For example, at day 12 onward (e.g., at days 12-14, or days 12-21), the cells can be cultured in DMEM / F12 + N2 medium supplemented with BDNF, GDNF, dbcAMP, AA, TGF03, DAPT, and CHIR99021. Also described herein are methods, where at the late-stage phase (e.g., day 12 onward, such as days 12-21), BDNF is replaced with DHF (e.g., 0.1-5 pM(e.g., 0.1-1 pM, 0.5-1.5 pM, 1-2 pM, 1.5-2.5 pM, 2-3 pM, 2.5-3.5 pM, 3-4 pM, 2.5-4.5 pM, or 4-5 pM) DHF, such as 1 pM DHF); GDNF is replaced with BT13 (e.g., 1-50 pM(e.g., 1-10 pM, 5-15 pM, 10-20 pM, 15-25 pM, 20-30 pM, 25-35 pM, 30-40 pM, 35-45 pM, or 40-50 pM) BT13, such as 10 pM BT13); and / or TGF03 is replaced with SRI-011381 (e.g., 0.1-5 pM (e.g., 0.1-1 pM, 0.5-1.5 pM, 1-2 pM, 1.5-2.5 pM, 2-3 pM, 2.5-3.5 pM, 3-4 pM, 2.5-4.5 pM, or 4-5 pM) SRI-011381, such as 1 pM SRI-011381) andPGE2 (e.g., 10-60 nM (e.g., 10-20 nM, 15-25 nM, 20-30 nM, 25-35 nM, 30-40 nM, 35-45 nM, 40-50 nM, 45-55 nM, or 50-60 nM) PGE2, such as 30 nM PGE2). For example, in the late-stage phase (e.g., at days 12-21), the cells can be cultured in DMEM / F12 + N2 medium supplemented with one or more of: DHF (e.g., 0.1-5 pM(e.g., 0.1-1 pM, 0.5-1.5 pM, 1-2 pM, 1.5-2.5 pM, 2-3 pM, 2.5-3.5 pM, 3-4 pM, 2.5-4.5 pM, or 4-5 pM) DHF, such as 1 pMDHF), BT13 (e.g., 1-50 pM(e.g., 1-10 pM, 5-15 pM, 10-20 pM, 15-25 pM, 20-30 pM, 25-35 pM, 30-40 pM, 35-45 pM, or 40-50 pM) BT13, such as 10 pMBT13), SRI-011381 (e.g., 0.1-5 pM(e.g., 0.1-1 pM, 0.5-1.5 pM, 1-2 pM, 1.5-2.5 pM, 2-3 pM, 2.5-3.5 pM, 3-4 pM, 2.5-4.5 pM, or 4-5 pM) SRI-011381, such as 1 pM SRI-011381), PGE2 (e.g., 10-60 nM (e.g., 10-20 nM, 15-25 nM, 20-30 nM, 25-35 nM, 30-40 nM, 35-45 nM, 40-50 nM, 45-55 nM, or 50-60 nM) PGE2, such as 30 nMPGE2), dbcAMP (e.g., 100-1000 pM (e.g., 100-300 pM, 200-400 pM, 300-500 pM, 400-600 pM, 500-700 pM, 600-800 pM, 700-900 pM, or 800-1000 pM) dbcAMP, such as 500 pM dbcAMP), AA (e.g., 50-500 pM (e.g., 50-150 pM, 100-200 pM, 150-250 pM, 200-300 pM, 250-350 pM, 300-400 pM, 350-450 pM, or 400-500 pM) AA, such as 200 pM AA), and DAPT (e.g., 1-50 pM (e.g., 1-10 pM, 5-15 pM, 10-20 pM,Attorney Docket No. 04843-0081W01
[0180] 15-25 pM, 20-30 pM, 25-35 pM, 30-40 pM, 35-45 pM, or 40-50 pM) DAPT, such as 10 pM DAPT). The late-stage phase of the 2ndgeneration protocol can include one or more of the following: dissociation of the cells at day 15; and transplantation and / or freezing the cells at day 21.
[0181] Monolayer-based protocol incorporating the early phase of 2nd generation protocol Also described herein is an improved monolayer-based cell differentiation protocol that incorporates the early phase (e.g., days 1-11) of the 2ndgeneration protocol (i.e., early phase of the 2ndgeneration chemically defined system) of the present disclosure. The late-stage phase (e.g., days 12-21) of this improved monolayer-based cell differentiation protocol can use the same protein factors as the 1stgeneration protocol. For example, the late-stage phase (e.g., days 12-21) of the improved monolayer-based cell differentiation protocol can use cell culture medium, such as a basal cell culture medium (e.g., DMEM / F12 medium) supplemented with N2 (e.g., 0.5-2X (e.g., 0.5-1.5X, 0.75-1.75X, or 1X-2X; such as IX) N2; and wherein, when N2 is provided as a 100X stock solution, 0.5-2X corresponds to 0.5-2% (v / v) (e.g., 1% (v / v)), BDNF (e.g., 5-50 ng / mL (e.g., 5-15 ng / mL, 10-20 ng / mL, 15-25 ng / mL, 20-30 ng / mL, 25-35 ng / mL, 30-40 ng / mL, 35-45 ng / mL, or 40-50 ng / mL) BDNF, such as 20 ng / mL BDNF), GDNF (e.g., 5-50 ng / mL (e.g., 5-15 ng / mL, 10-20 ng / mL, 15-25 ng / mL, 20-30 ng / mL, 25-35 ng / mL, 30-40 ng / mL, 35-45 ng / mL, or 40-50 ng / mL) GDNF, such as 20 ng / mL GDNF), TGF03 (e.g., 0.1-5 ng / mL (e.g., 0.1-1 ng / mL, 0.25-2.5 ng / mL, 0.5-1.5 ng / mL, 1-2 ng / mL, 1.5-2.5 ng / mL, 2-3 ng / mL, 2.5-3.5 ng / mL, 3-4 ng / mL, 3.5-4.5 ng / mL, or 4-5 ng / mL) TGF03, such as 1 ng / mL TGF03), dbcAMP (e.g., 100-1000 pM (e.g., 100-300 pM, 200-400 pM, 300-500 pM, 400-600 pM, 500-700 pM, 600-800 pM, 700-900 pM, or 800-1000 pM) dbcAMP, such as 500 pM dbcAMP), AA (e.g., 50-500 pM (e.g., 50-150 pM, 100-200 pM, 150-250 pM, 200-300 pM, 250-350 pM, 300-400 pM, 350-450 pM, or 400-500 pM) AA, such as 200 pM AA), and DAPT (e.g., 1-50 pM (e.g., 1-10 pM, 5-15 pM, 10-20 pM, 15-25 pM, 20-30 pM, 25-35 pM, 30-40 pM, 35-45 pM, or 40-50 pM) DAPT, such as 10 pMDAPT). Additionally, a Wnt signaling activator, such as CHIR99021 (e.g., 0.1-5 pM (e.g., 0.1-1 pM, 0.5-1.5 pM, 1-2 pM, 1.5-2.5 pM, 2-3 pM, 2.5-3.5 pM, 3-4 pM, 2.5-4.5 pM, or 4-5 pM) CHIR99021, such as 1 pM CHIR99021) can be added on days 12-14.Attorney Docket No. 04843-0081W01
[0182] The improved monolayer-based cell differentiation protocol can include: initial seeding of 100 x 103- 500 X 103(e.g., 100 x 103- 200 x 103, 150 x 103- 250 x 103, 200 x 103-300 x 103, 250 x 103- 350 x 103, 300 x 103- 400 x 103, 350 x 103- 450 x 103, or 400 x 103- 500 x 103) cells, such as 240 x 103cells at day 0; and / or replating of 1 x 106- 5 x 106(e.g., 1 x 106- 2 x 106, 1.5 x 106-2.5 x 106,2 x 106- 3 x 106,2.5 x 106- 3.5 x 106, 3 x 106- 4 x 106, 3.5 x 106- 4.5 x 106, or 4 x 106- 5 x 106) cells, such as 3 x 106cells on day 6.
[0183] Thus, described herein is an improved monolayer-based cell differentiation protocol that includes:
[0184] initial seeding of 100 x 103- 500 x 103(e.g., 100 x 103- 200 x 103, 150 x 103-250 x 103, 200 x 103- 300 x 103, 250 x 103- 350 x 103, 300 x 103- 400 x 103, 350 x 103- 450 x 103, or 400 x 103- 500 x 103) cells, such as 240 x 103cells at day 0;
[0185] culturing the cells in DMEM / F12 + N2 + B27 medium supplemented with NEAA (e.g., 0.5-2X (e.g., 0.5-1.5X, 0.75-1.75X, or 1X-2X) NEAA, such as IX NEAA; and wherein, when NEAA is provided as a 100X stock solution, 0.5-2X NEAA corresponds to 0.5-2% (v / v) NEAA), LDN193189 (e.g., 50-500 nM (e.g., 50-150 nM, 100-200 nM, 150-250 nM, 200-300 nM, 250-350 nM, 300-400 nM, 350-450 nM, or 400-500 nM) LDN193189, such as 200 nMLDN193189), and SB431542 (e.g., 1-50 pM (e.g., 1-10 pM, 5-15 pM, 10-20 pM, 15-25 pM, 20-30 pM, 25-35 pM, 30-40 pM, 35-45 pM, or 40-50 pM) SB431542, such as 10 pM SB431542) on day 1;
[0186] culturing the cells in DMEM / F12 + N2 + B27 medium supplemented with NEAA (e.g., 0.5-2X (e.g., 0.5-1.5X, 0.75-1.75X, or 1X-2X) NEAA, such as IX NEAA; and wherein, when NEAA is provided as a 100X stock solution, 0.5-2X NEAA corresponds to 0.5-2% (v / v) NEAA), LDN193189 (e.g., 50-500 nM (e.g., 50-150 nM, 100-200 nM, 150-250 nM, 200-300 nM, 250-350 nM, 300-400 nM, 350-450 nM, or 400-500 nM) LDN193189, such as 200 nMLDN193189), SB431542 (e.g., 1-50 pM (e.g., 1-10 pM, 5-15 pM, 10-20 pM, 15-25 pM, 20-30 pM, 25-35 pM, 30-40 pM, 35-45 pM, or 40-50 pM) SB431542, such as 10 pM SB431542), and purmorphamine (e.g., 0.1-5 pM (e.g., 0.1-1 pM, 0.5-1.5 pM, 1-2 pM, 1.5-2.5 pM, 2-3 pM, 2.5-3.5 pM, 3-4 pM, 2.5-4.5 pM, or 4-5 pM) purmorphamine, such as 2 pM purmorphamine) on day 2;Attorney Docket No. 04843-0081W01
[0187] culturing the cells in DMEM / F12 + N2 + B27 medium supplemented with NEAA (e.g., 0.5-2X (e.g., 0.5-1.5X, 0.75-1.75X, or 1X-2X) NEAA, such as IX NEAA; and wherein, when NEAA is provided as a 100X stock solution, 0.5-2X NEAA corresponds to 0.5-2% (v / v) NEAA), LDN193189 (e.g., 50-500 nM (e.g., 50-150 nM, 100-200 nM, 150-250 nM, 200-300 nM, 250-350 nM, 300-400 nM, 350-450 nM, or 400-500 nM) LDN193189, such as 200 nMLDN193189), SB431542 (e.g., 1-50 pM (e.g., 1-10 pM, 5-15 pM, 10-20 pM, 15-25 pM, 20-30 pM, 25-35 pM, 30-40 pM, 35-45 pM, or 40-50 pM) SB431542, such as 10 pM SB431542), purmorphamine (e.g., 0.1-5 pM (e.g., 0.1-1 pM, 0.5-1.5 pM, 1-2 pM, 1.5-2.5 pM, 2-3 pM, 2.5-3.5 pM, 3-4 pM, 2.5-4.5 pM, or 4-5 pM) purmorphamine, such as 2 pM purmorphamine), and CHIR99021 (e.g., 0.1-5 pM (e.g., 0.1-1 pM, 0.5-1.5 pM, 1-2 pM, 1.5-2.5 pM, 2-3 pM, 2.5-3.5 pM, 3-4 pM, 2.5-4.5 pM, or 4-5 pM) CHIR99021, such as 1 pM CHIR99021) on days 4-6;
[0188] replating of 1 x 106- 5 x 106(e.g., 1 x 106- 2 x 106, 1.5 x 106- 2.5 x 106, 2 x 106-3 x 106, 2.5 x 106- 3.5 x 106, 3 x 106- 4 x 106, 3.5 x 106- 4.5 x 106, or 4 x 106- 5 x 106) cells, such as 3 x 106cells on day 6;
[0189] culturing the cells in DMEM / F12 + N2 + B27 medium supplemented with NEAA (e.g., 0.5-2X (e.g., 0.5-1.5X, 0.75-1.75X, or 1X-2X) NEAA, such as IX NEAA; and wherein, when NEAA is provided as a 100X stock solution, 0.5-2X NEAA corresponds to 0.5-2% (v / v) NEAA), LDN193189 (e.g., 50-500 nM (e.g., 50-150 nM, 100-200 nM, 150-250 nM, 200-300 nM, 250-350 nM, 300-400 nM, 350-450 nM, or 400-500 nM) LDN193189, such as 200 nMLDN193189), purmorphamine (e.g., 0.1-5 pM (e.g., 0.1-1 pM, 0.5-1.5 pM, 1-2 pM, 1.5-2.5 pM, 2-3 pM, 2.5-3.5 pM, 3-4 pM, 2.5-4.5 pM, or 4-5 pM) purmorphamine, such as 2 pM purmorphamine), and CHIR99021 (e.g., 0.1-5 pM (e.g., 0.1-1 pM, 0.5-1.5 pM, 1-2 pM, 1.5-2.5 pM, 2-3 pM, 2.5-3.5 pM, 3-4 pM, 2.5-4.5 pM, or 4-5 pM) CHIR99021, such as 1 pM CHIR99021) on day 8;
[0190] culturing the cells in DMEM / F12 + N2 + B27 medium supplemented with NEAA (e.g., 0.5-2X (e.g., 0.5-1.5X, 0.75-1.75X, or 1X-2X) NEAA, such as IX NEAA; and wherein, when NEAA is provided as a 100X stock solution, 0.5-2X NEAA corresponds to 0.5-2% (v / v) NEAA), LDN193189 (e.g., 50-500 nM (e.g., 50-150 nM, 100-200 nM, 150-250 nM, 200-300 nM, 250-350 nM, 300-400 nM, 350-450 nM, or 400-500 nM) LDN193189, such as 200 nMLDN193189), purmorphamine (e.g., 0.1-5 pM (e.g., 0.1-1Attorney Docket No. 04843-0081W01
[0191] pM, 0.5-1.5 pM, 1-2 pM, 1.5-2.5 pM, 2-3 pM, 2.5-3.5 pM, 3-4 pM, 2.5-4.5 pM, or 4-5 pM) purmorphamine, such as 2 pM purmorphamine), CHIR99021 (e.g., 0.1-5 pM (e.g., 0.1-1 pM, 0.5-1.5 pM, 1-2 pM, 1.5-2.5 pM, 2-3 pM, 2.5-3.5 pM, 3-4 pM, 2.5-4.5 pM, or 4-5 pM) CHIR99021, such as 1 pM CHIR99021), and quercetin (e.g., 1-100 pM (e.g., 1-20 pM, 10-30 pM, 20-40 pM, 30-50 pM, 40-60 pM, 50-70 pM, 60-80 pM, 70-90 pM, or 90-100 pM) quercetin, such as 40 pM quercetin) on day 9;
[0192] culturing the cells in DMEM / F12 + N2 + B27 medium supplemented with NEAA (e.g., 0.5-2X (e.g., 0.5-1.5X, 0.75-1.75X, or 1X-2X) NEAA, such as IX NEAA; and wherein, when NEAA is provided as a 100X stock solution, 0.5-2X NEAA corresponds to 0.5-2% (v / v) NEAA), LDN193189 (e.g., 50-500 nM (e.g., 50-150 nM, 100-200 nM, 150-250 nM, 200-300 nM, 250-350 nM, 300-400 nM, 350-450 nM, or 400-500 nM) LDN193189, such as 200 nMLDN193189), and CHIR99021 (e.g., 0.1-5 pM (e.g., 0.1-1 pM, 0.5-1.5 pM, 1-2 pM, 1.5-2.5 pM, 2-3 pM, 2.5-3.5 pM, 3-4 pM, 2.5-4.5 pM, or 4-5 pM) CHIR99021, such as 1 pM CHIR99021) on day 10; and
[0193] culturing the cells in DMEM / F12 medium supplemented with N2 (e.g., 0.5-2X (e.g., 0.5-1.5X, 0.75-1.75X, or IX- 2X; such as IX) N2; and wherein, when N2 is provided as a 100X stock solution, 0.5-2X corresponds to 0.5-2% (v / v) (e.g., 1% (v / v)), BDNF (e.g., 5-50 ng / mL (e.g., 5-15 ng / mL, 10-20 ng / mL, 15-25 ng / mL, 20-30 ng / mL, 25-35 ng / mL, 30-40 ng / mL, 35-45 ng / mL, or 40-50 ng / mL) BDNF, such as 20 ng / mL BDNF), GDNF (e.g., 5-50 ng / mL (e.g., 5-15 ng / mL, 10-20 ng / mL, 15-25 ng / mL, 20-30 ng / mL, 25-35 ng / mL, 30-40 ng / mL, 35-45 ng / mL, or 40-50 ng / mL) GDNF, such as 20 ng / mL GDNF), TGF03 (e.g., 0.1-5 ng / mL (e.g., 0.1-1 ng / mL, 0.5-1.5 ng / mL, 1-2 ng / mL, 1.5-2.5 ng / mL, 2-3 ng / mL, 2.5-3.5 ng / mL, 3-4 ng / mL, 3.5-4.5 ng / mL, or 4-5 ng / mL) TGF03, such as 1 ng / mL TGF03), dbcAMP (e.g., 100-1000 pM (e.g., 100-300 pM, 200-400 pM, 300-500 pM, 400-600 pM, 500-700 pM, 600-800 pM, 700-900 pM, or 800-1000 pM) dbcAMP, such as 500 pM dbcAMP), AA (e.g., 50-500 pM (e.g., 50-150 pM, 100-200 pM, 150-250 pM, 200-300 pM, 250-350 pM, 300-400 pM, 350-450 pM, or 400-500 pM) AA, such as 200 pM AA), and DAPT (e.g., 1-50 pM (e.g., 1-10 pM, 5-15 pM, 10-20 pM, 15-25 pM, 20-30 pM, 25-35 pM, 30-40 pM, 35-45 pM, or 40-50 pM) DAPT, such as 10 pM DAPT) on days 12-21, with a Wnt signaling activator, such as CHIR99021 (e.g., 0.1-5 pM(e.g., 0.1-1 pM, 0.5-1.5 pM, 1-2 pM, 1.5-2.5 pM, 2-3 pM,Attorney Docket No. 04843-0081W01
[0194] 2.5-3.5 pM, 3-4 pM, 2.5-4.5 pM, or 4-5 pM) CHIR99021, such as 1 pM CHIR99021) added to the DMEM / F12 medium on days 12-14.
