Method for controlling quality of cell population

By employing a pigmentation culture system with DOPA staining and bFGF medium, the method effectively detects and reduces pigment cells in CECSi cell populations, ensuring better treatment outcomes.

WO2026155169A1PCT designated stage Publication Date: 2026-07-23CAKSUS BIO INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/JP2026/000919
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2025-01-15
Filing Date
2026-01-14
Publication Date
2026-07-23

AI Technical Summary

Technical Problem

The presence of unintended cells, particularly pigment cells, in iPS cell-derived therapeutic corneal endothelial cell substitutes (CECSi cells) leads to pigment deposition on the cornea after transplantation, affecting treatment efficacy.

Method used

A method involving a pigmentation culture system using DOPA staining and evaluation of TYRP1 gene expression, combined with culturing in a medium containing basic fibroblast growth factor (bFGF), to detect and reduce pigment cell contamination in CECSi cell populations.

Benefits of technology

Enables accurate quality control and minimization of pigment cell inclusion, resulting in a higher-quality CECSi cell population for transplantation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure JPOXMLDOC01-APPB-T000001
    Figure JPOXMLDOC01-APPB-T000001
  • Figure 00000032_0000
    Figure 00000032_0000
  • Figure 00000032_0001
    Figure 00000032_0001
Patent Text Reader

Abstract

The present invention addresses the problems regarding: how to identify pigment cells which are non-target cells included in a cell population including CECSi cells (hereinafter, also simply referred to as a CECSi cell population); how to control the quality of a CECSi cell population; and how to reduce the number of pigment cells included in a CECSi cell population. The present invention pertains to a method for controlling the quality of a cell population including iPS cell-derived therapeutic corneal endothelial substitute cells, the method comprising assessing the presence or absence of pigment cells in the cell population.
Need to check novelty before this filing date? Find Prior Art

Description

Quality control methods for cell populations

[0001] The present invention relates to a method for detecting unintended cells (cells other than CECSi cells) that may be included in a cell population, particularly a cell population containing iPS cell-derived therapeutic corneal endothelial cell substitutes from iPS cells (CECSi cells); a method for controlling the quality of a cell population containing CECSi cells using the detection method; and a method for producing a cell population of superior quality.

[0002] Corneal Endothelial Cell Substitute from iPS cells (CECSi cells) are cells that were previously developed for the treatment of bullous keratopathy (Patent Documents 1-3). In a clinical study in which CECSi cells were transplanted into the anterior chamber of patients with recurrent bullous keratopathy, while visual acuity improved, keratic precipitates (hereinafter referred to as pigmented Kp) with brown pigment were observed on the posterior surface of the cornea (Non-Patent Document 1). After a year of follow-up in the clinical study, the present inventors had the opportunity to perform a re-operation on the subject with a full-thickness corneal transplant and pathologically examined the pigmented Kp. As a result, it was considered that the pigmented Kp was caused by unintended cells included in the cell population containing CECSi cells changing into pigment cells containing melanin pigment (in this specification, these unintended cells are also referred to as "pigment cells"). Retinal pigment epithelium (RPE) cells are known as pigment cells in the ocular region. Attempts to create RPE cells from iPS cells have been made and are now in the clinical stage. Retinal pigment epithelial cell progenitor cells refer to cells whose differentiation into retinal pigment epithelial cells has been directed, and their association with pigment cell-related genes such as MITF (microphthalmia-associated transcription factor) has been reported (Non-patent Literature 1). However, there have been no reports to date of the inclusion of pigment cells or their progenitor cells in cell populations containing CECSi cells used for transplantation.

[0003] WO / 2013 / 051722WO / 2016 / 093359WO / 2019 / 142833

[0004] Hirayama M et al., Cell Reports Medicine 6, 101847, 2025Hosaka C et al., Pigment Cell Melanoma Res. 2019 Sep;32(5):623-633.

[0005] The problems of the present invention are how to identify unintended cells that may be mixed into a cell population containing CECSi cells (hereinafter also simply referred to as the CECSi cell population), how to quality control the CECSi cell population, and how to minimize the inclusion of unintended cells in the CECSi cell population.

[0006] In view of the above issues, the inventors first established a pigmentation culture system using a CECSi cell population. This is a culture system that induces pigmentation in approximately 30 days. Since DOPA (3,4-dihydroxyphenylalanine) staining is known as a simple staining method used to confirm melanin pigment, the inventors established a culture system that induces pigmentation in 30 days using the DOPA staining method. On the other hand, since DOPA staining did not stain the CECSi cell population on day 7 after seeding (Day 7), the inventors diligently investigated an evaluation system that could detect the presence of pigment cells at an earlier stage. After examining several candidate genes in light of the melanin biosynthesis pathway, the inventors found that the gene expression of TYRP1 (Tyrosinase-related protein 1), a tyrosinase-related protein, was in good correlation with the presence of pigment cells in the CECSi cell population, and further confirmed its expression even in a cryopreserved CECSi cell population. Furthermore, the inventors discovered that the contamination of pigment cells can be reduced by adding the FGF family, particularly basic fibroblast growth factor (bFGF), to the culture medium when producing CECSi cells. Based on these findings, the present invention was completed.

[0007] In other words, the present invention provides the following: [1] A method for controlling the quality of a cell population containing iPS cell-derived therapeutic corneal endothelial surrogate cells, comprising the step of evaluating the presence or absence of pigment cells in the cell population. [2] The method according to [1], wherein the cell population is cryopreserved. [3] The method according to [1] or [2], wherein the evaluation of the presence or absence of pigment cells is an evaluation of the presence or absence of TYRP1 gene expression. [4] A method for detecting pigment cells in a cell population containing iPS cell-derived therapeutic corneal endothelial surrogate cells, comprising the step of evaluating TYRP1 gene expression in the cell population. [5] A method for reducing the contamination of a cell population with pigment cells, comprising culturing the cell population containing iPS cell-derived therapeutic corneal endothelial surrogate cells in an FGF family-containing medium. [6] The method according to [5], wherein the pigment cells express the TYRP1 gene. [7] The method according to [5] or [6], wherein the culture is carried out for 2 to 30 days. A method for producing a cell population containing iPS cell-derived therapeutic corneal endothelial surrogate cells, comprising reducing the contamination of pigment cells by any of the methods described in [8], [5], to [7].

[0008] According to the present invention, quality control of the CECSi cell population can be easily and accurately performed by detecting pigment cells, which are unintended cells, within the CECSi cell population. Furthermore, by employing a specific culture method, the contamination of unintended pigment cells can be reduced, thereby enabling the production of a CECSi cell population of better quality.

