Compositions and methods useful for huntington's disease
Patent Information
- Application Number
- PCT/US2026/016055
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2025-02-22
- Filing Date
- 2026-02-20
- Publication Date
- 2026-08-27
Smart Images

Figure IMGF000001_0001 
Figure IMGF000002_0001 
Figure IMGF000003_0001
Abstract
Description
[0001]
[0002] COMPOSITIONS AND METHODS USEFUL FOR HUNTINGTON’S DISEASE
[0003] REFERENCE TO AN ELECTRONIC SEQUENCE LISTING
[0004] The electronic sequence listing filed herewith named “UPN-22-9988PCT” with size of 580,308 bytes, created on date of February 20, 2026, and tire contents of the electronic sequence listing (e.g., the sequences and text therein) are incorporated herein by reference in entirety.
[0005] BACKGROUND OF THE INVENTION
[0006] Huntington’s disease (HD) is a rare, inherited, often fatal, neurodegenerative condition that causes progressive motor deficits, psychiatric symptoms, and cognitive impairment. Huntington's disease symptoms can develop at any time, but they most commonly begin in adulthood, and often when people are in their 30s or 40s. If the disease develops before age of about 20, disease progression may be faster than adult-onset disease, and symptoms may differ (“Juvenile Huntington’s disease”). In the early stages of adult-onset HD patients may experience subtle involuntary movements, slight difficulty with executive functions, and depressed mood. These individuals generally remain independent. However, as the disease progresses, patients begin to require assistance and may no longer be able to drive or remain employed. Problem solving and coordination become increasingly difficult, and falls may become more frequent. During the late stages, HD patients may become bedridden, require feeding tubes, and be unable to speak due to loss of voluntary motor control and increased involuntary movements. In addition, at this stage in disease progression, dementia is often severe and can affect all aspects of cognition. Adult onset HD is typically fatal within 15 to 20 years of onset.
[0007] Worldwide, the prevalence of HD is estimated to be 2.7 per 100,000 individuals. However, it is known that this varies regionally. Western populations such as Canada, the United States, the United Kingdom, and Australia tend to have the highest prevalence, while Asian countries such as Japan, Korea, Taiwan, and Hong Kong tend to have a lower prevalence of the disease.
[0008] HD is inherited in an autosomal dominant manner and is caused by an expansion of a cytosine-adenine-guanine (CAG) trinucleotide repeat in the coding region of the HD
[0009]
[0010] gene, huntingtin (HTT), located in the short arm of chromosome 4 (4pl6.3). The HTT gene encodes the protein huntingtin (HTT), which is found in many tissues throughout the body, including throughout the central nervous system (CNS). While its function has not been entirely elucidated, it has been proposed to play critical roles in several cellular events such as protein trafficking, transport of vesicles, and selective autophagy. It has been reported that when the CAG sequence expands beyond the normal range of 6-26 repeats, it becomes unstable. In blood tests, fully-penetrant HD-causing mutant huntingtin alleles are defined as containing CAG repeats of ~40 and above, and clinical manifestation of HD is expected during a normal lifespan. 36-39 CAG repeats arc associated with rcduccd-pcnctrancc, and increased risk of clinical manifestation. An unaffected range of CAG repeats is defined as 26 or fewer CAG repeats. An intermediate range of 27-35 CAG repeats imparts increased risk of offspring inheriting a penetrant allele due to instability in CAG tract, especially following paternal transmission. The CAG repeat length in mutant HTT in brain cells from affected individuals may differ from that denoted by a blood test. Due to the inherent instability of the CAG repeat region, which increases with longer CAG repeats, mosaicism of CAG repeat lengths has been detected across CNS cells in HD patients. Within cells, CAG repeat expansions may increase in size over time (termed somatic instability (SI)), with reports of large expansions in CAG lengths in neurons in vulnerable brain regions, including, but not limited to, the caudate-putamen and the cerebral cortex. Longer CAG-repeat lengths have been associated with neuropathology in HD brain and in certain experimental models.
[0011] The current standard-of-care involves treatment of symptoms together with multidisciplinary support involving physicians, specialist nurses, therapists, clinical psychologists and dieticians to maintain independence and quality of life for as long as possible.
[0012] There is an ongoing need in the art for compositions and methods for effective treatment for Huntington’s Disease.
[0013] SUMMARY OF THE INVENTION
[0014] Provided herein are compositions useful for treating, slowing, preventing, or delaying the onset of a repeat expansion disease. In certain embodiments, the composition comprises (a) at least one nucleic acid sequence encoding an RNA molecule (or product)
[0015]
[0016] which inhibits expression of MSH3 in a human subject, optionally wherein the RNA inhibitory molecule (or product) is an microRNA (miRNA), a short hairpin RNA (shRNA), an siRNA, or an anti-sense oligonucleotide sequence (ASO). In certain embodiments, the at least one MHS3 inhibitory nucleic acid sequence comprises at least one of: (i) one or more of SEQ ID NO: 4, miR902S or a variant of SEQ ID NO: 4 sequence having 1 or 2 nucleotide changes; and / or SEQ ID NO: 10, miR902AS or a variant of SEQ ID NO: 10 sequence having 1 or 2 nucleotide changes; (ii) one or more of SEQ ID NO: 5, miR2482S or a variant of SEQ ID NO: 5 sequence having 1 or 2 nucleotide changes, and / or SEQ ID NO: 11, miR2482 AS or a variant of SEQ ID NO: 11 sequence having 1 or 2 nucleotide changes; and / or (iii) one or more of SEQ ID NO: 6, miR1331 S or a variant of SEQ ID NO: 6 sequence having 1 or 2 nucleotide changes, and / or SEQ ID NO: 12, miR1331AS or a variant of SEQ ID NO: 11 sequence having 1 or 2 nucleotide changes; and (b) carrier or vehicle for delivery of the at least one MSH3 inhibitory nucleotide sequence to the human subject, wherein the composition optionally comprises an expression cassette comprising the at least one MSH3 inhibitory nucleic acid sequence operably linked to expression control sequences therefor, optionally when tire expression cassette is in a viral vector.
[0017] In certain embodiments, provided herein is a recombinant adeno-associated viral (rAAV) particle comprising (a) an adeno-associated virus capsid and (b) a vector genome which is a nucleic acid molecule comprising an expression cassette which contains a MSH3 inhibitory nucleic sequence encoding an RNA molecule which inhibits expression of MSH3 in a subject and binds a target sequence comprising at least 10 consecutive nucleotides of CAAACTGAAACTGCCGCATTA or CAAACTGAAACTGCAGCATTA (miR902), the coding sequence being operably linked to expression control sequences therefor.
[0018] In certain embodiments, the expression cassette comprises at least two different MSH3 inhibitory nucleic acid sequences encoding the RNA molecule comprising a mature miRNA, wherein the at least two different MSH3 inhibitory nucleic acid sequences encode a sense sequence and an antisense sequence. Also provided are certain embodiments wherein the expression cassette comprising MSH3 inhibitory nucleic acid sequences for the RNA molecule comprises a 5’ miR flanking region, a sense sequence, an RNA loop sequence, an antisense sequence, and a 3’ miR flanking region.
[0019]
[0020] In certain embodiments, the MSH3 inhibitory’ nucleic acid sequence encoding SEQ ID NO: 1 comprises the sequence of at least 7, at least 15, or at least 17 consecutive nucleotides of SEQ ID NO: 4. In certain embodiments, the MSH3 inhibitory nucleic acid sequence encoding SEQ ID NO: 1 comprises the full-length sequence of SEQ ID NO: 4, optionally with 1 or 2 modified nucleotides. In certain embodiments, the expression cassette comprises at least one MSH3 inhibitory nucleic acid sequence of about 16 nucleotides to about 28 nucleotides in length encoding a miR902 antisense sequence of 7 to 21 consecutive nucleotides of: UAAUGCGGCAGUUUCAGUUUG (SEQ ID NO: 7). In certain embodiments, each of tire at least one MSH3 inhibitory’ sequence is independently a sequence of 18 to 26 nucleotides in length, or 19 to 23 nucleotides in length, and encodes the sequence of at least 11 consecutive nucleotides, at least 15 consecutive nucleotides, or at least 18 to 21 consecutive nucleotides. In certain embodiments, tire MSH3 inhibitory nucleic acid sequence encoding SEQ ID NO: 7 comprises the sequence of at least 7, at least 15, or 19 to 21 consecutive nucleotides of TAATGCGGCAGTTTCAGTTTG (SEQ ID NO: 10). In certain embodiments, the MSH3 inhibitory' nucleic acid sequence encoding SEQ ID NO: 1 comprises tire full-length sequence of SEQ ID NO: 10, optionally with 1 or 2 modified nucleotides. In certain embodiments, the MSH3 inhibitory nucleic acid sequence encoding the RNA molecule comprises a loop nucleic acid sequence that operatively links a sense sequence and an antisense sequence. In certain embodiments, the MSH3 inhibitory nucleic acid sequence further comprises an RNA loop sequence of the nucleic acid sequence of SEQ ID NO: 31. In certain embodiments, the rAAV particle or composition comprises the sense sequence, the loop sequence, and the antisense sequence comprises a nucleic acid sequence of SEQ ID NO: 16. In certain embodiments, the MSH3 inhibitory’ nucleic acid sequence encodes the miR902 having the sequence of:
[0021] SEQ ID NO: 25. In certain embodiments, the MSH3 inhibitory nucleic acid sequence encoding SEQ ID NO: 25, comprises the sequence of SEQ ID NO: 28.
[0022] In certain embodiments, tire nucleic acid sequence encoding at least one MHS3 inhibitory' molecule encoding SEQ ID NO: 2 comprises the sequence of at least 7, at least 15, or at least 17 consecutive nucleotides of TAGCAACTTGACTGCATTT (SEQ ID NO: 5). In certain embodiments, the nucleic acid sequence encoding at least one MHS3 inhibitory' molecule encodes SEQ ID NO: 2 comprises the full-length sequence of SEQ ID NO: 5, optionally with 1 or 2 modified nucleotides. In certain embodiments, tire expression
[0023]
[0024] cassette comprises at least one MSH3 inhibitory nucleic acid sequence of about 16 nucleotides to about 28 nucleotides in length encoding a miR2482 antisense sequence of 7 to 21 consecutive nucleotides of: UGCUGAAAUGCAGUCAACAGUUGCUA (SEQ ID NO: 8). In certain embodiments, each of the at least one MSH3 inhibitory sequence is independently a sequence of 18 to 26 nucleotides in length, or 19 to 23 nucleotides in length, and encodes the sequence of at least 11 consecutive nucleotides, at least 15 consecutive nucleotides, or at least 18 to 21 consecutive nucleotides. In certain embodiments, the MSH3 inhibitory nucleic acid sequence encoding SEQ ID NO: 8 comprises the sequence of at least 7, at least 15, or 19 to 21 consecutive nucleotides of TGCTGAAATGCAGTCAACAGTTGCTA (SEQ ID NO: 11). In certain embodiments, the MSH3 inhibitory nucleic acid sequence encoding SEQ ID NO: 2 comprises the full-length sequence of SEQ ID NO: 11, optionally with 1 or 2 modified nucleotides. In certain embodiments, the MSH3 inhibitory nucleic acid sequence encoding the RNA molecule comprises a loop nucleic acid sequence that operatively links a sense sequence and an antisense sequence. In certain embodiments, the MSH3 inhibitory' nucleic acid sequence further comprises an RNA loop sequence of the nucleic acid sequence of GTTTTGGCCACTGACTGAC (SEQ ID NO: 31). In certain embodiments, die sense sequence, the loop sequence, and the antisense sequence comprises a nucleic acid sequence encoding the sequence of:
[0025] UAAUGCGGCAGUUUCAGUUUGGUUUUGGCCACUGACUGACCAAACUGACUG CCGCAUUA (SEQ ID NO: 14). In certain embodiments, the MSH3 inhibitory nucleic acid sequence encoding SEQ ID NO: 14 comprises the sequence of TAATGCGGCAGTTTCAGTTTGGTTTTGGCCACTGACTGACCAAACTGACTGCCG CATTA (SEQ ID NO: 17). In certain embodiments, the 5’ flanking region comprises a nucleic acid sequence encoding the sequence of CUGGAGGCUUGCUGAAGGCUGUAUGCU (SEQ ID NO: 19). In certain embodiments, the MSH3 inhibitory nucleic acid sequence encoding SEQ ID NO: 19, comprises the sequence of ctggaggcttgctgaaggctgtatgct (SEQ ID NO: 21). In certain embodiments, the 3’ flanking region comprises a nucleic acid sequence encoding the sequence of CAGGACACAAGGCCUGUUACUAGCACUCACAUGGAACAAAUGGCC (SEQ ID NO: 23). In certain embodiments, the MSH3 inhibitory nucleic acid sequence encoding
[0026]
[0027] SEQ ID NO: 23, comprises the sequence of caggacacaaggcctgttactagcactcacatggaacaaatggcc (SEQ ID NO: 24). In certain embodiments, the MSH3 inhibitory nucleic acid sequence encoding the miR2482 comprises the sequence of: SEQ ID NO: 26:
[0028] CUGGAGGCUUGCUGAAGGCUGUAUGCUGAAAUGCAGUCAACAGUUGC UAGUUUUGGCCACUGACUGACUAGCAACUUGACUGCAUUUCAGGACACAAG GCCUGUUACUAGCACUCACAUGGAACAAAUGGCC. In certain embodiments, the MSH3 inhibitory nucleic acid sequence encoding SEQ ID NO: 26 comprises the sequence of SEQ ID NO: 29: ctggaggcttgctgaaggctgtaTGCTGAAATGCAGTCAACAGTTGCTAGTTTTGGCCACTG ACTGACTAGCAACTTGACTGCATTTcaggacacaaggcctgttactagcactcacatggaacaaatggcc. In certain embodiments, the miR2482 coding sequence(s) are operably linked to a constitutive promoter. In certain embodiments, the miR2482 coding sequence(s) are operably linked to a neuron specific and / or immune specific cell promoter.
[0029] In certain embodiments, the nucleic acid sequence encoding at least one MHS3 inhibitory' molecule encoding SEQ ID NO: 3 comprises the sequence of at least 7, at least 15, or at least 17 consecutive nucleotides of ATCTGTTAGTGCAGGATGA (SEQ ID NO: 6). In certain embodiments, the nucleic acid sequence encoding at least one MHS3 inhibitory molecule encodes SEQ ID NO: 3 comprises the full-length sequence of SEQ ID NO: 6, optionally with 1 or 2 modified nucleotides. In certain embodiments, the expression cassette comprises at least one MSH3 inhibitory nucleic acid sequence of about 16 nucleotides to about 28 nucleotides in length encoding a miR.1331 antisense sequence of 7 to 21 consecutive nucleotides of: GUCAUCCUGCACACUAACAGAU (SEQ ID NO: 9). In certain embodiments, each of the at least one MSH3 inhibitory sequence is independently a sequence of 18 to 26 nucleotides in length, or 19 to 23 nucleotides in length, and encodes the sequence of at least 11 consecutive nucleotides, at least 1 consecutive nucleotides, or at least 18 to 21 consecutive nucleotides. In certain embodiments, the MSH3 inhibitory nucleic acid sequence encoding SEQ ID NO: 9 comprises the sequence of at least 7, at least 15, or 19 to 21 consecutive nucleotides of GTCATCCTGCACACTAACAGAT (SEQ ID NO: 12). In certain embodiments, the MSH3 inhibitory nucleic acid sequence encoding SEQ ID NO: 3 comprises the full-length sequence of SEQ ID NO: 12, optionally with 1 or 2 modified nucleotides. In certain
[0030]
[0031] embodiments, the MSH3 inhibitory- nucleic acid sequence encoding the RNA molecule comprises a loop nucleic acid sequence that operatively links a sense sequence and an antisense sequence. In certain embodiments, the MSH3 inhibitory nucleic acid sequence further comprises an RNA loop sequence of the nucleic acid sequence of GTTTTGGCCACTGACTGAC (SEQ ID NO: 31). In certain embodiments, the sense sequence, the loop sequence, and the antisense sequence comprises a nucleic acid sequence encoding the sequence of:
[0032] GUCAUCCUGCACACUAACAGAUGUUUUGGCCACUGACUGACAUCUGU UAGUGCAGGAUGA (SEQ ID NO: 15). In certain embodiments, the MSH3 inhibitory nucleic acid sequence encoding SEQ ID NO: 13 comprises tire sequence of GTCATCCTGCACACTAACAGATGTTTTGGCCACTGACTGACATCTGTTAGTGCA GGATGA (SEQ ID NO: 18). In certain embodiments, tire 5' flanking region comprises a nucleic acid sequence encoding the sequence of CUGGAGGCUUGCUGAAGGCUGUAUGCU (SEQ ID NO: 19). In certain embodiments, the MSH3 inhibitory' nucleic acid sequence encoding SEQ ID NO: 19, comprises the sequence of ctggaggcttgctgaaggctgtatgct (SEQ ID NO: 21). In certain embodiments, the 3’ flanking region comprises a nucleic acid sequence encoding the sequence of CAGGACACAAGGCCUGUUACUAGCACUCACAUGGAACAAAUGGCC (SEQ ID NO: 23). In certain embodiments, the MSH3 inhibitory nucleic acid sequence encoding SEQ ID NO: 23, comprises the sequence of caggacacaaggcctgttactagcactcacatggaacaaatggcc (SEQ ID NO: 24). In certain embodiments, the MSH3 inhibitory' nucleic acid sequence encoding the miR1331 comprises the sequence of: SEQ ID NO: 27:
[0033] CUGGAGGCUUGCUGAAGGCUGUAUGCUGUCAUCCUGCACACUAACAG AUGUUUUGGCCACUGACUGACAUCUGUUAGUGCAGGAUGACAGGACACAAG GCCUGUUACUAGCACUCACAUGGAACAAAUGGCC. In certain embodiments, the MSH3 inhibitory nucleic acid sequence encoding SEQ ID NO: 27 comprises the sequence of SEQ ID NO: 30: ctggaggcttgctgaaggctgtatgctGTCATCCTGCACACTAACAGATGTTTTGGCCACTGAC TGACATCTGTTAGTGCAGGATGAcaggacacaaggcctgttactagcactcacatggaacaaatggcc. In certain embodiments, the miR1331 coding sequence(s) are operably linked to a constitutive
[0034]
[0035] promoter. In certain embodiments, the miR1331 coding sequence(s) are operably linked to a neuron specific and / or immune specific cell promoter.
[0036] In certain embodiments, the MSH3 inhibitory nucleic acid sequence is operably linked to a constitutive promoter, a neuron specific or immune specific cell promoter. In certain embodiments, the expression control sequences comprise a promoter which is human synapsin, a chicken beta actin promoter, a CMVe.mP84, a calmodulin promoter or a prion promoter, optionally wherein the chicken beta actin promoter is a CB7 promoter element or a CAG promoter element. In certain embodiments, the expression control sequences comprise a CB7 promoter or a CAG promoter. In certain embodiments, an rAAV particle comprises a vector genome which comprises one or more of: an AAV25’ inverted terminal repeat (ITR), the expression control sequence further comprise one or more of: a post-transcription regulatory element which is optionally a Woodchuck Hepatitis Virus Posttranscriptional Regulatory Elements (WPRE); a rabbit P-globin exon; or a rabbit globin poly(A), and an AAV23’ ITR. In certain embodiments, the expression cassette comprises the nucleic acid sequence acid sequence of SEQ ID NO: 81, SEQ ID NO: 82, or SEQ ID NO: 83. In certain embodiments, the vector genome comprises the nucleic acid sequence of SEQ ID NO: 32; SEQ ID NO: 33; or SEQ ID NO: 34.