[0195] Methods of treatment
[0196] Also described herein are methods of treatment using the mDACs (e.g., mDAPs and mDANs), e.g., the clinical-grade mDACs described hereinabove. For example, mDACs (e.g., mDAPs and mDANs) generated by the present methods can be used, e.g., as a cell model and to treat subjects who have (or are at risk of developing) Parkinson’s Disease (PD). Such subjects can be identified by skilled healthcare providers using methods known in the art. The methods can include obtaining primary somatic cells; generating a population of cells comprising mDAPs, and administered the cells to the subjects. The primary somatic cells can be obtained from the same subject who is to be treated, i.e., who has (or is at risk of developing) PD. The cells can also be obtained from a different subject, preferably of the same species as the subject who is to be treated (i.e., autologous cells), preferably an immunologically matched subject. The mDAPs generated by the present methods can be sufficient to generate a population comprising cells that express one or more mDAP markers (e.g., FOXA2 and LMX1A), such as TH+ cells that co-express FOXA2 and LMX1A, but not comprising cells that express SOX1, PAX6, and ki-67.
[0197] The cells can be administered using methods known in the art. The cells can be administered (e.g., implanted) directly into or near the affected area of the subject’s brain, e.g., bilaterally into one or more of the caudate nucleus, putamen, and substantia nigra, e.g., using magnetic resonance imaging-guided stereotactic surgery. See, e.g., Garitaonandia et al., Stem Cells Dev. 2018 Jul 15;27(14):951 -957; Kikuchi et al., Nature 548 : 592-596 (31 August 2017); MOrizane et al., Nature Communications 8:385 (2017); Sonntag etal., Prog Neurobiol. 2018 Sep;168:l-20.
[0198] Culture Dishes
[0199] Also provided herein are culture dishes and / or culture plates for use in the present methods. The dishes can have on the bottom a grid with a distance between the lines of 1.5-2.5 cm, e.g., about 2 cm, e.g., a 2x2 cm grid. The grid can be, e.g., formed as part ofAttorney Docket No. 04843-0081W01
[0200] the dish, printed or etched on the bottom. The culture dishes can be made using methods known in the art and any acceptable material for culture dishes, e.g., polystyrene, polyethylene, polypropylene, polycarbonate, and polyvinyl thermoplastic resins, e.g., using conventional injection-molding or thermoforming methods. Another suitable material is glass. The dishes can have substantially flat bottoms; alternatively, there can be circular or ovoid dips or depressions at the intersection of the grid lines, e.g., of about 2-10 mm, e.g., about 3-7 mm, e.g., about 5 mm diameter. The depressions can be, e.g., 0.01-0.2 mm deep. The dishes can have a biomatrix hydrogel support, e.g., a basement membrane extract or synthetic matrix.
[0201] The culture dishes can be 10 or 6 cm round culture dishes with 12 or 6 intersections, respectively, for plating the cells. The distance between the cell placement areas (center of the spot to center of the adjacent spot) can be 2 cm and the diameter of the cell spot can be 0.5 cm. The circumference can be about 1.57 cm, and the area can be about 0.2 cm2. Thus, a 6 cm dish can have 6 possible spots, and a 10 cm dish can have 12 possible spots at intersecting grid lines.
[0202] EXAMPLES
[0203] The invention is further described in the following examples, which do not limit the scope of the invention described in the claims.
[0204] Example 1. Improvement of in vitro differentiation procedure
[0205] Utilizing the previously established spotting-based midbrain dopaminergic cell (mDAC) differentiation protocol, we demonstrated that differentiating both human embryonic stem cells (hESCs) and human induced pluripotent stem cells (hiPSCs) for 21 to 28 days yielded mDACs with confirmed safety and efficacy (Song et al., 2020; Kim et al., 2022). In our pilot clinical study, we used mDACs that had undergone 28 days of differentiation, as they are typically more mature than those differentiated for 21 days (Schweitzer et al., 2020). We speculated that a shorter protocol (21-day; D21) may be more reliable and efficient if D21 mDACs could be rendered more mature. For both in vitro and in vivo neuronal differentiation, achieving the appropriate balance between proliferation and differentiation is crucial for generating neurons with the desiredAttorney Docket No. 04843-0081W01
[0206] maturity and phenotype. Since Notch signaling plays a pivotal role in this process (Lathia et al., 2008; Louvi & Artavanis-Tsakonas, 2006), many laboratories, including ours, have utilized the modulation of Notch signaling by small molecule inhibitors (e.g., DAPT) (Song et al., 2020; Piao et al., 2021; Nolbrant et al., 2017; Ogura et al., 2013; Nelson et al., 2007). We investigated whether we can render D21 mDACs more mature by modifying DAPT treatment. To this end, we conducted a comparative assessment of three different conditions using the WA09 hESC line and the C4 hiPSC line derived from PD01 (referred to as PD01-04 in this study): short-term DAPT treatment (for 3 days from D12 to D15) with 21- or 28-day differentiation, and long-term DAPT treatment (for 9 days from D 12 to D21) with 21 -day differentiation.
[0207] As shown in FIG. 1 J, cell viability exceeded 90% on the harvest day across all three conditions for both cell lines. The short-term DAPT group with 28-day differentiation demonstrated sustained increases in cell numbers over time, consistent with our previous study (Song et al., 2020). Of note, the short-term DAPT D28 group, which displayed the highest cell numbers at harvest day, exhibited significant variations in final cell number (FIG. IK). In contrast, the long-term DAPT D21 group maintained stable cell numbers in both WA09 and PD01-04 cells compared to the short-term DAPT D28 group (FIG. IK). Moreover, the culture medium in the short-term DAPT D28 group continued to become acidic during differentiation, with a pH value of < 6.5, whereas the pH level remained stable in the D21 groups with both short- and long-term DAPT (FIG. IL). We then assessed the expression of mDAP and mDAN markers in differentiated cells. In most cell groups, approximately 90% of the total cells expressed mDAP markers, FOXA2 and LMX1A (FIG. IM). Interestingly, the proportion of tyrosine hydroxylase (TH)+cells reached similar levels (10-12%) in the long-term DAPT D21 and the short-term DAPT D28 groups in both WA09 and PD01-04 cells, whereas it was significantly lower (4-6%) in the short-term DAPT D21 group (FIG. IN).
[0208] Additionally, the proportion of Ki67+cells was significantly higher in the short-term DAPT D21 group compared to the other two groups in both WA09 and PD01-04 cells (FIG. IO)
[0209] To assess the in vivo efficacy, PD01-04 D21 mDACs treated with short- and longterm DAPT were transplanted into the striatum of unilaterally 6-OHDA lesioned athymicAttorney Docket No. 04843-0081W01
[0210] rats. Graft analysis data revealed significant smaller graft volumes in the long-DAPT D21 group compared to the short-term DAPT D21 group at 7 months post-transplantation (FIGs. IB, 1C) This observation aligns with data from both in vitro analysis and in vivo graft analysis indicating a decrease in Ki67+proliferating cells in the long-term DAPT group (FIGs. ID, IO). Analysis of the TH+cell numbers in the graft area revealed no significant differences between the short-DAPT and long-DAPT groups (FIGs. IE, IF).
[0211] However, the TH+fiber density was significantly higher in the long-DAPT group compared to the short-DAPT group, suggesting substantially greater innervation of grafted mDANs in the long-DAPT group to the host striatum (FIGs. IE, 1G).
[0212] Behavioral analysis using the rotation behavior test showed that the long-term DAPT treatment group exhibited faster behavior recovery compared to the short-term DAPT group (FIG. 1H), consistent with the in vitro data showing higher percentage of TH+cells (FIG. IN) as well as the in vivo data showing higher striatal TH+fiber density observed in the long-term DAPT treatment group (FIGs. IE, 1G). However, the short-DAPT group eventually showed complete recovery of rotation behavior as well (FIG. 1H) These results imply that long-DAPT treatment leads to more mature culture with a higher TH+fiber density and with fewer proliferating cells, compared to short-DAPT treatment, preventing graft overgrowth, and resulting in faster and more complete behavioral recovery. Furthermore, the increased neuronal outgrowth of grafted TH+cells in the long-DAPT group indicates enhanced integration and connectivity within the host striatum. In summary, our findings suggest that our modified D21 differentiation protocol with prolonged DAPT treatment, as depicted in FIG. II, offers a more reliable approach with adequate maturity of mDACs.
[0213] Example 2. Generation and characterization of clinical-grade hiPSC lines from three additional PD patients
[0214] For autologous CRT, it is essential to generate clinical-grade hiPSC lines from diverse PD patients. To this end, we endeavored to generate multiple hiPSC lines from skin biopsies of three additional sporadic PD patients (PD02-PD04; FIG. 1A) using our episomal reprogramming method (Song et al., 2020; Schweitzer et al., 2020). We successfully derived 8-12 individual hiPSC clones from each patient’s fibroblasts andAttorney Docket No. 04843-0081W01
[0215] analyzed their genomic integrity by cataloguing de novo somatic variants in selected hiPSC lines from PD01-PD04 relative to their source cells. For PD01, we previously performed sequencing analyses on both hiPSC lines and fibroblasts. Our previous decision to proceed with transplantation in our pilot study using the PD01-04 line was based on the finding that this line exhibited a low number of de novo somatic variants and lacked any nonsynonymous de novo variants and that its D28 mDACs did not contain any de novo somatic variations associated with cancer or neurodegenerative disorders (Song et al., 2020; Schweitzer et al., 2020). We investigated the genomic integrity of new hiPSC clones from PD02-PD04 at passage 10 by analyzing both the original fibroblasts and the resulting hiPSCs (Marks et al., 2019). Briefly, we identified de novo somatic variants in hiPSCs and focused on variants present in both the fibroblasts and hiPSCs, particularly those with variant allelic fractions below 35% in fibroblasts but exceeding 35% in hiPSCs. We primarily focused on Tier 1 cancer genes listed in the Cancer Gene Census of the Catalog of Somatic Mutations In Cancer database, particularly those with reported oncogenic transformation activities (Sondka et al., 2018). Additionally, reported disease-causing mutations (DM class) associated with neurodegenerative diseases were screened using the Human Gene Mutation Database (HGMD) (Stenson et al., 2020). For all de novo somatic variants in protein- coding genes, we categorized the putative functional impact as HIGH, MODERATE (MOD), and LOW, according to the classification provided by the Variant Effect Predictor (McLaren et al., 2016). We identified candidate clinical-grade clones from each patient (25, 26, and 30 from PD02; 40, 43, and 44 from PD03; 12, 25, and 28 from PD04) harboring no potentially harmful variants (Table 6).
[0216] We characterized their quality against release criteria, as detailed in Tables 7A-7C. They displayed hESC-like morphology and expressed pluripotency markers such as OCT4, NANOG, and SSEA4 at both mRNA and protein levels (FIGs.2A-2I).
[0217] Furthermore, quantitative reverse-transcription polymerase chain reaction (qRT-PCR) and hematoxylin and eosin (H&E) staining analyses confirmed effective differentiation of these hiPSC clones into all three germ layer lineages both in vitro and in vivo (FIGs.2J-20). Our findings underscore the capability of our reprogramming method to generate clinical-grade hiPSCs from diverse adult human fibroblasts. These selected clonesAttorney Docket No. 04843-0081W01
[0218] underwent further characterization, including bacterial growth (BacT / Alert), mycoplasma testing, fingerprint pattern analysis with their parental fibroblasts, detection of reprogramming plasmid DNA presence in their genomes, and evaluation of karyotype integrity (FIGs. 2P, 7A-7I; Tables 7A-7C). All candidate clones maintained an intact karyotype, except for one clone (PD04-28) which exhibited a chromosome 17 anomaly (FIG. 2P), leading to its exclusion from further analysis.
[0219] Next, we generated mDACs from these selected hiPSCs using our modified differentiation method (FIG. II) and assessed their potential for the midbrain fate according to the release criteria (Table 5). On Day 21 of in vitro differentiation, all mDACs derived from these candidate hiPSC clones exhibited mean delta Cq (ACq) values of less than 10 for mDAC markers (e.g., FOXA2, LMX1 A, TH; FIGs.3A-3C; Tables 7A-7C), whereas pluripotent hPSC markers (e.g., OCT4, NANOG; FIGs.3D-3F) showed ACq values greater than 10, highlighting the higher expression of mDAC markers and the effective loss of pluripotency in the PD02-PD04 clones. Additionally, qRT-PCR analyses confirmed the minimal expression of non-ventral midbrain (non-VM) marker genes, including forebrain (e.g., PAX6, SOX1, FOXG1) and hindbrain markers (e.g., HOXA2, NKX6.1), further supporting the midbrain-specific identity of the PD02-PD04 clones (FIGs. 7J-7L). Most mDACs expressed floor plate and midbrain markers (e.g., FOXA2, LMX1A) (FIGs.3G-3L), with over 80% of these cells exhibiting doublepositive staining (FIGs.3M-3O). Additionally, approximately 10% of total cells expressed TH (FIGs.3P-3R), indicating a clear mDAN identity. Notably, mDACs derived from the selected 8 hiPSC clones exhibited undetectable expression of pluripotency genes such as OCT4 and SSEA4 (FIG. 3S), indicating successful removal of undifferentiated hiPSCs through our protocol utilizing quercetin treatment (Song et al., 2020; Lee et al., 2013). Moreover, these cells did not express markers associated with serotonergic (e.g., tryptophan hydroxylase (TPH)) or noradrenergic neurons (e.g., dopamine b-hydroxylase (DBH)) (FIG.3S). Subsequently, we compared the viability of cryopreserved D21 -mDACs with their freshly prepared counterparts and found that the cryopreserved mDACs maintained viability levels exceeding 80%, like those of the freshly prepared ones (FIGs.3T-3Y). All mDACs tested negative for BacT / Alert and Gram staining and were endotoxin-free (<5.01 EU / mL) (Tables 7A-7C). In summary,Attorney Docket No. 04843-0081W01
[0220] seven out of nine candidate clones met all quality control (QC) criteria. PD02-25, PD03-44, and PD04-25 were finally selected to represent PD02, PD03, and PD04, respectively, for further studies (Table 6). All mDACs derived from these clones, like their parental hiPSC lines, exhibited intact karyotypes (FIG.3Z).