[0009] This figure shows the results of DOPA staining and TYRP1 immunostaining to identify melanin pigment after thawing cryopreserved CECSi cell populations, reseeding, and culturing for one month. DOPA-positive cells and TYRP1-positive cells were found to be identical. This figure shows the results of detecting TYRP1-positive cells by single-cell analysis using several lots of CECSi cell populations. This figure shows the melanin biosynthesis pathway. This figure shows the results of immunostaining of CECSi cell populations cultured for one week in HE-SFM + bFGF (20 ng / ml) or DMEM / F12 + ITS supplement + bFGF (20 ng / ml) medium. From left to right, the images show Na,K-ATPase staining, ZO-1 staining, triple staining of Na,K-ATPase, ZO-1, and DAPI, and phase-contrast staining. This graph shows the results of measuring the cell count over time in CECSi cell populations cultured for one week in various media. This figure shows the results of immunostaining of CECSi cell populations cultured for one week in HE-SFM + bFGF (20 ng / ml) (top panel) or M199 + ITS supplement + bFGF (20 ng / ml) (bottom panel). From left to right, the images show Na,K-ATPase staining, ZO-1 staining, and triple staining for Na,K-ATPase, ZO-1, and DAPI. This figure shows the results of immunostaining of CECSi cell populations cultured for one week in HE-SFM + bFGF (20 ng / ml) (top panel) or M199 + ITS supplement + bFGF (20 ng / ml) + Albumin (bottom panel). From left to right, the images show Na,K-ATPase staining, ZO-1 staining, and triple staining for Na,K-ATPase, ZO-1, and DAPI. The images show the results of immunostaining of CECSi cell populations cultured for one week in HE-SFM + bFGF (20 ng / ml) (top panel) or M199 + DMEM / F12 + ITS supplement + bFGF (20 ng / ml) + Albumin (bottom panel). From left to right, the images show Na,K-ATPase staining, ZO-1 staining, and triple staining for Na,K-ATPase, ZO-1, and DAPI. The graphs on the left and right show the results of measuring the number of cells in CECSi cell populations cultured for one week in various media over time.This graph shows the changes in the expression of various genes (OCT4, MITF, TYRP1) during the CECSi cell differentiation induction process. It also shows the results of quantitative PCR, comparing the relative expression levels of the OCT4, TYRP1, and MITF genes in CECSi cells differentiated with and without bFGF. B4G12 cells, iPS cells, were used as a control.

[0010] The present invention will be described below. Unless otherwise specified, terms used herein have the meanings commonly used in the art.

[0011] 1. Method for controlling the quality of a cell population containing iPS cell-derived therapeutic corneal endothelial replacement cells (CECSi cell population) The present invention provides a method for controlling the quality of a CECSi cell population. This method is based on the findings of the inventors that if unintended cells (i.e., cells other than CECSi cells) are mixed into a CECSi cell population, these unintended cells may change into pigment cells containing melanin pigment that cause pigment deposition on the posterior surface of the cornea after transplantation of the CECSi cell population. Such unintended cells are referred to herein as "pigment cells." Pigment cells may be cells that already contain (exhibit) melanin pigment, or cells that can change into cells containing (exhibit) melanin pigment over time. In this specification, the latter is also referred to as "pigment progenitor cells," but in this specification, "pigment cells" is a concept that includes "pigment progenitor cells," and unless otherwise specified, "pigment cells" in this invention refers to both pigment cells and pigment progenitor cells.

[0012] In the present invention, the CECSi cell population can be prepared from induced pluripotent stem cells (iPS cells), preferably mammalian-derived iPS cells, by commonly practiced methods or according to previously reported information.

[0013] iPS cells include, for example, cells that have acquired multipotency similar to ES cells by introducing multiple genes into somatic cells such as skin cells. Examples include iPS cells obtained by introducing the Oct3 / 4 gene, Klf4 gene, C-Myc gene, and Sox2 gene (Nat Biotechnol 2008; 26: 101-106). In addition, various methods for creating iPS cells have been diligently refined, including methods that further reduce the number of introduced genes (Nature. 2008 Jul 31;454(7204):646-50), methods that utilize small molecule compounds (Cell Stem Cell. 2009 Jan 9;4(1):16-9, Cell Stem Cell. 2009 Nov 6;5(5):491-503, Science, 2013, 341, pp.651-654), and methods that utilize transcription factor proteins instead of genes (Cell Stem Cell. 2009 May 8;4(5):381-4). However, the fundamental properties of the created iPS cells, namely their multipotency, are the same regardless of the method of creation, and all of these methods can be used as the source of the CECSi cell population used in this invention.

[0014] There are no particular limitations on the somatic cells used in the production of iPS cells, but examples include tissue-derived fibroblasts, hematopoietic cells (e.g., peripheral blood mononuclear cells, T cells, etc.), hepatocytes, pancreatic cells, intestinal epithelial cells, and smooth muscle cells.

[0015] When iPS cells are reprogrammed by expressing several genes (e.g., four factors: Oct3 / 4, Sox2, Klf4, and Myc), the means for expressing these genes are not particularly limited. Examples of means for expressing genes include infection methods using viral vectors (e.g., retroviral vectors, lentiviral vectors, Sendai virus vectors, adenovirus vectors, adeno-associated virus vectors), gene transfer methods using plasmid vectors (e.g., plasmid vectors, episomal vectors) (e.g., calcium phosphate method, lipofection method, retronectin method, electroporation method), gene transfer methods using RNA vectors (e.g., calcium phosphate method, lipofection method, electroporation method), and direct protein injection methods.

[0016] It is also possible to obtain iPS cells that have been categorized into cell lines. Specifically, the iPS cells include 201B7, 201B7-Ff, 253G1, 253G4, 1201C1, 1205D1, 1210B2, 836B3, FF-I14s03, FF-I01s04, MH09s01, Ff-XT18s02, Ff-WIs03, Ff-WJs513, Ff-CLs14, Ff-KVs09, QHJI14s03, QHJI01s04, RWMH09s01, DRXT18s02, RJWIs03, YZWJs513, ILCLs14, GLKVs09, Ff-XT28s05-ABo_To, Ff-I01s04-ABII-KO, Ff-I14s04-ABII- KO (all from iPS Academia Japan, Inc. or Kyoto University iPS Research Foundation), Tic (JCRB1331 strain), Dotcom (JCRB1327 strain), Squeaky (JCRB1329 strain), and Toe (JCRB1338 strain), Lollipop (JCRB1336 strain) (all from the National Center for Child Health and Development, the Department of Rare Diseases and Disease Resources Research at the National Institute of Biomedical Innovation, and the JCRB Cell Bank), UTA-1 strain and UTA-1-SF-2-2 strain (both from the University of Tokyo), strains 21526, 21528, 21530, 21531, 31536, and 31538 (all from Fujifilm Cellular Dynamics, Inc.), etc. can be used.

[0017] The CECSi cell population used in the present invention includes, for example, corneal endothelial-like cells developed by the present inventors (Patent Documents 1-3), and can be manufactured and prepared by the methods described in Patent Documents 1-3. Preferably, it may be a corneal endothelial cell substitute from iPS cells (including cells to which additional functions have been conferred by gene editing or gene transfer) that has corneal endothelial cell-like properties and functions and is characterized by enhanced gene expression of NR3C2 (nuclear receptor subfamily 3, group C, member 2) (Patent Document 3).