[0037] In certain embodiments, the rAAV particle or the composition further comprises a nucleic acid sequence encoding a peptide, polypeptide, protein, or ASO operably linked to expression control sequences which direct expression thereof, optionally wherein the peptide, polypeptide, ASO, or miRNA is therapeutic for a repeat expansion disease, optionally wherein the therapeutic is an Total Huntingtin Gene (HTT) gene, or a human cholesterol 24-hydroxylase gene (hCPY46Al). In certain embodiments, the repeat expansion disease is Huntington's disease, Fragile X Syndrome, myotonic dystrophy (DM1 and DM2), amyotrophic lateral sclerosis and / or frontotemporal dementia caused by somatic expansion in the C90RF72 gene, spinocerebellar ataxias (SCAs 1. 2, 3, 6, 7 and 17).
[0038] Friedreich's ataxia (FRDA), Fragile X Tremor Ataxia Syndrome (FXS / FXTAS), dentatorubral-pallidoluysian atrophy (DRPLA), spinal and bulbar muscular atrophy (SBMA), or Unverricht-Lundborg myoclonic epilepsy (EPM1).
[0039] In certain embodiments, an rAAV particle has a natural ly occurring or a non-naturally occurring clade F capsid, and / or a capsid which is capsid of crossing the bloodbrain barrier. In certain embodiments, the AAV capsid is AAVhu68, AAVrh91, AAV1,
[0040]
[0041] AAV9, AAV5 or AAV8 capsid. In certain embodiments, the vector genome further comprises a FAN 1 nucleic acid sequence encoding human FAN 1 (hFAN 1) operably linked to expression control sequences. In certain embodiments, the hFAN 1 has an amino acid sequence of SEQ ID NO: 105.
[0042] In certain embodiments, a composition is provided comprising: (a) a delivery vehicle for a FAN 1 nucleic acid sequence encoding human FAN 1 gene operably linked to expression control sequences; and (b) a delivery vehicle for at least onsMSH3 inhibitory nucleic acid sequence encoding an RNA molecule (or product) which inhibits expression of MSH3 in a human subject, optionally wherein the RNA inhibitory molecule (or product) is an microRNA (miRNA), an short hairpin RNA (shRNA), an siRNA, or an anti-sense oligonucleotide sequence (ASO), wherein the at least one MSH3 inhibitory nucleic acid sequence is as defined herein comprises at least one of: (i) SEQ ID NO: 4. miR902S or a variant of SEQ ID NO: 4 sequence having 1 or 2 nucleotide changes; and / or SEQ ID NO: 10, miR902AS or a variant of SEQ ID NO: 10 sequence having 1 or 2 nucleotide changes; (ii) one or more of SEQ ID NO: 5, miR2482S or a variant of SEQ ID NO: 5 sequence having 1 or 2 nucleotide changes, and / or TGCTGAAATGCAGTCAACAGTTGCTA (SEQ ID NO: 11, miR2482 AS) or a variant of SEQ ID NO: 11 sequence having 1 or 2 nucleotide changes; and / or (iii) one or more of SEQ ID NO: 6, miR1331S or a variant of SEQ ID NO: 6 sequence having 1 or 2 nucleotide changes, and / or SEQ ID NO: 12, miR133 IAS or a variant of SEQ ID NO: 11 sequence having 1 or 2 nucleotide changes, optionally when the expression cassette is in a viral vector.
[0043] In certain embodiments, a recombinant adeno-associated virus (rAAV) particle is provided which comprises: (a) an AAV capsid; and (b) a vector genome in the AAV capsid, the vector genome comprising an expression cassette, wherein tire expression cassette comprises a nucleic acid sequence of SEQ ID NO: 104 or a sequence at least 95% identical thereto encoding a human FANCI-associated nuclease (hFANl) having SEQ ID NO: 105. wherein tire hFANl nucleic acid sequence is operably linked to expression control sequences. In certain embodiments, the hFAN 1 coding sequence is SEQ ID NO: 104 or a sequence at least 99% identical thereto encoding the hFAN 1 amino acid sequence of SEQ ID NO: 105. In certain embodiments, the hFANl coding sequence is operably linked to a constitutive promoter, cell specific promoter, optionally a neuron specific or an immune cell specific promoter. In certain embodiments, the expression
[0044]
[0045] control sequences may comprise a promoter which is human synapsin, a chicken beta actin promoter, a CMVe.mP84, a calmodulin promoter or a prion promoter, optionally wherein the chicken beta actin promoter is a CB7 promoter element or a CAG promoter element. In certain embodiments, the vector genome comprises one or more of: an AAV25' inverted terminal repeat (1TR), tire expression control sequence further comprise one or more of: a post-transcription regulatory element which is optionally a Woodchuck Hepatitis Vims Posttranscriptional Regulatory Elements (WPRE); a rabbit P-globin exon; or a rabbit globin poly(A), and an AAV23’ ITR. In certain embodiments, the expression cassette comprises the nucleic acid sequence of SEQ ID NO: 84, 86, 88, 90, 92, 94, 96, 98, 100, or 102.
[0046] In certain embodiments, the expression cassette comprising the hFAN 1 coding sequence further comprises a nucleic acid sequence encoding a second therapeutic molecule (or product), optionally wherein the nucleic acid sequence encodes an RNA inhibitory molecule (or product) that inhibits expression of MSH3 in a human subject. In certain embodiments, the expression cassette comprises a linker between the coding sequence of hFAN 1 and the sequence encoding the RNA inhibitory molecule (or product). In certain embodiments, the linker is a self-cleaving 2A linker.
[0047] In certain embodiments, an rAAV particle has an expression cassette comprising the hFANl coding sequence, a linker, and wMSH3 inhibitory nucleic acid sequence encoding an RNA molecule (or product) which inhibits expression of MSH3 , wherein the hFAN 1 coding sequence and the MSH3 inhibitor} nucleic acid sequence are operably linked to expression control sequences which comprise at least one promoter, at least enhancer, and the linker encoding a self-cleaving peptide. In certain embodiments, the expression cassette comprises an enhancer upstream of the hFAN 1 coding sequence and the MSH3 inhibitory nucleic acid sequence and optionally a post-transcription regulator}’ element which is downstream of the hFAN 1 coding sequence and the MSH3 inhibitory nucleic acid sequence. In certain embodiments, the AAV capsid is a naturally occurring or a non-naturally occurring clade F capsid, and / or a capsid which is capsid of crossing the blood-brain barrier. In certain embodiments, the AAV capsid is AAVhu68, AAVrh91, AAV1, AAV9, AAV5 or AAV8.
[0048] In certain embodiments, provided herein is a pharmaceutical composition comprising an rAAV particle as defined herein and one or more of a pharmaceutically acceptable suspending agent, a carrier, and / or an excipient.
[0049]
[0050] In certain embodiments, provided herein is a method of using rAAV or a composition as provided herein for administration into a subject for treatment of Huntington’s disease and / or a disorder associated with a repeat expansion disease, optionally wherein the disorder is Fragile X Syndrome, myotonic dystrophy (DM1 and DM2), amyotrophic lateral sclerosis and / or frontotemporal dementia caused by somatic expansion in the C90RF72 gene, spinocerebellar ataxias (SCAs 1, 2, 3, 6, 7 and 17), Friedreich's ataxia (FRDA), Fragile X Tremor Ataxia Syndrome (FXS / FXTAS), dentatorubral-pallidoluysian atrophy (DRPLA), spinal and bulbar muscular atrophy (SBMA), or Unvcrricht-Lundborg myoclonic epilepsy (EPM1). In certain embodiments, the infusion is delivered intrathecally. In certain embodiments, the infusion is delivered via bilateral, intraparenchymal infusion into a subject’s caudate and putamen.
[0051] In certain embodiments, a nucleic acid molecule useful for rAAV production is provided which comprises one or more of a nucleic acid sequence encoding an miRNA which inhibits MSH3 expression in a subject comprising a 5’ flanking region, a sense sequence, a loop, an antisense sequence, and a 3 ’ flanking region. In certain embodiments, the nucleic acid sequence has SEQ ID NO: 81, 82, 83, 86, 87, 90, 91, 94, 95, 98, 99, 102, or 103. In certain embodiments, an rAAV packaging cell is provided which contains the nucleic acid molecule.
[0052] In certain embodiments, a nucleic acid molecule useful for rAAV production is provided which comprises a nucleic acid sequence comprising a nucleic acid sequence of SEQ ID NO: 104 or a sequence at least 95% identical thereto encoding a human FANCI-associated nuclease (hFAN 1) having SEQ ID NO: 105, wherein the hFAN 1 nucleic acid sequence is operably linked to expression control sequences. In certain embodiments, the nucleic acid sequence comprises SEQ ID NO: 84, 86, 88, 90, 92, 94, 96, 98, 100, or 102. In certain embodiments, an rAAV packaging cell is provided which contains the nucleic acid molecule.
[0053] In certain embodiments, provided herein is a method of treating, preventing or delaying the onset of a repeat expansion disease in a subject in need thereof, wherein the method comprises administering to the subject the rAAV particle as described herein. In certain embodiments, the repeat expansion disease is selected from Huntington’s disease, Fragile X Syndrome, myotonic dystrophy (DM1 and DM2), amyotrophic lateral sclerosis and / or frontotemporal dementia caused by somatic expansion in the C90RF72 gene,
[0054]
[0055] spinocerebellar ataxias (SC As 1, 2, 3, 6, 7 and 17), Friedreich's ataxia (FRDA), Fragile X Tremor Ataxia Syndrome (FXS / FXTAS), dentatorubral-pallidoluysian atrophy (DRPLA), spinal and bulbar muscular atrophy (SBMA), and Unverricht-Lundborg myoclonic epilepsy (EPM1). In certain embodiments, the repeat expansion disease is Huntington's Disease. In certain embodiments, provided herein is a method of treating, preventing or delaying the onset of Huntington's Disease in a subject in need thereof, wherein the method comprises administering to the subject the rAAV particle as described herein.
[0056] These and other aspects of the invention are apparent from the following detailed description of the invention.
[0057] BRIEF DESCRIPTION OF THE FIGURES FIG. 1 shows results (plotted as fold change in MSH3 mRNA and fold change in protein levels) of an in vitro screen of miRNAs targeting mouse MSH3 in mouse N2a cells. N2a cells were transfected with plasmids containing the miRNAs as indicated and RNA or protein was harvested from cells. RT-qPCR was performed to measure MSH3 mRNA levels using MSH3 primers and was normalized to glyceraldehyde 3 -phosphate dehydrogenase (GAPDH). Western blots were performed to quantify MSH3 protein levels using an MSH3 antibody and a GAPDH loading control.
[0058] FIG. 2 shows quantitative reverse transcription polymerase chain reaction (RT-qPCR) results (plotted as relative expression) of an in vitro screen of miRNAs targeting mouse MSH3 in human HEK293 cells. These results show that artificial mouse miR (miRNA902) cross-reacts with human MSH3.
[0059] FIG. 3 shows RT-qPCR and Western blot results (plotted as fold change in mRNA and fold change in protein levels) of an in vitro screen of miRNAs targeting human MSH3 in mouse N2a cells. These results show possible cross-reactivity, but sequence mismatch leads to translational repression rather than RNA degradation.
[0060] FIG. 4A shows confirmation of cross-reactivity of mouse miRNA (miR902 or human miR1331) on human MSH3 protein in HEK293 cells, plotted as relative levels of MSH3 protein. FIG. 4B shows confirmation of knockdown by human miRNA (miR2482) on human MSH3 protein, plotted as relative levels of MSH3 protein.
[0061] FIG. 5 shows western blot confirming mouse and human FAN 1 expression in mouse N2a cells 48 hours after plasmid (pAAV.CAG.CI.hFAN lco.SV40 (comprising
[0062]
[0063] engineered human FAN 1 coding sequence) and pAAV.CAG.CI.msFAN lnat.SV40 (comprising mouse FAN1 native coding sequence)) transfection in N2a cells.
[0064] FIG. 6A shows expression of MSH3 mRNA in mouse cortex as measured by RT-qPCR, following administration with a recombinant AAV particle comprising a Clade F capsid and a vector genome which comprises an artificial miR expressed under a CB7 promoter which comprises a CMV enhancer, chicken beta actin promoter, and an intron, and further having a Woodchuck Hepatitis Virus (WHP) Posttranscriptional Regulatory Element (WPRE) upstream of a rabbit beta globin polyA signal). FIG6A shows expression following administration of AAV9-PHP.cB.CB7.CI.mMSH3.miR902.WPRE.rBG. FIG.
[0065] 6B shows expression of MSH3 mRNA in mouse cortex as measured by RT-qPCR, following administration with AAV9-PHP.eB.CB7.CI.hMSH3.miR1331.WPRE.rBG. FIG.
[0066] 6C shows expression of MSH3 mRNA in mouse cortex as measured by RT-qPCR, following administration with AAV9-PHP.eB.CB7.CI.mMSH3.miR2482.WPRE.rBG. These results show that miR 902 and miR 2482 injected animals have reduced MSH3 mRNA.
[0067] FIG. 7A shows a western blot analysis confinning MSH3 protein expression. FIG.
[0068] 7B shows quantified relative expression of MSH3 protein (from western blot of FIG. 7A). These results confinn that miR902 demonstrates reduced MSH3 protein expression in vivo, miR NT (non-targeting miRNA, ThennoFisher BlociT Kit) served as a control. FIG. 7C shows miRNA assay results as perfonned with stem-loop qPCR, plotted as fold change, of MSH3 miRNA expression in mouse cortex. These results show that mature miRNA 902 expression was detected.
[0069] FIG. 8A shows western blot analysis confinning FAN 1 expression in a study examining FAN1 expression in vivo in brain in wild-ty pe 9-11-wccks old mice (n=5) administered with PBS or AAV-PHP.eB.CAG.CI.mFANl.SV40 intravenously at a dose of 3xl0nGC. wherein necropsy was performed on day 14 following administration. FIG. 8B shows quantification of mouse FAN 1 expression in vivo in mice, plotted as mFanl protein levels.
[0070] FIG. 9A shows MSH3 mRNA expression levels in liver, plotted as fold-change, following administration with PBS or AAVhu68.CB7.CI.mMSH3.miR902.WPRE.rBG intravenously at a dose of 3xl0nGC. FIG. 9B shows miR902 expression levels in liver, plotted as fold-change, following administration with PBS or
[0071]
[0072] AAVhu68.CB7.CI.mMSH3.miR902.WPRE.rBG. FIG. 9C shows mouse Fanl expression levels, ploted as fold change as measured by RT-qPCR, following administration with PBS orAAVhu68.CAG.CI.mFANl.SV40.
[0073] FIG 10A shows human FAN1 RNA expression levels in brain, plotted as fold change following administration with PBS or AAVhu68.hSyn.hFAN lco.SV40 or AAVhu68.hSyn.hFANlco.mMSH3-miR902.SV40 ICV at a dose of IxlO11GC. FIG. 10B shows amplification of human FAN1 RNA levels, plotted as RFU.
[0074] FIG. 11 A show s mouse Fanl protein expression, plotted as fold change, as quantified from sample western blot. FIG. 11B shows mouse Fanl protein expression in brain, ploted as fold change, as quantified from two different western blots. These results show CAG.mFanlnat (AAVhu68.CAG.CI.mFANl.SV40) vector resulted in highest expression, while expression from the dual vector (i.e., AAVhu68.hSyn.mFANnat.mMSH3-miR902.SV40) is minimal. FIG. 11C shows mouse FAN1 RNA expression, ploted as fold change. These results show that CAG.mFanlnat (AAVhu68.CAG.CI.mFANl.SV40) vector resulted in highest expression, and confirmed that mouse FAN 1 RNA was expressed from vectors comprising Synapsin promoter.
[0075] FIGs. 12A shows knockdown of MSH3 in vivo via RT-qPCR. FIG. 12A show s MSH3 RNA expression levels, ploted as fold change. FIG. 12B shows MSH3 miRNA902 expression levels via stem-loop RT-qPCR, ploted as units RFU.
[0076] FIG. 13A shows mouse FAN 1 mRNA expression levels from qPCR, ploted as fold change as compared to untransfected control, in HEK cells following transfection with vectors comprising CMV-E.pP-84 promoter (VI: pAAV.CMV-E(+).uP- 84.mFANnat.SV40; V2: pAAV.CMV-E(+).uP-84.mFANnat.mMSH3-miR902.SV40; V3: pAAV.CAG.CI.mFANl.SV40 NGS; V4: pAAV.CAG.CI.mFANnat.link.niMSH3miR902.SV40). FIG. 13B shows mouse FAN1 expression levels as measured via qPCR, plotted as fold change as compared to untransfected control, in N2A cells following transfection with vectors comprising CMV-E.pP-84 promoter (VI: pAAV.CMV-E(+).uP-84.mFANnat.SV40; V2: pAAV.CMV-E(+).uP-84.mFANnat.mMSH3-miR902.SV40; V3: pAAV.CAG.CI.mFANl.SV40 NGS; V4: pAAV.CAG.CI.mFANnat.link.mMSH3miR902.SV40).
[0077] FIG. 14A shows human FAN 1 mRNA expression levels from qPCR, ploted as fold change as compared to untransfected control, in HEK cells follow ing transfection with
[0078]
[0079] vectors comprising CMV-E.pP-84 promoter (V5: pAAV.CMV-E(+).uP-84.hFANlco.SV40; V6: pAAV.CMV-E(+).uP-84.hFANlco.mMSH3-miR902.SV40; V7: pAAV.CAG.CI.hFANl.SV40 NGS; V8: pAAV.CAG.hFANlco.link.miR902.SV40). FIG.
[0080] 14B shows human FAN 1 mRNA expression levels from qPCR, plotted as fold change as compared to untransfected control, in N2A cells following transfection with vectors comprising CMV-E.pP-84 promoter (V5: pAAV.CMV-E(+).uP-84.hFANlco.SV40_v2; V6: pAAV.CMV-E(+).uP-84.hFANlco.mMSH3-miR902.SV40; V7: pAAV.CAG.CI.hFANl.SV40 NGS; V8: pAAV.CAG.hFANlco.hnk.miR902.SV40).
[0081] FIG. 15A shows MSH3 mRNA levels from qPCR, plotted as fold change as compared to untransfected control, in HEK293 cells following transfection with vectors comprising CMV-E.pP-84 promoter (V6: pAAV.CMV-E(+).uP-84.hFANlco.mMSH3-miR902.SV40; V8: pAAV.CAG.hFANlco.link.miR902.SV40). FIG. 15B shows MSH3 miR902 expression in HEK293 cells, plotted as fold change, following transfection with vectors comprising CMV-E.pP-84 promoter (V6: pAAV.CMV-E(+).uP-84.hFANlco.mMSH3-miR902.SV40; V8: pAAV.CAG.hFANlco.lmk.miR902.SV40).
[0082] FIG. 16 shows hFANl mRNA expression as measured by qPCR, plotted as fold expression as compared to PBS-administered control, following administration of PBS, AAVhu68.CAG.CI.hFANlco.SV40, AAVhu68.CMV-E(+).mP-84.hFANlco.SV40. or AAVhu68.Prionl48.hFANlco.SV40p.
[0083] FIG. 17 shows relative transgene mRNA expression, plotted as fold expression as compared to PBS-administered control, following administration with AAVl.CB7.CI.TestTransgenel.rBG, AAV5.CB7.CI. TestTransgenel.rBG, AAVrh91.CB7.CI. TestTransgene2.rBG, AAV8.CB7.CI. TestTransgene2.rBG.