[0221] TABLE 5. Quality control release criteria and results
[0222] >
[0223] >
[0224]
[0225] Attorney Docket No. 04843-0081W01
[0226] >
[0227] >
[0228] <
[0229] <
[0230] >
[0231] >
[0232]
[0233] Attorney Docket No. 04843-0081W01
[0234] >
[0235] >
[0236] <
[0237] >
[0238] >
[0239]
[0240] TABLE 6. Number mutations of cancer genes and neurodegenerative disease genes identified in candidate clinical-grade clones from each patient
[0241]
[0242] Attorney Docket No. 04843-0081W01
[0243]
[0244] Attorney Docket No. 04843-0081W01
[0245]
[0246] TABLES 7A-7C. Quality control release criteria and results from PD02-PD04
[0247] TABLE 7A. Quality control release criteria and results from PD02
[0248]
[0249] Attorney Docket No. 04843-0081W01
[0250] >
[0251] >
[0252]
[0253] Attorney Docket No. 04843-0081W01
[0254] >
[0255] >
[0256] <
[0257] <
[0258]
[0259] > Attorney Docket No. 04843-0081W01
[0260] >
[0261] >
[0262] >
[0263] <
[0264] >
[0265] >
[0266]
[0267] TABLE 7B. Quality control release criteria and results from PD03
[0268]
[0269] Attorney Docket No. 04843-0081W01
[0270] >
[0271] >
[0272]
[0273] Attorney Docket No. 04843-0081W01
[0274] >
[0275] >
[0276] <
[0277] <
[0278]
[0279] Attorney Docket No. 04843-0081W01
[0280] >
[0281] >
[0282] >
[0283] >
[0284] <
[0285] >
[0286] >
[0287]
[0288] Attorney Docket No. 04843-0081W01
[0289] TABLE 7C Quality control release criteria and results from PD04
[0290] >
[0291] >
[0292]
[0293] Attorney Docket No. 04843-0081W01
[0294] >
[0295] >
[0296] < < < <
[0297] <
[0298]
[0299] Attorney Docket No. 04843-0081W01
[0300] >
[0301] >
[0302] >
[0303] >
[0304] <
[0305] >
[0306] >
[0307]
[0308] Attorney Docket No. 04843-0081W01
[0309] Example 3. GLP safety study shows that grafted PD01-04-mDACs confined to the brain with no adverse effects
[0310] We conducted a comprehensive evaluation of the safety profile of PD01-04-mDACs under GLP conditions, overseen by independent pathologists from an external contract research organization. Our experimental design adhered to regulatory recommendations, specifically focusing on biodistribution, toxicity, and tumorigenicity aspects, in line with recent pre-clinical studies of allogeneic CRT for PD (Piao et al., 2021; Doi et al., 2020; Kirkeby et al., 2023; Park et al., 2024). These studies were conducted over extended periods, ranging from 4 to over 39 weeks, to ensure thorough assessment of potential late-onset effects and comprehensive evaluation of safety and biodistribution.
[0311] Toxicity / Tumorigenicity study: For this study, we opted for the NOD.Cg-I>rkdc'c,dIL2rmIW]l / SzJ (NSG) mouse strain due to its extended lifespan and immunodeficiency characteristics. NSG mice are among the most immunodeficient (Shultz et al., 2007), facilitating the survival and maturation of human cells transplanted into the striatum within a xenogeneic environment. D21 mDACs from PD01-04 genotyping matched that of original fibroblasts and met all QC criteria (Table 5).
[0312] Cryopreserved D21 mDACs from PD01-04 were thawed and transplanted bilaterally after confirming the viability (>70%; typically, more than 80%) at a dosage of 100,000 cells per site. The GLP study duration was 274 days (approximately 39 weeks), with specific termination time points pre-established for various groups, as outlined in Table 8 (top). Various measures were recorded, including animal weights, hematological analyses, and clinical chemistry assessing various blood parameters (e.g., albumin, alkaline phosphatase, blood urea nitrogen, calcium, cholesterol, creatinine, glucose, phosphate, triglycerides, sodium, potassium, chloride, globulin). At 29 days, animals in groups 1 and 2 exhibited a modest weight increase in females receiving PD01-04-mDACs (Group 2) compared to female mice receiving the vehicle (Group 1 ; data not shown). However, at all other time points (85- and 274-days), no significant differences in weights were observed. Hematological analyses revealed no significant changes between groups throughout the study. Similarly, clinical chemistry results were comparable at all observed time points for both Group 1 and Group 2 males and females (data not shown).Attorney Docket No. 04843-0081W01
[0313] We performed microscopic evaluation of individual animals from each group based on H&E and hNuc staining. The Group 1 negative control animals were considered non-tumorigenic, as intended, based on the absence of human-origin cells in 5 / 5 male and 5 / 5 female animals at Day 29, in 5 / 5 male and in 5 / 5 female animals at Day 85, and in 5 / 5 male and 5 / 5 female animals at Day 274 (0.0% tumorigenicity; Group 1; FIGS. 4A, 4F).
[0314] Importantly, all mice receiving PD01-04-mDACs survived until Day 274 without tumor formation. Thus 5 / 5 male and 5 / 5 female animals at Day 29, in 5 / 5 male and 5 / 5 female animals at Day 85, and in 15 / 15 male and 12 / 12 female animals at Day 274 were free of tumors (0.0% tumorigenicity; Group 2 in FIG.4F). Histological sections of animals exhibited dense hNuc staining on Day 29, which gradually diffused by Days 85 and 274 (FIG. 4B). However, three (3 / 12 mice, 6 / 24 injection sites), five (5 / 19 mice, 7 / 38 injection sites), and all animals (10 / 10 mice, 20 / 20 injection sites) that were injected with 1% (Group 3; FIGs.4C, 4F), 10% (Group 4; FIGs.4D, 4F), and 100% hiPSCs (Group 5; FIGs.4E, 4F), respectively, developed tumors, leading to early termination.
[0315] Importantly, these teratomas were localized to the injection sites and did not appear in other tissues (refer to the Biodistribution Study below).
[0316] Biodistribution Study: For the biodistribution study, NSGmice received bilateral injections of D21 mDACs (100,000 cells per site) into the striatum and were monitored for up to 39 weeks as outlined in Table 8 (middle). Scheduled euthanasia were at 4, 12, and 39 weeks post- injection. Throughout the study, all animals experienced weight gain, with no discernible differences between those receiving vehicle (Group 1) and PD01-04-mDACs (Group 2) at each euthanasia point. At specified time points, Group 2 animals were euthanized, and brain slices from various areas were collected for analysis. Additionally, tissues were collected to assess potential cell migration (FIGs. 4G-4I). DNA extracted from these tissues and brain regions was quantified before performing qPCR, with the limit of quantitation set at 0.30303 genome copies per 1 mg of tissue DNA. As illustrated in FIGs. 4G-4I, human genomic DNA was exclusively detected in the brains of transplanted animals at 29, 85, and 274 days posttransplantation, indicating no migration of transplanted cells out of the CNS to major organs or the circulation. Thus, D21 mDACs used for autologous CRT pose no risk of cell redistribution to other body parts.Attorney Docket No. 04843-0081W01
[0317] Cell fate analysis: Cell fate analysis was conducted in animals receiving PD01-04-mDACs at 29- and 274 days post-transplantation in both brain hemispheres. Brain
[0318] samples were collected and analyzed for the expression of cell fate markers (Table 8;
[0319] bottom). All samples exhibited the presence of human-specific hNCAM+in the grafted region of the striatum, indicating the survival of transplanted cells (FIGs. 8 A, 8B). The graft sizes were notably larger in the Day 274 group (FIGs. 8A-8C). TH+neuronal
[0320] bodies were observed in the striatum, indicating the presence of mDANs within the
[0321] grafts, with higher counts in the Day 274 group compared to the Day 29 group (FIG.
[0322] 8E). Furthermore, TH+fiber density was markedly higher in the Day 274 group
[0323] compared to the Day 29 group (FIG. 8F). Volumetric analysis revealed a 10-fold
[0324] increase in graft volume between Day 29 (0.48 mm3) and Day 274 (4.88 mm3) (FIG.
[0325] 8C). Conversely, a decrease in the density of hNuc+cells was observed in the Day 274
[0326] grafts (FIG. 8D). This GLP study demonstrates that PD01-04-mDACs mature within the transplanted brain, giving rise to TH+neurons, as observed at Day 274. We noted a significant expansion of the graft volume (~10-fold) between Day 29 and Day 274, accompanied by a decrease in graft cell density. As examined by ALDH1 Al staining, approximately 70% of TH+cells appear to be A9-like dopamine neurons in the graft at
[0327] Day 274 post-transplantation (FIG. 8G).
[0328] Expression of the proliferation marker Ki67 was present in 2.95% of cells on Day
[0329] 29 but in few cells on Day 274 (FIG. 81). Staining for SOX1, PAX6, and Ki67 was also performed, as co-expression of these markers is associated with rosette formation,
[0330] indicative of proliferating cells. On Day 29, 0.021% of cells expressed all three proteins, but none were observed on Day 274 (FIG. 8J). Importantly, no cells expressing OCT4 were found in the grafted areas of both the Day 29 and Day 274 groups, supporting the
[0331] QC data that indicated an absence of this protein in D21 mDACs FIG. 8H).
[0332] TABLE 8. Results from Toxicity / Tumorigenicity Study, Biodistribution Study, Cell
[0333] fate analyses
[0334]
[0335] Attorney Docket No. 04843-0081W01
[0336]
[0337] Example 4. In vivo studies of Dll mDACs derived from PD02-25, PD03-44, and
[0338] PD04-25
[0339] We proceeded to assess the safety of mDACs derived from PD02-25, PD03-44,
[0340] and PD04-25 by transplanting them into the striatum of NSG mice. After validating their
[0341] QC criteria (Table 5, Tables 7A-7C), we transplanted 100,000 D21 mDACs into the
[0342] striatum of NSG mice, longitudinally examined safety properties, and performed graft analyses at 28 (FIGs. 9A-9L), 56 (FIGs. 10A-10M), and 274 days (FIG. 5) posttransplantation. Importantly, no tumor formation was observed in any mouse at any time point (total analyzed grafts = 63; 17 for PD02-25; 24 for PD03-44; 22 for PD04-25).
[0343] Furthermore, no OCT4+cells were detected in any transplanted mice at any time point
[0344] (FIGs. 5H, 51, 9G, 9H, 10H, and 101), demonstrating the absence of undifferentiated
[0345] and / or transformed cells in grafts and validating the safety of mDACs from all three
[0346] lines. Additionally, histological examination using H&E staining demonstrated the
[0347] absence of rosette structures in grafts up to day 274 (FIGs. 5A, 10A). As observed in the grafts of PD01-04-mDACs (FIGs. 8A-8L), longitudinal analysis revealed a gradual
[0348] increase in graft volume (FIGs. 5B, 5C, 9A, 9B, 10B, and 10C) and the number of TH+cells (FIGs. 5E, 5F, 9D, 9E, 10E, and 10F), and a concomitant decrease in cell density
[0349] and proliferative cells (e.g., Ki67+) (FIGs. 5D, 5J, 5K, 9C, 91, 9J, 10D, 10J, and 10K).Attorney Docket No. 04843-0081W01
[0350] PAX6 / SOXl / Ki67 triple-positive cells were undetectable in all grafts at 274 days posttransplantation, further suggesting the safety of these grafts (FIGs. 5L and 5M). To evaluate the potential presence of other cell types within the grafts, we conducted immunostaining using antibodies against Collagen Type I Alpha 1 Chain (COL1A1) and Transthyretin (TTR). COL1 Al+and TTR+cells represent vascular leptomeningeal cells and choroid plexus epithelial cells, respectively, and have been occasionally observed in mDAC grafts in previous studies (Liang et al., 2022; Tikiova et al., 2020). Our results show that in grafts from PD01-04, PD03-44, and PD04-25, COL1 Al+cells were initially detectable on day 28 but were greatly diminished by day 274 (FIG. 11 A). In contrast, grafts from PD02-25 exhibited a higher abundance of COL1A1+cells, which persisted until day 274. Notably, TTR+cells were absent in grafts from all lines throughout the observation period (FIG. 11C).
[0351] While our data confirmed the safety of these mDACs after transplantation into the striatum of NSG mice, significant variability was observed in graft behavior. Most notably, the graft volume and the total number of TH+cells of PD03-44 were substantially smaller than those of other grafts of PD01-04, PD02-25, and PD04-25 (FIGs. 5A-5M, 8A-8I, 9A-9L, 10A-10M). In addition, cell densities of PD03-44 grafts, as examined by hNuc+cells per mm3, were lower than other grafts at D28 and D56, but by D274 post-transplantation became similar across all lines (FIGs. 5D, 9C, and 10D).
[0352] To assess efficacy, we transplanted 100,000 mDACs from PD02-25 through PD04-25 into the striatum of 6-OHDA lesioned athymic rats and monitored rotation behavior every 4 weeks for up to 32 weeks post-transplantation. Importantly, consistent with our findings in NSG mice, no tumor formation or presence of OCT4+cells was detected in any grafts (total analyzed grafts = 20; 7 for PD02-25: 7 for PD03-44: 6 for PD04-25), confirming the safety of D21 mDACs across all three hiPSC lines (FIGs.6 J and 6K). Moreover, less than 0.5% Ki67+proliferative cells were observed in grafts from all three lines (FIGs. 6L and 6M), and no PAX6 / SOXl / Ki67 triple-positive cells were identified in these grafts (FIG. 6N). Consistent with the results observed in NSG mice, COL1 Al+staining demonstrated variable expression, with PD02-25 grafts showing higher levels. Similarly, TTR+cells were absent in any of the grafts from PD02-25 to PD04-25 (FIGs.
[0353] 11B and 11D). Rats receiving D21 mDACs from PD03-44 and PD04-25 exhibitedAttorney Docket No. 04843-0081W01
[0354] complete recovery in rotation behavior by 24 weeks post-transplantation and maintained this improvement thereafter (FIG. 6A), like rats receiving PD01-04-mDACs (FIG. 1H).
[0355] Strikingly, however, rats receiving PD02-25-mDACs did not show improvement in rotation behavior throughout the entire 32-week period post-transplantation. These results were unexpected given that PD02-25-mDACs demonstrated comparable or higher efficiency in generating TH+mDANs both in vitro following D21 differentiation (FIGs.
[0356] 3P-3R) and in vivo post-transplantation into the striatum of NSG mice (FIGs. 5E, 5F, 9D, 9E, 10E, and 10F). Despite smaller volumes, PD03-44-mDAC grafts contained significantly more TH+neurons (2,466 ± 373.2) compared to PD02-25 grafts (416.6 ± 6954) (FIGs.6B, 6C, 6E, and 6F) A notable discrepancy was observed in the significantly lower number of TH+neurons in PD02-25 grafts within 6-OHDA lesioned athymic rats compared to NSG mice (416.6 ± 69.5 vs 4,970 ± 945, respectively). This observation suggests that mDANs in PD02-25 grafts are more vulnerable in 6-OHDA lesioned athymic rats compared to the more immune-deficient NSG mice; however, the precise mechanisms underlying this difference require further investigation.
[0357] To elucidate why PD02-25-mDACs failed to improve rotation behavior, we systematically examined grafts from all rats 32 weeks post-transplantation. All grafts from the three lines showed a similar population of A9-specific dopaminergic neurons (FIGs. 6H and 61) PD02-25-mDAC grafts exhibited higher populations of Ki67+and PAX6 / SOXl / Ki67 triple-positive cells, compared to PD03-44 and PD04-25 at 28- and 56-days in NSG mice (FIGs. 91, 9K, 10J and 10L). Notably, although PD02-25-mDAC grafts exhibited larger volumes than those from PD03-44 and PD04-25, and human cell density was comparable (FIGs.6B-6D), they contained significantly fewer TH+dopamine neurons. Additionally, the TH+fiber density in the striatum of transplanted athymic rats was substantially lower in PD02-25 grafts, compared to PD03-44 and PD04-25 grafts (FIGs.6E-6G). Based on these observations, we speculated that TH+fiber density, rather than TH+cell number, may be a key determinant of functional efficacy. Indeed, re-examination of all grafts in NSG mice at Day 28, 56, and 274 posttransplantation revealed that TH+fiber density was significantly lower in PD02-25 compared to PD03-44 and PD04-25 across all time points (FIGs. 5E, 5G, 9D, 9F, 10E, and 10G).Attorney Docket No. 04843-0081W01
[0358] We subsequently performed RNA-seq analyses on hiPSC lines and their corresponding mDACs. To minimize variations arising from batch differences, RNA-seq was conducted using the same cryopreserved batches of mDACs that were used for transplantation studies in mice and rats. The transcriptomic analysis revealed significant and consistent gene expression changes during the differentiation process, which were observed across all patient samples despite inherent inter-patient variability, underscoring the robustness of our differentiation protocol. As expected, the expression of pluripotency markers (SOX2, OCT4, NANOG, MYC) was drastically reduced in mDACs compared to hiPSCs, whereas mDAP / mDAN markers (e.g., DDC, TH, GIRK2, TUJ1, LMX1A, FOXA2, EN1, and OTX2) were markedly increased. Notably, expression of non-VM markers showed variable and modest increases, consistent with observations in FIGs. 7J-7L. However, our data did not identify any marker(s) that could predict functional efficacy.
[0359] Example 5. Compromised genomic integrity and tumorigenicity of a hiPSC line derived from Coriell-banked fibroblasts
[0360] We next investigated whether hiPSCs from fibroblasts with extended passaging exhibit a distinct safety profile. We utilized Coriell ND35976 fibroblasts (CF) from a 63-year-old Caucasian male with sporadic PD to generate hiPSC lines. Following initial morphological characterization and pluripotent gene expression analysis, one clone, referred to as CF-hiPSC, was selected for further investigation. The CF-hiPSC line met initial QC criteria, demonstrating absence of episomal DNA, efficient expression of pluripotency markers OCT4 and SSEA4, and maintenance of intact karyotypes (FIGs. 12A, 12F, 12H, and 121). Subsequently, mDACs were generated from CF-hiPSCs, exhibiting a pathogen- and mycoplasma-free status, DNA fingerprinting matching, and intact karyotypes (FIGs. 12G and 12J). They also prominently expressed key mDAC marker genes, such as LMX1A, FOXA2, with no expression of TPH and DBH (FIGs. 12B-12D). However, a significant percentage of these mDACs (3.3%) exhibited OCT4 expression without SSEA4 expression (FIGs. 12B and 12E), suggesting cellular transformation rather than undifferentiated hiPSCs.Attorney Docket No. 04843-0081W01
[0361] Genomic analysis revealed the presence of de novo somatic variants in CF-hiPSCs compared to their source fibroblasts. Notably, variants in cancer-associated genes in the fibroblasts evolved into clonal variants in CF-hiPSCs (Tables 9A-9C).