[0018] The corneal endothelial cell-like properties and functions of corneal endothelial cell substitutes include, specifically, the following characteristics (i) to (iv), and corneal endothelial cell substitutes possess at least one, preferably two, more preferably three, and even more preferably all four of these characteristics: (i) Cell-to-cell adhesion is composed of N-Cadherin. (ii) Tight junctions are formed between cells. (iii) Na,K-ATPase α1 subunit is expressed on the cell membrane. (iv) Expression of the transcription factor PITX2 is observed in the cell nucleus. Whether or not cell-to-cell adhesion is composed of N-Cadherin can be confirmed by immunostaining for N-Cadherin. Whether or not tight junctions are formed between cells can be confirmed by observing the presence of ZO-1, a protein that constitutes tight junctions, by immunostaining for ZO-1. Alternatively, it can be confirmed by directly observing the structure with an electron microscope. Whether or not the Na,K-ATPase α1 subunit (ATP1A1) is expressed on the cell membrane can be confirmed by immunostaining for ZO-1 and the Na,K-ATPase α1 subunit, which will show co-staining of both. Whether or not the transcription factor PITX2 is expressed in the cell nucleus can be confirmed by immunostaining for PITX2.

[0019] The term "mammals" includes rodents, ungulates, carnivora, lagomorphs, primates, etc. Rodents include mice, rats, hamsters, guinea pigs, etc. Ungulates include pigs, cattle, goats, horses, sheep, etc. Carnivora includes dogs, cats, etc. Lagomorphs include rabbits, etc. "Primates" refers to mammals belonging to the order Primates, and includes prosimians such as lemurs, lorises, and zwei, and anthropoids such as monkeys, apes, and humans.

[0020] The iPS cells used in the present invention are mammalian iPS cells, preferably rodent (e.g., mouse, rat) or primate (e.g., human, monkey) iPS cells, and most preferably human iPS cells.

[0021] One example of a method for producing CECSi cell populations is, but is not limited to, the following: iPS cells are treated with iMatrix-511 (0.6 μg / cm³). 2 The cultures are then incubated for one week in a culture dish coated with ) using StemFit® AK03N medium (Ajinomoto Healthy Supply Co., Ltd.). After that, iMatrix-511 (0.3 μg / cm³) is added. 2 The cells are re-seed into culture dishes coated with iMatrix-511 (0.6 μg / cm³), and differentiation induction culture from iPS cells to corneal endothelial substitute cells is performed for 14 days using the differentiation induction medium (Table 1) listed below. If using cryopreserved iPS cells, the iPS cells are thawed and treated with iMatrix-511 (0.6 μg / cm³). 2 After culturing for 18 days in a culture dish coated with ), using StemFit® AK03N medium (Ajinomoto Healthy Supply Co., Ltd.) (with two subculturings during the process), differentiation induction is performed.

[0022]

[0023] The CECSi cell population can be cultured on a larger scale as desired and then cryopreserved. The method for freezing and preserving the CECSi cell population is not particularly limited and can be carried out using methods commonly used for cell cryopreservation. Preferably, the cells are frozen and stored at -70°C or below, more preferably at -80°C or below. The storage period is not particularly limited, but typically ranges from several weeks to one year, preferably two weeks to six months, and can be preserved without impairing the viability after thawing.

[0024] Cell cryopreservation refers to the process of preserving cells for long-term storage without subculturing. It is known that freezing cells directly can lead to ice crystal formation due to the water content within the cells. These growing ice crystals can damage the cell membrane, a phenomenon known as cryoprotection. Therefore, cryopreservation solutions contain cryoprotective agents to prevent this damage.

[0025] The cryoprotective agent is not particularly limited as long as the objective of preventing frost damage is achieved, but examples include cell-permeable cryoprotective agents and cell-impermeable cryoprotective agents. Examples include dimethyl sulfoxide (DMSO), ethylene glycol, carboxylated polylysine, glycerol, propylene glycol, sericin, propanediol, dextran, polyvinylpyrrolidone, polyvinyl alcohol, hydroxyethyl starch, chondroitin sulfate, polyethylene glycol, formamide, acetamide, adonitol, perseitol, raffinose, lactose, trehalose, sucrose, and mannitol. The cryoprotective agent may be used alone or in combination of two or three or more types. Preferably, the commonly used DMSO is used.

[0026] The cryopreservation solution may contain a medium for dissolving and / or diluting a cryoprotectant and maintaining cell viability. The medium is not particularly limited as long as it has the above functions, and physiological saline, various physiological buffers (e.g., PBS, HBSS, etc.), and those based on various basal media for cell culture may be used. Examples of the basal medium include MEM medium, BME medium, BGJb medium, CMRL 1066 medium, Glasgow MEM medium, Improved MEM Zinc Option medium, IMDM medium, Medium 199 medium, Eagle MEM medium, αMEM medium, DMEM medium, Ham's medium (e.g., F10, F12), RPMI 1640 medium, Fischer's medium, and mixed media thereof. Any medium that can be used for culturing animal cells is not particularly limited. These media are commercially available. Furthermore, these media can be serum-containing media or serum-free media. Preferably, they are serum-free media. When the medium used in the present invention is a serum-containing medium, mammalian sera such as bovine serum and fetal bovine serum can be used, and the concentration of the serum in the medium is 0.1 to 20% (v / v), preferably 1 to 10% (v / v).

[0027] The addition concentration of the cryoprotectant to the cryopreservation solution, or the concentration of the cryoprotectant in the cryopreservation solution, is not particularly limited as long as it does not excessively deteriorate the quality of the cells by the freezing and thawing operations. Typically, for example, it can be about 1% to about 60% (v / v), about 2% to about 50% (v / v), about 5% to about 40% (v / v), about 5% to about 20% (v / v), about 10% to about 20% (v / v), etc. with respect to the entire cryopreservation solution. When the cryoprotectant is DMSO, for example, it is included at 10 to 20% in the cryopreservation solution.

[0028] Commercially available cryopreservation solutions (e.g., Cell Banker (registered trademark), Ban Banker (registered trademark)) that already contain a cryoprotectant can also be preferably used.

[0029] CECSi cell populations, after cryopreservation, can be thawed, re-seeded, and further cultured. Cell culture during expansion is preferably carried out in a culture medium specifically for CECSi cells. Such culture media can be any known medium and are not particularly limited, but examples include DMEM, DMEMHG, EMEM, IMDM (Iscove's Modified Dulbecco's Medium), GMEM (Glasgow's MEM), RPMI-1640, α-MEM, Ham's Medium F-12, Ham's Medium F-10, Ham's Medium F12K, Medium 199 (M199), ATCC-CRCM30, DM-160, DM-201, BME, Fischer, McCoy's 5A, Leibovitz's L-15, RITC80-7, MCDB105, MCDB107, MCDB131, MCDB153, MCDB201, NCTC109, NCTC135, Waymouth's MB752 / 1, CMRL-1066, Williams' medium E, and Brinster's BMOC-3. Examples include medium, human endothelial SFM (HE-SFM), and mixed media thereof.