[0084] FIG. 18A shows MSH3 mRNA expression, plotted as fold expression, as measured in striatum via qPCR. HdhQ 111 mice were dosed bilaterally directly into tire striatum with lelOGC of each vector at 3 months of age and necropsied at 6 months of age. FIG. 18B shows miR902 expression, plotted as fold expression, as measured in striatum via stemloop RT-qPCR. FIG. 18C shows MSH3 protein expression, plotted as percent MSH3 expression, as measured in striatum via Western blot.
[0085] FIG. 19A shows somatic instability indices in striatum as compared to PBS treated and miRNT treated mice. FIG. 19B shows somatic instability indices in liver.
[0086]
[0087] FIG. 20A shows mouse FAN 1 (mF AN 1) mRNA expression, plotted as fold expression, as measured in striatum via qPCR. HdhQl 11 mice and dosed bilaterally directly into the striatum with lelOGC of each vector at 3 months of age and necropsied at 6 months of age. FIG. 20B shows human FAN1 (hFANl) expression, plotted as fold expression, as measured in striatum.
[0088] FIG. 21 shows FAN1 protein expression levels in mouse striatal neurons (STR) from HdhQ 111 mice (Jackson Labs) which were bred to have increased CAG repeat lengths, HEK293 or N2a cells, as expressed under a CAG, pP84 or CALM Ip promoter.
[0089] FIG. 22 shows MSH3 protein expression, plotted as percent MSH3 expression, as measured in striatum via Western blot, following delivery of miR902, miR1331 or miR2482 in the human kidney cell line. HEK293.
[0090] FIG. 23 shows expression of FAN 1 (western blot) in striatum tissue.
[0091] FIG. 24A shows FAN 1 effect on somatic instability in striatum (PBS control used from data as shown in FIG. 18 and 19). FIG. 24B shows effect in FAN 1 on somatic instability in liver tissue (PBS control used from data as shown in FIG. 18 and 19).
[0092] FIG. 25A shows somatic instability index in striatum. FIG. 25B shows somatic instability index in liver. FIG. 25C shows FAN 1 expression (as measured by qPCR, and plotted as fold hFanl protein).
[0093] FIG. 26 shows FAN 1 effect on somatic instability in striatum (combined view from FIG. 19A, 24A, and 25A).
[0094] FIG. 27 shows quantification of average percent MSH3 protein in striatum (Baseline: PBS; miR902: AAVhu68.CB7.MSH3 miR902; hFANl: AAVhu68.
[0095] Syn.hFANlco; Dual: AAVhu68 hFANlco.link.mMSH3.miR902).
[0096] FIG. 28A shows alignment of tire mouse (SEQ ID NO: 108), human (SEQ ID NO: 109) and macaque (SEQ ID NO: 110) miR902 sequences.
[0097] FIG. 28B shows alignment of the mouse (SEQ ID NO: 114), human (SEQ ID NO: 115) and macaque (SEQ ID NO: 116) miR2482 sequences.
[0098] FIG. 28C shows alignment of the mouse (SEQ ID NO: 111), human (SEQ ID NO: 112) and macaque (SEQ ID NO: 113) miR1331 sequences.
[0099]
[0100] DETAILED DESCRIPTION OF THE INVENTION
[0101] Provided herein is a composition useful for preventing, delaying the onset of, slowing, or treating a repeat expansion disease, e.g.. Huntington’s Disease. In certain embodiments the composition comprises an RNA inhibitory sequence which represses expression of MSH3 in a human subject and a carrier or vehicle for delivery of the RNA inhibitory sequence to the human subject. In certain embodiments, the composition comprises an artificial miRNA, e.g., miR902, miR2482 and / or miR1331, which is delivered to a subject by any suitable route, optionally in combination with one or more therapeutic products. In other embodiments, the RNA inhibitory sequence is an ASO or an RNA, e.g., one or more miR902, miR2482 and / or miR1331. In certain embodiments, the RNA inhibitory sequences are delivered via a non-viral or a viral vector.
[0102] In certain embodiments, a composition is provided which comprises (a) a delivery vehicle for miR902 which suppresses expression of MSH3 in a human subject and (b) a delivery vehicle nucleic acid sequence encoding human FAN 1 gene operably linked to expression control sequences.
[0103] Composition and regimens providing combination of one or more of these RNA inhibitory molecules (e.g., miR902) and FAN1 are provided.
[0104] RNA inhibitory sequences
[0105] Provided herein are nucleic acid molecules, including without limitation, miRNAs, siRNAs, dsRNAs, ASO, and shRNAs (collectively RNA inhibitory molecules) which inhibit expression of a MutS Homolog 3 (MSH3) gene product (DNA mismatch repair protein) in a human subject.
[0106] In certain embodiments, the inhibitory sequence (miR902 target) is an artificial nucleic acid sequence which contains at least 7 contiguous nucleotides complementary to SEQ ID NO: 108 (murine) or SEQ ID NO: 109 (human):
[0107] (murine) CAAACTGAAACTGCCGCATTA (SEQ ID NO: 108) or (human / macaque) CAAACTGAAACTGCAGCATTA (SEQ ID NO: 109 / SEQ ID NO: 110) (see also, FIG. 28A).
[0108] In certain embodiments, the inhibitory' sequences encode an RNA targeted to MSH3 gene (i.e., miR902) which comprises at least one nucleic acid sequence of about 16 nucleotides to about 28 nucleotides in length encoding a miR902 sense sequence (guide
[0109]
[0110] strand) of 7 to 19 consecutive nucleic acid sequences of: CAAACUGACUGCCGCAUUA (SEQ ID NO: 1); or CAAACUGACUGCAGCAUUA (SEQ ID NO: 145).
[0111] In certain embodiments, the nucleic acid sequence encoding SEQ ID NO: 1 comprises tire sequence of at least 7, at least 15. or at least 19 consecutive nucleotides of CAAACTGACTGCCGCATTA (SEQ ID NO: 4). In certain embodiments, the nucleic acid sequence encoding SEQ ID NO: 1 comprises the full-length sequence of SEQ ID NO: 4, optionally with 1 or 2 modified nucleotides.
[0112] As used herein, these “modified nucleotides” encompass mismatches due to substitution, mutation, etc., including a truncation at the 5’ and / or 3' end.
[0113] In certain embodiments, the inhibitory sequence further comprises at least one nucleic acid sequence of about 16 nucleotides to about 28 nucleotides in length encoding a miR902 anti-sense sequence (passenger strand) of 7 to 21 consecutive nucleotides of: UAAUGCGGCAGUUUCAGUUUG (SEQ ID NO: 7). In certain embodiments, each inhibitory coding sequence is independently a sequence of 18 to 26 nucleotides in length, or 19 to 21 nucleotides in length, and encodes tire sequence of at least 11 consecutive nucleotides, at least 15 consecutive nucleotides, or at least 18 consecutive nucleotides.
[0114] In certain embodiments, the nucleic acid sequence encoding SEQ ID NO: 7 comprises tire sequence of at least 7, at least 15, or 19 to 21 consecutive nucleotides of TAATGCGGCAGTTTCAGTTTG (SEQ ID NO: 10). In certain embodiments, the nucleic acid sequence encoding SEQ ID NO: 1 comprises the full-length sequence of SEQ ID NO: 10, optionally with 1 or 2 modified nucleotides.
[0115] In certain embodiments, the inhibitor}' sequence further comprises a loop nucleic acid sequence that operatively links tire sense sequence (guide strand) and the antisense sequence (passenger strand). For example, the RNA loop sequence may have the nucleic acid sequence of GTTTTGGCCACTGACTGAC (SEQ ID NO: 31), or a sequence at least 95% to 100% identical thereto, at least 97% identical, or a sequence at least 99% to 100% identical thereto. Alternatively, in other embodiments, a loop sequence of a different length, e.g., at least 4 to 8 based in length, or a loop with a longer sequence, may be selected.
[0116] In certain embodiments, the inhibitory' RNA molecule has a sense sequence, an antisense sequence, and a loop sequence therebetween, the nucleic acid sequence encoding the sequence of:
[0117]
[0118] UAAUGCGGCAGUUUCAGUUUGGUUUUGGCCACUGACUGACCAAACUG ACUGCCGCAUUA (SEQ ID NO: 13) (miR.902), or a sequence at least 95% to 100% identical thereto, at least 97% identical, or a sequence at least 99% to 100% identical thereto. In certain embodiments, the nucleic acid sequence encoding SEQ ID NO: 13 comprises the sequence of TAATGCGGCAGTTTCAGTTTGGTTTTGGCCACTGACTGACCAAACTGACTGCCG CATTA (SEQ ID NO: 16, miR902), or a sequence at least 95% to 100% identical thereto, at least 97% identical, or a sequence at least 99% to 100% identical thereto.
[0119] In certain embodiments, the inhibitory RNA further comprises a 5’ flanking region and / or a 3’ flanking region. In certain embodiments, the 5’ flanking region comprises a nucleic acid sequence encoding the sequence of CUGGAGGCUUGCUGAAGGCUGUAUGCU (SEQ ID NO: 19) or CUGGAGGCUUGCUGAAGGCUGUA (SEQ ID NO: 20). In certain embodiments, the nucleic acid sequence encoding SEQ ID NO: 19, comprises the sequence of ctggaggcttgctgaaggctgtatgct (SEQ ID NO: 21), or a sequence at least 95% to 100% identical thereto, at least 97% identical, or a sequence at least 99% to 100% identical thereto. In certain embodiments, tire nucleic acid sequence encoding SEQ ID NO: 20, comprises the sequence of SEQ ID NO: 22, or a sequence at least 95% to 100% identical thereto, at least 97% identical, or a sequence at least 99% to 100% identical thereto. In certain embodiments, the 3’ flanking region comprises a nucleic acid sequence encoding the sequence of CAGGACACAAGGCCUGUUACUAGCACUCACAUGGAACAAAUGGCC (SEQ ID NO: 23). In certain embodiments, the nucleic acid sequence encoding SEQ ID NO: 23, comprises the sequence of caggacacaaggcctgttactagcactcacatggaacaaatggcc (SEQ ID NO: 24), or a sequence at least 95% to 100% identical thereto, at least 97% identical, or a sequence at least 99% to 100% identical thereto.
[0120] In certain embodiments, the RNA inhibitory sequence encodes the miR902 having the sequence of:
[0121] CUGGAGGCUUGCUGAAGGCUGUAUGCUGUAAUGCGGCAGUUUCAGUU UGGUUUUGGCCACUGACUGACCAAACUGACUGCCGCAUUACAGGACACAAG GCCUGUUACUAGCACUCACAUGGAACAAAUGGCC (SEQ ID NO: 25).
[0122]
[0123] In certain embodiments, the nucleic acid sequence encoding SEQ ID NO: 25, comprises the sequence of ctggaggcttgctgaaggctgtatgctgTAATGCGGCAGTTTCAGTTTGGTTTTGGCCACTGACT GACCAAACTGACTGCCGCATTAcaggacacaaggcctgttactagcactcacatggaacaaatggcc (SEQ ID NO: 28), or a sequence at least 95% to 100% identical thereto, at least 97% identical, or a sequence at least 99% to 100% identical thereto
[0124] In certain embodiments, the inhibitory sequence comprises at least one miR902 sense, at least one miR902 antisense, and / or a loop, 5' and / or 3’ overhang as defined herein. In certain embodiments, an ASO comprising one or more of these sequences is selected. In other embodiments, another RNA inhibitory sequence comprises one or more of the miR902 sequences.
[0125] In certain embodiments, tire inhibitory RNA sequence (miR2482 target) is an artificial nucleic acid sequence which contains at least 7 contiguous nucleotides complementary to SEQ ID NO: 114 (murine; TAGCAACTGTTGACTGTATTT) or SEQ ID NO: 115 / 116 (human / macaque; TAGCAACTGTTGACTGCATTT). See also, FIG. 28B.
[0126] In certain embodiments, the inhibitory sequences encode an RNA targeted to MSH3 gene (i.e., miR2482) which comprises at least one nucleic acid sequence of about 16 nucleotides to about 28 nucleotides in length encoding a miR2482 sense sequence (guide strand) of 7 to 19 consecutive nucleic acid sequences of: UAGCAACUUGACUGCAUUU (SEQ ID NO: 2).
[0127] In certain embodiments, the nucleic acid sequence encoding SEQ ID NO: 2 comprises the sequence of at least 7, at least 15, or at least 19 consecutive nucleotides of SEQ ID NO: 5. In certain embodiments, the nucleic acid sequence encoding SEQ ID NO:2 comprises the full-length sequence of SEQ ID NO: 5, optionally with 1, 2 modified nucleotides.
[0128] In certain embodiments, tire inhibitory sequence further comprises at least one nucleic acid sequence of about 16 nucleotides to about 28 nucleotides in length encoding a miR2482 antisense (passenger strand) sequence of 7 to 21 consecutive nucleotides of: UGCUGAAAUGCAGUCAACAGUUGCUA (SEQ ID NO: 8). In certain embodiments, each inhibitory coding sequence is independently a sequence of 18 to 26 nucleotides in length, or 19 to 21 nucleotides in length, and encodes tire sequence of at least 11
[0129]
[0130] consecutive nucleotides, at least 15 consecutive nucleotides, or at least 18 consecutive nucleotides.
[0131] In certain embodiments, the nucleic acid sequence encoding SEQ ID NO: 8 comprises tire sequence of at least 7, at least 15. or 19 to 21 consecutive nucleotides of TGCTGAAATGCAGTCAACAGTTGCTA (SEQ ID NO: 11). In certain embodiments, the nucleic acid sequence encoding SEQ ID NO: 8 comprises the full-length sequence of SEQ ID NO: 11, optionally with 1 or 2 modified nucleotides.
[0132] In certain embodiments, the inhibitory sequence further comprises a loop nucleic acid sequence that operatively links tire sense sequence (guide strand) and the antisense sequence (passenger strand). For example, the RNA loop sequence of the nucleic acid sequence of SEQ ID NO: 31, or a sequence at least 80%, at least 85%, at least 90%, at least 95% identical thereto, at least 97% identical, or a sequence 99% to 100% identical thereto.
[0133] In certain embodiments, the inhibitory RNA molecule has a sense sequence, an antisense sequence and a loop sequence therebetween, which comprises the nucleic acid sequence encoding the sequence of:
[0134] UGCUGAAAUGCAGUCAACAGUUGCUAGUUUUGGCCACUGACUGACUAGCAA CUUGACUGCAUUU (SEQ ID NO: 14) (miR2482), or a sequence at least 95% identical thereto, at least 97% identical, or a sequence at least 99% to 100% identical thereto. In certain embodiments, the nucleic acid sequence encoding SEQ ID NO: 14 comprises the sequence of TGCTGAAATGCAGTCAACAGTTGCTAGTTTTGGCCACTGACTGACTAGCAACTT GACTGCATTT (SEQ ID NO: 17), or a sequence at least 95% identical thereto, at least 97% identical, or a sequence at least 99% to 100% identical thereto.
[0135] In certain embodiments, the inhibitory’ RNA further comprises a 5’ flanking region and / or a 3’ flanking region. In certain embodiments, the 5’ flanking region comprises a nucleic acid sequence encoding the sequence of CUGGAGGCUUGCUGAAGGCUGUAUGCU (SEQ ID NO: 19). In certain embodiments, the nucleic acid sequence encoding SEQ ID NO: 19, comprises the sequence of ctggaggcttgctgaaggctgtatgct (SEQ ID NO: 21), or a sequence at least 95% identical thereto, at least 97% identical, or a sequence at least 99% identical thereto. In certain embodiments, the 3’ flanking region comprises a nucleic acid sequence encoding the sequence of
[0136]
[0137] CAGGACACAAGGCCUGUUACUAGCACUCACAUGGAACAAAUGGCC (SEQ ID NO: 23). In certain embodiments, the nucleic acid sequence encoding SEQ ID NO: 23, comprises the sequence of caggacacaaggcctgttactagcactcacatggaacaaatggcc (SEQ ID NO: 24), or a sequence at least 95% identical thereto, at least 97% identical, or a sequence at least 99% to 100% identical thereto.
[0138] In certain embodiments, the RNA inhibitor} sequence encodes the miR2482 having the sequence of:
[0139] CUGGAGGCUUGCUGAAGGCUGUAUGCUGAAAUGCAGUCAACAGUUGC UAGUUUUGGCCACUGACUGACUAGCAACUUGACUGCAUUUCAGGACACAAG GCCUGUUACUAGCACUCACAUGGAACAAAUGGCC (SEQ ID NO: 26).
[0140] In certain embodiments, tire nucleic acid sequence encoding SEQ ID NO: 26, comprises the sequence of ctggaggcttgctgaaggctgtaTGCTGAAATGCAGTCAACAGTTGCTAGTTTTGGCCACTG ACTGACTAGCAACTTGACTGCATTTcaggacacaaggcctgttactagcactcacatggaacaaatggcc (SEQ ID NO: 29), or a sequence at least 95% identical thereto, at least 97% identical, or a sequence at least 99% to 100% identical thereto
[0141] In certain embodiments, the inhibitory sequence comprises at least one miR2482 sense, at least one miR2482 antisense, and / or a loop, 5’ and / or 3’ overhang as defined herein. In certain embodiments, an ASO comprising one or more of these sequences is selected. In other embodiments, another RNA inhibitory sequence comprises one or more of the miR2482 sequences.
[0142] In certain embodiments, the inhibitory sequence comprises at least one miR2482 sense, at least one miR2482 antisense, and / or a loop, 5’ and / or 3’ overhang as defined herein. In certain embodiments, an ASO comprising one or more of these sequences is selected. In other embodiments, another RNA inhibitory sequence comprises one or more of the miR2482 sequences.
[0143] In certain embodiments, tire inhibitory sequence (miR1331 target) is an artificial nucleic acid sequence which contains at least 7 contiguous nucleotides complementary to SEQ ID NO: 111 (murine; CAATGTCAGTGTGCGGGATGA) or SEQ ID NO: 112 / 113 (human / macaque; ATCTGTTAGTGTGCAGGATGA). See also, FIG. 28C.
[0144] In certain embodiments, the inhibitory' sequences encode an RNA targeted to MSH3 gene (i.e., miR1331) which comprises at least one nucleic acid sequence of about 16
[0145]
[0146] nucleotides to about 28 nucleotides in length encoding a miR1331 sense sequence (guide strand) of 7 to 19 consecutive nucleic acid sequences of: AUCUGUUAGUGCAGGAUGA (SEQ ID NO: 3).
[0147] In certain embodiments, the nucleic acid sequence encoding SEQ ID NO: 1 comprises the sequence of at least 7, at least 15, or at least 19 consecutive nucleotides of ATCTGTTAGTGCAGGATGA (SEQ ID NO: 6). In certain embodiments, the nucleic acid sequence encoding SEQ ID NO: 3 comprises the full-length sequence of SEQ ID NO: 6, optionally with 1 or 2 modified nucleotides.
[0148] In certain embodiments, the inhibitory’ sequence further comprises at least one nucleic acid sequence of about 16 nucleotides to about 28 nucleotides in length encoding a miR1331 sense sequence (passenger strand) of 7 to 21 consecutive nucleotides of:
[0149] GUCAUCCUGCACACUAACAGAU (SEQ ID NO: 9). In certain embodiments, each inhibitory' coding sequence is independently a sequence of 18 to 26 nucleotides in length, or 19 to 21 nucleotides in length, and encodes the sequence of at least 11 consecutive nucleotides, at least 15 consecutive nucleotides, or at least 18 consecutive nucleotides.