[0362] Additionally, novel variants in genes like NOTCH2 and COL2A1 were identified.
[0363] Analysis of known cancer-associated variants present in both the fibroblasts and hiPSCs revealed a total of 58 variants, including 38 variants linked to cancer (Sondka et al., 2018), as listed in Table 9C. These variants exhibited a higher mutational burden compared to clinical-grade hiPSCs (PD01-04, PD02-25, PD03-44, PD04-25), including 9 HIGH and 22 MOD impact variants and 13 variants associated with neurodegenerative diseases (FIG. 12K; Tables 9A-9C). To assess the impact of compromised genomic integrity of the CF-hiPSC clone on safety, we conducted safety assessments under GLP conditions. D21 mDACs derived from CF-hiPSCs were transplanted into the striatum of NSG mice. The grafts from these mice showed the formation of rosettes and denser hNuc staining (FIG. 12L). Remarkably, all animals receiving CF-mDACs developed multipotent neoplasms composed of both neuronal and glial cell tumors (FIG. 12L). These tumors were observed in animals euthanized at both 29 and 85 days posttransplantation, leading to the euthanasia of the remaining animals at 180 days posttransplantation.
[0364] TABLE 9A. Cancer associated subclonal variants in Coriell ND35976 fibroblasts
[0365]
[0366] Attorney Docket No. 04843-0081W01
[0367] TABLE 9B. Cancer associated variants that were found in both Coriell ND35976 fibroblasts and CF-hiPSCs
[0368]
[0369] Attorney Docket No. 04843-0081W01
[0370]
[0371] Attorney Docket No. 04843-0081W01
[0372]
[0373] TABLE 9C. Cancer associated de novo variants in CF-hiPSCs
[0374]
[0375] Attorney Docket No. 04843-0081W01
[0376] &
[0377] &
[0378]
[0379] Attorney Docket No. 04843-0081W01
[0380] &
[0381]
[0382] Attorney Docket No. 04843-0081W01
[0383] &
[0384] &
[0385]
[0386] Attorney Docket No. 04843-0081W01
[0387] Discussion for Examples 1-5
[0388] A fundamental question in regenerative medicine centers on the feasibility of utilizing a patient's own cells to replace degenerated cells or tissue. The concept of personalized, or autologous, CRT gained momentum with the emergence of iPSC technology in 2006 (Yamanaka, 2020; Takahashi & Yamanaka, 2006). Given the selective degeneration of mDANs in the substantia nigra as the hallmark of PD (Kalia & Lang, 2015; Stoker & Barker, 2020; Meissner, 2011 ; Obeso et al., 2010; Poewe et al., 2017), personalized CRT holds significant potential as an intervention (Sonntag et al., 2018; Cha et al., 2023; Osborn et al., 2020; Schweitzer et al., 2021). In our pursuit of establishing hiPSC-based personalized CRT for PD, we previously developed core techniques, culminating in an autologous CRT intervention for a single sporadic PD patient without immunosuppression (Cha et al., 2017; Cha et al., 2021; Song et al., 2020; Kim et al., 2022; Lee et al., 2013; Schweitzer et al., 2020; Schweitzer et al., 2020). We now present rigorous standards of safety and efficacy that we advocate as important to interventions of this kind for Investigational New Drug (IND) submission and subsequent clinical translation, including GLP and non-GLP safety analyses of mDACs derived from clinical-grade hiPSC lines. Several key findings emerged, pertinent not only to personalized CRT for PD but also to the broader application in degenerative diseases.
[0389] To implement autologous CRT, it is imperative to validate the consistent generation of clinical-grade hiPSCs from diverse patient cohorts. Leveraging our improved episomal reprogramming method (Cha et al., 2017; Cha et al., 2021; Song et al., 2020), we successfully derived multiple hiPSC lines from the biopsied fibroblasts of four sporadic PD patients, identifying potential clinical-grade hiPSC lines from each patient. Comprehensive bioinformatics analyses confirmed the genomic integrity of these hiPSC lines, thereby ensuring their suitability for clinical translation. Moreover, all hiPSC lines exhibited pluripotent differentiation potential both in vitro and in vivo, robustly generating mDACs expressing mDA markers while devoid of pluripotent markers.
[0390] Addressing safety concerns, we conducted GLP studies of mDACs derived from PD01-04-hiPSCs. Ensuring the safety of CRT entails excluding undifferentiated hiPSCsAttorney Docket No. 04843-0081W01
[0391] and maintaining genomic integrity, devoid of tumor-associated mutations. Our comprehensive analysis of tumorigenicity, toxicology, and biodistribution data of PD01-04-mDACs supported their clinical viability and safety. Additionally, non-GLP studies of mDACs derived from PD02-PD04 confirmed their safety and efficient generation of TH+mDANs in vitro and upon transplantation into the striatum of NSG mice. In contrast, CF-hiPSCs derived from Coriell-banked fibroblasts exhibited alarming safety concerns. Although initially meeting QC criteria, OCT4 expression was observed in 3.3% of mDACs after in vitro differentiation. Furthermore, transplantation of CF-mDACs led to tumor formation in all recipient mice. Genomic analyses revealed significant mutational burdens in CF-hiPSCs, highlighting the nexus between genomic integrity and safety.
[0392] In clinical applications, the utilization of well-defined “clinical-grade” cell lines is paramount. However, establishing a standardized definition of such lines and their cell products remains a topic of debate within the scientific and clinical community. For instance, while many groups adhere to similar release QC criteria (Piao et al., 2021; Doi et al., 2020; Kirkeby et al., 2023; Park et al., 2024), consensus on defining clinical-grade hiPSCs remains elusive. Recent QC guidelines for clinical-grade hiPSCs, mandate karyotyping and residual vector testing, with WES / WGS being recommended on a voluntary basis for information purposes only (Sullivan et al., 2018). Despite this, we advocate for establishing standard criteria focusing on the genomic integrity of hPSC lines, given the escalating reports of genomic aberrations in both hESC and hiPSC lines. In a UK study of 25 clinical-grade hESC lines available from the EU Tissue and Cell Derivatives bank, four hESC lines exhibited culture-adapted microduplications on chromosome 20ql 1.21 at higher passages (Canham et al., 2015). Additionally, other studies discovered six mosaic mutations in TP53, potentially conferring a growth advantage, in five of hESC lines, including the widely used WA09 line, underscoring the necessity for rigorous and periodic monitoring of genomic integrity (Merkle et al., 2017; Baumann, 2017; Trounson, 2017). In our study, we have adopted a stringent monitoring strategy for somatic mutations in our previous (Song et al., 2020; Schweitzer et al., 2020) and current studies, utilizing WES / WGS with advanced bioinformatics pipelines. In sum, to ensure safety, we propose three key measures: (1) complete elimination ofAttorney Docket No. 04843-0081W01
[0393] undifferentiated cells, (2) maintenance of genomic integrity, and (3) absence of pluripotent marker expression post differentiation and transplantation (Table 5). Our safety objective is to ensure that grafts meeting these QC criteria pose no greater tumor risk than the spontaneous glioma incidence (Ostrom et al., 2014).
[0394] In autologous CRT, handling diverse patients presents a unique challenge, as individual variations in genetic background may influence the outcomes of reprogramming, differentiation, safety, and / or efficacy of the cells. Recent studies have underscored the significance of “genetic background” as a major contributor of hiPSC variation (Rouhani et al., 2014; Kyttala et al., 2016; Choi et al., 2015). In line with this notion, our in vivo analyses revealed significant inter-individual variability in the behavior of mDACs following transplantation, including graft volume, cell density, proliferation markers, and TH+cell numbers after transplantation. Notably, mDACs derived from PD02-25, unlike those from the other lines, failed to improve rotational behavior in athymic rats. This outcome was unexpected, as PD02-25 exhibited normal levels of TH+cells following in vitro differentiation and after their transplantation into NSG mice. To investigate the underlying mechanisms and identify potential biomarkers predictive of behavioral efficacy, we conducted cell fate and bulk RNA-seq analyses of hiPSCs and mDACs (at Day 21) from all four patients. However, we were unable to identify any specific marker gene(s) associated with PD02-25-mDAC’s inability to improve motor deficits in 6-OHDA lesioned rats. One notable finding was that the striatal TH+fiber density of PD02-25 grafts was significantly lower (<10% of the contralateral intact side) in both NSG mice and OHDA-lesioned athymic rats compared to grafts from PD01-04, PD03-44, and PD04-25. These data suggest that PD02-25 grafts exhibit a significant deficiency in their ability to mature and innervate the host brains, despite a sufficient number of TH+cells. While the underlying mechanisms require further investigation, we have incorporated this as a key criterion for assessing efficacy in our proposed release QC criteria (Table 5). In our clinical trial, for patients like PD02, we plan to identify additional clinical-grade hiPSC lines that may pass all QC criteria.
[0395] Alternatively, allogeneic cell transplantation will also be considered if necessary.
[0396] Since the cells used in our autologous approach are derived from PD patients, it is crucial to assess potential signs of PD pathology in the grafts post-transplantation. ToAttorney Docket No. 04843-0081W01
[0397] address this, our previous study conducted long-term safety and efficacy evaluations of the PD01-04 hiPSC line, comparing it to non-PD WA09 hESC-derived mDACs (Song et al., 2020). This study demonstrated that both PD patient-derived and non-PD WA09 hESC-derived mDACs exhibited comparable efficacy and safety, with no pathological findings. While neither our previous nor current studies identified clear pathological findings after transplantation into the striatum of 6-OHDA-lesioned athymic rats, we cannot rule out the possibility that PD patient-derived mDAC grafts could develop PD-related pathology in other animal models, such as a-synuclein models. This concern may be more pronounced when extending autologous cell therapy to familial PD patients. Therefore, the potential for PD pathology in autologous cell therapy remains a critical issue that requires further investigation.
[0398] In summary, our data supports the feasibility of personalized CRT for PD, achieved through the generation of clinical-grade hiPSCs and mDACs from most freshly biopsied fibroblast cells, in accordance with our proposed release QC criteria. Building upon these promising results, we received FDA approval in October 2023, and are currently preparing to implement this therapy in treating eight sporadic PD patients. However, individual genetic variability may lead to differences in behavior and functional efficacy among mDAC grafts, underscoring the need for further optimization of each step of the autologous CRT process. The clinical outcomes of these initial trials are anticipated to provide invaluable insights, enhancing the reliability and benefit of future interventions for a broader population of PD patients.
[0399] The study was meticulously designed to compile a comprehensive data package aimed at meeting regulatory requirements in the United States, spanning from pre-IND to post-IND stages, primarily focusing on ensuring the safety and efficacy of autologous CRT for PD patients. Our findings demonstrated that multiple hiPSC lines can be successfully derived from the biopsied fibroblasts of each of the four patients tested in this study, identifying potential clinical-grade hiPSC lines from each patient.
[0400] Comprehensive bioinformatics analyses confirmed the genomic integrity of these hiPSC lines, thereby ensuring their suitability for clinical translation. Additionally, the hiPSC-derived mDACs from each patient exhibited satisfactory in vitro differentiation into mDA neuronal identity. However, after transplantation, the cells displayed significantAttorney Docket No. 04843-0081W01
[0401] variability in behavior, including differences in graft volume, cell density, proliferation markers, and TH+cell numbers. Most strikingly, mDACs derived from one (PD02) of four patients, unlike those from the other patients, failed to improve rotational behavior in athymic rats, highlighting the variability in their potential to address motor dysfunction. Despite extensive efforts, including cell fate and bulk RNA-seq analyses, we failed to identify any clear marker gene(s) that could predict the capacity to improve motor deficits in 6-OHDA lesioned rats. Since it is impractical to conduct full scale behavioral recovery assessments in animal models for every patient, further investigation is essential to identify reliable marker gene(s) that can predict therapeutic efficacy. Notably, we found that PD02-25 grafts contained significantly lower TH+fiber density in both NSG mice and 6-OHDA-lesioned rats compared to grafts from PD01-04, PD03-44, and PD04-25. Based on this finding, we incorporated TH+fiber density as a release criterion for efficacy assessment. As this criterion is not yet approved by regulatory authorities, we plan to engage with the FDA to seek its approval. Moreover, given the limited number of patients in our study (n = 4), additional investigation is needed to confirm the reliability of TH+fiber density as an efficacy marker. Overall, our study emphasizes the need for continued research to better understand the inter- individual variabilities of patient-derived cell products.
[0402] Another critical challenge in CRT of PD is ensuring the efficient survival of grafted mDACs in both autologous and allogeneic approaches. We recently uncovered that the surgical procedure itself (referred to as needle trauma) induces a substantial host immune response, compromising the survival of implanted TH+neurons and that cotransplantation of autologous Treg cells significantly enhances their survival (Park et al., 2023). While the addition of autologous Tregcells has the potential to improve CRT outcomes, it is not yet included in our current FDA-approved protocol. Therefore, future studies should thoroughly investigate these factors to better understand their impact and inform future interventions.
[0403] In addition to scientific challenges, our study underscores the significant financial barriers associated with autologous cell therapy. Currently, the costs of personalized cell therapy are considerably higher than those of allogeneic approaches, necessitating strategic planning to ensure both sustainability and accessibility of these treatmentAttorney Docket No. 04843-0081W01
[0404] options. To render this approach affordable for a broader patient population, substantial research efforts are required to optimize and automate all or most parts of the cell manufacturing process. Alternatively, tailored therapeutic strategies, including autologous, human leukocyte antigen (HL A) -matched, and allogeneic approaches, may need to be considered based on individual patient factors such as genetic background and personal preferences (Schweitzer et al., 2021).
[0405] Materials and Methods for Examples 1-5
[0406] Key resources
[0407] &
[0408] & &
[0409]
[0410] Attorney Docket No. 04843-0081W01
[0411] &
[0412]
[0413] Attorney Docket No. 04843-0081W01
[0414] &
[0415]
[0416] Attorney Docket No. 04843-0081W01
[0417] "
[0418]
[0419] Animals and housing conditions for GLP safety study
[0420] The GLP safety study on toxicology, tumorigenicity, and biodistribution study was conducted at WuXi AppTec. in St. Paul, MN. All animal experiments were approved by the Institutional Animal Care and Use Committee (IACUC) of WuXi AppTec, in accordance with NIH guidelines.
[0421] Upon arrival, the animals underwent an acclimatization period of at least 5 days within a designated animal room and individually housed in sterile microisolator cages equipped with sterile contact bedding. The environmental conditions of the animal room, including temperature, relative humidity, and photo-period, were regulated according to NIH recommendations for this species as stipulated in the “Guide for the Care and Use of Laboratory Animals”. The relative humidity was maintained within a range of 30-70% and the temperature was kept between 20-22°C (68-72°F). The animals were supplied with irradiated feed ad libitum and were provided with autoclaved mouse huts, igloos, or sterile manipulatives as environmental enrichment. Prior to cell transplantation, animals were weighed and systemically assigned to groups, separating males and females. ToAttorney Docket No. 04843-0081W01
[0422] reduce observational bias, group numbers were omitted from data collection worksheets and cage cards. Identification of individual animals was maintained through microchipping from the day of cell transplantation.
[0423] Animals and housing conditions for non-GLP safety and efficacy study
[0424] The non-GLP safety and efficacy study was conducted in the laboratory of Kwang-Soo Kim at McLean Hospital. Animal studies were performed in accordance with current NIH guidelines and McLean Hospital / Harvard University IACUC protocols (2015N000001 and 2015N000002). The study involved specific animal strains: athymic rats with 6-OHDA lesions
[0425]
[0426] Taconic Biosciences), males aged 12 to 14 weeks, and Nod Scid Gamma mice NOD.Cg-PrkdcscldIl2rfmlWjl / SzJ, The Jackson Laboratory, strain code 005557), males and females aged 8 to 10 weeks. All animals were housed in ventilated cages on a 12-hrs light / dark cycle and had ad libitum access to sterile food and water throughout the study. To minimize observational bias, the experimenters were blinded to group assignments, and group numbers were excluded from data collection worksheets and cage cards. Randomization was applied to animal groupings.
[0427] Cell Lines
[0428] All human iPSC lines except CF-hiPSC were generated from fibroblasts derived from skin biopsies of patients. All participants provided written informed consent, approved by the institutional review board at Massachusetts General Hospital. This consent included a detailed explanation of the study's purpose, procedures, risks, and potential benefits, ensuring participants were fully informed before agreeing to participate. The sporadic PD patients consisted of: PD01 a 68-year-old Hispanic male, PD02 a 64-year-old White male, PD03 a 53-year-old White female, and PD04 a 68-year-old White male at the time of biopsy. CF-hiPSCs were generated from ND35976 human fibroblasts, sourced from the Coriell Institute, originating from a 63 -year-old White male with sporadic PD. WA09 hESC line was obtained from WiCell Institute (Madison, WI) and is not listed in the International Cell Line Authentication Committee (ICLAC) Register of Misidentified Cell Lines or the NCBI Biosample database of misidentifiedAttorney Docket No. 04843-0081W01
[0429] cell lines. All cell lines were routinely tested for mycoplasma detection using a Venor GeM Mycoplasma Detection Kit (Sigma- Aldrich).