[0030] The medium can contain additives known per se. The additives are not particularly limited as long as they do not inhibit the growth of cells, especially CECSi cells. Examples include growth factors (such as insulin, etc.), iron sources (such as transferrin, etc.), polyamines (such as putrescine, etc.), minerals (such as sodium selenate, etc.), saccharides (such as glucose, etc.), organic acids (such as pyruvic acid, lactic acid, etc.), amino acids (such as L-glutamine, etc.), reducing agents (such as 2-mercaptoethanol, etc.), vitamins (such as ascorbic acid, d-biotin, etc.), steroids (such as β-estradiol, progesterone, etc.), antibiotics (such as streptomycin, penicillin, gentamicin, etc.), buffers (such as HEPES, etc.), lipids (such as linoleic acid, etc.), nucleic acids (such as thymidine, etc.). Also, additives known per se that have been conventionally used for culturing pluripotent stem cells can be appropriately included. The additives are preferably contained within the concentration ranges known per se. Further, supplements (such as B-27 supplement, ITS supplement, etc.) obtained by appropriately combining multiple types of the above components may also be included.

[0031] The medium may contain serum. The serum is not particularly limited as long as it is animal-derived serum and does not inhibit the growth of cells, especially pluripotent stem cells, preferably iPS cells. Preferably, it is mammalian-derived serum (such as fetal bovine serum, human serum, etc.), more preferably human serum. The concentration of the serum may be within the concentration range known per se.

[0032] The incubator used for cell culture is not particularly limited as long as it can culture the target cells, especially pluripotent stem cells, preferably iPS cells. Examples include flasks, tissue culture flasks, dishes, Petri dishes, tissue culture dishes, multi-dishes, microplates, microwell plates, multi-plates, multiwell plates, microslides, chamber slides, petri dishes, tubes, trays, culture bags, and roller bottles.

[0033] The culture vessel may be cell-adherent or non-cell-adherent, and the appropriate choice depends on the purpose. Cell-adherent culture vessels may be coated with any cell-supporting substrate, such as an extracellular matrix (ECM), to improve cell adhesion to the vessel surface. The cell-supporting substrate may be any substance intended for cell adhesion.

[0034] The culture temperature is not particularly limited, but may be approximately 30-40°C, preferably approximately 37°C. 2 The concentration may be about 1-10%, preferably about 2-5%. The partial pressure of oxygen may be 1-10%.

[0035] The inventors have found that pigment cells may be present as unintended cells in the CECSi cell population prepared and / or cultured in this manner. By detecting pigment cells in the cell population, it is possible to determine the extent to which unintended cells are present, which contributes to quality control of the CECSi cell population. The method for detecting pigment cells is not particularly limited as long as it is possible to detect the melanin pigment expressed by the cells or to detect cells that can potentially transform into pigment cells in the future. DOPA staining is one method for detecting pigment cells. DOPA staining is a method for detecting melanin by utilizing the activity of tyrosinase, an enzyme involved in the biosynthesis of melanin pigment. In particular, it is possible to visualize cells that produce melanin in tissue sections or fixed cultured cells. The specific procedure is as follows: (1) Prepare the sections and immerse them in a staining solution containing 3,4-dihydroxyphenylalanine (DOPA); (2) Incubate the sections, and the DOPA will be oxidized by the activity of tyrosinase, forming a melanin-like substance that appears dark brown to black; (3) By observing the stained sections, melanin-producing cells, i.e., pigment cells, can be identified. With DOPA staining, pigment cells cannot be detected relatively early after CECSi cell population seeding (e.g., day 7), but by continuing the culture for a certain period (e.g., several weeks to one month), it is possible to detect the contaminating pigment cells, and the procedure is simple.

[0036] Alternatively, considering the melanin biosynthesis pathway (Figure 3), attention may be focused on pigment cell-related genes whose expression fluctuates at each stage. Specifically, examples include SOX10, PAX3, MITF, TYRP1, PMEL17, etc. As will be described later in the examples, TYRP1 gene expression, in particular, shows a high correlation with the detection of pigment cells and allows for early detection; therefore, TYRP1 gene expression is a preferred indicator for detecting pigment cells mixed in with the CECSi cell population. Specifically, tools are used to evaluate the expression of each gene. Examples of such tools include primer sets (pairs of forward primers and reverse primers) used in methods utilizing DNA amplification reactions (PCR method). If detection at the protein level is possible, antibodies, etc., can be used as such tools.

[0037] (1) Method utilizing amplification reaction (PCR method) In the present invention, the expression of pigment-related genes can be detected simply and with high accuracy using polymerase chain reaction (PCR), preferably quantitative PCR. Primer design methods are well known in the art, and primers usable in the present invention are designed to satisfy the conditions for specific annealing, for example, having a length and base composition (melting temperature) that allows for specific annealing. For example, the length for which a primer functions is preferably 10 bases or more, more preferably 15 to 50 bases, and even more preferably 15 to 30 bases. When designing, it is also preferable to check the GC content of the primer and the melting temperature (Tm) of the primer. Tm means the temperature at which 50% of any nucleic acid strand forms a hybrid with its complementary strand, and in order for the template DNA and primer to form a double helix and anneal, it is necessary to optimize the annealing temperature. On the other hand, if this temperature is lowered too much, nonspecific reactions will occur, so it is desirable that the temperature be as high as possible. Known primer design software can be used to check Tm. The designed primers can be chemically synthesized using known oligonucleotide synthesis methods, but are usually synthesized using commercially available chemical synthesis equipment. Preferably, commercially available primer pairs are used.

[0038] In a specific embodiment, for example, the following primer sets are given: TYRP1 (forward primer: CTCAATGGCGGAGTGGCTTGTG (SEQ ID NO: 1), reverse primer: ACGTTGCAACCATTGGTCTGG (SEQ ID NO: 2)) PMEL17 (forward primer: GCCTCCTTTGCTCCATTCCAGCTC (SEQ ID NO: 3), reverse primer: GTGCTTGTTCCCTCCATCCCA (SEQ ID NO: 4)) MITF (forward primer: CTCGAGCTCCATGGGAACTTTCC (SEQ ID NO: 5), reverse primer: GATGCCTGAAGGAGGCTTTGG (SEQ ID NO: 6))

[0039] The amplification reaction is not particularly limited, but known methods utilizing the principle of polymerase chain reaction (PCR) can be cited. Amplification is carried out until the amplification product reaches a detectable level. The optimal conditions for PCR can be easily determined by those skilled in the art. To detect whether a specific amplification reaction has occurred after the above amplification reaction, known means capable of specifically recognizing the amplification product obtained by the amplification reaction can be used. For example, a specific amplification reaction can be detected by confirming whether an amplification fragment of a specific size has been amplified using agarose gel electrophoresis or the like. The size of the amplification product can be estimated based on the nucleotide sequence between the designed primers.