[0150] In certain embodiments, the nucleic acid sequence encoding SEQ ID NO: 9 comprises the sequence of at least 7, at least 15, or 19 to 21 consecutive nucleotides of GTCATCCTGCACACTAACAGAT (SEQ ID NO: 12). In certain embodiments, the nucleic acid sequence encoding SEQ ID NO: 1 comprises the foil-length sequence of SEQ ID NO: 10, optionally with 1 or 2 modified nucleotides.
[0151] In certain embodiments, the sense sequence (guide strand) comprises the nucleic acid sequence encoding SEQ ID NO: 3; and foe antisense sequence (passenger strand) comprises foe nucleic acid sequence encoding SEQ ID NO: 9. In certain embodiments, the RNA inhibitory molecule comprises the nucleic acid sequence of SEQ ID NO: 6; and the passenger strand comprises foe nucleic acid sequence of SEQ ID NO: 12.
[0152] In certain embodiments, foe inhibitory sequence further comprises a loop nucleic acid sequence that operatively links foe sense sequence (guide strand) and the antisense sequence (passenger strand). For example, the RNA loop sequence of foe nucleic acid sequence of GTTTTGGCCACTGACTGAC (SEQ ID NO: 31), or a sequence at least 95% to 100% identical thereto, at least 97% identical, or a sequence at least 99% to 100% identical thereto.
[0153]
[0154] In certain embodiments, the inhibitory' RNA molecule has a sense sequence, a loop sequence, which comprises tire nucleic acid sequence encoding the sequence of:
[0155] UAAUGCGGCAGUUUCAGUUUGGUUUUGGCCACUGACUGACCAAACUG ACUGCCGCAUUA (SEQ ID NO: 13) (miR1331), or a sequence at least 95% to 100% identical thereto, at least 97% identical, or a sequence at least 99% to 100% identical thereto. In certain embodiments, the nucleic acid sequence encoding SEQ ID NO: 13 comprises the sequence of TAATGCGGCAGTTTCAGTTTGGTTTTGGCCACTGACTGACCAAACTGACTGCCG CATTA (SEQ ID NO: 16, miR1331), or a sequence at least 95% to 100% identical thereto, at least 97% identical, or a sequence at least 99% to 100% identical thereto.
[0156] In certain embodiments, tire inhibitory RNA further comprises a 5’ flanking region and / or a 3’ flanking region. In certain embodiments, tire 5' flanking region comprises a nucleic acid sequence encoding the sequence of CUGGAGGCUUGCUGAAGGCUGUAUGCU (SEQ ID NO: 19) or CUGGAGGCUUGCUGAAGGCUGUA (SEQ ID NO: 20). In certain embodiments, the nucleic acid sequence encoding SEQ ID NO: 19, comprises the sequence of ctggaggcttgctgaaggctgtatgct (SEQ ID NO: 21), or a sequence at least 95% to 100% identical thereto, at least 97% identical, or a sequence at least 99% to 100% identical thereto. In certain embodiments, the nucleic acid sequence encoding SEQ ID NO: 20. comprises the sequence of SEQ ID NO: 22, or a sequence at least 95% to 100% identical thereto, at least 97% identical, or a sequence at least 99% to 100% identical thereto. In certain embodiments, the 3’ flanking region comprises a nucleic acid sequence encoding tire sequence of CAGGACACAAGGCCUGUUACUAGCACUCACAUGGAACAAAUGGCC (SEQ ID NO: 23). In certain embodiments, the nucleic acid sequence encoding SEQ ID NO: 23, comprises tire sequence of caggacacaaggcctgttactagcactcacatggaacaaatggcc (SEQ ID NO: 24), or a sequence at least 95% to 100% identical thereto, at least 97% identical, or a sequence at least 99% to 100% identical thereto.
[0157] In certain embodiments, the RNA inhibitory' sequence encodes the miR1331 having the sequence of:
[0158] CUGGAGGCUUGCUGAAGGCUGUAUGCUGUCAUCCUGCACACUAACAGAUGU
[0159]
[0160] UUUGGCCACUGACUGACAUCUGUUAGUGCAGGAUGACAGGACACAAGGCCU GUUACUAGCACUCACAUGGAACAAAUGGCC (SEQ ID NO: 27).
[0161] In certain embodiments, the nucleic acid sequence encoding SEQ ID NO: 27, comprises tire sequence of ctggaggcttgctgaaggctgtatgctGTCATCCTGCACACTAACAGATGTTTTGGCCACTGAC TGACATCTGTTAGTGCAGGATGAcaggacacaaggcctgttactagcactcacatggaacaaatggcc (SEQ ID NO: 30) or a sequence at least 95% to 100% identical thereto, at least 97% identical, or a sequence at least 99% to 100% identical thereto.
[0162] In certain embodiments, one or more of an alternative loop sequence, an alternate 5’ overhang, an alternative 3' overhang may be selected. In still other embodiments, tire 5’ and / or 3‘ overhang may be absent. In some embodiments, the RNA inhibitory sequences provide herein have 0-7 nucleotide 3’ overhangs or 0-4 nucleotide 5' overhangs. In some embodiments, the RNA molecule has a single uracil (e.g., U) overhang at each 3’ end of the RNA. In some embodiments, the siRNA molecule has a double uracil (e g., UU) overhang at each 3 ’ end of the RNA. In some embodiments, the RNA molecule has a single thymine (e.g., T) overhang at each 3’ end of the siRNA. In some embodiments, the RNA molecule has a double thymine (e.g., TT) overhang at each 3’ end of the RNA. In some embodiments, the RNA molecule has a cytosine and thymine (e.g., CT) overhang at each 3’ end of the RNA.
[0163] In certain embodiments, tire inhibitory sequence comprises at least one miR1331 sense, at least one miR1331 antisense, and / or a loop, 5’ and / or 3’ overhang as defined herein. In certain embodiments, an ASO comprising one or more of these sequences is selected. In other embodiments, another RNA inhibitory sequence comprises one or more of the miR1331 sequences.
[0164] In some embodiments, the sense and antisense strands of an RNA molecule are completely complementary over the full-length of the continuous sequence. In some embodiments, the sense and antisense strands of an inhibitory RNA molecule (e.g., miR902, miR2482, or miR1331) of the disclosure are completely complementary to the extent that their lengths overlap with one another. Depending on the sequence of the first and second strand, complementarity need not be complete or perfect, which means that the first and second strand are not 100% base-paired due to mismatches. One or more
[0165]
[0166] mismatches may be present within an inhibitory RNA as provided herein without impacting the RNAi’s ability to reduce expression of the MSH3.
[0167] The miRNA and / or another selected other RNA inhibitory sequences may be chemically synthesized and administered to a subject, or the RNA inhibitory sequences can be encoded in a nucleic acid sequence that is expressed in the cell via a suitable composition, e.g., a viral or non-viral vector.
[0168] A chemically synthesized miRNA can comprise a single-stranded RNA (ssRNA) or a double-stranded RNA (dsRNA) molecule. The RNA molecule can comprise a pri-miRNA, which can be hundreds of nucleotides in length, a pre -miRNA, which is generally 60-80 nucleotides in length, or tire mature miRNA, which may be 18-26 nucleotides in length and / or as disclosed herein. Administration of the pri-miRNA and pre-miRNA to the cell results in production of the mature miRNA. RNA molecules can be synthesized in vitro from a DNA template, or can be synthesized commercially and are available from such corporations as Dharmacon, Inc. (Lafayette, Colo ), Qiagen (Valencia, Calif.), and Ambion (Austin, Tex.). In some embodiments, the RNA inhibitory molecule is another RNA which comprises one or more of a sense and / or one or more of the sequence of the artificial miR-902, miR2482, or miR133 Idescribed herein, optionally in an RNAi having a loop and / or an optional 5’ and / or 3' overhang, or an ASO.
[0169] A used herein, the term “effective amount” above described is meant a sufficient amount of the RNA inhibitory molecule(s) (e.g., miR902, miR2482. miR1331, or a precursor or variant thereof) for achieving the desired inhibition of MSH3 expression.
[0170] Such at least one miRNA may be used in combinations, including in an expression cassette or a vector genome also comprising a coding sequence for therapeutic protein, enzy me, or other moiety’, and which is operably linked to the coding sequence. In certain embodiments, the vector genome may contain one miRNA to eight miRNA sequences, which are the same or different.
[0171] FAN1
[0172] In certain embodiments, a vector comprising a nucleic acid human Fanconi anemia-associated nuclease l(hFAN 1) coding sequence operably linked to expression control sequences is provided for delivery to a subject for delaying clinical onset, treatment, and / or amelioration of symptoms of Huntington's disease and / or other disorders associated with
[0173]
[0174] CAG repeat expansion. In certain embodiments, a vector comprising a nucleic acid mouse Fanconi anemia-associated nuclease l(mFANl) coding sequence operably linked to expression control sequences is provided for delivery to a subject for delaying clinical onset, treatment, and / or amelioration of symptoms of Huntington’s disease and / or other disorders associated with CAG repeat expansion.
[0175] In certain embodiments, e.g., when used in combination with an RNA inhibitory molecule as described herein, a native human FAN 1 coding sequence may be selected. However, in other embodiments, provided herein is a novel nucleic acid sequence having an artificial human FAN 1 coding sequence operably linked to sequences for in vivo expression of human FAN 1 to a subject. In certain embodiments, the hFAN 1 coding sequence is nucleic acid sequence of SEQ ID NO: 104 or a sequence 95% to 100% identical thereto encoding a hFAN 1 having the amino acid sequence of SEQ ID NO: 105, wherein the hFAN 1 nucleic acid sequence is operably linked to expression control sequences. In some embodiments, provided herein is a nucleic acid sequence having an engineered human FAN 1 coding sequence. In certain embodiments, the hFAN 1 coding sequence is nucleic acid sequence of SEQ ID NO: 104 or a sequence 95% to 100% identical thereto encoding a hFAN 1 having the amino acid sequence of SEQ ID NO: 105, wherein the hFAN 1 coding sequence is engineered, and wherein the hFAN 1 nucleic acid sequence is operably linked to expression control sequences.
[0176] These hFAN 1 and the other nucleic acid sequences described herein, can be cloned using molecular biology techniques, or generated de novo by DNA synthesis, which can be performed using routine procedures by sendee companies having business in the field of DNA synthesis and / or molecular cloning (e.g., GeneArt, GenScript, Life Technologies, Eurofins). The nucleic acid sequences encoding the RNA or DNA (e.g., cDNA) described herein are assembled and placed into any suitable genetic element, e.g., naked DNA, phage, transposon, cosmid, episome, etc., which transfers the sequences carried thereon to a host cell, e.g.. for generating non-viral delivery systems (e.g., RNA-based systems, naked DNA, or the like), or for generating viral vectors in a packaging host cell, and / or for delivery to a host cells in a subject. In one embodiment, the genetic element is a vector. In one embodiment, the genetic element is a plasmid. The methods used to make such engineered constructs are known to those with skill in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, e.g., Green and
[0177]
[0178] Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY (2012).
[0179] Expression Cassete and Vector Genome
[0180] Provided herein is a nucleic acid molecule comprising the artificial miR and / or artificial hFAN 1 coding sequence under control of regulatory sequences which direct expression of the functional expression product in a target cell. In certain embodiments, the expression cassette comprises an open reading frame (ORF) for a hFAN 1 coding sequence which encode functional hFANl, wherein the ORF is operably linked to regulatory control sequences which direct expression of the functional hFAN 1 protein in a cell, and wherein the regulatory control sequences comprise a promoter, or a hybrid promoter, optionally an enhancer, optionally an intron, and a polyadenylation (polyA) sequence. In certain embodiments, the expression cassette is a nucleic sequence comprising: (i) a nucleic acid sequence comprising SEQ ID NO: 104 or a sequence 95% to 100% identical thereto encoding a hFAN 1 having the amino acid sequence of SEQ ID NO: 105 encoding a human FAN1 (hFANl), and (ii) regulatory control sequences operably linked to the sequences of (i), wherein the regulatory control sequences comprise an optional enhancer, a promoter, an optional intron, and a polyadenylation (polyA) signal sequence.
[0181] In certain embodiments, an expression cassete comprises one or more coding sequences for an RNA inhibitory molecule (e.g., one or more of the sense and / or antisense sequences of the miR902, miR2482, and / or miR133), operably linked to expression control sequences which direct expression of the gene product.
[0182] As used herein, an “expression cassette” refers to a nucleic acid molecule which comprises a biologically useful nucleic acid sequence (e.g., a gene cDNA encoding a protein, enzyme or other useful gene product, RNA. etc.) and include regulatory sequences operably linked thereto which control, direct, enable and / or modulate transcription, translation, and / or expression of the nucleic acid sequence and its gene product.
[0183] As used herein, the term “regulatory' sequence / s”, or “regulatory? control sequence / s “or “expression control sequence / s” refers to nucleic acid sequences, including, but not limiting to, e.g., initiator sequences, enhancer sequences, promoter sequences, intron sequences, and polyA signal sequences which direct, enable, induce, repress, or otherw ise
[0184]
[0185] control the transcription, translation and / or expression of nucleic acid sequences encoding a product to which they are operably linked.
[0186] As used herein, “operably linked’' sequences include both regulatory sequences that are contiguous or non-contiguous with the nucleic acid sequence and regulatory sequences that act in trans or cis nucleic acid sequence. Such regulatory sequences typically include, e.g., one or more of a promoter, an enhancer, an intron, a Kozak sequence, a polyadenylation sequence, and a TATA signal. The expression cassette may contain regulatory sequences upstream (5’ to or also 5') of the gene / coding sequence, e.g., one or more of a promoter, an enhancer, an intron, etc., and one or more of an enhancer, or regulatory sequences downstream (3’ to or 3') a gene sequence, e.g.. 3’ untranslated region (3‘ UTR) comprising a poly adenylation site, among other elements. In certain embodiments, the regulatory sequences are operably linked to the nucleic acid sequence of a gene product, wherein the regulatory sequences are separated from nucleic acid sequence of a gene product by an intervening nucleic acid sequences, i.e., 5 ’-untranslated regions (5 ’UTR). In certain embodiments, the expression cassette comprises nucleic acid sequence of one or more of gene products. In some embodiments, the expression cassette can be a monocistronic or a bicistronic expression cassette.
[0187] Typically, such an expression cassette can be used for generating a viral vector and contains the coding sequence for the gene product described herein flanked by packaging signals of the viral genome and other expression control sequences such as those described herein. In certain embodiments, a vector genome may contain two or more expression cassettes.
[0188] Where present, multicistronic expression constructs simultaneously express two or more separate products from the same nucleic acid molecule (i.e., produced from the same promoter). For example, such nucleic acids can comprise coding sequences for two or more reporter proteins separated by an intervening internal ribosome entry site (IRES) or an intervening 2A peptide coding sequence. These 2A peptides are small “self-cleaving” peptides, generally having a length of 18-22 amino acids and produce approximately equimolar levels of multiple genes from the same nucleic acid molecule. The “cleavage” occurs between the glycine and proline residues found on the C -terminus, meaning the upstream cistron will have a few additional residues added to the end, while tire downstream cistron will start with the proline. As a result, the “cleaved-off ’ downstream
[0189]
[0190] peptide may have proline at its N-terminus. 2A-mediated cleavage is a universal phenomenon in eukaryotic cells. Examples of suitable 2A peptides are provided herein. In certain embodiments, the 2A peptides derived from foot-and-mouth disease virus (F2A), equine rhinitis A virus (E2A), porcine teschovirus- 1 (P2A) and Thosea asigna virus (T2A). See also, Jake Chng, et al. (2015) Cleavage efficient 2A peptides for high level monoclonal antibody expression in CHO cells, mAbs, 7:2, 403-412, which is incorporated herein by reference in its entirety. In certain embodiments, the 2A peptide linker is a 2A peptide from foot-and-mouth disease virus with the GSG linker (GF2A). In certain embodiments, the 2A peptide linker is a 2A peptide from porcine teschovirus- 1 with the GSG linker (GP2A). In certain embodiments, the 2A peptide linker is a 2A peptide from Thosea asigna virus with the GSG linker (GT2A). comprises the 2A linker, wherein the 2A linker is Thosea asigna virus GSG linker (GT2A), Porcine teschovirus- 1 GSG linker (GP2A). or Foot-and-mouth disease virus GSG linker (GF2A)
[0191] In certain embodiments, the regulatory sequences comprise one or more of a promoter. In certain embodiments the selected promoter is a constitutive promoter. In certain embodiments, the promoter is a ubiquitous promoter. In certain embodiments, the promoter is a cell specific promoter. In certain embodiments, the promoter is a neuron specific and / or immune specific cell promoter. For example such promoters may include chicken beta-actin (CB) promoter, human cytomegalovirus (CMV) promoter, ubiquitin C promoter (UbC), the early and late promoters of simian virus 40 (SV40), U6 promoter, metallothionein promoters, EFla promoter, ubiquitin promoter, hypoxanthine phosphoribosyl transferase (HPRT) promoter, dihydrofolate reductase (DHFR) promoter (Scharfmann et al., Proc. Natl. Acad. Sci. USA 88:4626-4630 (1991), adenosine deaminase promoter, phosphoglyccrol kinase (PGK) promoter, pyruvate kinase promoter phosphoglycerol mutase promoter, the P-actin promoter (Lai et al., Proc. Natl. Acad. Sci. USA 86: 10006-10010 (1989)). the long terminal repeats (LTR) of Moloney Leukemia Virus and other retroviruses, the thymidine kinase promoter of Herpes Simplex Virus and other constitutive promoters known to those of skill in the art. In certain embodiments, the promoter is a CB7 promoter, also referred to as hybrid CB7 promoter, comprising a cytomegalovirus immediate-early (CMV IE) enhancer and the chicken P-actin promoter, optionally w ith spacer sequence, optionally witir a chimeric intron comprising chicken beta actin intron and further comprising a chicken beta-actin splicing donor (including the exon
[0192]
[0193] sequence, chicken beta actin intron) and rabbit beta-globin splicing acceptor), or a CBh promoter [SJ Gray et al, Hu Gene Ther, 201 1 Sep; 22(9): 143-1153], In certain embodiments, the promoter is a tissue- or cell specific -promoter. In certain embodiments, the promoter is Synapsin I promoter. In one embodiment, expression of the gene product is controlled by a regulatable promoter that provides tight control over the transcription of the sequence encoding the gene product, e.g., a pharmacological agent, or transcription factors activated by a pharmacological agent or in alternative embodiments, physiological cues. Promoter systems that are non-leaky and that can be tightly controlled are preferred.
[0194] Examples of rcgulatablc promoters which arc ligand-dcpcndcnt transcription factor complexes that include, without limitation, members of the nuclear receptor superfamily activated by their respective ligands (e.g., glucocorticoid, estrogen, progestin, retinoid, ecdysone, and analogs and mimetics thereof) and rTTA activated by tetracycline. In one aspect, the gene switch is an EcR-based gene switch. Examples of such systems include, without limitation, the systems described in US Patent Nos. 6,258,603, 7,045,315, U.S. Published Patent Application Nos. 2006 / 0014711, 2007 / 0161086, and International Published Application No. WO 01 / 70816. Examples of chimeric ecdysone receptor systems are described in U.S. Pat. No. 7,091,038, U.S. Published Patent Application Nos.
[0195] 2002 / 0110861, 2004 / 0033600, 2004 / 0096942, 2005 / 0266457, and 2006 / 0100416, and International Published Application Nos. WO 01 / 70816, WO 02 / 066612, WO 02 / 066613, WO 02 / 066614, WO 02 / 066615, WO 02 / 29075, and WO 2005 / 108617. each of which is incorporated by reference in its entirety. An example of a non-steroidal ecdysone agonist-regulated system is the RheoSwitch® Mammalian Inducible Expression System (New England Biolabs, Ipswich, MA).