[0430] Fibroblast culture from patient ’s skin biopsy
[0431] A single 3 -mm skin punch biopsy obtained from a patient was divided into 6-12 equal-sized segments and dissociated with collagenase B (2 U / mL) for up to 6 hrs. The resultant small tissue clumps were plated onto a fibronectin- coated well of a 12-well plate containing tissue transport medium (DMEM, 15% FBS, NEAA, and 100 U / mL penicillin-streptomycin). Two days later, the cells were fed with fibroblast medium (DMEM, 15% FBS, IX NEAA, and 55 pM 0-ME) every other day until fibroblasts started to migrate out of the tissue clumps. Fibroblasts outgrowths were monitored and fed every other day until they reached confluence and were passaged using TryPLE for further expansion and subsequent reprogramming into hiPSCs.
[0432] Human iPSC generation
[0433] Fibroblasts were electroporated with non-genome integrating episomal vectors encoding the Yamanaka four factors (OCT4, SOX2, KLF4, L-MYC) alongside episomal vectors encoding metabolic reprogramming microRNAs (miR-302s and -200c) using the Neon transfection system, with specific electroporation parameters (pulse voltage:
[0434] 1,650V; pulse width: 10 ms; pulse number: 3). Following electroporation, the transfected cells were gently mixed with 5 mL of pre- warmed fibroblast medium supplemented with 10 pM Y-27632 followed by plating of 1 mL aliquots of the cell suspension onto Matrigel-coated 6-well plates with 1 mL of the same medium. Starting the next day, the cells were fed with 3 mL of either Essential 8 medium or NUTRISTEM® hPSC XF medium, supplemented with 1 mM NAM, 500 pM NaB, and 200 pM AA daily until appearance of ESC-like colonies. The observed ESC-like colonies were handpicked and transferred onto Matrigel-coated 24-well plates in Essential 8 medium or NUTRISTEM® hPSC XF medium with 10 pM Y-27632 to establish hiPSC lines. The cells were routinely maintained, passaged, and cryopreserved at 5 -passage intervals up to passage 20. For cryopreservation, cells were dissociated with 0.5 mM EDTA solution, resuspended in cell freezing medium at 1 million cells per mL, consisting of eitherAttorney Docket No. 04843-0081W01
[0435] Essential 8 medium or NUTRISTEM® hPSC XF medium supplemented with 10% DMSO. Subsequently, the cells were aliquoted into cryovials and stored in a temperature-monitored vapor-phase nitrogen tank at McLean Hospital, constituting the master cell bank.
[0436] In vitro differentiation ofhiPSCs to mDACs
[0437] Clinical-grade hiPSCs were thawed and cultured on Matrigel-coated 6-cm cell culture dishes in either Essential 8 medium or NUTRISTEM® hPSC XF medium. On day 0 of differentiation, a grid with 2 horizontal and 3 vertical lines was drawn on the bottom of new 6-cm dishes yielding 6 junctions and 10 pL of Matrigel was loaded at each junction to make a limited spot-coated area. Spotted dishes were incubated at 37°C for at least 30 min. hiPSCs were dissociated using Accutase and seeded onto these spotted dishes at 10,000 cells per 10 pL spot in Essential 8 medium or NUTRISTEM® hPSC XF medium, supplemented with 10 pM Y-27632. For the floor plate induction stage (days 1-5), the cells were fed with DMEM medium supplemented with 15% KSR, GlutaMAX, 0-ME. For the neural precursor induction stage (days 6-11), cells were fed with DMEM medium supplemented with 11.5% KSR, 0.25% N2 (days 6-7), 7.5% KSR, 0.5% N2 (days 8-9), 3.75% KSR, 0.75% N2 (days 10-11) including GlutaMAX, 0-ME and NEAA. Dual SMAD inhibitors, 200 nMLDN193189 and 10 pM SB431542 were added from days 1-11 and days 1-7, respectively. From days 2 to 9, the cells were treated with 100 ng / mL SHH, 100 ng / mL FGF8, and 2 pM Purmorphamine. Additionally, 1 pM CHIR99021 was added from days 4-11. On day 9, the cells were treated with 40 pM quercetin for 16 hrs. For the mDAPs induction and maturation stage (days 12-20), the cells were fed with DMEM / F12 medium supplemented with N2, 20 ng / mL BDNF, 20 ng / mL GDNF, 1 ng / mL TGF03, 500 pM dbcAMP, 200 pM AA, and 10 pM DAPT, with 1 pM CHIR99021 added on days 12-14. On day 15, cells were dissociated with Accutase, and a single-cell suspension was plated onto poly-L-ornithine / fibronectin / laminin-coated 6-cm dishes at a density of 3 million per dish. On day 21, cells were dissociated with Accutase, collected in cryogenic vials containing 3 million cells in 1 mL of CS10 cryopreservation medium, and stored in a temperature-monitored vapor-phase nitrogen tank at McLean Hospital. Cell viability prior to freezingAttorney Docket No. 04843-0081W01
[0438] and post-thaw was assessed using an acridine orange / propidium iodide staining solution (Aligned Genetics, Gyeonggi-do, South Korea) on a LUNA-FX7 automated cell counter (Aligned Genetics).
[0439] Whole genome sequencing (WGS) / whole exome sequencing (WES)
[0440] To assess somatic mutations that may occur during the derivation and passaging of fibroblasts and hiPSCs, and during the differentiation of mDACs, WGS / WES on these cell types were performed by Novogene using Agilent’s protocols for whole-genome and whole-exome captures, along with library preparation. The mean depth of coverage exceeded 40x for WGS and lOOx for WES across all samples. We performed paired analyses to identify somatic mutations in the hiPSCs and mDACs relative to the parental fibroblasts using MuTect2. Sequencing reads were aligned to the GRCh38 reference genome, which includes alternative contigs and decoys, employing a standard analytical pipeline (BWA-MEM and GATK-HC as implemented in bcbio-nextgen (https : / / bcbio-nextgen.readthedocs.io / en / latest / )). We also used the following annotation engines: snpEff (http: / / pcingola.github.io / SnpEff / ) and OpenCravat (https: / / opencravat.org / ). We then scrutinized whether loss-of-function or missense mutations in COSMIC Tier 1 cancer-related genes are detected in hiPSCs and mDACs. Furthermore, we examined whether somatic mutations were present in genes associated with neurodegenerative disorders, including PD and the dopamine biosynthesis pathway, referencing the Human Gene Mutation Database (HGMD) Professional version 2018.2 and the ClinVar database. Additionally, somatic mutation candidates were visually inspected in the Integrative Genomics Viewer to exclude potential false positives.
[0441] qRT-PCR
[0442] Total RNA was extracted from the cells using the Direct-zol RNA MiniPrep Plus kit (Zymo Research), and RNA concentration was determined with a Nanodrop ND-2000 spectrophotometer (NanoDrop Technologies). cDNA synthesis was carried out on a T100™ Thermal Cycler using the iScript cDNA Synthesis Kit (Bio-Rad Laboratories). Quantitative analyses were conducted via qRT-PCR using the SsoAdvanced SYBR Green supermix (Bio-Rad Laboratories), and PCR reactions were performed on a CFXAttorney Docket No. 04843-0081W01
[0443] Connect Real-Time System (Bio-Rad Laboratories) using gene-specific primers. Gene expression levels were quantified relative to the 0-actin gene as a reference. Relative gene expression was calculated using the AACq method with the following steps: 1) ACq = Cq (gene of interest) - Cq (0-actin, reference gene); 2) AACq = ACq (experimental sample) -ACq (control sample); 3) Fold change = 2'AACq. The primers used in this study are listed in Table 10.
[0444] RNA-seq and data analysis
[0445] Total RNA was extracted with the Direct-zol RNA MiniPrep Plus kit (Zymo Research), and library preparation and sequencing were performed by Genewiz (Azenta Life Science). Briefly, total RNA samples were quantified using a Qubit 2.0 Flurometer (Thermo Fisher), and RNA integrity was assessed with a 4200 TapeStation (Agilent Technologies). RNA sequencing libraries were constructed using the NEBNext Ultra II RNA Library Preparation Kit for Illumina, following the manufacturer’s recommendations. The libraries were multiplexed, clustered on the flowcell, and loaded onto the Illumina NovaSeq X Plus instrument according to the manufacturer’s instructions. Sequencing was performed using a 2x150 pair-end configuration. The quality of the raw reads was evaluated using FastQC (vO.11.5). The sequencing reads were aligned to the human reference genome GRCh38 using the 2-PASS STAR algorithm (v2.7.9a). HTSeq-count (v2.0.9) was employed to generate raw counts for each transcript according to the Gencode transcript models (release 44). Differentially expressed genes between iPSC lines and mDACs samples were analyzed using paired Wald test on normalized count data using DESeq2 R package.
[0446] Immunocytochemistry
[0447] Cells were washed with PBS and fixed with 4% formaldehyde for 10 min. After treating for 1 hr with blocking solution (PBS containing 0.3% Triton X-100 and 1% horse serum), cells were incubated overnight at 4°C with primary antibodies. Next day, cells were washed three times with a washing solution (PBS containing 0.1% Triton X-100) and incubated for 1 hr with appropriate fluorescence-conjugated secondary antibodies. After washing three times with washing solution, cells were stained with Hoechst 33342Attorney Docket No. 04843-0081W01
[0448] for nuclear visualization for 5 min. Cell images were captured using fluorescence microscopy (Keyence, Osaka, Japan). Data regarding specific cell populations were analyzed from the microscopic images using ImageJ software.
[0449] Episomal plasmid detection
[0450] Genomic DNA was extracted using the DNeasy Blood & Tissue Kit (Qiagen) and PCR amplification was performed using EBNA1 -specific primers over 30 cycles with the following thermal profile: 95°C for 30 sec, 55°C for 30 sec, and 72°C for 30 sec. The sequences for the EBNA1 primers are listed in Table 10.
[0451] DNA fingerprinting
[0452] PCR amplification of genomic DNA was conducted using GOTAQ® DNA polymerase over 35 cycles with the following conditions: denaturation at 95°C for 30 sec, annealing at 55°C for 30 sec, and extension at 72°C for 1 min. The primers used in this study are detailed in Table 10.
[0453] Karyotype analysis
[0454] To assess copy number variations, a minimum of 2 million cells were harvested, and the resultant frozen cell pellets were submitted to Thermo Fisher (Madison, WI) for analysis using the KARYOSTAT+™ assay.
[0455] Cell preparation for transplantation
[0456] To avoid batch-to-batch variation in our in vivo studies using NSG mice and 6-OHDA-lesioned athymic rats, we performed in vitro differentiation on a large scale to generate mDACs. We then prepared and cryopreserved sufficient vials of D21 mDACs for all hiPSC lines (i.e., PD01-04, PD02-25, PD03-44, and PD04-25) used in the study. Cryopreserved D21 mDACs were thawed in a Lab Armor bead bath (Sheldon Manufacturing) and resuspended in transplantation medium composed of DMEM / F12 (without phenol red), supplemented with 20 ng / mL BDNF, 20 ng / mL GDNF, 10 pM Y-27632, and 20 mM Boc-D-FMK. After centrifugation at 300 x g for 5 min, the cell pellets were resuspended in LR solution (Thermo Fisher) to achieve concentrations of 50,000 orAttorney Docket No. 04843-0081W01
[0457] 100,000 cells / pL. During the transplantation procedure, cells were kept at 2-8°C for up to 2 hrs.
[0458] Surgical procedure
[0459] Animals were anesthetized using isoflurane with a SomnoSuite Anesthesia System (Kent Scientific Corporation, Torrington, CT). Stereotaxic procedures were performed using a stereotaxic apparatus (David KOPF Instruments, Tujunga, CA) equipped with a Micro4 controller (World Precision Instruments, Sarasota, FL). In athymic rats, unilateral lesions targeting the nigrostriatal pathway were induced by the stereotaxic administration of 6-OHDA into the medial forebrain bundle. Desipramine (10 mg / kg) was administered to the rats 15 min prior to anesthesia to protect noradrenergic projections. A total of 2 pL of 6-OHDA solution (7.5 mg / mL in 0.2% ascorbic acid and 0.9% saline) was delivered using a 10 pL Hamilton syringe (Hamilton Company, Reno, NV). Injection coordinates were determined with respect to bregma: antero-posterior (AP), -4.0; medio-lateral (ML), -1.3; and dorsoventral (DV), -7.0. For intra-striatal transplantation of D21 mDACs in athymic rats, a single deposit of 2 pL (50,000 cells / pL) was positioned at the following coordinates: AP, +0.8; ML, -3.0; and DV, -5.5. The cells were injected using a 10 pL Hamilton syringe equipped with a blunt 26G, 0.75-inch needle at a rate of 0.4 pL / min. For striatal injections in Nod Scid Gamma mice, a single deposit of 2 pL (50,000 cells / pL) of both hiPSCs and mDACs was administered bilaterally into the striatum at the following coordinates relative to bregma (in mm): AP +0.5; ML - / +1.8; DV -3.2. Following injection, the needle was left in place for 5 min and then gradually withdrawn over another 5 min. Following surgery, the incisions were closed with AUTOCLIP® Surgical Suture (Fine Science Tools, Foster City, CA), and animals were maintained on a warm pad for monitoring until they regained consciousness. To alleviate discomfort, all animals received Ketoprofen (5 mg / kg) subcutaneously and 1 mL of 0.9% sodium chloride intraperitoneally for hydration. For Nod Scid Gamma mouse testes injections, a 1 cm longitudinal incision was made through the skin and peritoneum, exposing the testes on sterile gauze. Carefully avoiding major blood vessels, 10 pL (5,000 cells / pL) of hiPSCs were slowly injected into the testisAttorney Docket No. 04843-0081W01
[0460] capsules. The needle was removed gently to avoid cell reflux, and the testes and fatty tissue were repositioned within the abdomen.
[0461] D-Amphetamine induced rotation test
[0462] D-Amphetamine, functioning as an indirect presynaptic dopamine agonist, was administered intraperitoneally (4 mg / kg for rats, 5 mg / kg for mice) to induce rotational behavior in animals that were effectively lesioned with 6-OHDA. Rotational behavior was monitored and recorded for either 30 or 90 min using an automated Rotometer system (San Diego Instruments, San Diego, CA). Full body rotations towards the lesioned side were counted as a positive value, and only those animals exhibiting six or more net ipsilateral rotations per minute were classified as successfully lesioned.
[0463] Biodistribution test
[0464] To evaluate the safety of D21 mDACs for clinical use, biodistribution tests were performed under GLP conditions by WuXi Apptec (St. Paul, MN). Tissues including sternum (bone marrow), brain, heart, kidneys, liver, lungs, axillary lymph nodes, spleen, cervical spine, thoracic spine, lumbar spine, and whole blood were collected from animals in the GLP safety study during scheduled necropsies and were subsequently frozen. Genomic DNA was extracted from each frozen tissue sample, and qPCR analyses for human Alu-specific sequences were performed in technical triplicates to detect the presence of human DNA. For larger tissues, a randomly selected portion of the homogenized whole tissue was processed for DNA extraction. For brain tissue, 4 mm biopsies (2 mm x 2 mm x 2 mm portions) from the right and left hemispheres at the injection sites were taken for DNA extraction and qPCR analysis. Tissues from naive animals (2 males and 2 females) were used for the validation study and the requirements of DNA yield as well as the lowest non-interference dilution (evaluated by spiking with 50 genome copies of positive control from donor cells) were determined. At the lowest non-interference dilution, the absence of quantifiable amount of target DNA in the DNA isolated from each tissue was confirmed (less than the Limit of Quantification, LOQ) in qPCR assay. The LOQ was determined to be approximately 0.30303 genome copies, andAttorney Docket No. 04843-0081W01
[0465] the positive threshold was calculated using the following formula: 0.30303 genome copies / pg x dilution factor.
[0466] Brain sectioning and immunohistochemistry
[0467] Deep anesthesia was induced through an intraperitoneal injection of Ketamine (100 mg / kg) and Xylazine (10 mg / kg), followed by an intracardial perfusion with ice-cold PBS (0.01M, pH 7.4) for 8 min, succeeded by a perfusion with a 4% formaldehyde solution for 20 min, at a flow rate of 10 mL / min. Subsequently, brains were extracted and post-fixed overnight in 4% formaldehyde solution at 4°C, and then cryopreserved by successive incubations in 30% sucrose. The brains were embedded in Tissue-Tek® O.C.T. compound (Sakura Finetek, Torrance, CA), and coronal sections (30 pm) encompassing the entire striatum were serially collected using a Leica CM1950 cryostat (Buffalo Grove, IL). Brain slices were pre-incubated in a blocking solution containing 1% normal horse serum and 0.3% Triton X-100 in PBS at room temperature for 1 hr. After pre- incubation, brain slices were incubated overnight with rabbit anti-TH antibody (1:2,000) and mouse anti-hNuc antibody (1:1,000). Following rinsing, the samples were stained with a biotinylated secondary antibody (Vector Labs) for 1 hr, and then visualized using the VECTASTAIN® ELITE® ABC-HRP kit and the DAB peroxidase substrate kit, as per manufacturer's instructions. For quantification of TH+neurons within the grafts, the optical fractionator probe of the Stereo Investigator (MBF Bioscience, Williston, VT) was employed under a 63X oil lens, with a counting frame of 50 x 50 pm and a grid size of 200 x 200 pm. Final counts were adjusted for series number (1:6 - 1 : 12) to estimate the total number of TH-positive neurons per animal brain.