[0040] Alternatively, the presence or absence of amplification of nucleic acid fragments can be detected based on labels attached to primers or substrates. For example, dNTPs incorporated during the amplification reaction can be treated with labels such as radioactive isotopes, fluorescent substances, or luminescent substances, and these labels can be detected. Examples of radioactive isotopes include: 32 P, 125 I, 35S and other substances can be used. As fluorescent substances, for example, fluorescene (FITC), sulfohodamine (TR), and tetramethylrhodamine (TRITC) can be used. As luminescent substances, luciferin can be used. There are no particular restrictions on the types of labels or methods for introducing them; various conventionally known methods can be used. For example, a random priming method using radioactive isotopes can be used as a method for introducing the labels.

[0041] As for observing the amplification product incorporating the labeled dNTP, any method known in the art for detecting the labeled substance described above may be used. For example, if a radioactive isotope is used as the labeled substance, its radioactivity can be measured using, for example, a liquid scintillation counter or a γ-counter. If fluorescence is used as the labeled substance, its fluorescence can be detected using a fluorescence microscope or a fluorescence plate reader.

[0042] (2) Detection at the protein level When detecting the expression of each gene at the protein level, this can be done by immunoassay (immunological assay). The expression of the protein is measured based on its reaction with an antibody that specifically binds to the protein. The immunoassay may be performed in either a liquid-phase or solid-phase system, as long as it is a method commonly used in the field. The form of the immunoassay is also not limited, and in addition to the direct solid-phase method, it may also be the sandwich method, competitive method, Western blotting method, ELISA (enzyme-linked immunosorbent assay), etc.

[0043] The binding (reaction) between proteins and antibodies can be measured according to well-known methods. Those skilled in the art can determine the effective and optimal measurement method for each immunoassay, depending on the type and format of the immunoassay employed and the type of label used. For example, to easily detect the binding of proteins and antibodies in a sample, the binding can be directly detected by labeling the antibody, or indirectly detected by using a labeled secondary antibody or a biotin-avidin complex, etc.

[0044] As labels for labeling antibodies used in immunoassays, enzymes, radioisotopes, fluorescent dyes, or avidin-biotin systems can be used. As enzymes, enzymes used in ordinary enzyme immunoassays (EIA), such as peroxidase, β-galactosidase, alkaline phosphatase, etc. can be used. As radioisotopes, 125 I and 3 those used in ordinary radioimmunoassays (RIA) such as H can be used. As fluorescent dyes, those used in ordinary fluorescent antibody methods such as fluorescein isothiocyanate (FITC) and tetramethylrhodamine isothiocyanate (TRITC) can be used.

[0045] Detection of the label signal can also be carried out according to methods known in the art. For example, when using an enzyme label, a substrate that decomposes and develops color by the action of the enzyme is added, the amount of substrate decomposition is optically measured to determine the enzyme activity, this is converted into the amount of bound antibody, and the amount of antibody is calculated by comparison with a standard value. The substrate varies depending on the type of enzyme used. For example, when using peroxidase as the enzyme, 3,3',5,5'-tetramethylbenzidine can be used, and when using alkaline phosphatase as the enzyme, p-nitrophenol, etc. can be used. When using a radioactive label, the amount of radiation emitted by the radioactive label is measured using a scintillation counter or the like. Fluorescent labels can be detected and quantified using, for example, a fluorescence microscope, a plate reader, etc.

[0046] 2. Method for Reducing the Contamination of Pigment Cells in Cell Populations Containing iPS Cell-Derived Therapeutic Corneal Endothelial Replacement Cells (CECSi Cell Populations) The inventors have found that when pigment cells are present in CECSi cell populations, brown pigment deposits appear on the posterior surface of the cornea after transplantation. Therefore, they investigated whether it is possible to reduce the contamination of pigment cells as much as possible when expanding the cell population before transplantation. As a result, they found that the contamination of pigment cells can be suppressed by culturing (additional culture) in the presence of the FGF family, preferably bFGF. The FGF family includes multiple members with diverse physiological activities. FGF1 (acid fibroblast growth factor), bFGF (basic fibroblast growth factor, FGF2), FGF3, FGF4, FGF5, FGF6, FGF7 (keratinocyte growth factor), FGF8-23, etc. are known. The amount of FGF family used in this method is not particularly limited as long as it can significantly suppress the contamination of pigment cells, and can be appropriately adjusted depending on the type of basal culture medium and other components used. Typically, by culturing cells in a medium containing the FGF family at a concentration of 1 to 1000 ng / ml, preferably 10 to 500 ng / ml, more preferably 15 to 200 ng / ml, and even more preferably 20 to 100 ng / ml for 2 to 30 days, 2 to 10 days, preferably 4 to 9 days, more preferably 5 to 8 days, and even more preferably about 1 week, the proportion of pigment cells in the cell population can be reduced without impairing the cell's proliferative capacity. The medium used for additional culture of the CECSi cell population is also called the additional culture medium. During the additional culture period, the medium is changed at a frequency of once every 1 to 3 days, preferably once every 1 to 2 days, if desired. Although culturing in a medium containing the FGF family is preferably performed during the additional culture of the CECSi cell population, it can also be performed in the process of producing the CECSi cell population, i.e., in the process of inducing differentiation from iPS cells to CECSi cells, if desired. The use of the FGF family in the process of producing the CECSi cell population may enable the acquisition of a CECSi cell population of higher purity. In that case, the cells are cultured in the presence of the FGF family for about 8 days, preferably 2 to 7 days, more preferably 3 to 6 days, before the differentiation induction from iPS cells to CECSi cells is completed.Specifically, when inducing differentiation from iPS cells to CECSi cells over 32 days, the FGF family is added to the culture medium from day 24, preferably from day 25, and more preferably from day 26, after the start of differentiation induction. The timing of FGF family addition may be the period after differentiation induction when MITF and / or TYRP1 expression increases, as shown in the examples described later. The CECSi cell population prepared by culturing in a medium containing the FGF family can be frozen and stored until use.

[0047] The present invention will be described in detail below with reference to examples, but the present invention is not limited in any way to the following examples. Furthermore, the reagents and materials used are commercially available unless otherwise specified. Unless otherwise noted, abbreviations used herein are the same as those commonly used in the art.