[0196] In certain embodiments, the promoter which is human synapsin, a chicken beta actin promoter, a CMVe.mP84, a calmodulin promoter or a prion promoter. In certain embodiments, chicken beta actin promoter is in a promoter element which further comprises a combination of an enhancer and / or an intron. For example, CB7 a hybrid promoter comprising a cytomegalovirus immediate-early (CMV IE) enhancer and a chicken (I-actin promoter, optionally with spacer sequence, optionally with a chimeric intron comprising chicken beta actin intron and further comprising a chicken beta-actin splicing donor (including the exon sequence, chicken beta actin intron) and rabbit betaglobin splicing acceptor (see, e.g., SEQ ID NO: 117). The GAG promoter is also a hybrid
[0197]
[0198] promoter element comprising a chicken beta actin promoter (see, e.g., SEQ ID NO: 122), a hybrid intron in CAG (e.g., SEQ ID NO: 124) comprising a rabbit betal-globin (SEQ ID NO: 121), a rabbit b-globin exon (e.g., SEQ ID NO: 121), and optional spacer sequences between the elements. In still other embodiments, the promoter a small promoter which expression in neurons. Examples of suitable small promoters may include, e.g., may be a human Synapsin promoter (e.g., see, SEQ ID NO: 125), a CMV-E(+).pP-84 promoter (see, e.g., SEQ ID NO: 126), a CMV-E(+) promoter (see, e.g., SEQ ID NO: 127), a pU-84 promoter (see, e.g., SEQ ID NO: 128), a CALM1 promoter (see, e.g., SEQ ID NO: 129), or pCALMl promoter which is a calmodulin promoter (Ca binding protein) or a prion promoter, such as prion 148 (see, e.g., SEQ ID NO: 130). Still other promoters may include, e.g., a Ca2+ / calmodulin-dependent kinase subunit a (CaMKII) promoter, neuronspecific enolase (NSE) promoter, and synapsin I with a minimal CMV sequence (Synl-miniCMV) promoter.
[0199] In certain embodiments, the expression cassette comprises one or more expression enhancers. In one embodiment, tire expression cassette contains two or more expression enhancers. These enhancers may be the same or may differ from one another. In a further embodiment, the enhancer(s) is selected from one or more of an APB enhancer, an ABPS enhancer, an alpha mic / bik enhancer, a TTR enhancer, an en34 enhancer, an ApoE enhancer, a cytomegalovirus immediate early (CMV IE) enhancer, or an RSV enhancer. In yet another embodiment, the regulatory elements comprise an intron. In a further embodiment, the intron is selected from chicken beta actin intron (CBA), human beta globin, IVS2, SV40 (Promega), chimeric intron available from Promega®, bGH, alphaglobulin, beta-globulin, collagen, ovalbumin, or p53. See, e.g., WO 2011 / 126808. In one embodiment, the regulatory elements comprise a polyA. In a further embodiment, the polyA is a synthetic polyA or from bovine growth hormone (bGH), human growth hormone (hGH), SV40. rabbit P-globin (RBG or rBG), or modified RBG (mRBG).
[0200] Optionally, one or more sequences may be selected to stabilize mRNA. An example of such a sequence is a modified WPRE sequence, which may be engineered upstream of the polyA sequence and downstream of the coding sequence [see, e g., MA Zanta-Boussif, et al, Gene Therapy (2009) 16: 605-619.
[0201] In certain embodiments, the expression cassettes may include one or more expression enhancers such as post-transcriptional regulatory element from hepatitis viruses
[0202]
[0203] of woodchuck (WPRE), human (HP RE), ground squirrel (GPRE) or arctic ground squirrel (AGSPRE); or a synthetic post-transcriptional regulatory element. These expressionenhancing elements are particularly advantageous when placed in a 3' UTR and can increase mRNA stability and / or protein yield. Suitable WPRE sequences are provided in the vector genomes described herein and are known in the art (e.g., such as those described in US PatentNos. 6,136,597, 6,287,814, and 7,419,829, which are incorporated by reference). In certain embodiments, the WPRE is a variant that has been mutated to eliminate expression of the w oodchuck hepatitis B virus X (WHX) protein, including, for example, mutations in the start codon of the WHX gene. In other embodiments, enhancers are selected from a non-viral source. In certain embodiments, no post-transcriptional regulatory sequence is present.
[0204] In certain embodiments, the expression cassette comprising miR and / or hFAN coding sequence operably linked to expression control sequences. In certain embodiments, the target cell is a nervous system cell, brain cell, and / or immune system cell. In certain embodiments, the target cell is brain cell. In other embodiments, otirer target cells may be desired.
[0205] In certain embodiments, the regulator}’ sequences comprise an enhancer, w herein the enhancer is a cytomegalovirus immediate early enhancer (CMV IE enhancer). In certain embodiments, the regulatory sequences comprise an enhancer, wherein the enhancer is a CMV IE enhancer comprising nucleic acid of SEQ ID NO: 118. In certain embodiments, the regulatory sequences comprise a promoter, wherein the promoter is a chicken beta actin promoter. In certain embodiments, the regulatory sequences comprise a promoter, wherein the promoter is a chicken beta actin promoter comprising SEQ ID NO: 119. In certain embodiments, tire regulatory sequences comprise an intron, w herein the intron is a chicken beta actin intron. In certain embodiments, tire regulatory sequences comprise an intron, wherein tire intron is a chicken beta actin intron comprising SEQ ID NO: 123. In certain embodiments, the regulatory sequences comprise an intron, wherein the intron is a chimeric intron comprising a chicken beta actin intron and further comprising a chicken beta-actin splicing donor (including the exon sequence, chicken beta actin intron) and rabbit beta-globin splicing acceptor). In certain embodiments, tire regulatory' sequences comprise an intron, wherein the intron is a chimeric intron comprising SEQ ID NO: 120. In certain embodiments, die regulatory sequences comprise a promoter w hich is a hybrid CB7
[0206]
[0207] promoter comprising a cytomegalovirus immediate-early (CMV IE) enhancer and the chicken P-actin promoter, optionally with spacer sequence, optionally with a chimeric intron comprising chicken beta actin intron and further comprising a chicken beta-actin splicing donor (including the exon sequence, chicken beta actin intron) and rabbit betaglobin splicing acceptor). In certain embodiments, the regulatory sequences comprise a promoter which is a hybrid CB7 promoter comprises SEQ ID NO: 117. In certain embodiments, the regulatory sequences comprise a promoter which is a CAG promoter comprising a cytomegalovirus (CMV) enhancer and tire chicken P-actin promoter, optionally with spacer sequence, optionally with a shortened chimeric intron comprising chicken beta actin intron and rabbit beta-globin exon. In certain embodiments, the regulatory sequences comprise a promoter which is a hybrid CAG promoter comprises SEQ ID NO: 122. In certain embodiments, the regulatory sequences comprise a polyadenylation (poly A) signal sequence, wherein the polyadenylation signal sequence is a SV40 polyA signal sequence. In certain embodiments, the regulatory sequences comprise a polyA signal sequence from a non-viral source, e.g., the polyadenylation signal sequence is a rabbit beta globin polyA signal sequence comprising SEQ ID NO: 121.
[0208] In certain embodiments, an expression cassette comprises expression control sequences operably linked a nucleic acid sequence encoding at least one RNA product which inhibits expression of MSH3 in a human subject, wherein the at least one nucleic acid sequence comprises at least one of:
[0209] (i) one or more of CAAACTGACTGCCGCATTA (SEQ ID NO: 4, miR902S) or a variant of SEQ ID NO: 4 sequence having 1 or 2 nucleotide changes; and / or TAATGCGGCAGTTTCAGTTTG (SEQ ID NO: 10, miR902AS) or a or a variant of SEQ ID NO: 10 sequence having 1 or 2 nucleotide changes;
[0210] (ii) one or more of TAGCAACTTGACTGCATTT (SEQ ID NO: 5, miR2482S) or a variant of SEQ ID NO: 5 sequence having 1 or 2 nucleotide changes, and / or TGCTGAAATGCAGTCAACAGTTGCTA (SEQ ID NO: 11, miR2482 AS) or a variant of SEQ ID NO: 11 sequence having 1 or 2 nucleotide changes; and / or
[0211] (iii) one or more of ATCTGTTAGTGCAGGATGA (SEQ ID NO: 6, miR133 IS) or a variant of SEQ ID NO: 6 sequence having 1 or 2 nucleotide changes, and / or GTCATCCTGCACACTAACAGAT (SEQ ID NO: 12, miR133 IAS) or a variant of SEQ ID NO: 11 sequence having 1 or 2 nucleotide changes.
[0212]
[0213] In certain embodiments, an expression cassette comprises a combination of the sequences of (i). In certain embodiments, tire expression cassette comprises a combination of the sequences of (ii). In certain embodiments, the expression cassette comprises two sequences of (iii). In certain embodiments, the expression cassette comprises a combination of the sense sequences of (i), (ii) and / or (iii). In certain embodiments, the expression cassette comprises a combination of a sense and an anti-sense sequences of (i) in combination with at least one sequence of (ii) and / or (iii). In certain embodiments, the expression cassette comprises a combination of a sense and an antisense sequences of (ii) in combination with at least one sequence of (i) and / or (iii). In certain embodiments, tire expression cassette comprises a combination of a sense and an anti-sense sequences of (iii) in combination with at least one sequence of (i) and / or (ii).
[0214] In certain embodiments, an expression cassette comprises an expression cassette comprising a promoter, an optional enhancer, an optional intron, a nucleic acid sequence encoding a miR9025’ overhang, a miR902 sense sequence, a miR loop sequence, a miR antisense sequence, a mIR903 3’ overhang, an optional WPRE element, and a poly A. In certain embodiments, tire encoded miR902 with flanking sequences is SEQ ID NO: 136. In certain embodiments, tire promoter element comprises a chicken beta actin promoter.
[0215] Examples include CB7 or CAG promoters. In certain embodiments, the polyA sequence is a rabbit beta globin poly A or a SV40 polyA. See. e.g., expression cassettes SEQ ID NO: 81 (CB7.Cl.mMSH3 miR902.WPRE.RBG).
[0216] In certain embodiments, an expression cassette comprises an expression cassette comprising a promoter, a nucleic acid sequence encoding a mi 1331 5’ overhang, a miR1331 sense sequence, a miR loop sequence, a miR antisense sequence, a mIR1331 3’ overhang, an optional WPRE clement, and a poly A. In certain embodiments, the promoter element comprises a chicken beta actin promoter. Examples include CB7 or CAG promoters. In certain embodiments, the polyA sequence is a rabbit beta globin poly A or a SV40 polyA. See, e.g., expression cassettes SEQ ID NO: 82 (CB7.CI.hMHS3.miR1331.WPRE.RBG).
[0217] In certain embodiments, an expression cassette comprises an expression cassette comprising a promoter, a nucleic acid sequence encoding a mi24825’ overhang, a miR2482 sense sequence, a miR loop sequence, a miR antisense sequence, a mIR24823’ overhang, an optional WPRE element, and a poly A. In certain embodiments, the promoter
[0218]
[0219] element comprises a chicken beta actin promoter. Examples include CB7 or CAG promoters. In certain embodiments, the polyA sequence is a rabbit beta globin poly A or a SV40 polyA. See, e.g., expression cassettes SEQ ID NO: 83:
[0220] CB7.CI.hMHS3.miR2482.WPRE.RBG.
[0221] In certain embodiments, an expression cassette comprises a hFAN 1 coding sequence. In certain embodiments, the expression cassette comprises an expression cassette comprising a promoter, an optional enhancer, an optional intron, a nucleic acid sequence encoding hFANl, an optional WPRE element, and a poly A. In certain embodiments, the promoter clement comprises a chicken beta actin promoter. Examples include CB7 or CAG promoters. In certain embodiments, the polyA sequence is a rabbit beta globin poly A or a SV40 polyA. See, e.g., expression cassettes of SEQ ID NO: 84 comprising the CAG.CI.hFANlco.SV40. A murine FAN lexpression cassette is provided in SEQ ID NO: 85. In another embodiment, the expression cassette is CMV-E(+).mP-84.hFANlco.SV40 (SEQ ID NO: 92); CMV-E(+).mP-84.mFANnat.SV40 (SE ID NO: 93); pCALMl.hFANlco.SV40 (SEQ ID NO: 96); pCALMl.mFANnat.SV40 (SEQ ID NO: 97); Prionl48.hFANlco.SV40 (SEQ ID NO: 100); or Prion 148.mF AN lco.SV40 (SEQ ID NO: 101).
[0222] In certain embodiments, an expression cassette comprises a promoter, an optional enhancer, an optional intron, a sequence encoding hFAN 1, a linker, and a nucleic acid sequence encoding an RNA inhibitory molecule (e.g., miR902, mIR1331, or mlR2482). In certain embodiments, the promoter is a hSyn promoter, a CMV promoter (e.g., CMV-E(+), CLAM1, Prior 148, or CAG. One suitable expression cassette is:
[0223] CAG.hFANlco.lmk.mMSH3.miR902.RBG (SEQ ID NO: 86), CAG.CLmFANl.link.mMSH3.miR902.SV40 (SEQ ID NO: 87), Syn.hFANlco.link.mMSH3.miR902.SV40 (SEQ ID NO: 90).
[0224] Syn.mFANl.link.mMSH3.miR902.SV40 (SEQ ID NO: 91), , CMV-E(+).mP-84.hFANlco.mMSH3.miR902.SV40 (SEQ ID NO: 94), CMV-E(+).mP-84.mFANnat.mMSH3.miR902.SV40 (SEQ ID NO: 95), pCALMl.hFANlco.mMSH3.miR902.SV40 (SEQ ID NO: 98); pCALMl.mFANnat.mMSH3.miR902.SV40 (SEQ ID NO: 99);
[0225] Prion 148. hF AN lco.mMSH3.miR902.SV40 (SEQ ID NO: 102); or
[0226] Prion 148.mFANnat.mMSH3.miR902.SV40 (SEQ ID NO: 103).
[0227]
[0228] In certain embodiments, an expression cassette comprises: a) a nucleic acid sequence encoding an miRNA comprising a guide strand and an passenger strand, wherein the guide strand comprises a nucleic acid sequence encoding the sequence of SEQ ID NO: 1 (comprising tire miR902 miRNA), SEQ ID NO: 2, or SEQ ID NO: 3, and wherein the nucleic acid sequence encoding the guide strand and the passenger strand is operatively linked to a 5’ flanking region and a 3’ flanking region; b) a CB7 promoter operatively linked to the nucleic acid sequence encoding the miRNA; c) a Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element (WPRE) operatively linked to the nucleic acid sequence encoding the miRNA; and d) a rabbit globin poly(A) operatively linked to tire nucleic acid sequence encoding the miRNA
[0229] In certain embodiments, an expression cassette comprises: a) a nucleic acid sequence comprising SEQ ID NO: 104 or a sequence 95% to 100% identical thereto encoding a hFAN 1 having the amino acid sequence of SEQ ID NO: 105 encoding a human FAN1 (hFANl); b) a CAG promoter operatively linked to the nucleic acid sequence encoding the hFANl; and c) an SV40 terminator and / or polyA operatively linked to the nucleic acid sequence encoding tire hFANl.
[0230] In certain embodiments, an expression cassette comprises: a) a nucleic acid sequence comprising SEQ ID NO: 104 or a sequence 95% to 100% identical thereto encoding a hFAN 1 having the amino acid sequence of SEQ ID NO: 105 encoding a human FAN 1 (hFAN 1); b) a hSyn promoter operatively linked to the nucleic acid sequence encoding the hFAN 1 ; c) an SV40 terminator operatively linked to the nucleic acid sequence encoding the hFAN 1; and d) an SV40 polyA operatively linked to the nucleic acid sequence encoding tire hFANl.
[0231] In certain embodiments, an expression cassette comprises: a) a nucleic acid sequence comprising SEQ ID NO: 104 or a sequence 95% to 100% identical thereto encoding a hFAN 1 having the amino acid sequence of SEQ ID NO: 105 encoding a human FAN 1 (hFANl); b) a CMV-E(+).uP-84 promoter operatively linked to the nucleic acid sequence encoding the hFAN 1; c) an SV40 terminator operatively linked to the nucleic acid sequence encoding the hFANl; and d) an SV40 polyA operatively linked to the nucleic acid sequence encoding the hFANl.
[0232] In certain embodiments, an expression cassette comprises: a) a nucleic acid sequence comprising SEQ ID NO: 104 or a sequence 95% to 100% identical thereto
[0233]
[0234] encoding a hFAN 1 having the amino acid sequence of SEQ ID NO: 105 encoding a human FAN1 (hFANl); b) a pCALMl promoter operatively linked to the nucleic acid sequence encoding the hFANl; c) an SV40 terminator operatively linked to the nucleic acid sequence encoding the hFAN 1; and d) an SV40 polyA operatively linked to the nucleic acid sequence encoding the hFAN 1.
[0235] In certain embodiments, an expression cassette comprises: a) a nucleic acid sequence comprising SEQ ID NO: 104 or a sequence 95% to 100% identical thereto encoding a hFAN 1 having the amino acid sequence of SEQ ID NO: 105 encoding a human FAN1 (hFANl); b) a prion promoter operatively linked to the nucleic acid sequence encoding the hFANl; c) an SV40 terminator operatively linked to the nucleic acid sequence encoding the hFANl; and d) an SV40 polyA operatively linked to the nucleic acid sequence encoding the hFANl.
[0236] In certain embodiments, an expression cassette comprises: a) a nucleic acid sequence comprising SEQ ID NO: 104 or a sequence 95% to 100% identical thereto encoding a hFAN 1 having the amino acid sequence of SEQ ID NO: 105 encoding a human FAN 1 (hFANl); b) a hSyn promoter operatively linked to tire nucleic acid sequence encoding tire hFAN 1 ; c) a nucleic acid sequence encoding an miRNA comprising a guide strand and an passenger strand, wherein the guide strand comprises a nucleic acid sequence encoding the sequence of SEQ ID NO: 1 (comprising the miR902 miRNA), SEQ ID NO: 2, or SEQ ID NO: 3, and wherein the nucleic acid sequence encoding the guide strand and the passenger strand is operatively linked to a 5’ flanking region and a 3’ flanking region; d) a nucleic acid linker operatively linked to the nucleic acid sequence encoding the hFAN 1 and the nucleic acid sequence encoding the miRNA; e) an SV40 terminator operatively linked to the nucleic acid sequence encoding the miRNA; and f) an SV40 polyA operatively linked to the nucleic acid sequence encoding the miRNA.
[0237] In certain embodiments, an expression cassette comprises: a) a nucleic acid sequence comprising SEQ ID NO: 104 or a sequence 95% to 100% identical thereto encoding a hFAN 1 having the amino acid sequence of SEQ ID NO: 105 encoding a human FAN 1 (hFANl); b) a CAG promoter operatively linked to the nucleic acid sequence encoding the hFAN 1 ; c) a nucleic acid sequence encoding an miRNA comprising a guide strand and an passenger strand, wherein the guide strand comprises a nucleic acid sequence encoding tire sequence of SEQ ID NO: 1 (comprising the miR902 miRNA), SEQ ID NO:
[0238]
[0239] 2, or SEQ ID NO: 3, and wherein the nucleic acid sequence encoding the guide strand and the passenger strand is operatively linked to a 5’ flanking region and a 3’ flanking region; d) a nucleic acid linker operatively linked to the nucleic acid sequence encoding the hFAN 1 and the nucleic acid sequence encoding the miRNA; e) an SV40 terminator operatively linked to the nucleic acid sequence encoding the miRNA; and f) an SV40 polyA operatively linked to the nucleic acid sequence encoding the miRNA.