[0468] Brain sections and immunofluorescence
[0469] Coronal sections of entire midbrain were prepared as free-floating sections and incubated for 1 hr at room temperature in a blocking solution containing 1% normal horse serum and 0.3% Triton X-100 in PBS. Primary antibodies diluted in the blocking solution were applied at 4°C overnight. After three washes with PBS containing 0.1% Tween 20, sections were incubated with secondary antibodies conjugated to Alexa 488, Alexa 568, or Alexa 647 - diluted as per the primary antibodies - for 2 hrs at room temperature. AllAttorney Docket No. 04843-0081W01
[0470] sections were counterstained with Hoechst 33342, washed three additional times, mounted with a cover slip using mounting media, and examined with a fluorescence microscope (KEYENCE, Osaka, Japan). For negative controls, sections stained solely with secondary antibodies were processed under identical conditions and imaged for comparison.
[0471] Dopaminergic (TH+) fiber density analysis
[0472] To quantify dopaminergic fiber density, brain sections from grafted striatal regions were subjected to tyrosine hydroxylase (TH) immunostaining using the avidinbiotin complex method with diaminobenzidine (TH-ABC-DAB). Bright-field microscopy (Keyence, Osaka, Japan) was used to capture images from randomly selected areas on both the grafted and intact sides. Images were analyzed with ImageJ software by inverting the images and measuring the intensity of the brown DAB staining. Fiber density in the grafted striatum was determined by subtracting the background intensity from the measured TH+signal. This value was then normalized to the TH+fiber density of the intact side on the same section, which was set at 100%. The resulting data were expressed as a percentage of the intact side’s fiber density.
[0473] Hematoxylin and eosin staining
[0474] For the pathological examination of Nod Scid Gamma mouse testes and brain tissues, each mouse was anesthetized with Ketamine / Xylazine, and the testes were promptly excised and temporarily preserved in a 4% formaldehyde solution. For the analysis of Nod Scid Gamma mouse brain tissue, every sixth coronal section encompassing the entire striatum was mounted on glass slides. Subsequently, the glass slides containing both testes and brain tissues were dispatched to the Rodent Histopathology Core at Harvard Medical School, Boston, MA, for Hematoxylin and Eosin staining.
[0475] Quantification and statistical analysis
[0476] All experiments were conducted in biological triplicate, unless specified otherwise. Details regarding the number of samples (n) and the statistical tests applied forAttorney Docket No. 04843-0081W01
[0477] each figure panel are available in the figure legends. Statistical analyses were conducted using GraphPad Prism 10 software, with a value of p < 0.05 considered to be statistically significant. Mutation data were analyzed and visualized using R, with p-values derived from a two-sided binomial test and adjusted via Bonferroni correction.
[0478] TABLE 10. Exemplary Primers used in Examples 1-5
[0479]
[0480] Attorney Docket No. 04843-0081W01
[0481]
[0482] References for Examples 1-5
[0483] 1. Bloem, B.R., Okun, M.S. & Klein, C. Parkinson's disease. Lancet 397, 2284-2303 (2021).
[0484] 2. Kalia, L.V. & Lang, A.E. Parkinson's disease. Lancet 386, 896-912 (2015).
[0485] 3. Stoker, T.B. & Barker, R.A. Recent developments in the treatment of Parkinson's Disease. FlOOORes 9 (2020).
[0486] 4. Meissner, W.G. et al. Priorities in Parkinson's disease research. Nat Rev Drug Discov 10, 377-393 (2011).
[0487] 5. Obeso, J. A. et al. Missing pieces in the Parkinson's disease puzzle. Nat Med 16, 653-661 (2010).
[0488] 6. Poewe, W. et al. Parkinson disease. Nat Rev Dis Primers 3, 17013 (2017).
[0489] 7. Lindvall, O. & Bjorklund, A. Cell therapeutics in Parkinson's disease.
[0490] Neurotherapeutics 8, 539-548 (2011).
[0491] 8. Parmar, M., Grealish, S. & Henchcliffe, C. The future of stem cell therapies for Parkinson disease. Nat Rev Neurosci 21, 103-115 (2020).
[0492] 9. Sonntag, K.C. et al. Pluripotent stem cell-based therapy for Parkinson's disease:
[0493] Current status and future prospects. Prog Neurobiol 168, 1-20 (2018).Attorney Docket No. 04843-0081W01
[0494] 10. Barker, R.A., Drouin-Ouellet, J. & Parmar, M. Cell-based therapies for Parkinson disease-past insights and future potential. Nat Rev Neurol 11, 492-503 (2015).
[0495] 11. Park, T.Y., Jeon, J., Cha, Y. & Kim, K.S. Past, present, and future of cell replacement therapy for parkinson's disease: a novel emphasis on host immune responses. Cell Res 34, 479-492 (2024).
[0496] 12. Cha, Y., Park, T.Y., Leblanc, P. & Kim, K.S. Current Status and Future Perspectives on Stem Cell-Based Therapies for Parkinson's Disease. JMov Disord 16, 22-41 (2023).
[0497] 13. Kim, T.W., Koo, S.Y. & Studer, L. Pluripotent Stem Cell Therapies for Parkinson Disease: Present Challenges and Future Opportunities. Front Cell Dev Biol 8, 729 (2020).
[0498] 14. Osborn, T.M., Hallett, P.J., Schumacher, J.M. & Isacson, O. Advantages and Recent Developments of Autologous Cell Therapy for Parkinson's Disease Patients. Front Cell Neurosci 14, 58 (2020).
[0499] 15. Freed, C.R. et al. Transplantation of embryonic dopamine neurons for severe Parkinson's disease. N Engl J Med 344, 710-719 (2001).
[0500] 16. Olanow, C.W. et al. A double-blind controlled trial of bilateral fetal nigral transplantation in Parkinson's disease. Ann Neurol 54, 403-414 (2003).
[0501] 17. Yamanaka, S. Pluripotent Stem Cell-Based Cell Therapy -Promise and Challenges. Cell Stem Cell 27, 523-531 (2020).
[0502] 18. Takahashi, K. & Yamanaka, S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126, 663-676 (2006). 19. Cha, Y. et al. Metabolic control of primed human pluripotent stem cell fate and function by the miR-200c-SIRT2 axis. Nat Cell Biol 19, 445-456 (2017).
[0503] 20. Cha, Y. et al. SIRT2 regulates mitochondrial dynamics and reprogramming via MEK1-ERK-DRP1 and AKT1-DRP1 axes. CellRep l, 110155 (2021).
[0504] 21. Song, B. et al. Human autologous iPSC-derived dopaminergic progenitors restore motor function in Parkinson's disease models. J Clin Invest 130, 904-920 (2020).
[0505] 22. Kim, J. et al. Spotting-based differentiation of functional dopaminergic progenitors from human pluripotent stem cells. Nat Protoc 17, 890-909 (2022).
[0506] 23. Lee, M.O. et al. Inhibition of pluripotent stem cell-derived teratoma formation by small molecules. Proc Natl Acad Sci U SA 110, E3281-3290 (2013).
[0507] 24. Schweitzer, J.S. etal. Columnar Injection for Intracerebral Cell Therapy. Oper Neurosurg (Hagerstown) 18, 321-328 (2020).
[0508] 25. Schweitzer, J.S. etal. Personalized iPSC-Derived Dopamine Progenitor Cells for Parkinson's Disease. N Engl J Med 382, 1926-1932 (2020).
[0509] 26. Lathia, J.D., Mattson, M.P. & Cheng, A. Notch: from neural development to neurological disorders. J Neurochem 107, 1471-1481 (2008).
[0510] 27. Louvi, A. & Artavanis-Tsakonas, S. Notch signalling in vertebrate neural development. Nat Rev Neurosci 7 , 93-102 (2006).
[0511] 28. Piao, J. et al. Preclinical Efficacy and Safety of a Human Embryonic Stem Cell-Derived Midbrain Dopamine Progenitor Product, MSK-DA01. Cell Stem Cell 28, 217-229 e217 (2021).
[0512] 29. Nolbrant, S., Heuer, A., Parmar, M. & Kirkeby, A. Generation of high-purity human ventral midbrain dopaminergic progenitors for in vitro maturation and intracerebral transplantation. Nat Protoc 12, 1962-1979 (2017).Attorney Docket No. 04843-0081W01
[0513] 30. Ogura, A., Morizane, A., Nakajima, Y., Miyamoto, S. & Takahashi, J. gamma-secretase inhibitors prevent overgrowth of transplanted neural progenitors derived from human-induced pluripotent stem cells. Stem Cells Dev 22, 374-382 (2013).
[0514] 31. Nelson, B.R., Hartman, B.H., Georgi, S.A., Lan, M.S. & Reh, T.A. Transient inactivation of Notch signaling synchronizes differentiation of neural progenitor cells. Dev Biol 304, 479-498 (2007).
[0515] 32. Marks, P. el al. Resolving the full spectrum of human genome variation using Linked-Reads. Genome Res 29, 635-645 (2019).
[0516] 33. Sondka, Z. et al. The COSMIC Cancer Gene Census: describing genetic dysfunction across all human cancers. Nat Rev Cancer 18, 696-705 (2018).
[0517] 34. Stenson, P.D. et al. The Human Gene Mutation Database (HGMD((R))): optimizing its use in a clinical diagnostic or research setting. Hum Genet 139, 1197-1207 (2020).
[0518] 35. McLaren, W. et al. The Ensembl Variant Effect Predictor. Genome Biol 17, 122 (2016).
[0519] 36. Doi, D. etal. Pre-clinical study of induced pluripotent stem cell-derived dopaminergic progenitor cells for Parkinson's disease. Nat Commun 11, 3369 (2020). 37. Kirkeby, A. et al. Preclinical quality, safety, and efficacy of a human embryonic stem cell-derived product for the treatment of Parkinson's disease, STEM-PD. Cell Stem Cell 30, 1299-1314 el299 (2023).
[0520] 38. Park, S. et al. Preclinical and dose-ranging assessment of hESC-derived dopaminergic progenitors for a clinical trial on Parkinson's disease. Cell Stem Cell 31, 25-38 e28 (2024).
[0521] 39. Shultz, L.D., Ishikawa, F. & Greiner, D.L. Humanized mice in translational biomedical research. Nat Rev Immunol 7 , 118-130 (2007).
[0522] 40. Liang, L. et al. Single-cell transcriptomics reveals the cell fate transitions of human dopaminergic progenitors derived from hESCs. Stem Cell Res Ther 13, 412 (2022).
[0523] 41. Tikiova, K. et al. Single cell transcriptomics identifies stem cell-derived graft composition in a model of Parkinson's disease. Nat Commun 11, 2434 (2020).
[0524] 42. Schweitzer, J.S., Song, B. & Kim, K.S. A step closer to autologous cell therapy for Parkinson's disease. Cell Stem Cell IS, 595-597 (2021).
[0525] 43. Sullivan, S. et al. Quality control guidelines for clinical-grade human induced pluripotent stem cell lines. Regen Med 13, 859-866 (2018).
[0526] 44. Canham, M. A. et al. The Molecular Karyotype of 25 Clinical-Grade Human Embryonic Stem Cell Lines. Sci Rep 5, 17258 (2015).
[0527] 45. Merkle, F.T. et al. Human pluripotent stem cells recurrently acquire and expand dominant negative P53 mutations. Nature 545, 229-233 (2017).
[0528] 46. Baumann, K. Stem cells: Stem cell-based therapies threatened by the accumulation of p53 mutations. Nat Rev Mol Cell Biol 18, 403 (2017).
[0529] 47. Trounson, A. Potential Pitfail of Pluripotent Stem Cells. N Engl J Med '1'1, 490-491 (2017).
[0530] 48. Ostrom, Q.T. etal. The epidemiology of glioma in adults: a "state of the science" review. Neuro Oncol 16, 896-913 (2014).
[0531] 49. Rouhani, F. et al. Genetic background drives transcriptional variation in human induced pluripotent stem cells. PLoS Genet 10, e!004432 (2014).Attorney Docket No. 04843-0081W01
[0532] 50. Kyttala, A. et al. Genetic Variability Overrides the Impact of Parental Cell Type and Determines iPSC Differentiation Potential. Stem Cell Reports 6, 200-212 (2016). 51. Choi, J. et al. A comparison of genetically matched cell lines reveals the equivalence of human iPSCs andESCs. Nat Biotechnol 33, 1173-1181 (2015).
[0533] 52. Park, T.Y. etal. Co-transplantation of autologous T(reg) cells in a cell therapy for Parkinson's disease. Nature 619, 606-615 (2023).
[0534] Example 6. Comparison of different culture conditions for inducing mDACs We previously established an mDA neuronal differentiation method of hPSCs as a 1stgeneration protocol (FIG. 13A) (Jeon et al., 2025; Song et al., 2020; Kim et al., 2022). To advance toward a fully chemically defined system, we evaluated whether hPSC-derived mDACs generated under animal source-free culture conditions exhibited differentiation patterns comparable to those obtained with the 1stgeneration protocol. Specifically, we aimed to replace KSR with defined supplements and substitute recombinant proteins such as SHH and FGF8 with small molecules. To this end, the 1stgeneration protocol was divided into two distinct phases — early specification (days 1-11) and late maturation (days 12 onward) — using day 12, when mDA neuron induction begins, as the boundary. We then tested multiple basal media conditions during the early stage (Table 11)
[0535] Across all tested culture conditions, total cell yields at day 15 were consistently lower than those obtained with the 1stgeneration protocol (FIGs. 13B-13D). Among the chemically defined conditions, DMEM / F12+N2 supported the highest cell numbers compared with Neurobasal+N2+B27 and DMEM / F12+Neurobasal+N2 (FIGs. 13B-13D) After replating on day 15, mDACs derived from all culture conditions except for Neurobasal+N2+B27 showed comparable cell counts by day 21 (FIGs. 13B, 13E, and 13F). Immunocytochemical analyses showed that day 21 mDACs across all culture conditions contained >80% FOXA2+and LMX1 A+cells, with TH+cells approximately 10% of total counts (FIGs. 13G-13J). Because DMEM / F12+N2 yielded the highest cell numbers at day 21, it was selective as the most promising basal medium for further optimization.
[0536] Since late-stage media are applied from day 12, whereas replating occurs at day 15 in the 1stgeneration protocol, we next examined whether advancing the replating step to day 12 would improve differentiation efficiency. As expected, total cell numbers atAttorney Docket No. 04843-0081W01
[0537] day 12 were lower than those at day 15 (FIGs. 13B-13D). However, by day 21, cell counts were indistinguishable between cells replated at day 12 versus day 15 (FIGs. 13E, 13F), and immunostaining confirmed no differences in F0XA2+, LMX1A+, or TH+proportions (FIGs. 13G-13J). These results indicate that advancing replating from day 15 to day 12 does not enhance mDA differentiation or maturation.
[0538] To improve cell yields, we next tested whether specific supplements could restore cell numbers in the DMEM / F12+N2 condition (Table 12). Addition of B27 restored day 15 cell numbers to levels comparable to the 1stgeneration protocol (FIG. 14A), whereas GlutaMax supplementation had no effect. When equal numbers of cells were replated on day 15, the day 21 cell counts were similar across all tested conditions (FIG. 14B).
[0539] Immunocytochemistry further confirmed comparable of F0XA2+, LMX1A+, and TH+cells (FIGs. 14C-14F). These findings demonstrate that the DMEM / F12+N2+B27 combination supports mDAC generation at levels equivalent to the 1stgeneration condition.
[0540] Building on these results with WA09 hESCs and Bl hiPSCs, we defined the early-stage phase (days 1-11) of a chemically defined mDA neuronal differentiation protocol, hereafter referred to as the 2ndgeneration protocol (Table 12). This approach was further validated in two additional hPSC lines, H7 hESCs and C4 hiPSCs, which yielded cell numbers comparable to those of the 1stgeneration protocol (FIGs. 15A-15D). Notably, under DMEM / F12+N2+B27 conditions, -95% of cells expressed F0XA2 and LMX1A, while -10% expressed TH (FIGs. 15E-15G), reinforcing DMEM / F12+N2+B27 as a robust candidate for a fully chemically defined in vitro differentiation system.