[0048] Example 1 <<Materials and Methods>> 1. Method for producing CECSi cells (1) iPS cell maintenance culture (adherent culture) process Y27632 was added to iPS cell medium AK03N (Ajinomoto Healthy Supply Co., Ltd.) at a concentration of 10 μM (hereinafter referred to as AK03N + Y medium). A T12.5 flask (Corning) for culture was coated with iMatrix 511 at a concentration of 3.2 μg / ml. 1.0 × 10⁻⁶ iPS cells (FF-I01s04 strain) 4 cells / cm 2 The seeds were suspended in AK03N+Y medium at the specified density and seeded into this T12.5 flask. CO2 was 37°C. 2Culture was started in an incubator, and the following day the medium was changed to AK03N medium that does not contain Y27632. Thereafter, the medium was changed every 2-3 days, and from the 4th day of culture onwards, the medium was changed daily. The iPS cells were collected once a week using TrypLE-Select (Thermo Fisher Scientific) and seeded under the same conditions as above into iMatrix 511 coated T25 culture flasks (Sumitomo Bakelite) or T150 culture flasks (Sumitomo Bakelite), and the medium was changed. For induction into CECSi cells, iPS cells of 3 to 29 passages were used. (2) Differentiation induction into CECSi cells (adherent culture) process The iPS cells were collected from the T150 flask using TrypLE-Select and suspended in the following <CECSi cell induction medium-1>. A T150 culture flask (Sumitomo Bakelite) was coated with iMatrix 511 at a concentration of 1.5 μg / mL, and 1.0 × 10⁶ iPS cells were placed in it. 4 cells / cm 2 Seeds were sown at this density. CO2 at 37°C. 2Culturing was started in an incubator, and the culture medium was changed every 2-3 days, and then daily from day 9 of culture onwards. On day 14 of culture, CECSi cells were harvested from a T150 flask using Accutase (Innovative Cell Technologies), washed with a washing solution, suspended in freezing medium (GC LYMPHOTEC Inc.), and frozen and stored at -70°C or below. <CECSi Cell Induction Medium - 1> ・DMEM / F12 ・AOF-ITS supplement; 1× ・IGF1 (human recombinant); 10 ng / mL ・LIF (human recombinant); 10 ng / mL ・IL6 (human recombinant); 10 ng / mL ・IL11 (human recombinant); 5 ng / mL ・TNFα (human recombinant); 10 ng / mL ・Hydrocorton; 100 ng / mL <Scaffold material (coating agent)> ・iMatrix-511 (laminin 511 E8 fragment) <Freezing medium (GC LYMPHOTEC Inc.) > ・DMSO ・Human serum albumin ・D-glucose ・HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) ・RPMI1640 (containing L-glutamine and phenol red) medium ・DPBS (Dulbecco's Phosphate-Buffered Saline; KCl, NaCl, KH 2 PO 4 , Na 2 HPO 4 ) ・Sodium bicarbonate ・Distilled water for injection <Washing solution> ・DMEM / F12 (DMEM / F12 no phenyl red immediately before suspension in frozen medium) ・AOF-ITS supplement; 1× ・IGF1; 50 ng / mL ・Y27632; 10 μM

[0049] 2. Detection of pigment cells in CECSi cell population (1) The CECSi cell population was tested using iMatrix 511 (iMatrix511MG: matrixosome: Cat. 892005) at a concentration of 0.25 μg / cm³. 2 6.15 × 10 in cell culture wells coated with 5 cells / cm 2 or 3.08 × 10 5 cells / cm 2 After seeding cells at the specified density, culturing them for a certain period in the following <Specific Medium A> will produce pigment cells containing melanin pigment. <Specific Medium A> ・DMEM / F12 (Thermo Fisher Scientific: Cat. 11330-032) + B-27 supplement (B-27 TM Supplement (50X), serum free: gibco: Cat. 17504044), or DMEM / F12+ITS supplement(ITS AF TM-Blood-free cell culture media supplement (100X): In Vitria: Cat. 777ITS091) (2) After culturing the CECSi cell population in the above-mentioned specific medium A for a certain period of time, melanin-containing pigment cells are detected by immunohistochemical staining for TYRP1 (tyrosinase-related protein), PMEL17 (melanosome protein), MITF (microphthalmia-related transcription factor), preferably TYRP1. Alternatively, their gene expression is detected by quantitative PCR. Alternatively, DOPA staining is performed. - Immunostaining blocking solution: Incubate at room temperature for 30 minutes with 10% normal donkey serum and 0.1% Triton-X in D-PBS (-), then incubate overnight at 4°C with rabbit anti-human TYRP1 (novusbio, Cat. NBP3-07156) 1:100 and mouse anti-human Pmel17 (Santa Cruz, Cat. Sc-377325) 1:200. After that, incubate at room temperature for 1 hour with donkey anti-rabbit Cy-3 (Jackson, 711-165-152) 1:200 and donkey anti-mouse Alexa flour 488 (Invitrogen, A21202) 1:200 before mounting. Quantitative PCR TYRP1 (forward primer: CTCAATGGCGGAGTGGCTTGTG (SEQ ID NO: 1), reverse primer: ACGTTGCAACCATTGGTCTGG (SEQ ID NO: 2)) PMEL17 (forward primer: GCCTCCTTTGCTCCATTCCAGCTC (SEQ ID NO: 3), reverse primer: GTGCTTGTTCCCTCCATCCCA (SEQ ID NO: 4)) MITF (forward primer: CTCGAGCTCCATGGGAACTTTCC (SEQ ID NO: 5), reverse primer: GATGCCTGAAGGAGGCTTTGG (SEQ ID NO: 6)) ・DOPA staining DOPA staining is a simple staining method used to identify melanin pigment. It visualizes the melanin pigment produced by adding an excess of tyrosinase substrate. The prepared 0.1% DOPA solution (L-DOPA:Sigma:Cat.D9628-5G 0.01g in D-PBS 10mL) is added to cells fixed with 4% paraformaldehyde and incubated at 37°C for 2 hours.(3) The CECSi cell population was cultured for one week in a medium containing bFGF (FGFbasic: Peprotech: Cat. 100-18B) added to the following <Specific Medium B>. <Specific Culture Medium B> Human Endothelial SFM (HE-SFM, ThermoFisher Scientific, Cat. 11111044), M199 medium (Medium 199, HEPES, ThermoFisher Scientific, Cat. 12340030), RPMI medium (RPMI 1640 Medium, HEPES, ThermoFisher Scientific, Cat. 22400089), DMEM / F12 + ITS medium, and mixed media thereof. Preferably, Specific Culture Medium B is HE-SFM, M199 medium, DMEM / F12 + ITS, or mixed media thereof. The concentration of bFGF is 1 to 1000 ng / ml, more preferably 20 to 100 ng / ml.

[0050] <<Experimental Results>> (1) The cryopreserved CECSi cell population was cultured for one month in DMEM / F12+B-27 supplement medium on cell culture wells coated with iMatrix 511. DOPA staining to identify melanin pigment and TYRP1 immunostaining were performed, and as shown in Figure 1, DOPA-positive cells and TYRP1-positive cells matched in some cells. From these results, it was found that even if some pigment cells were mixed in with the CECSi cell population, pigment cells containing melanin pigment could be detected by culturing for a certain period and DOPA staining, and furthermore, these pigment cells containing melanin pigment could also be detected by TYRP1 immunostaining.