[0240] In certain embodiments, an expression cassette comprises: a) a nucleic acid sequence comprising SEQ ID NO: 104 or a sequence 95% to 100% identical thereto encoding a hFAN 1 having the amino acid sequence of SEQ ID NO: 105 encoding a human FAN1 (hFANl); b) a CMV-E(+).uP-84 promoter operatively linked to the nucleic acid sequence encoding the hFANl; c) a nucleic acid sequence encoding an miRNA comprising a guide strand and an passenger strand, wherein the guide strand comprises a nucleic acid sequence encoding the sequence of SEQ ID NO: 1 (comprising the miR902 miRNA), SEQ ID NO: 2, or SEQ ID NO: 3, and wherein the nucleic acid sequence encoding the guide strand and the passenger strand is operatively linked to a 5 ’ flanking region and a 3 ’ flanking region; d) a nucleic acid linker operatively linked to the nucleic acid sequence encoding tire hFAN 1 and the nucleic acid sequence encoding the miRNA; e) an SV40 terminator operatively linked to the nucleic acid sequence encoding the miRNA; and f) an SV40 polyA operatively linked to the nucleic acid sequence encoding the miRNA.
[0241] In certain embodiments, an expression cassette comprises: a) a nucleic acid sequence comprising SEQ ID NO: 104 or a sequence 95% to 100% identical thereto encoding a hFAN 1 having the amino acid sequence of SEQ ID NO: 105 encoding a human FAN 1 (hFANl); b) a pCALMl promoter operatively linked to the nucleic acid sequence encoding the hFAN 1 ; c) a nucleic acid sequence encoding an miRNA comprising a guide strand and an passenger strand, wherein the guide strand comprises a nucleic acid sequence encoding the sequence of SEQ ID NO: 1 (comprising the miR902 miRNA), SEQ ID NO: 2, or SEQ ID NO: 3, and wherein the nucleic acid sequence encoding the guide strand and the passenger strand is operatively linked to a 5’ flanking region and a 3’ flanking region; d) a nucleic acid linker operatively linked to the nucleic acid sequence encoding the hFAN 1 and tire nucleic acid sequence encoding the miRNA; e) an SV40 terminator operatively linked to the nucleic acid sequence encoding the miRNA; and f) an SV40 polyA operatively linked to tire nucleic acid sequence encoding tire miRNA.
[0242]
[0243] In certain embodiments, an expression cassette comprises: a) a nucleic acid sequence comprising SEQ ID NO: 104 or a sequence 95% to 100% identical thereto encoding a hFAN 1 having tire amino acid sequence of SEQ ID NO: 105 encoding a human FAN 1 (hFANl); b) a prion promoter operatively linked to the nucleic acid sequence encoding the hFAN 1; c) a nucleic acid sequence encoding an miRNA comprising a guide strand and an passenger strand, wherein the guide strand comprises a nucleic acid sequence encoding the sequence of SEQ ID NO: 1 (comprising the miR902 miRNA), SEQ ID NO: 2, or SEQ ID NO: 3, and wherein the nucleic acid sequence encoding the guide strand and the passenger strand is operatively linked to a 5’ flanking region and a 3’ flanking region; d) a nucleic acid linker operatively linked to the nucleic acid sequence encoding the hFAN 1 and the nucleic acid sequence encoding the miRNA; e) an SV40 terminator operatively linked to the nucleic acid sequence encoding the miRNA; and f) an SV40 polyA operatively linked to the nucleic acid sequence encoding the miRNA.
[0244] These expression cassettes may be delivered or engineered into a variety of delivery vehicles or carriers, including a non-viral carrier or a viral vector, and / or compositions.
[0245] Vector
[0246] A " vector’ as used herein is a biological or chemical moiety comprising a nucleic acid sequence which can be introduced into an appropriate target cell for replication or expression of said nucleic acid sequence. Examples of a vector includes but not limited to a recombinant virus, a plasmid, Lipoplexes, a Polymersome, Polyplexes, a dendrimer, a cell penetrating peptide (CPP) conjugate, a magnetic particle, or a nanoparticle. In one embodiment, a vector is a nucleic acid molecule into which an exogenous or heterologous or engineered nucleic acid encoding a functional product may be inserted (e.g., hFANl and / or an RNA inhibitory molecule (e.g., miR902), which can then be introduced into an appropriate target cell. Such vectors preferably have one or more origin of replication, and one or more site into which the recombinant DNA can be inserted. Vectors often have means by which cells with vectors can be selected from those without, e.g., they encode drug resistance genes. Common vectors include plasmids, viral genomes, and "artificial chromosomes". Conventional methods of generation, production, characterization or quantification of the vectors are available to one of skill in the art.
[0247]
[0248] In one embodiment, the vector is a non-viral plasmid that comprises an expression cassette described thereof, e.g., “naked DNA”, “naked plasmid DNA”; coupled with various compositions and nano particles, including, e.g., micelles, liposomes, cationic lipid - nucleic acid compositions, poly-glycan compositions and other polymers, lipid and / or cholesterol-based - nucleic acid conjugates, and other constructs such as are described herein. See, e.g., X. Su, et al, Mol. Pharmaceutics, 2011, 8 (3), pp 774-787; web publication: March 21, 2011; WO2013 / 182683, WO 2010 / 053572 and WO 2012 / 170930, all of which are incorporated herein by reference.
[0249] Viral vector is widely used to refer to a nucleic acid molecule that includes virus-derived nucleic acid elements that facilitate transfer and expression of non-native nucleic acid molecules within a cell. The term adeno-associated viral vector refers to a viral vector or plasmid containing structural and functional genetic elements, or portions thereof, that are primarily derived from AAV. The term “retroviral vector” refers to a viral vector or plasmid containing structural and functional genetic elements, or portions thereof, that are primarily derived from a retrovirus. The term “lentiviral vector” refers to a viral vector or plasmid containing structural and functional genetic elements, or portions thereof, that are primarily derived from a lentivirus, and so on. The term “hybrid vector” refers to a vector including structural and / or functional genetic elements from more than one virus type.
[0250] Suitably, the viral vector is a “replication-defective virus" or a “viral vector” which refers to a synthetic or artificial viral particle in which an expression cassette containing a nucleic acid sequence encoding a desired coding sequence (e.g., miR or hFAN 1) packaged in a viral capsid or envelope, where any viral genomic sequences also packaged within the viral capsid or envelope are replication-deficient; i.e., they cannot generate progeny virions but retain the ability to infect target cells. In one embodiment, the genome of the viral vector does not include genes encoding the enzymes required to replicate (the genome can be engineered to be "gutless" - containing only the nucleic acid sequence encoding the desired product flanked by the signals required for amplification and packaging of the artificial genome), but these genes may be supplied during production. Therefore, it is deemed safe for use in gene therapy since replication and infection by progeny virions cannot occur except in the presence of the viral enzyme required for replication.
[0251]
[0252] In certain embodiments, a recombinant virus vector is an adeno-associated virus (AAV), an adenovirus, a bocavirus, a hybrid AAV / bocavirus, a herpes simplex virus or a lentivirus.
[0253] As used herein, the term "adenovirus vector' refers to those constructs containing adenovirus sequences sufficient to (a) support packaging of an expression construct and (b) to express a coding sequence that has been cloned therein in a sense or antisense orientation. Suitably, the adenoviral vector is replication defective and lacks an adenovirus El region. Thus, it will be most convenient to introduce the polynucleotide encoding the gene of interest at the position from which the El -coding sequences have been removed. However, the position of insertion of tire construct within the adenovirus sequences is not critical. The polynucleotide encoding the gene of interest may also be inserted in lieu of a deleted E3 region in E3 replacement vectors or in the E4 region where a helper cell line or helper virus complements the E4 defect. The adenovirus may be of any of the 42 different known serotypes or subgroups A-F.
[0254] Other viral vectors may also be employed. For example, vectors derived from viruses such as vaccinia virus, polioviruses and herpes viruses may be employed. They offer several attractive features for various mammalian cells.
[0255] Retrovirus. Retroviruses are a common tool for gene delivery. “Retrovirus” refers to an RNA virus that reverse transcribes its genomic RNA into a linear double-stranded DNA copy and subsequently covalently integrates its genomic DNA into a host genome. Once the vims is integrated into the host genome, it is referred to as a “provirus.” The provirus serves as a template for RNA polymerase II and directs the expression of RNA molecules which encode the structural proteins and enzymes needed to produce new viral particles.
[0256] Illustrative retroviruses suitable for use in some embodiments include: Moloney murine leukemia vims (M-MuLV), Moloney murine sarcoma vims (MoMSV), Haney murine sarcoma vims (HaMuSV), murine mammary tumor vims (MuMTV), gibbon ape leukemia vims (GaLV), feline leukemia vims (FLV), spumavims. Friend murine leukemia vims, Murine Stem Cell Vims (MSCV) and Rous Sarcoma Vims (RSV) and lentivims.
[0257] “Lentivirus” refers to a group (or genus) of complex retroviruses. Illustrative lentiviruses include: HIV (human immunodeficiency vims; including HIV type 1, and HIV type 2); visna-maedi vims (VMV); the caprine arthritis-encephalitis vims (CAEV); equine
[0258]
[0259] infectious anemia vims (EIAV); feline immunodeficiency vims (FIV); bovine immune deficiency vims (BIV); and simian immunodeficiency vims (SIV). In some embodiments, HIV based vector backbones (i.e., HIV cis-acting sequence elements) can be used.
[0260] In certain embodiments, an Adeno-Associated Vims (AAV) vector is selected. AAV has a single-stranded linear DNA that is encapsidated into capsid proteins VP1, VP2 and VP3 to form an icosahedral virion or viral particle. In the recombinant AAV particles described herein, the function of the native AAV rep and AAV cap sequences has been ablated by deleting these coding sequences.
[0261] Recombinant Adeno-associated Vims (rAAV)
[0262] Provided herein is a recombinant adeno-associated vims (rAAV) useful for treating Huntington’s Disease or a disease associated with CAG expansion. The rAAV comprises (a) an AAV capsid; and (b) a vector genome packaged in the AAV capsid of (a). Suitably, the AAV capsid selected targets the cells to be treated. In certain embodiments, the capsid is capable of crossing the blood-brain barrier. In certain embodiments, the capsid is from Clade F. However, in certain embodiments, another AAV capsid source may be selected, i.e., Clade A. In certain embodiments, Ore AAV capsid is AAVhu68 capsid. In certain embodiments, the AAV capsid is AAVhu95 capsid. In certain embodiments, the AAV capsid is AAVhu96 capsid. In certain embodiments, the AAV capsid is an AAV9 capsid. In certain embodiments, the AAV capsid is a mutant AAV9 capsid. In certain embodiments, the AAV capsid is from Clade A source, e.g., AAVrh91, AAV1, or from another non-Clade F source, e.g., clade AAV5 or AAV8. Still other suitable AAV capsids are described below.
[0263] As used herein, an AAV “vector genome’’ refers to the nucleic acid sequence packaged inside a parvovirus (e.g., rAAV) capsid which fonns a viral particle. The AAV sequences of the vector typically comprise the cis-acting 5' and 3' inverted terminal repeat sequences (See, e.g., B. J. Carter, in “Handbook of Parvoviruses”, ed., P. Tijsser, CRC Press, pp. 155 168 (1990)). The ITR sequences are about 145 bp in length. Preferably, substantially the entire sequences encoding the ITRs are used in the molecule, although some degree of minor modification of tirese sequences is permissible. The ability to modify these ITR sequences is within tire skill of the art. (See, e.g., texts such as Sambrook et al, “Molecular Cloning. A Laboratory Manual”, 2d ed., Cold Spring Harbor Laboratory, New
[0264]
[0265] York (1989); and K. Fisher et al., J. Virol., 70:520532 (1996)). An example of such a molecule employed is a “cis-acting'’ plasmid containing tire transgene, in which the selected transgene sequence and associated regulatory elements are flanked by the 5' and 3' AAV ITR sequences. In one embodiment, the ITRs are from an AAV different than that supplying a capsid. In one embodiment, the ITR sequences from AAV2. However, ITRs from other AAV sources may be selected. A shortened version of the 5 ’ ITR, termed AITR, has been described in which the D-sequence and terminal resolution site (trs) are deleted. In certain embodiments, the vector genome includes a shortened AAV2 ITR of 130 base pairs, wherein the external A elements is deleted. Without wishing to be bound by theory, it is believed that the shortened ITR reverts back to the wild-type length of 145 base pairs during vector DNA amplification using the internal (A') element as a template. In other embodiments, full-length AAV 5’ and 3’ ITRs are used. Where the source of the ITRs is from AAV2 and the AAV capsid is from another AAV source, the resulting vector may be termed pseudotyped. However, other configurations of these elements may be suitable.
[0266] In the examples herein, a vector genome contains, at a minimum, from 5’ to 3’, an AAV 5’ ITR (also referred to as 5’ ITR), coding sequence(s) (i.e., transgene(s)), and an AAV 3’ ITR (also referred to as 3’ ITR). ITRs from AAV2, a different source AAV than the capsid, or other than frill-length ITRs may be selected. In certain embodiments, the ITRs are from the same AAV source as the AAV which provides the rep function during production or a transcomplementing AAV. Further, other ITRs, e.g., self-complementary (scAAV) ITRs, may be used. Both single-stranded AAV (ssAAV) and self-complementary (sc) AAV are encompassed with the rAAV. The transgene is a nucleic acid coding sequence, heterologous to the vector sequences, which encodes a polypeptide, protein, functional RNA molecule (c.g., miRNA), anti-sense oligonucleotide (ASO) or other gene product, of interest. The nucleic acid coding sequence is operatively linked to regulatory components in a manner which permits transgene transcription, translation, and / or expression in a cell of a target tissue. Suitable components of a vector genome are discussed in more detail herein.
[0267] In one example, a “vector genome” contains, at a minimum, from 5’ to 3’, a vectorspecific sequence, a nucleic acid sequence encoding hFAN 1 operably linked to regulatory control sequences (which direct their expression in a target cell), where the vector-specific sequence may be a terminal repeat sequence which specifically packages the vector
[0268]
[0269] genome into a viral vector capsid or envelope protein. For example, AAV inverted terminal repeats are utilized for packaging into AAV and certain other parvovirus capsids. In certain embodiments, the vector genome is an expression cassette having inverted terminal repeat (ITR) sequences necessary for packaging the vector genome into the AAV capsid at the extreme 5’ and 3’ end and containing therebetween a hFAN 1 gene as described herein operably linked to sequences which direct expression thereof. In certain embodiments, a vector genome may comprise at a minimum from 5’ to 3’, an AAV 5’ ITR, coding sequence(s), and an AAV 3’ ITR. In certain embodiments, the ITRs are from AAV2, a different source AAV than the capsid, or other than full-length ITRs may be selected. In certain embodiments, the ITRs are from the same AAV source as the AAV which provides the rep function during production or a transcomplementing AAV. Further, other ITRs may be used.
[0270] In certain embodiments, tire provided herein is rAAV comprising a nucleic acid molecule comprising a vector genome comprising at least one AAV ITR at the extreme 5' and / or extreme 3' end of the nucleic acid molecule which is the vector genome and an expression cassette. In certain embodiments, the vector genome is a nucleic acid molecule which comprises a 5' - AAV ITR, the expression cassette and a 3' - AAV ITR. In certain embodiments, wherein the vector genome comprises a nucleic acid sequence encoding a gene product operably linked to regulatory sequences which enables expression of transgene in a target cell, (e.g., by directing transcription, translation and / or expression).
[0271] In certain embodiments, provided herein is an rAAV comprising an AAV capsid and a nucleic acid molecule comprising expression cassette. In certain embodiments, the rAAV comprises vector genome comprising a nucleic acid molecule comprising, 5' to 3’, AAV- 5' ITR - an optional enhancer - a promoter - an optional intron - coding sequence (e.g., test transgene) - poly adenylation (polyA) signal sequence - AAV3' - ITR. In other embodiments, the orientation of the ITRs may change from the orientation presented in the vector genome of the nucleic acid used in production (e.g., a plasmid). Thus, in certain embodiments, the rAAV may comprise a vector genome flanked by 3' and 5' AAV ITRs, respectively. In certain embodiments, the rAAV may comprise a vector genome flanked by two 5' AAV ITRs. In certain embodiments, the rAAV may comprise a vector genome flanked by two 3' AAV ITRs. In other embodiments, an rAAV as provided herein may be
[0272]
[0273] partially truncated such that tire 5' AAV ITR and / or the 3' AAV ITR is not detectable in the vector genome packaged in a final rAAV product.
[0274] It should be understood that the compositions in the expression cassette and vector genomes described herein are intended to be applied to other compositions, regimens, aspects, embodiments and methods described across tire Specification.
[0275] In certain embodiments, the rAAV comprises an adeno-associated virus (AAV) capsid and a nucleic acid molecule comprising an expression cassette, wherein the expression cassette is a nucleic sequence comprising: (i) a hFAN 1 sequence - linker -RNA inhibitory scqucncc(s), and (ii) regulator ’ control sequences operably linked to the sequences of (i), wherein the regulatory control sequences comprise an optional enhancer, a promoter, an optional intron, and a polyadenylation (poly A) signal sequence.
[0276] In certain embodiments, tire rAAV comprises an adeno-associated virus (AAV) capsid and a nucleic acid molecule comprising an expression cassette, wherein the expression cassette is a nucleic sequence comprising: (i) a RNA inhibitory’ sequence(s) -linker - hFAN 1 (s), and (ii) regulatory control sequences operably linked to the sequences of (i), wherein the regulatory’ control sequences comprise an optional enhancer, a promoter, an optional intron, and a polyadenylation (polyA) signal sequence.
[0277] In certain embodiments, tire rAAV comprises an adeno-associated virus (AAV) capsid and a nucleic acid molecule comprising an expression cassette, wherein tire expression cassette is a nucleic sequence comprising: (i) RNA inhibitory sequence(s) -linker - coding sequence therapeutic gene product, and (ii) regulatory’ control sequences operably linked to the sequences of (i), wherein the regulatory’ control sequences comprise an optional enhancer, a promoter, an optional intron, and a polyadenylation (polyA) signal sequence.
[0278] In certain embodiments, the rAAV comprises a nucleic acid molecule comprising a vector genome comprising at least one AAV ITR at the extreme 5' and / or extreme 3' end of the nucleic acid molecule which is the vector genome and an expression cassette. In certain embodiments, the rAAV comprises vector genome comprising a nucleic acid molecule comprising, 5’ to 3’, AAV- 5’ ITR (also referred to as 5' AAV ITRs or 5’ AAV ITRs) - expression cassette - AAV3’ - ITR (also referred to as 3' AAV ITRs or 3’ AAV ITRs). In other embodiments, tire orientation of the ITRs may change from the orientation presented in the vector genome of the nucleic acid used in production (e.g., a plasmid).
[0279]
[0280] Thus, in certain embodiments, the rAAV may comprise a vector genome flanked by 3' and 5' AAV ITRs, respectively. In certain embodiments, the rAAV may comprise a vector genome flanked by two 5' AAV ITRs. In certain embodiments, the rAAV may comprise a vector genome flanked by two 3' AAV ITRs. In other embodiments, an rAAV as provided herein may be partially truncated such that the 5' AAV 1TR and / or the 3' AAV 1TR is not detectable in the final rAAV product.