[0541] TABLE 11. Comparison of basal media on mDAP differentiation of hPSCs
[0542]
[0543] Attorney Docket No. 04843-0081W01
[0544]
[0545] TABLE 12. Comparison of supplements on mDAP differentiation of hPSCs
[0546]
[0547] Attorney Docket No. 04843-0081W01
[0548]
[0549] Example 7. Effect of DHF as a replacement for BDNF in late-stage mDAP differentiation
[0550] Building on the successful replacement of animal-derived components (e.g., KSR) and recombinant proteins (e.g., SHH, FGF8) in the early stage of differentiation (days 1-11), we next sought to optimize the late-stage stage (days 12-21) by substituting recombinant proteins such as BDNF, GDNF, and TGF03, with small molecules (FIG. 4A). As a first step, we tested whether 7,8-dihydryoxyflavone (DHF), a small-molecule TrkB agonist, could replace BDNF (Jang et al., 2010). Differentiating cells were treated with 0.03, 0.3, or 1 pM DHF during this period, and outcomes were assessed on day 21. At day 15, total cell numbers were comparable across all groups, regardless of BDNF or DHF treatment. By day 21, all conditions except 1 pM DHF showed a slight, nonsignificant reduction in cell number relative to the 1stgen condition, whereas the 1 pM DHF group maintained cell numbers equivalent to the control (FIGs. 16B, 16D).
[0551] Withdrawal of both BDNF and DHF did not markedly reduce cell numbers but resulted in immature morphology, indicating impaired neuronal maturation (FIGs. 16B-16D). In contrast, >0.3 pMDHF promoted neuronal morphology, with 1 pMDHF yieldingAttorney Docket No. 04843-0081W01
[0552] mDAPs bearing well-developed neurites comparable to those observed under BDNF treatment (FIG. 16B).
[0553] To determine whether DHF-treated cells acquired appropriate mDA phenotypes, day 21 cultures were stained for specific markers for mDAP, neural precursor, undifferentiated hPSC, serotonergic neuron and noradrenergic neuron. As shown in FIGs. 16E-16H, >0.3 pMDHF maintained high expression of FOXA2 and LMX1A in >80% of cells, with TH-positive populations reaching -9% at 0.3 pM and -12% at 1 pM. Together, these findings demonstrate that 1 pM DHF effectively supports neuronal maturation and lineage specificity, establishing it as a promising chemically defined replacement for BDNF in late-stage mDAP differentiation.
[0554] Example 8. Effect of BT13 as a replacement of GDNF in late-stage mDAP differentiation
[0555] We next tested whether BT13, a small-molecule RET agonist, could replace GDNF during the late stage of mDAP differentiation (Renko et al., 2021).
[0556] Differentiating cells were treated with BT13 at various concentrations (0, 5, 10, and 25 pM), and outcomes were assessed on day 21. Treatment with 5 pM BT13 maintained total cell numbers and neuronal morphology comparable to controls (FIGs. 17A-17E).
[0557] In contrast, >10 pM BT13 caused a marked reduction in total cell numbers (FIGs. 17A-17E). Interestingly, 10 pM BT13 yielded the highest proportion of TH-positive cells (-33%), whereas increasing the concentration to 25 pM reduced the TH-positive population to -26% (FIGs. 17F-17H). BT13 treatment also decreased the number of Ki67-positive proliferating cells at day 21, while no other cell types such as undifferentiated hPSCs, serotonergic neurons or noradrenergic neurons were detected under these conditions (FIGs. 17H, 171). Overall, 10 pM BT13 provided the optimal balance of cell viability and dopaminergic specification, supporting its potential as a chemically defined substitute for GDNF in late-stage mDAP differentiation.Attorney Docket No. 04843-0081W01
[0558] Example 9. PGE2 and SRI only partially replace TGFP3 in late-stage mDAP differentiation
[0559] To explore alternatives to TGF03 during the late stage of mDAP differentiation (days 12-21), we first evaluated SRI-011381 (SRI), a TGF0 pathway agonist (Luo, 2023). Differentiating C4 hiPSCs treated with 0.3 pM SRI yielded the lowest total cell numbers at both days 15 and 21, whereas higher doses (>1 pM) maintained day 21 cell counts comparable those of the Kim condition (FIGs. 18A-18E). However, replacing TGF03 with SRI markedly reduced the proportion of TH+cells (<7%), while expression of FOXA2 and LMX1A remained unaffected (FIGs. 18F, 18G). In addition, a reduced proportion of Ki67-positive proliferating cells was observed in groups treated with >1 pM SRI (FIG. 18H). No undifferentiated cells (OCT4+, SSEA4+) or non-dopaminergic lineages, including serotonergic (TPH2+) or noradrenergic (DBH+) cells, were detected across conditions (FIG. 18H). A similar pattern was observed in WA09 hESCs-derived mDACs, indicating that SRI alone is insufficient to replace TGF03 during late-stage mDAP differentiation.
[0560] Given prior evidence implicating prostaglandin E2 (PGE2) in dopaminergic neuronal differentiation (Alfranca et al., 2008), we next tested PGE2 as a substitute. Cultures treated with 10-100 nM PGE2 showed reduced cell counts at day 15, but numbers recovered to control levels by day 21 (FIGs. 19A-19E). PGE2 slightly decreased FOXA2 expression (<70% of cells) compared with TGFp3-treated groups (FIG. 19F) LMX1A expression was maintained at -60% across conditions except at 100 nM, while TH+proportions peaked at -11% with 10 nM PGE2 and declined to <9% at >30 nM (FIGs. 19F, 19G). Notably, even without TGF03, -8% of cells remained TH+, suggesting that PGE2 provide partial but incomplete support for dopaminergic differentiation under defined conditions.
[0561] Finally, we examined whether combined treatment with SRI and PGE2 could replace TGF03. Cells treated with SRI (0.3 or 1 pM) plus PGE2 (10 or 30 nM) exhibited reduced cell counts at day 15, which recovered by day 21 to control levels (FIGs.20A-20E). The combination maintained FOXA2+expression but reduced LMX1 A+proportion to -60% of total cells (FIG.20F). The highest TH+fraction (-10.5%) was observed with 1 pM SRI plus 30 nM PGE2, comparable to single-agent treatments (FIG.Attorney Docket No. 04843-0081W01
[0562] 20G). Collectively, these findings indicate that neither SRI nor PGE2, alone or in combination, can fully substitute for TGF03 in promoting dopaminergic differentiation under chemically defined conditions.
[0563] Example 10. Development of a monolayer-based mDAC differentiation incorporating the early-phase 2ndgeneration protocol
[0564] Our spotting-based mDAC differentiation method has proven robust, reliable, and validated in both pre-clinical and clinical settings (Jeon et al., 2025; Song et al., 2020; Kim et al., 2022). However, to enable broader patient application in future PD cell therapy, there is a need for a protocol that is scalable, easily accessible, and compatible with automated systems. Conventional monolayer approaches face major limitations, including excessive overgrowth of cells followed by detachment and cell death (Jeon et al., 2025; Song et al., 2020; Kim et al., 2022). To overcome these challenges, we sought to establish a monolayer-based protocol incorporating the early phase (days 1-11) of the 2ndgeneration chemically defined system, which displayed slower overall growth and differentiation than the 1stgeneration protocol, as described above. However, in the late stages of differentiation (days 12-21), we used the same protein factors as the 1stgeneration protocol.
[0565] We first optimized replating timing and cell density. Multiple replating time points (Days 6, 8, and 10) were tested, together with varying cell densities (240K, 400K, and 73 OK) and replating densities (3M, 6M) (FIG.21 A). Initial cell density had little effect on differentiation outcome, whereas replating timing strongly influenced cell morphology. Day 8 and 10 replating produced heterogenous cultures containing flatshaped cells, while day 6 replating yielded homogenous neuronal populations with enriched neurite growth by Day 21 (FIG. 21B). Cell yield and viability analyses showed that both Day 6 and Day 10 replating generated sufficient mDACs, but low-density replating (3M) consistently resulted in better viability compared to high-density replating (6M) (FIG. 21C).
[0566] We next examined mDAC marker expression in 240K-3M groups replated on Day 6, 8, and 10. All groups generated >80% FOXA2+cells. Notably, TH+population was highest in the Day 6 replated group, exceeding 30%, a threefold increase relative toAttorney Docket No. 04843-0081W01
[0567] our spotting-based 1stgeneration protocol (FIG.21D). Based on these findings, the optimal parameters were defined as initial seeding at 240K with replating at 3M on Day 6. Under these conditions, reproducible populations of FOXA2+, LMX1 A+mDACs were generated, with significantly higher TH+populations than the spotting group at day 21 (FIG. 21E). Collectively, these results demonstrate that this monolayer-based mDAC differentiation method achieves high efficiency, reproducibility, and enhanced dopaminergic yield, establishing a promising platform for next-generation, scalable and automation-compatible applications.
[0568] Discussion for Examples 6-10
[0569] Parkinson’s disease (PD) is characterized by the progressive loss of midbrain dopaminergic neurons (mDANs) in the substantia nigra pars compacta, leading to diminished striatal dopaminergic tone and cardinal motor symptoms (Meissner et al., 2011; Obeso et al., 2010; Poewe et al., 2017). This lesion-centered pathophysiology has long motivated cell replacement therapy (CRT), in which appropriately specified dopaminergic cells repopulate the nigrostriatal pathway to restore neurotransmission (Barker et al., 2015). Human pluripotent stem cells (hPSCs)-including human embryonic stem cells (hESCs) and induced pluripotent stem cells (hiPSCs)-provide a renewable source for generating lineage- defined neural derivatives and have accelerated efforts to develop transplantable midbrain dopaminergic progenitors for PD (Sonntag et al., 2018).
[0570] Directing hPSCs to a ventral midbrain identity relies on recapitulating embryonic patterning cues that establish floor plate-derived dopaminergic lineages (Arenas et al., 2015). Over the past decade, stepwise differentiation protocols have used temporal control of key signaling pathways to guide fate acquisition and neuronal maturation (Chambers et al., 2009; Kriks et al., 2011). Although these approaches have enabled the production of transplant-competent midbrain dopaminergic progenitors, many widely used methods depend on animal- derived or compositionally undefined supplements and on multiple recombinant morphogens and neurotrophic factors (Cha et al., 2023). Such inputs can introduce batch-to-batch variability, complicate mechanistic interpretation, and pose challenges for reproducibility, scale-up, and technology transfer to good manufacturing practice (GMP) environments (Sasai, 2002; Kawasaki et al., 2000; PerrierAttorney Docket No. 04843-0081W01
[0571] et al., 2004). In addition, reliance on numerous protein reagents increases cost and supply-chain sensitivity, practical considerations that become increasingly consequential as programs move from discovery to preclinical development and, ultimately, clinical manufacturing.
[0572] These translational constraints sharpen a general design principle for nextgeneration differentiation systems: adopt chemically defined, xeno-free conditions that are stable, well characterized, and compatible with standardized release testing. In this framework, developmental signaling is implemented with precisely formulated media and, where feasible, with small-molecule modulators that replace or minimize recombinant proteins. Chemically defined conditions are expected to improve protocol portability across hPSC lines, facilitate root-cause analysis when performance drifts, and align culture inputs with regulatory expectations for identity, purity, potency, and safety assessments. Equally important, defined systems help decouple biological requirements from confounding matrix or supplement effects, enabling more rigorous mapping between in vitro parameters (e.g., progenitor specification, neuronal maturation, proliferative quiescence) and functional attributes relevant to transplantation.
[0573] Despite progress, important gaps remain. First, there is a need for differentiation workflows that are fully defined across both early patterning and late maturation phases, rather than partially defined hybrids. Second, protocols should support robust generation of ventral midbrain-specified progenitors that proceed to dopaminergic neuronal identities while maintaining low proliferation and minimal off-target lineage contamination. Third, approaches must demonstrate reproducibility across distinct hPSC lines and manufacturing runs, using quantitative readouts that are informative for downstream quality control and translational decision-making. Addressing these gaps would provide a clearer path from laboratory protocols to scalable production of consistent cell products.
[0574] Here, we set out to develop and benchmark a fully chemically defined, xeno-free culture framework that directs hPSCs toward midbrain dopaminergic lineages in a stage-appropriate manner while minimizing reliance on recombinant proteins and eliminating undefined components. The strategy organizes morphogenetic cues into an early specification phase and a later maturation phase, each supported by defined mediaAttorney Docket No. 04843-0081W01
[0575] compositions and targeted pathway modulation. We evaluate performance across multiple hPSC lines using molecular and cellular criteria aligned with prospective release attributes-lineage identity, neuronal maturation, proliferative status, and off-target reduction-chosen for their relevance to standardization and manufacturability. By establishing a reproducible and analytically tractable differentiation environment, this work aims to provide a practical foundation for producing midbrain dopaminergic cells under conditions that are better suited to rigorous experimentation and future translational application.
[0576] References for Examples 6-10
[0577] 1. Parmar, M., Grealish, S., and Henchcliffe, C. (2020). The future of stem cell therapies for Parkinson disease. Nat Rev Neurosci 21, 103-115. 10.1038 / s41583-019-0257-7.
[0578] 2. Doi, D., Magotani, H., Kikuchi, T., Ikeda, M., Hiramatsu, S., Yoshida, K., Amano, N., Nomura, M., Umekage, M., Morizane, A., and Takahashi, J. (2020). Pre-clinical study of induced pluripotent stem cell-derived dopaminergic progenitor cells for Parkinson's disease. Nat Commun 11, 3369. 10.1038 / s41467-020-17165-w.
[0579] 3. Kirkeby, A., Nelander, J., Hoban, D.B., Rogelius, N., Bjartmarz, H., Novo Nordisk Cell Therapy, R., Storm, P., Fiorenzano, A., Adler, A.F., Vale, S., et al. (2023). Preclinical quality, safety, and efficacy of a human embryonic stem cell-derived product for the treatment of Parkinson's disease, STEM-PD. Cell Stem Cell 30, 1299-1314 el299.
[0580] 10.1016 / j.stem.2023.08.014.
[0581] 4. Park, S., Park, C.W., Eom, J.H., Jo, M.Y., Hur, H.J., Choi, S.K., Lee, J.S., Nam, 5.T., Jo, K.S., Oh, Y.W., et al. (2024). Preclinical and dose-ranging assessment of hESC-derived dopaminergic progenitors for a clinical trial on Parkinson's disease. Cell Stem Cell 31, 278-279. 10.1016 / j.stem.2024.01.006.
[0582] 5. Kim, T.W., Piao, J., Bocchi, V.D., Koo, S.Y., Choi, S.J., Chaudhry, F., Yang, D., Cho, H.S., Hergenreder, E., Perera, L.R., et al. (2025). Enhanced yield and subtype identity of hPSC-derived midbrain dopamine neuron by modulation of WNT and FGF18 signaling. bioRxiv. 10.1101 / 2025.01.06.631400.
[0583] 6. Jeon, J., Cha, Y., Hong, Y.J., Lee, I.H., Jang, H., Ko, S., Naumenko, S., Kim, M., Ryu, H.L., Shrestha, Z., et al. (2025). Pre-clinical safety and efficacy of human induced pluripotent stem cell-derived products for autologous cell therapy in Parkinson's disease. Cell Stem Cell 32, 343-360 e347. 10.1016 / j.stem.2025.01.006.
[0584] 7. Tchieu, J., Zimmer, B., Fattahi, F., Amin, S., Zeltner, N., Chen, S., and Studer, L. (2017). A Modular Platform for Differentiation of Human PSCs into All Major Ectodermal Lineages. Cell Stem Cell 21, 399-410 e397. 10.1016 / j.stem.2017.08.015. 8. Christiansen, J.R., and Kirkeby, A. (2024). Clinical translation of pluripotent stem cell-based therapies: successes and challenges. Development 151. 10.1242 / dev.202067.Attorney Docket No. 04843-0081W01
[0585] 9. Kirkeby, A., Main, H., and Carpenter, M. (2025). Pluripotent stem-cell-derived therapies in clinical trial: A 2025 update. Cell Stem Cell 32, 329-331.
[0586] 10.1016 / j.stem.2025.01.003.
[0587] 10. Chen, K.G., Mallon, B.S., McKay, R.D., and Robey, P.G. (2014). Human pluripotent stem cell culture: considerations for maintenance, expansion, and therapeutics. Cell Stem Cell 14, 13-26. 10.1016 / j.stem.2013.12.005.
[0588] 11. Ozawa, H., Matsumoto, T., and Nakagawa, M. (2023). Culturing human pluripotent stem cells for regenerative medicine. Expert Opin Biol Ther 23, 479-489. 10.1080 / 14712598.2023.2225701.
[0589] 12. Song, B., Cha, Y., Ko, S., Jeon, J., Lee, N., Seo, H., Park, K.J., Lee, I.H., Lopes, C., Leitosa, M., et al. (2020). Human autologous iPSC-derived dopaminergic progenitors restore motor function in Parkinson's disease models. J Clin Invest 130, 904-920.
[0590] 10.1172 / JCI 130767.
[0591] 13. Kim, J., Jeon, J., Song, B., Lee, N., Ko, S., Cha, Y., Leblanc, P., Seo, H., and Kim, K.S. (2022). Spotting-based differentiation of functional dopaminergic progenitors from human pluripotent stem cells. Nat Protoc 17, 890-909. 10.1038 / s41596-021-00673-4.
[0592] 14. Jang, S.W., Liu, X., Yepes, M., Shepherd, K.R., Miller, G.W., Liu, Y., Wilson, W.D., Xiao, G, Bianchi, B., Sun, Y.E., and Ye, K. (2010). A selective TrkB agonist with potent neurotrophic activities by 7,8-dihydroxyflavone. Proc Natl Acad Sci U S A 107, 2687-2692. 10.1073 / pnas.0913572107.