[0051] (2) Four lots of CECSi cell populations were fixed, and sequencing libraries were prepared using Chromium Fixed RNA Kit (10× Genomics) and ChromiumX (10× Genomics). The prepared sequencing libraries were clustered using NovaSeq X Plus (Illumina) and NovaSeq X Series 10B Reagent Kit (Illumina), and then sequenced. Based on this sequencing data, single-cell expression analysis was performed using Cell Ranger version 8.0.1 (10× Genomics). From the results of this single-cell expression analysis, it was confirmed that TYRP1-positive cells accounted for 3-5% of the CECSi cell population (Figure 2).

[0052] (3) Furthermore, when comparing the values ​​calculated using the BZ-X800 Analyzer (KEYENCE) for the fraction of TYRP1-positive pigment cells that appeared when the CECSi cell population was cultured for one month as described in (1), with the relative expression rate of the TYRP1 gene measured by quantitative PCR in the CECSi cell population (frozen cells) before culture, a high correlation was observed (correlation coefficient R = 0.864). The correlation coefficient R = 0.724 was observed between the fraction of pigment progenitor cells measured by the BZ-X800 Analyzer and the relative expression rate by MITF quantitative PCR, and the correlation coefficient R = 0.518 was observed for the relative expression rate by PMEL17 quantitative PCR. From these results, it was found that among pigment cell-related genes, quantitative PCR of TYRP1 is the most appropriate for detecting pigment progenitor cells in the CECSi cell population and, consequently, for quality control of the cell population.

[0053] (4) When the frozen CECSi cell population was thawed and seeded in HE-SFM + bFGF (20 ng / ml) medium and cultured for one week, the relative expression level of TYRP1 measured by quantitative PCR was found to decrease from 56.07 before culture to 1.00 after culture. Furthermore, when cultured for one week in DMEM / F12 + ITS supplement + bFGF (20 ng / ml) medium, the relative expression level of TYRP1 measured by quantitative PCR was found to decrease from 43.79 before culture to 0.29 after culture, and when cultured for one week in DMEM / F12 + ITS supplement + bFGF (100 ng / ml) medium, the relative expression level of TYRP1 measured by quantitative PCR was found to decrease from 43.79 before culture to 0.24 after culture. Therefore, it was found that by adding bFGF and further culturing the CECSi cell population, the number of pigment progenitor cells that may contaminate the CECSi cell population can be reduced, ultimately resulting in the production of a CECSi cell population of higher quality. Similar results were obtained when cultured for four weeks.

[0054] (5) The cryopreserved CECSi cell population was thawed and seeded in a medium of DMEM / F12 + ITS supplement + bFGF (20 ng / ml) and cultured for one week. As shown in (4), the relative expression level of TYRP1 by quantitative PCR was sufficiently reduced, and a linear staining pattern of the protein ZO-1, which indicates tight junction formation, was confirmed (Figure 4). When the cells were similarly cultured in a medium of M199 + ITS supplement + bFGF (20 ng / ml), the relative expression level of TYRP1 by quantitative PCR decreased from 43.79 before culture to 0.38 after culture, but cell proliferation was poor (Figure 5), and the staining pattern of ZO-1 was disordered (Figure 6). To promote cell proliferation, Albumin (human and plant recombinant expression: Fujifilm Wako Pure Chemical Corporation, Cat. 018-21541) was added at a concentration of 0.5 g / L. When cells were cultured in the same medium of M199 + ITS supplement + bFGF (20 ng / ml) + Albumin (0.5 g / L), the relative expression level by quantitative PCR of TYRP1 decreased from 43.79 before culture to 0.92 after culture, and the ZO-1 staining pattern also improved (Figure 7). Although cell proliferation improved, it did not match the results obtained when cultured in HE-SFM + bFGF (20 ng / ml) medium (Figure 5). Similar results were obtained when the bFGF concentration was 100 ng / ml. To further promote cell proliferation, M199 and DMEM / F12 were mixed in a 9:1 ratio, and the cells were cultured in the same medium of M199 + DMEM / F12 + ITS supplement + bFGF (20 ng / ml) + Albumin (0.5 g / L). As a result, the relative expression level of TYRP1 by quantitative PCR decreased from 43.8 before culture to 0.858 after culture (Figure 9, right panel), the ZO-1 staining was good (Figure 8), and cell proliferation became comparable to that of culture in HE-SFM + bFGF (20 ng / ml) medium (Figure 9, left panel). Therefore, it was found that in order to reduce the number of pigment progenitor cells that may be mixed into the CECSi cell population and ultimately produce a higher quality CECSi cell population, a culture medium of M199 + DMEM / F12 + ITS supplement + bFGF (20 ng / ml) + Albumin (0.5 g / L) can be used in the additional culture of the CECSi cell population.

[0055] Example 2 <<Materials and Methods>> 1. Method for producing CECSi cells (1) Expansion culture process of iPS cells The cryopreserved iPS cells were thawed, and the cell suspension was seeded in a T25 flask coated with iMatrix511 (Day 0 of culture). After seeding, the culture was maintained at 37°C and 5% CO2. 2 The cells were cultured for 6 days under the following conditions. The culture medium was changed with AK03N on days 1, 4, and 5 of culture. On day 6 of culture, the culture medium was discarded, and the cells were detached and collected using CTS TripLE Select (Thermo Fisher Scientific, Cat. A12859-01). The collected iPS cells were seeded in a T25 flask coated with iMatrix-511 (on day 6 of culture). After seeding, the cells were incubated at 37°C and 5% CO2. 2 The cells were cultured for a further 6 days under these conditions. The culture medium was changed with AK03N (Ajinomoto Healthy Supply Co., Ltd.) on days 7, 10, and 11 of culture. On day 12 of culture, the culture medium was discarded, and the cells were detached and collected using CTS TripLE Select (Thermo Fisher Scientific, Cat. A12859-01). The collected iPS cells were seeded in a T150 flask coated with iMatrix-511 (on day 12 of culture). After seeding, the cells were cultured at 37°C and 5% CO2. 2 The cells were cultured for a further 6 days under the following conditions. The culture medium was changed with AK03N (Ajinomoto Healthy Supply Co., Ltd.) on days 13, 16, and 17 of the culture. On day 18 of the culture, the culture medium was discarded, and the cells were detached and collected using CTS TripLE Select (Thermo Fisher Scientific, Cat. A12859-01). (2) Differentiation induction process to CECSi cells (with and without bFGF) The collected iPS cells were suspended in the following <CECSi cell induction medium-1> and then seeded in a T150 flask coated with iMatrix511 (day 0 of culture). After seeding, the cells were cultured at 37°C and 5% CO2. 2The cells were cultured for 11 days under these conditions. For some cells, from day 29 of culture onwards, the culture medium was changed with induction medium to which bFGF (Peprotech, Cat. 100-18B-10UG) was added to a final concentration of 20 ng / mL, and the culture was continued until day 32. The cells were harvested using Accutase (Innovative Cell Technologies #AT104-100ML) and stored in cell preservation solution Banbankar hRM (Nippon Genetics #CS-07-001) in 1 x 10⁶ units. 7 The cells were suspended at a density of cells / mL and stored frozen at -70°C or below. <CECSi Cell Induction Medium - 2> ・DMEM / F12 ・AOF-ITS supplement; 1× ・IGF1 (human recombinant); 10 ng / mL ・LIF (human recombinant); 10 ng / mL ・IL6 (human recombinant); 10 ng / mL ・IL11 (human recombinant); 5 ng / mL ・TNFα (human recombinant); 10 ng / mL ・Hydrocorton; 100 ng / mL <Scaffolding Material (Coating Agent)> ・iMatrix-511 (laminin 511 E8 fragment)