[0281] In certain embodiments, a vector genome comprises a 5’ ITR, an expression cassette operably linked to expression control sequences, and a 3’ ITR, in which tire nucleic acid sequence encodes at least one RNA product which inhibits expression of MSH3 in a human subject, wherein the at least one nucleic acid sequence comprises at least one of:
[0282] (i) one or more of CAAACTGACTGCCGCATTA (SEQ ID NO: 4, miR902S) or a variant of SEQ ID NO: 4 sequence having 1 or 2 nucleotide changes; and / or TAATGCGGCAGTTTCAGTTTG (SEQ ID NO: 10, miR902AS) or a or a variant of SEQ ID NO: 10 sequence having 1 or 2 nucleotide changes;
[0283] (ii) one or more of TAGCAACTTGACTGCATTT (SEQ ID NO: 5, miR2482S) or a variant of SEQ ID NO: 5 sequence having 1 or 2 nucleotide changes, and / or TGCTGAAATGCAGTCAACAGTTGCTA (SEQ ID NO: 11, miR2482 AS) or a variant of SEQ ID NO: 11 sequence having 1 or 2 nucleotide changes; and / or
[0284] (iii) one or more of ATCTGTTAGTGCAGGATGA (SEQ ID NO: 6, miR133 IS) or a variant of SEQ ID NO: 6 sequence having 1 or 2 nucleotide changes, and / or GTCATCCTGCACACTAACAGAT (SEQ ID NO: 12, miR133 IAS) or a variant of SEQ ID NO: 11 sequence having 1 or 2 nucleotide changes.
[0285] In certain embodiments, a vector genome comprises an expression cassette comprising a combination of the sequences of (i). In certain embodiments, the vector genome comprises an expression cassette which comprises a combination of the sequences of (ii). In certain embodiments, the vector genome comprises an expression cassette which comprises two sequences of (iii). In certain embodiments, the vector genome comprises an expression cassette which comprises a combination of the sense sequences of (i), (ii) and / or (iii). In certain embodiments, the vector genome comprises an expression cassette which comprises a combination of a sense and an anti-sense sequences of (i) in combination with at least one sequence of (ii) and / or (iii). In certain embodiments, the vector genome comprises an expression cassette which comprises a combination of a sense and an
[0286]
[0287] antisense sequences of (ii) in combination with at least one sequence of (i) and / or (iii). In certain embodiments, tire vector genome comprises an expression cassette which comprises a combination of a sense and an anti-sense sequences of (iii) in combination w ith at least one sequence of (i) and / or (ii).
[0288] In certain embodiments, a vector genome comprises an expression cassette w hich comprises an expression cassette comprising a promoter, an optional enhancer, an optional intron, a nucleic acid sequence encoding a miR9025 ’ overhang, a miR902 sense sequence, a miR loop sequence, a miR antisense sequence, a mIR903 3 ’ overhang, an optional WPRE element, and a poly A. In certain embodiments, the encoded miR902 with flanking sequences is SEQ ID NO: 136. In certain embodiments, tire promoter element comprises a chicken beta actin promoter. Examples include CB7 or CAG promoters. In certain embodiments, the polyA sequence is a rabbit beta globin poly A or a SV40 polyA. See, e.g., expression cassettes SEQ ID NO: 81 (CB7.CI.mMSH3 miR902.WPRE.RBG).
[0289] In certain embodiments, a vector genome comprises an expression w hich cassette comprises an expression cassette comprising a promoter, a nucleic acid sequence encoding a mil331 5’ overhang, a miR1331 sense sequence, a miR loop sequence, a miR antisense sequence, a mIR1331 3' overhang, an optional WPRE element, and a poly A. In certain embodiments, the promoter element comprises a chicken beta actin promoter.
[0290] Examples include CB7 or CAG promoters. In certain embodiments, the polyA sequence is a rabbit beta globin poly A or a SV40 polyA. See, e.g., expression cassettes SEQ ID NO: 82 (CB7.CI.hMHS3.miR1331.WPRE.RBG).
[0291] In certain embodiments, a vector genome comprises an expression cassette comprises an expression cassette comprising a promoter, a nucleic acid sequence encoding a mi24825’ overhang, a miR2482 sense sequence, a miR loop sequence, a miR antisense sequence, a mIR24823’ overhang, an optional WPRE element, and a poly A. In certain embodiments, the promoter element comprises a chicken beta actin promoter. Examples include CB7 or CAG promoters. In certain embodiments, the polyA sequence is a rabbit beta globin poly A or a SV40 polyA. See, e.g., expression cassettes SEQ ID NO: 83:
[0292] CB7.CI.hMHS3.miR2482.WPRE.RBG.
[0293] In certain embodiments, a vector genome comprises an expression cassette which comprises a hFANl coding sequence. In certain embodiments, the expression cassette comprises an expression cassette comprising a promoter, an optional enhancer, an
[0294]
[0295] optional intron, a nucleic acid sequence encoding hFANl, an optional WPRE element, and a poly A. In certain embodiments, the promoter element comprises a chicken beta actin promoter. Examples include CB7 or CAG promoters. In certain embodiments, the polyA sequence is a rabbit beta globin poly A or a SV40 polyA. See. e.g., expression cassettes of SEQ ID NO: 84 comprising the CAG.CI.hFAN lco.SV40. A murine FAN lexpression cassette is provided in SEQ ID NO: 85. In another embodiment, the expression cassette is CMV-E(+).mP-84.hFANlco.SV40 (SEQ ID NO: 92); CMV-E(+).mP-84.mFANnat.SV40 (SE ID NO: 93); pCALMl.hFANlco.SV40 (SEQ ID NO: 96); pCALMl.mFANnat.SV40 (SEQ ID NO: 97); Prion 148. hFANl co. SV40 (SEQ ID NO: 100); or Prionl48.mFANlco.SV40 (SEQ ID NO: 101).
[0296] In certain embodiments, a vector genome comprises an AAV ITR, an expression cassette comprising a promoter, an optional enhancer, an optional intron, a sequence encoding hFANl , a linker, and a nucleic acid sequence encoding an RNA inhibitory molecule (e g., miR902, mIR1331, or mIR2482), and an AAV ITR. In certain embodiments, the promoter is a hSyn promoter, a CMV promoter (e.g., CMV-E(+), CLAM1, Prior 148, or CAG. One suitable expression cassette is:
[0297] CAG.hFANlco.lmk.mMSH3.miR902.RBG (SEQ ID NO: 86), CAG.CLmFANl.link.mMSH3.miR902.SV40 (SEQ ID NO: 87), Syn.hFANlco.link.mMSH3.miR902.SV40 (SEQ ID NO: 90).
[0298] Syn.mFANl.lmk.mMSH3.miR902.SV40 (SEQ ID NO: 91), CMV-E(+).mP-84.hFANlco.mMSH3.miR902.SV40 (SEQ ID NO: 94), CMV-E(+).mP-84.mFANnat.mMSH3.miR902.SV40 (SEQ ID NO: 95), pCALMl.hFANlco.mMSH3.miR902.SV40 (SEQ ID NO: 98); pCALMl.mFANnat.mMSH3.miR902.SV40 (SEQ ID NO: 99);
[0299] Prionl48.hFANlco.mMSH3.miR902.SV40 (SEQ ID NO: 102); or
[0300] Prion 148.mFANnat.mMSH3.miR902.SV40 (SEQ ID NO: 103).
[0301] In certain embodiments, a parvovirus (e.g., AAV) vector genome comprises: an expression cassette comprising: a) a nucleic acid sequence encoding an miRNA comprising a guide strand and an passenger strand, wherein the guide strand comprises a nucleic acid sequence encoding the sequence of SEQ ID NO: 1 (comprising the miR902 miRNA), SEQ ID NO: 2, or SEQ ID NO: 3, and wherein the nucleic acid sequence encoding the guide strand and the passenger strand is operatively linked to a 5’ flanking
[0302]
[0303] region and a 3’ flanking region; b) a CB7 promoter operatively linked to the nucleic acid sequence encoding tire miRNA; c) a Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element (WPRE) operatively linked to the nucleic acid sequence encoding the miRNA; d) a rabbit globin poly(A) operatively linked to the nucleic acid sequence encoding the miRNA; and e) one of a 5’ adeno-associated virus (AAV) inverted terminal repeats (ITRs), a 5’ ITR, or a variants thereof, flanking the expression cassette.
[0304] In certain embodiments, a parvovirus (e.g., AAV) vector genome comprises: an expression cassette a) a nucleic acid sequence comprising SEQ ID NO: 104 or a sequence 95% to 100% identical thereto encoding a hFAN 1 having the amino acid sequence of SEQ ID NO: 105 encoding a human FAN 1 (hFAN 1); b) a CAG promoter operatively linked to the nucleic acid sequence encoding the hFANl; c) an SV40 terminator and / or polyA operatively linked to the nucleic acid sequence encoding the hFAN 1 ; and d) one of a 5 ’ adeno-associated virus (AAV) inverted terminal repeats (ITRs), a 5’ ITR, or a variants thereof, flanking the expression cassette.
[0305] In certain embodiments, a parvovirus (e.g., AAV) vector genome comprises: a) a nucleic acid sequence comprising SEQ ID NO: 104 or a sequence 95% to 100% identical thereto encoding a hFANl having the amino acid sequence of SEQ ID NO: 105 encoding a human FAN 1 (hFANl); b) a hSyn promoter operatively linked to the nucleic acid sequence encoding the hFANl: c) an SV40 terminator operatively linked to the nucleic acid sequence encoding the hFAN 1; d) an SV40 polyA operatively linked to the nucleic acid sequence encoding the hFAN 1; and e) one of a 5’ adeno-associated virus (AAV) inverted terminal repeats (ITRs), a 5’ ITR, or a variants thereof, flanking the expression cassette.
[0306] In certain embodiments, a parvovirus (e.g., AAV) vector genome comprises: a) a nucleic acid sequence comprising SEQ ID NO: 104 or a sequence 95% to 100% identical thereto encoding a hFANl having the amino acid sequence of SEQ ID NO: 105 encoding a human FAN1 (hFANl); b) a CMV-E(+).uP-84 promoter operatively linked to the nucleic acid sequence encoding the hFANl; c) an SV40 terminator operatively linked to the nucleic acid sequence encoding the hFANl; d) an SV40 polyA operatively linked to the nucleic acid sequence encoding the hFANl; and e) one of a 5’ adeno-associated virus (AAV) inverted terminal repeats (ITRs), a 5’ ITR, or a variants thereof, flanking the expression cassette.
[0307]
[0308] In certain embodiments, a parvovirus (e.g., AAV) vector genome comprises: a) a nucleic acid sequence comprising SEQ ID NO: 104 or a sequence 95% to 100% identical thereto encoding a hFANl having the amino acid sequence of SEQ ID NO: 105 encoding a human FAN 1 (hFANl); b) a pCALMl promoter operatively linked to the nucleic acid sequence encoding the hFANl; c) an SV40 terminator operatively linked to the nucleic acid sequence encoding the hFANl; d) an SV40 polyA operatively linked to the nucleic acid sequence encoding the hFANl; and e) one of a 5’ adeno-associated virus (AAV) inverted terminal repeats (ITRs), a 5 ’ ITR, or a variants thereof, flanking the expression cassette.
[0309] In certain embodiments, a parvovirus (e g., AAV) vector genome comprises: a) a nucleic acid sequence comprising SEQ ID NO: 104 or a sequence 95% to 100% identical thereto encoding a hFAN 1 having the amino acid sequence of SEQ ID NO: 105 encoding a human FAN 1 (hFAN 1); b) a prion promoter operatively linked to the nucleic acid sequence encoding the hFAN 1 ; c) an SV40 terminator operatively linked to the nucleic acid sequence encoding the hFANl; d) an SV40 polyA operatively linked to the nucleic acid sequence encoding the hFANl; and e) one of a 5’ adeno-associated virus (AAV) inverted terminal repeats (ITRs), a 5’ ITR, or a variants thereof, flanking the expression cassette.
[0310] In certain embodiments, a parvovirus (e g., AAV) vector genome comprises: a) a nucleic acid sequence comprising SEQ ID NO: 104 or a sequence 95% to 100% identical thereto encoding a hFAN 1 having the amino acid sequence of SEQ ID NO: 105 encoding a human FAN 1 (hFAN 1); b) a hSyn promoter operatively linked to the nucleic acid sequence encoding the hFANl; c) a nucleic acid sequence encoding an miRNA comprising a guide strand and an passenger strand, wherein tire guide strand comprises a nucleic acid sequence encoding the sequence of SEQ ID NO: 1 (comprising the miR902 miRNA), SEQ ID NO: 2, or SEQ ID NO: 3, and wherein the nucleic acid sequence encoding the guide strand and the passenger strand is operatively linked to a 5’ flanking region and a 3’ flanking region; d) a nucleic acid linker operatively linked to the nucleic acid sequence encoding the hFAN 1 and the nucleic acid sequence encoding the miRNA; e) an SV40 terminator operatively linked to the nucleic acid sequence encoding the miRNA; f) an SV40 polyA operatively linked to the nucleic acid sequence encoding the miRNA; and g) one of a 5’ adeno-associated virus (AAV) inverted terminal repeats (ITRs), a 5' ITR, or a variants thereof, flanking the expression cassette.
[0311]
[0312] In certain embodiments, a parvovirus (e.g., AAV) vector genome comprises: a) a nucleic acid sequence comprising SEQ ID NO: 104 or a sequence 95% to 100% identical thereto encoding a hFANl having the amino acid sequence of SEQ ID NO: 105 encoding a human FAN 1 (hFAN 1); b) a CAG promoter operatively linked to the nucleic acid sequence encoding the hFAN 1: c) a nucleic acid sequence encoding an miR A comprising a guide strand and an passenger strand, wherein the guide strand comprises a nucleic acid sequence encoding the sequence of SEQ ID NO: 1 (comprising the miR902 miRNA), SEQ ID NO: 2, or SEQ ID NO: 3, and wherein the nucleic acid sequence encoding the guide strand and the passenger strand is operatively linked to a 5’ flanking region and a 3’ flanking region; d) a nucleic acid linker operatively linked to the nucleic acid sequence encoding the hFAN 1 and the nucleic acid sequence encoding the miRNA; e) an SV40 terminator operatively linked to the nucleic acid sequence encoding the miRNA; 1) an SV40 polyA operatively linked to the nucleic acid sequence encoding the miRNA; and g) one of a 5’ adeno-associated virus (AAV) inverted terminal repeats (ITRs), a 5’ ITR, or a variants thereof, flanking the expression cassette.
[0313] In certain embodiments, a parvovirus (e.g., AAV) vector genome comprises: a) a nucleic acid sequence comprising SEQ ID NO: 104 or a sequence 95% to 100% identical thereto encoding a hFANl having the amino acid sequence of SEQ ID NO: 105 encoding a human FAN1 (hFANl); b) a CMV-E(+). uP-84 promoter operatively linked to the nucleic acid sequence encoding the hFAN 1; c) a nucleic acid sequence encoding an miRNA comprising a guide strand and an passenger strand, wherein the guide strand comprises a nucleic acid sequence encoding the sequence of SEQ ID NO: 1 (comprising the miR902 miRNA), SEQ ID NO: 2, or SEQ ID NO: 3, and wherein the nucleic acid sequence encoding the guide strand and the passenger strand is operatively linked to a 5’ flanking region and a 3’ flanking region; d) a nucleic acid linker operatively linked to the nucleic acid sequence encoding the hFAN 1 and the nucleic acid sequence encoding the miRNA; e) an SV40 terminator operatively linked to the nucleic acid sequence encoding the miRNA; f) an SV40 polyA operatively linked to the nucleic acid sequence encoding the miRNA; and g) one of a 5’ adeno-associated virus (AAV) inverted terminal repeats (ITRs), a 5’ ITR, or a variants thereof, flanking the expression cassette.
[0314] In certain embodiments, a parvovirus (e.g., AAV) vector genome comprises: a) a nucleic acid sequence comprising SEQ ID NO: 104 or a sequence 95% to 100% identical
[0315]
[0316] thereto encoding a hFANl having the amino acid sequence of SEQ ID NO: 105 encoding a human FAN 1 (hFANl); b) a pCALMl promoter operatively linked to the nucleic acid sequence encoding the hFANl; c) a nucleic acid sequence encoding an miRNA comprising a guide strand and an passenger strand, wherein the guide strand comprises a nucleic acid sequence encoding the sequence of SEQ ID NO: 1 (comprising the miR902 miRNA), SEQ ID NO: 2, or SEQ ID NO: 3, and wherein the nucleic acid sequence encoding the guide strand and the passenger strand is operatively linked to a 5’ flanking region and a 3’ flanking region; d) a nucleic acid linker operatively linked to the nucleic acid sequence encoding the hFAN 1 and the nucleic acid sequence encoding the miRNA; c) an SV40 terminator operatively linked to the nucleic acid sequence encoding the miRNA; f) an SV40 polyA operatively linked to the nucleic acid sequence encoding the miRNA; and g) one of a 5’ adeno-associated virus (AAV) inverted terminal repeats (ITRs), a 5’ ITR, or a variants thereof, flanking the expression cassette.
[0317] In certain embodiments, a parvovirus (e g., AAV) vector genome comprises: a) a nucleic acid sequence comprising SEQ ID NO: 104 or a sequence 95% to 100% identical thereto encoding a hFANl having the amino acid sequence of SEQ ID NO: 105 encoding a human FAN 1 (hFANl); b) a prion promoter operatively linked to tire nucleic acid sequence encoding the hFANl: c) a nucleic acid sequence encoding an miRNA comprising a guide strand and an passenger strand, wherein the guide strand comprises a nucleic acid sequence encoding the sequence of SEQ ID NO: 1 (comprising the miR902 miRNA), SEQ ID NO: 2, or SEQ ID NO: 3, and wherein the nucleic acid sequence encoding the guide strand and the passenger strand is operatively linked to a 5’ flanking region and a 3’ flanking region; d) a nucleic acid linker operatively linked to the nucleic acid sequence encoding the hFAN 1 and the nucleic acid sequence encoding the miRNA; c) an SV40 terminator operatively linked to tire nucleic acid sequence encoding the miRNA; f) an SV40 polyA operatively linked to the nucleic acid sequence encoding the miRNA; and g) one of a 5' adeno-associated virus (AAV) inverted terminal repeats (ITRs). a 5’ ITR, or a variants thereof, flanking the expression cassette.
[0318] In certain embodiments, the AAV capsid for the compositions and methods described herein is chosen based on tire target cell. In certain embodiments, the AAV capsid transduces a neuron or a brain cell. In certain embodiments, other AAV capsid may be chosen.
[0319]
[0320] In certain embodiments, the Clade F AAV capsid is an AAVhu68 capsid [See, e.g., US2020 / 0056159; PCT / US21 / 55436; SEQ ID NO: 142 and 144 for nucleic acid sequence; SEQ ID NO: 143 for encoded amino acid sequence], an AAVhu95 capsid [See, e.g., International Patent Application No. PCT / US2022 / 077315, filed September 30, 2022; (hu95 nucleic acid sequence)] and (hu95 amino acid sequence), or an AAVhu96 capsid [See, e.g.. International Patent Application No. PCT / US2022 / 077315, filed September 30, 2022], AAV9 capsid [See, e.g., US 7,906, 111] or engineered mutants and variants thereof [see, e.g., W02020 / 200499; W02003 / 054197], See also, International Patent Application No. PCT / US2022 / 077315, filed September 30, 2022, W02025 / 007046 (“DPR”), published 2 January 2025, which is incorporated herein by reference in its entirety.
[0321] In certain embodiments, tire AAV capsid is a non-clade F capsid, for example a Clade A, B, C, D, or E capsid. In certain embodiment, the non-Clade F capsid is an AAV 1 or a variation thereof. In certain embodiment, the AAV capsid transduces a target cell other than the heart cells. In certain embodiments, the AAV capsid is a Clade A capsid (e.g., AAV1, AAV6, AAVrh91), a Clade B capsid (e.g., AAV 2), a Clade C capsid (e.g., hu53), a Clade D capsid (e.g., AAV7), or a Clade E capsid (e.g., rhlO).