[0593] 15. Renko, J.M., Mahato, A.K., Visnapuu, T., Valkonen, K., Karelson, M., Voutilainen, M.H., Saarma, M., Tuominen, R.K., and Sidorova, Y.A. (2021).
[0594] Neuroprotective Potential of a Small Molecule RET Agonist in Cultured Dopamine Neurons and Hemiparkinsonian Rats. J Parkinsons Dis 11, 1023-1046. 10.3233 / JPD-202400.
[0595] 16. Luo, J. (2023). Augmentation of transforming growth factor-beta signaling for the treatment of neurological disorders. Neural Regen Res 18, 1711-1712. 10.4103 / 1673-5374.363833.
[0596] 17. Alfranca, A., Lopez-Oliva, J.M., Genis, L., Lopez-Maderuelo, D., Mirones, I., Salvado, D., Quesada, A. J., Arroyo, A.G, and Redondo, J.M. (2008). PGE2 induces angiogenesis via MTl-MMP-mediated activation of the TGLbeta / Alk5 signaling pathway. Blood 112, 1120-1128. 10.1182 / blood-2007-09-112268.
[0597] 18. Meissner, W.G, Lrasier, M., Gasser, T., Goetz, C.G, Lozano, A., Piccini, P., Obeso, J. A., Rascol, O., Schapira, A., Voon, V., etal. (2011). Priorities in Parkinson's disease research. Nat Rev Drug Discov 10, 377-393. 10.1038 / nrd3430.
[0598] 19. Obeso, J.A., Rodriguez-Oroz, M.C., Goetz, C.G, Marin, C., Kordower, J.H., Rodriguez, M., Hirsch, E.C., Larrer, M., Schapira, A.H., and Halliday, G. (2010).
[0599] Missing pieces in the Parkinson's disease puzzle. Nat Med 16, 653-661.
[0600] 10.1038 / nm.2165.
[0601] 20. Poewe, W., Seppi, K., Tanner, C.M., Halliday, G.M., Brundin, P., Volkmann, J., Schrag, A.E., and Lang, A.E. (2017). Parkinson disease. Nat Rev Dis Primers 3, 17013.
[0602] 10.1038 / nrdp.2017.13.
[0603] 21. Barker, R.A., Drouin-Ouellet, J., and Parmar, M. (2015). Cell-based therapies for Parkinson disease-past insights and future potential. Nat Rev Neurol 11, 492-503.
[0604] 10.1038 / nrneurol.2015.123.Attorney Docket No. 04843-0081W01
[0605] 22. Sonntag, K.C., Song, B., Lee, N., Jung, J.H., Cha, Y., Leblanc, P., Neff, C., Kong, S.W., Carter, B.S., Schweitzer, J., and Kim, K.S. (2018). Pluripotent stem cell-based therapy for Parkinson's disease: Current status and future prospects. Prog Neurobiol 168, 1-20. 10.1016 / j.pneurobio.2018.04.005.
[0606] 23. Arenas, E., Denham, M., and Villaescusa, J.C. (2015). How to make a midbrain dopaminergic neuron. Development 142, 1918-1936. 10.1242 / dev.097394.
[0607] 24. Chambers, S.M., Fasano, C.A., Papapetrou, E.P., Tomishima, M., Sadelain, M., and Studer, L. (2009). Highly efficient neural conversion of human ES and iPS cells by dual inhibition of SMAD signaling. Nat Biotechnol 27, 275-280. 10.1038 / nbt.1529. 25. Kriks, S., Shim, J.W., Piao, J., Ganat, Y.M., Wakeman, D.R., Xie, Z., Carrillo-Reid, L., Auyeung, G., Antonacci, C., Buch, A., et al. (2011). Dopamine neurons derived from human ES cells efficiently engraft in animal models of Parkinson's disease. Nature 480, 547-551. 10.1038 / naturel 0648.
[0608] 26. Cha, Y., Park, T.Y., Leblanc, P., and Kim, K.S. (2023). Current Status and Future Perspectives on Stem Cell-Based Therapies for Parkinson's Disease. J Mov Disord 16, 22-41. 10.14802 / jmd.22141.
[0609] 27. Sasai, Y. (2002). Generation of dopaminergic neurons from embryonic stem cells. J Neurol 249 Suppl 2, 1141-44. 10.1007 / s00415-002- 1208-0.
[0610] 28. Kawasaki, H., Mizuseki, K., Nishikawa, S., Kaneko, S., Kuwana, Y., Nakanishi, S., Nishikawa, S.I., and Sasai, Y. (2000). Induction of midbrain dopaminergic neurons from ES cells by stromal cell-derived inducing activity. Neuron 28, 31-40.
[0611] 10.1016 / s0896-6273(00)00083-0.
[0612] 29. Perrier, A.L., Tabar, V., Barberi, T., Rubio, M.E., Bruses, J., Topf, N., Harrison, N.L., and Studer, L. (2004). Derivation of midbrain dopamine neurons from human embryonic stem cells. Proc Natl Acad Sci U S A 101, 12543-12548.
[0613] 10.1073 / pnas.0404700101.
[0614] OTHER EMBODIMENTS
[0615] It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.
Claims
Attorney Docket No. 04843-0081W01WHAT IS CLAIMED IS:
1. A method of generating a population of midbrain dopaminergic cells (mDACs), the method comprising: providing a population of induced pluripotent stem cells (iPSCs); and maintaining the cells for 21 days under conditions sufficient for the iPSCs to differentiate into mDACs, wherein the maintaining comprises:(i) maintaining the cells in a basal medium supplemented with N2 and B27 for days 1-11 for floor plate induction and neural precursor induction, wherein the medium is further supplemented with one or more of non-essential amino acid (NEAA), 4-{6-[4- (Piperazin- 1 -yl)phenyl] pyrazolo [ 1 , 5 -a] pyrimidin-3 -yl } quinoline (LDN 193189), 4- [4- (2H-l,3-Benzodioxol-5-yl)-5-(pyridin-2-yl)-lH-imidazol-2-yl]benzamide (SB431542), purmorphamine (PMN), 6-((2-((4-(2,4-Dichlorophenyl)-5-(4-methyl- 1 H-imidazol-2-yl)pyrimidin-2-yl)amino)ethyl)amino)nicotinonitrile (CHIR99021 ), and quercetin (QC); and(ii) maintaining the cells in a basal medium supplemented with N2 for days 12-21 for induction and maturation of mDACs, wherein the medium is further supplemented with one or more of 7,8-dihydroxyflavone (DHF), N,N-diethyl-3-(4-(4-fluoro-2- (trifluoromethyl)benzoyl)piperazin-l-yl)-4-methoxybenzenesulfonamide (BT13), N’- cyclohexyl-N-(phenylmethyl)-N-(4-piperidinylmethyl)-urea (SRI-011381), prostaglandin E2 (PGE2), dibutyryl cyclic AMP (dbcAMP), ascorbic acid (AA), and phenylglycine t-butyl ester (DAPT).
2. The method of claim 1, wherein step (i) comprises maintaining the cells in: the basal medium supplemented with 0.5-2X N2, 0.5-2X B27, 0.5-2X NEAA, 50-500 nM LDN193189, and 1-50 pM SB431542 on day 1; the basal medium supplemented with 0.5-2XN2, 0.5-2XB27, 0.5-2XNEAA, 50-500 nMLDNl 93189, 1-50 pM SB431542, and 0.1-5 pM PMN on day 2; the basal medium supplemented with 0.5- 2XN2, 0.5-2XB27, 0.5-2XNEAA, 50-500 nM LDN193189, 1-50 pM SB431542, 0.1-5 pMPMN, and 0.1-5 pM CHIR99021 on days 4-6; the basal medium supplemented with 0.5-2X N2, 0.5-2X B27, 0.5-2X NEAA, 50-500 nM LDN193189, 0.1-5 pMPMN, and 0.1-5 pM CHIR99021 on day 8; the basal medium supplementedAttorney Docket No. 04843-0081W01with 0.5-2X N2, 0.5-2X B27, 0.5-2X NEAA, 50-500 nM LDN193189, 0.1-5 pM PMN, 0.1-5 pM CHIR99021, and 1-100 pM QC on day 9; and the basal medium supplemented with 0.5-2X N2, 0.5-2X B27, 0.5-2X NEAA, 50-500 nM LDN193189, and 0.1-5 pM CHIR99021 on day 10.
3. The method of claim 1 or 2, wherein step (ii) comprises maintaining the cells in: the basal medium supplemented with 0.5-2XN2, 0.1-5 pMDHF, 1-50 pMBT13, 0.1-5 pM SRI-011381, 10-60 nMPGE2, 100-1000 pM dbcAMP, 50-500 pMAA, and 1-50 pMDAPT.
4. The method of any one of claims 1-3, wherein the method comprises dissociation of the cells on day 15.
5. The method of any one of claims 1-4, wherein the method comprises transplantation and / or freezing of the cells on day 21.
6. The method of any one of claims 1-5, wherein the method comprises, before (i), plating the cells in discrete, individual areas with sufficient distance between the areas to maintain isolation between the areas, in a biomatrix hydrogel support, with a density of about 5,000-20,000 cells per area, preferably about 10,000 cells per area.
7. The method of claim 6, wherein the biomatrix hydrogel support is a basement membrane extract or synthetic matrix.
8. The method of claims 6 or 7, wherein the cells are suspended in the hydrogel before plating.
9. The method of any one of claims 6-8, wherein the areas are about 2-10 mm indiameter.Attomey Docket No. 04843-0081W0110. The method of any one of claims 6-9, wherein the distance between the areas is 1-3 cm.
11. A method of generating a population of midbrain dopaminergic cells (mDACs), the method comprising: providing a population of induced pluripotent stem cells (iPSCs); seeding 100 x 103- 500 x 103cells from the population of cells at day 0; and maintaining the cells in a monolayer for 21 days under conditions sufficient for the iPSCs to differentiate into mDACs, wherein the maintaining comprises:(i) maintaining the cells in a basal medium supplemented with N2 and B27 for days 1-11 for floor plate induction and neural precursor induction, wherein the medium is further supplemented with one or more of non-essential amino acid (NEAA), 4-{6-[4- (Piperazin- 1 -yl)phenyl] pyrazolo [ 1 , 5 -a] pyrimidin-3 -yl } quinoline (LDN 193189), 4- [4- (2H-l,3-Benzodioxol-5-yl)-5-(pyridin-2-yl)-lH-imidazol-2-yl]benzamide (SB431542), purmorphamine (PMN), 6-((2-((4-(2,4-Dichlorophenyl)-5-(4-methyl- 1 H-imidazol-2-yl)pyrimidin-2-yl)amino)ethyl)amino)nicotinonitrile (CHIR99021 ), and quercetin (QC); and(ii) maintaining the cells in a basal medium supplemented with N2 for days 12-21 for induction and maturation of mDACs, wherein the medium is further supplemented with one or more of brain-derived neurotrophic factor (BDNF), glial cell line-derived neurotrophic factor (GDNF), transforming growth factor beta 3 (TGF03), dibutyryl cyclic AMP (dbcAMP), ascorbic acid (AA), and N-[N-(3,5-difluorophenacetyl)-l- alanyl]-S-phenylglycine t-butyl ester (DAPT).
12. The method of claim 11, wherein step (i) comprises replating 1 x 106- 5 x 106cells on day 6.
13. The method of claim 11 or 12, wherein step (i) comprises maintaining the cells in: the basal medium supplemented with 0.5-2X N2, 0.5-2X B27, 0.5-2X NEAA, 50-500 nM LDN193189, and 1-50 pM SB431542 on day 1; the basal medium supplemented with 0.5-2XN2, 0.5-2XB27, 0.5-2XNEAA, 50-500 nMLDNl 93189, 1-50 pM SB431542, and 0.1-5 pM PMN on day 2; the basal medium supplemented with 0.5-Attorney Docket No. 04843-0081W012XN2, 0.5-2XB27, 0.5-2XNEAA, 50-500 nMLDN193189, 1-50 pM SB431542, 0.1-5 pMPMN, and 0.1-5 pM CHIR99021 on days 4-6; the basal medium supplemented with 0.5-2X N2, 0.5-2X B27, 0.5-2X NEAA, 50-500 nM LDN193189, 0.1-5 pMPMN, and 0.1-5 pM CHIR99021 on day 8; the basal medium supplemented with 0.5-2X N2, 0.5-2XB27, 0.5-2XNEAA, 50-500 nM LDN193189, 0.1-5 pM PMN, 0.1-5 pM CHIR99021, and 1-100 pM QC on day 9; and the basal medium supplemented with 0.5-2X N2, 0.5-2X B27, 0.5-2X NEAA, 50-500 nM LDN193189, and 0.1-5 pM CHIR99021 on day 10.
14. The method of any one of claims 11-13, wherein step (ii) comprises maintaining the cells in the basal medium supplemented with 0.5-2X N2, 5-50 ng / mL BDNF, 5-50 ng / mL GDNF, 0.1-5 ng / mL TGF03, 100-1000 pM dbcAMP, 50-500 pM AA, and 1- 50 pM DAPT.
15. The method of any one of claims 11-14, wherein the basal medium is further supplemented with 0.1-5 pM CHIR99021 on days 12-14.
16. The method of any one of claims 1-15, wherein the population of iPSCs is a population of human iPSCs (hiPSCs).
17. The method of any one of claims 1-16, wherein the population of iPSCs is generated by a method comprising:obtaining a population of primary somatic cells from a subject;inducing expression of OCT4, KLF4, SOX2, and L-MYC in the cells; and maintaining the cells under conditions sufficient for the primary somatic cells to become iPSCs.
18. The method of claim 17, wherein inducing expression of OCT4, KLF4, SOX2, and L- MYC comprises transfecting the primary somatic cells with polycistronic episomal vector that comprises human Oct4 linked with 2A sequence of foot-and-mouthAttorney Docket No. 04843-0081W01disease virus (OCT4-F2A), KLF4, S0X2 linked with 2A sequence of porcine teschovirus (SOX2-P2A), and L-MYC coding sequences.
19. The method of claim 17 or 18, wherein the population of iPSCs is generated by a method comprising expressing in the primary somatic cells one or more exogenous microRNAs (miRNAs) selected from the group consisting of miR-106a, -106b, -136s, -200c, -302s, -369s, and -371 / 373.
20. The method of claim 19, wherein the miRNAs comprise one or both of miR-302s and miR-200c.
21. The method of claim 20, wherein the method comprises introducing into the cells an episomal vector that comprises sequences coding for miR-302s and miR-200c.
22. The method of any one of claims 17-21, wherein the population of iPSCs is generated by a method comprising expressing in the primary somatic cells all of OCT4, KLF4, SOX2, miR-302s and miR-200c.
23. The method of claim 22, wherein the method comprises introducing into the primary somatic cells (i) a vector, preferably a viral vector or polycistronic episomal vector, that comprises human Oct4 linked with 2A sequence of foot-and-mouth disease virus (OCT4-F2A), KLF4, SOX2 linked with 2A sequence of porcine teschovirus (SOX2- P2A), and L-MYC coding sequences, or mature RNAs of Oct4, KLF4, SOX2, and L- MYC, or corresponding proteins, and (ii) a vector, preferably a viral vector or episomal vector, that comprises sequences coding for miR-302s and miR-200c, or mature miR-302s and miR-200c.
24. The method of any one of claims 17-23, wherein the primary somatic cells are fibroblasts, hair keratinocytes, blood cells, or bone marrow mesenchymal stem cells (MSCs).Attorney Docket No. 04843-0081W0125. A population of cells comprising mDACs generated by the method of any one of claims 1-24.
26. The population of cells of claim 25, wherein the mDACs express F0XA2, LMX1 A, and TH at mRNA and / or protein level.
27. The population of cells of claim 25 or 26, wherein the mDACs do not express or have non-detectable expression of OCT4, NANOG, and SSEA-4.
28. The population of cells of any one of claims 25-27, wherein the mDACs do not express or have non-detectable expression of PAX6, SOX1, F0XG1, H0XA2, and NKX6.1.
29. The population of cells of any one of claims 25-28, wherein the mDACs do not express or have non-detectable expression of tryptophan hydroxylase (TPH) and dopamine b-hydroxylase (DBH).
30. The population of cells of any one of claims 25-29, wherein the mDACs do not harbor Tier 1 cancer genes.
31. The population of cells of any one of claims 25-30, wherein at least 70% of mDACs in the population are viable.
32. The population of cells of any one of claims 25-30, wherein following implantation of the mDACs to a host brain, TH+ fiber density in grafted side of the brain is 20% or more than that in intact side of the brain.
33. A composition comprising the population of cells of any one of claims 25-32.Attorney Docket No. 04843-0081W0134. A method of treating a subject who has or is at risk of developing Parkinson’s Disease (PD), the method comprising administering to the subject the population of cells of any one of claims 25-32.
35. The method of claim 34, wherein the population of cells is generated from primary somatic cells that are obtained from the same subject who is to be treated.
36. The method of claim 34, wherein the population of cells is generated from primary somatic cells that are obtained from a different subject who is of the same species as the subject who is to be treated.
37. The method of any one of claims 34-36, wherein the subject is human.