[0056] 2. Detection of pigment cells in the CECSi cell population (1) Samples for quantitative PCR were prepared from the cell population between day 23 and day 32 of the differentiation induction process without bFGF addition (which can be called a CECSi cell population as almost all of them were differentiated into CECSi cells), and from the CECSi cell population that had been frozen after the completion of production and then thawed. The gene expression of OCT4 (octamer-binding transcription factor 4), TYRP1 (tyrosinase-related protein), and MITF (microphthalmia-related transcription factor) was detected by quantitative PCR. Quantitative PCR method OCT4: Used in experimental results (1) (forward primer: GAAACCCAACACTGCAGCAGA (SEQ ID NO: 7), reverse primer: TCGCTTGCCCTTCTGGCG (SEQ ID NO: 8)) OCT4: Used in experimental results (2) (QIAGEN: Cat. QT00210840, sequence not disclosed) TYRP1 (forward primer: CTCAATGGCGAGTGGTCTTGG (SEQ ID NO: 1), reverse primer: ACGTTGGCACCATTTGGGTCTGG (SEQ ID NO: 2)) MITF (forward Primer: CTCGAGCTCCATGGGAACTTTCC (SEQ ID NO: 5), reverse primer: GATGCTGAAGGAGTCTTGG (SEQ ID NO: 6)

[0057] <<Experimental Results>> (1) Samples were prepared between day 23 and day 32 of the differentiation induction process and quantitative PCR was performed. When the OCT4 expression level on day 23 was set to 1, it decreased to 0.409 on day 25 and to 0.122 on day 32. The TYRP1 expression level increased from 14.501 on day 25 to 193.920 on day 32. The MITF expression level increased from 31.917 on day 25 to 211.610 on day 32. From this, it was found that the percentage of undifferentiated cells remaining had decreased sufficiently by day 25 of culture, and that the expression of MITF and TYRP1 had begun to increase (Figure 10). (2) CECSi cell populations that were differentiated with or without bFGF and then cryopreserved were thawed and samples for quantitative PCR were prepared. Using TYRP1 quantitative PCR, the relative expression levels of the TYRP1 gene were examined in CECSi cell populations differentiated with and without bFGF. Compared to the control B4G12 cells (expression level set to 1), the expression level decreased from 27.2 (without bFGF) to 10.1 (with bFGF). Further examination of the relative expression level of the MITF gene showed a decrease from 4.0 (without bFGF) to 1.9 (with bFGF). On the other hand, OCT4 quantitative PCR, used to detect the remaining undifferentiated cells, showed no change in the relative expression level of the OCT4 gene (0.057 (without bFGF) to 0.040 (with bFGF) (Figure 11). (3) Therefore, it was found that by adding bFGF and inducing differentiation at a time when the rate of remaining undifferentiated cells has sufficiently decreased (OCT4 expression has sufficiently decreased) and MITF and / or TYRP1 expression has increased, the number of pigment progenitor cells that may be mixed into the CECSi cells can be reduced, ultimately resulting in the production of higher-quality CECSi cells.

[0058] Example 3: Rat anterior chamber transplantation test. A population of CECSi cells cryopreserved using cryopreservation medium (GC LYMPHOTEC Inc., CS-11-001) was designated as Group A. A population of CECSi cells cryopreserved from the same lot as Group A was cultured for one week in a medium of M199 + DMEM / F12 + ITS supplement + bFGF (20 ng / ml) + Albumin (0.5 g / L) in the same manner as in Example 1 (5), and cryopreserved using the same cryopreservation solution, Bang Bangkar (GC LYMPHOTEC Inc., CS-11-001), and this was designated as Group B. Cells from Group A or Group B were thawed by mixing them with DMEM / F12 + ITS + Y-27632 medium. In the anterior chamber of 12-week-old nude rats F344 / NJcl-rnu / rnu, thawed cells from group A or group B were placed in 2 × 10⁻¹⁶ cells. 5 The cells were administered at a dose of 5 μL / eye. A comparison of the occurrence rates of unintended cells (pigment cells) in group A (10 cells) and group B (9 cells) observed for 4 weeks revealed that in group A, 6 out of 10 cells had unintended cells (60.0%), while in group B, 2 out of 9 cells had unintended cells (22.2%). Therefore, this method was confirmed to reduce the occurrence rate of unintended cells. Unintended cells were detected by DOPA staining, which identifies melanin pigment.

[0059] According to the present invention, quality control of a CECSi cell population can be easily and accurately performed by detecting pigment cells, which are unintended cells, within the CECSi cell population. Furthermore, by employing a specific culture method, it becomes possible to reduce the number of pigment cells, which are unintended cells, and thereby produce a cell population of better quality. This application is based on U.S. Provisional Application 63 / 745,474 (filed January 15, 2025), the contents of which are fully incorporated herein.

Claims

1. A method for controlling the quality of a cell population containing iPS cell-derived corneal endothelial replacement cells for therapeutic use, comprising the step of evaluating the presence or absence of pigment cells in the cell population.

2. The method according to claim 1, wherein the cell population is cryopreserved.

3. The method according to claim 1, wherein the evaluation of the presence or absence of pigment cells is equivalent to the evaluation of the presence or absence of TYRP1 gene expression.

4. A method for detecting pigment cells in a cell population containing iPS cell-derived therapeutic corneal endothelial replacement cells, comprising the step of evaluating the expression of the TYRP1 gene in the cell population.

5. A method for reducing the contamination of a cell population with pigment cells, comprising culturing a cell population containing iPS cell-derived therapeutic corneal endothelial replacement cells in a medium containing the FGF family.

6. The method according to claim 5, wherein the pigment cells express the TYRP1 gene.

7. The method according to claim 5, wherein the culture is carried out for 2 to 30 days.

8. A method for producing a cell population containing iPS cell-derived therapeutic corneal endothelial surrogate cells, comprising reducing the contamination of pigment cells by the method described in claim 5.