[0322] In certain embodiments, the AAV capsid is a Clade A capsid, such as AAVrh91 capsid (nucleic acid sequence of SEQ ID NOs: 146 and 147; amino acid sequence of SEQ ID NO: 148). See, PCT / US20 / 030266, filed April 29, 2020. now published WO2020 / 223231, which is incorporated by reference herein and International Application No. PCT / US21 / 45945, filed August 13, 2021, which are incorporated herein by reference.
[0323] As used herein, the term “clade” as it relates to groups of AAV refers to a group of AAV which are phylogenetically related to one another as determined using a Neighbor-Joining algorithm by a bootstrap value of at least 75% (of at least 1000 replicates) and a Poisson correction distance measurement of no more than 0.05, based on alignment of the AAV vpl amino acid sequence. The Neighbor-Joining algorithm has been described in the literature. See. e.g., M. Nei and S. Kumar, Molecular Evolution and Phylogenetics (Oxford University Press, New York (2000). Computer programs are available that can be used to implement this algorithm. For example, the MEGA v2.1 program implements the modified Nei-Gojobori method. Using these techniques and computer programs, and the sequence of an AAV vp 1 capsid protein, one of skill in the art can readily determine whether a selected AAV is contained in one of the clades identified herein, in another clade, or is
[0324]
[0325] outside these clades. See, e.g., G Gao, et al, J Virol, 2004 Jun; 78(10): 6381-6388, which identifies Clades A, B, C, D, E and F, and provides nucleic acid sequences of novel AAV, GenBank Accession Numbers AY530553 to AY530629. See, also, WO 2005 / 033321.
[0326] A rAAV is composed of an AAV capsid and a vector genome. An AAV capsid is an assembly of a heterogeneous population of vpl, a heterogeneous population of vp2, and a heterogeneous population of vp3 proteins. As used herein when used to refer to vp capsid proteins, the term “heterogeneous” or any grammatical variation thereof, refers to a population consisting of elements that are not the same, for example, having vpl, vp2 or vp3 monomers (proteins) with different modified amino acid sequences.
[0327] As used herein when used to refer to vp capsid proteins, the term “heterogeneous” or any grammatical variation thereof, refers to a population consisting of elements that are not the same, for example, having vpl, vp2 or vp3 (also referenced as VP1, VP2, VP3, or Vpl, Vp2, Vp3) monomers (proteins) with different modified amino acid sequences. The term “heterogeneous population” as used in connection with vpl, vp2 and vp3 proteins (alternatively termed isoforms), refers to differences in the amino acid sequence of the vpl, vp2 and vp3 proteins within a capsid. The AAV capsid contains subpopulations within the vp 1 proteins, within the vp2 proteins and within the vp3 proteins which have modifications from the predicted amino acid residues. These subpopulations include, at a minimum, certain deamidated asparagine (N or Asn) residues. For example, certain subpopulations comprise at least one, two, three or four highly deamidated asparagines (N) positions in asparagine - glycine pairs and optionally further comprising other deamidated amino acids, wherein the deamidation results in an amino acid change and other optional modifications.
[0328] In certain embodiments, AAV capsids are provided which have a heterogeneous population of AAV capsid isoforms (i.c., VP1, VP2, VP3) w hich contain multiple highly deamidated “NG” positions. In certain embodiments, the highly deamidated positions are in tire locations identified below-, with reference to tire predicted full-length VP 1 amino acid sequence. In other embodiments, the capsid gene is modified such that the referenced “NG” is ablated and a mutant “NG” is engineered into another position. In certain embodiments, certain subpopulations comprise three or four highly deamidated asparagines in positions: N57, N329, N452 and N512, and optional deamidation in other positions w ithin the capsid sequence. In certain embodiments, the VP1, VP2 VP3 proteins are a heterogenous population having deamidation in about 50% to about 100% of positions N57
[0329]
[0330] (VP1 only), N329, N452, and / or N512, based on the AAV9 capsid residue positions. In certain embodiments, tire capsid comprises VP proteins which are highly deamidated in all of these positions. In certain embodiments, the percentage of deamidation in one or more of these highly deamidated positions is over 50%, over 55%. over 60%, over 65%, over 70%, over 75%, over 80%, over 85%, over 90%, over 95%, or about 70% to about 100%, or values therebetween.
[0331] As used herein, the terms '‘target cell” and “target tissue” can refer to any cell or tissue which is intended to be transduced by the subject AAV vector or in which expression of the RNA inhibitory sequence and / or hFAN 1 is desired. The term may refer to any one or more of muscle, liver, lung, airway epithelium, central nervous system, neurons, eye (ocular cells), or heart. In certain embodiments, the vector is delivered to a target cell ex vivo. In certain embodiments, the vector is delivered to the target cell in vivo.
[0332] Additionally, provided herein, is an rAAV production system useful for producing a rAAV as described herein. The production system comprises a cell culture comprising (a) a nucleic acid sequence encoding an AAV capsid protein; (b) the vector genome; and (c) sufficient AAV rep functions and helper functions to permit packaging of the vector genome into the AAV capsid. In certain embodiments, the cell culture is a human embryonic kidney 293 cell culture. In certain embodiments, the AAV rep is from a different AAV. In certain embodiments, wherein the AAV rep is from AAV2. In certain embodiments, the AAV rep coding sequence and cap genes are on the same nucleic acid molecule, wherein there is optionally a spacer between the rep sequence and cap gene.
[0333] For use in producing an AAV viral vector (e.g., a recombinant (r) AAV), the vector genomes can be carried on any suitable vector, e.g., a plasmid, which is delivered to a packaging host cell in culture or in suspension. As used herein, the term “host cell” may refer to the packaging cell line in which a vector (e.g.. a recombinant AAV) is produced. A host cell may be a prokaryotic or eukary otic cell (e.g.. human, insect, or yeast) that contains exogenous or heterologous DNA that has been introduced into the cell by any means, e.g.. electroporation, calcium phosphate precipitation, microinjection, transformation, viral infection, transfection, liposome delivery, membrane fusion techniques, high velocity DNA-coated pellets, viral infection and protoplast fusion. Examples of host cells may include, but are not limited to an isolated cell, a cell culture, an Escherichia coli cell, a yeast cell, a human cell, a non-human cell, a mammalian cell, a non-mammalian cell, an
[0334]
[0335] insect cell, an HEK-293 cell, a liver cell, a kidney cell, a cell of the central nervous system, a heart cell, or a stem cell.
[0336] The plasmids useful in this invention may be engineered such that they are suitable for replication and packaging in vitro in prokaryotic cells, insect cells, mammalian cells, among others. Suitable transfection techniques and packaging host cells are known and / or can be readily designed by one of skill in the art.
[0337] In certain embodiments, a nucleic acid sequence (e.g., a plasmid or a sequence in a packaging cell) useful in producing an rAAV particle is provided.
[0338] In certain embodiments, a nucleic acid molecule useful for rAAV production comprises: (a) a adeno-associated virus 5' inverted terminal repeat; (b) a nucleic acid sequence encoding an miRNA which inhibits MSH3 expression in a subject comprising a 5' flanking region, a sense sequence, a loop, an antisense sequence, and a 3’ flanking region, wherein the sense sequence comprises a nucleic acid sequence encoding the sequence of wherein the at least one nucleic acid sequence comprises at least one of:
[0339] (i) one or more of CAAACTGACTGCCGCATTA (SEQ ID NO: 4, miR902S) or a variant of SEQ ID NO: 4 sequence having 1 or 2 nucleotide changes; and / or TAATGCGGCAGTTTCAGTTTG (SEQ ID NO: 10, miR902AS) or a or a variant of SEQ ID NO: 10 sequence having 1 or 2 nucleotide changes;
[0340] (ii) one or more of TAGCAACTTGACTGCATTT (SEQ ID NO: 5. miR2482S) or a variant of SEQ ID NO: 5 sequence having 1 or 2 nucleotide changes, and / or TGCTGAAATGCAGTCAACAGTTGCTA (SEQ ID NO: 11, miR2482 AS) or a variant of SEQ ID NO: 11 sequence having 1 or 2 nucleotide changes; and / or
[0341] (iii) one or more of ATCTGTTAGTGCAGGATGA (SEQ ID NO: 6, miR133 IS) or a variant of SEQ ID NO: 6 sequence having 1 or 2 nucleotide changes, and / or GTCATCCTGCACACTAACAGAT (SEQ ID NO: 12, miR133 IAS) or a variant of SEQ ID NO: 11 sequence having 1 or 2 nucleotide changes:
[0342] (c) regulatory control sequences operably linked to the miR encoding sequence;
[0343] (d) an AAV 3’ inverted terminal repeat (ITR).
[0344] In certain embodiments, a plasmid is provided which comprises a nucleic acid sequence of SEQ ID NO: 81, 82, 83, 86, 87, 90, 91, 94, 95, 98, 99, 102, or 103. In certain embodiments, the nucleic acid sequence is in an rAAV packaging cell.
[0345]
[0346] In certain embodiments, a nucleic acid is provided which is useful for rAAV production, e.g., in a plasmid or a packaging cell. In certain embodiments, the nucleic acid molecule comprises (a) a adeno-associated virus 5 ’ inverted terminal repeat; (b) a nucleic acid sequence comprising a nucleic acid sequence of SEQ ID NO: 104 or a sequence at least 95% identical thereto encoding a human FANCl-associated nuclease (hFAN 1) having SEQ ID NO: 105, wherein the hFANl nucleic acid sequence is operably linked to expression control sequences; and (c) an AAV 3’ inverted terminal repeat (ITR). In certain embodiments, the plasmid or packaging cell comprises a nucleic acid sequence having a sequence of SEQ ID NO: 84, 86, 88, 90, 92, 94, 96, 98, 100, or 102.
[0347] As used herein, a “vector genome” refers to the nucleic acid sequence packaged inside the rAAV capsid which forms a viral particle. Such a nucleic acid sequence contains AAV inverted terminal repeat sequences (ITRs). In the examples herein, a vector genome contains, at a minimum, from 5’ to 3’, an AAV 5’ ITR, expression cassette comprising coding sequence(s) (i.e., transgene(s)), and an AAV 3’ ITR. In certain embodiments, the ITRs are from AAV2, a different source AAV than the capsid, or other than full-length ITRs may be selected. In certain embodiments, the ITRs are from the same AAV source as the AAV which provides the rep function during production or a trans-complementing AAV. In certain embodiments, other ITRs, e.g., self-complementary (scAAV) ITRs, may be used (e.g.. for delivery of a miR sequence as provided herein). Both single-stranded AAV and self-complementary (sc) AAV are encompassed with the rAAV. The transgene is a nucleic acid coding sequence, heterologous to the vector sequences, which encodes a polypeptide, protein, functional RNA molecule (e.g., miRNA, miRNA inhibitor) or other gene product, of interest. The nucleic acid coding sequence is operatively linked to regulatory’ components in a manner which permits transgcnc transcription, translation, and / or expression in a cell of a target tissue. Suitable components of a vector genome are discussed in more detail herein. In one example, a “vector genome” contains, at a minimum, from 5’ to 3’, a vector-specific sequence, a nucleic acid sequence encoding protein of interest operably linked to regulatory control sequences (which direct their expression in a target cell), where the vector-specific sequence may be a terminal repeat sequence which specifically packages the vector genome into a viral vector capsid or envelope protein. For example, AAV inverted terminal repeats are utilized for packaging into AAV and certain other parvovirus capsids.
[0348]
[0349] In certain embodiments, non- viral genetic elements used in manufacture of a rAAV, will be referred to as vectors (e.g., production vectors). In certain embodiments, these vectors are plasmids, but the use of other suitable genetic elements is contemplated. Such production plasmids may encode sequences expressed during rAAV production, e.g., AAV capsid or rep proteins required for production of a rAAV, which are not packaged into the rAAV. Alternatively, such a production plasmid may carry the vector genome which is packaged into the rAAV.
[0350] Methods for generating and isolating AAVs suitable for use as vectors are known in the art. Sec generally, e.g., Grieger & Samulski, 2005, Adcno-associatcd virus as a gene therapy vector: Vector development, production and clinical applications, Adv. Biochem. Engin / Biotechnol. 99: 119-145; Bulling et al.. 2008. Recent developments in adeno-associated virus vector technology, J. Gene Med. 10:717-733; and the references cited below, each of which is incorporated herein by reference in its entirety. As used herein, a gene therapy vector refers to a rAAV as described herein, which is suitable for use in treating a patient. For packaging a gene into virions, the ITRs are the only AAV components required in cis in the same construct as the nucleic acid molecule containing the gene. The cap and rep genes can be supplied in trans.
[0351] In one embodiment, the expression cassettes described herein are engineered into a genetic element (e.g.. a shuttle plasmid) which transfers the immunoglobulin construct sequences carried thereon into a packaging host cell for production of a viral vector. In one embodiment, the selected genetic element may be delivered to an AAV packaging cell by any suitable method, including transfection, electroporation, liposome delivery, membrane fusion techniques, high velocity DNA-coated pellets, viral infection and protoplast fusion. Stable AAV packaging cells can also be made. The methods used to make such constructs are known to those with skill in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, e.g., Molecular Cloning: A Laboratory Manual, ed. Green and Sambrook, Cold Spring Harbor Press, Cold Spring Harbor, NY (2012).
[0352] The term "‘AAV intermediate” or “AAV vector intermediate” refers to an assembled rAAV capsid which lacks the desired genomic sequences packaged therein. These may also be termed an “empty” capsid. Such a capsid may contain no detectable genomic sequences of an expression cassette, or only partially packaged genomic
[0353]
[0354] sequences which are insufficient to achieve expression of the gene product. These empty capsids are non-functional to transfer the gene of interest to a host cell.
[0355] The recombinant adeno-associated virus (AAV) described herein may be generated using techniques which are known. See, e.g., WO2024 / 081551A1, published 18 April 2024; WO 2003 / 042397; WO 2005 / 033321, WO 2006 / 110689: US 7588772 B2. Such a method involves culturing a host cell which contains a nucleic acid sequence encoding an AAV capsid protein; a functional rep gene; an expression cassette composed of, at a minimum, AAV inverted terminal repeats (ITRs) and a transgene; and sufficient helper functions to permit packaging of the expression cassette into the AAV capsid protein. Methods of generating tire capsid, coding sequences therefor, and methods for production of rAAV viral vectors have been described. See, e.g.. Gao, et al, Proc. Natl. Acad. Sci. U.S.A. 100 (10), 6081-6086 (2003) and US 2013 / 0045186A1.
[0356] In certain embodiment, the rAAV may be generated (manufactured) using triple transfection techniques. In certain embodiments the rAAV are generated using a stable mammalian cell line. In certain embodiments, the stable cell line comprises one or more of: (a) a first plurality of polynucleotide molecules which comprise a coding sequence for at least one adeno-associated virus (AAV) replicase (Rep) protein necessary for production of a replication-defective rAAV vector (Rep52 and Rep78), wherein said rep proteins coding sequences are operably linked to a doxycycline-inducible promoter which directs expression of the rep proteins in the cell line; (b) at least a second plurality of polynucleotide molecules each encoding adenovirus (Ad) helper proteins necessary for production of a replication-defective rAAV vector comprising at least an Ad E2A DNA Binding Protein (DBP) coding sequence, and Ad E4ORF6 coding sequence, wherein the Ad E2A DBP coding sequences and the Ad E4ORF6 coding sequences arc operably linked to a doxycycline-inducible promoter which direct expression of the Ad helper proteins in the cell line; (c) a nucleic acid molecule comprising an Ad El coding sequence operably linked to a constitutive promoter which directs expression of the Ad El in the cell line; (d) at least a third plurality of nucleic acid molecules each of which comprises an AAV VP1 coding sequence which encodes AAV VP1 proteins, AAV VP2 proteins and AAV VP3 proteins which self-assemble to form an AAV capsid following expression in the cell, said AAV VP1 coding sequence being operably linked to a promoter which directs expression of the VP1 coding sequences in the cell line.
[0357]
[0358] In one embodiment, a production cell culture useful for producing a recombinant AAV having a capsid selected from an AAVhu68, an AAV9, a mutant AAV9, an AAVhu95 or an AAVhu96 is provided. Such a cell culture contains a nucleic acid which expresses the AAVhu68 capsid protein (or alternatively AAV9 capsid, mutant AAV9 capsid, AAVhu95 capsid, or AAVhu96 capsid) in the host cell; a nucleic acid molecule suitable for packaging into the AAVhu68 capsid, e.g., a vector genome which contains AAV ITRs and a non- AAV nucleic acid sequence encoding a gene operably linked to regulatory sequences which direct expression of the gene in a host cell; and sufficient AAV rep functions and adenovirus helper functions to permit packaging of the vector genome into the recombinant AAVhu68 (or AAV9, mutant AAV9, AAVhu95, AAVhu96 capsid. In one embodiment, the cell culture is composed of mammalian cells (e.g., human embryonic kidney 293 cells, among others) or insect cells (e.g., Spodoptera frugiperda (SIP) cells). In certain embodiments, baculovirus provides the helper functions necessary for packaging the vector genome into the recombinant AAVhu68 capsid, AAV9 capsid, mutant AAV9 capsid, AAVhu95 capsid or AAVhu96 capsid.
[0359] Optionally the rep functions are provided by an AAV other than AAV2, selected to complement the source of tire ITRs.
[0360] In one embodiment, cells are manufactured in a suitable cell culture (e.g., HEK 293 or Sf9) or suspension. Methods for manufacturing the gene therapy vectors described herein include methods well known in the art such as generation of plasmid DNA used for production of the gene therapy vectors, generation of the vectors, and purification of the vectors. In some embodiments, tire gene therapy vector is an AAV vector and the plasmids generated are an AAV cis-plasmid encoding the AAV vector genome and the gene of interest, an AAV trans-plasmid containing AAV rep and cap genes, and an adenovirus helper plasmid. The vector generation process can include method steps such as initiation of cell culture, passage of cells, seeding of cells, transfection of cells with the plasmid DNA, post-transfection medium exchange to serum free medium, and the harvest of vectorcontaining cells and culture media. The harvested vector-containing cells and culture media are referred to herein as crude cell harvest. In yet another system, the gene therapy vectors are introduced into insect cells by infection with baculovirus-based vectors. For reviews on these production systems, see generally, e.g., Zhang et al., 2009, Adenovirus-adeno-associated virus hybrid for large-scale recombinant adeno-associated virus
[0361]
[0362] production, Human Gene Therapy 20:922-929, the contents of each of which is incorporated herein by reference in its entirety. Methods of making and using these and other AAV production systems are also described in the following US patents, the contents of each of which is incorporated herein by reference in its entirety: US Patent Nos.
[0363] 5,139,941; 5.741.683; 6,057,152; 6.204,059; 6,268.213; 6,491,907; 6.660.514; 6,951,753; 7,094,604; 7,172,893; 7,201,898; 7,229,823; and 7,439,065.
[0364] The crude cell harvest may thereafter be subject method steps such as concentration of the vector harvest, diafdtration of the vector harvest, microfluidization of the vector harvest, nuclease digestion of the vector harvest, filtration of microfluidizcd intermediate, crude purification by chromatography, crude purification by ultracentrifugation, buffer exchange by tangential flow filtration, and / or formulation and filtration to prepare bulk vector. An affinity chromatography purification followed anion exchange resin chromatography are used to purify the vector drug product and to remove empty capsids. These methods are described in more detail in International Patent Application No. PCT / US2016 / 065970, filed December 9, 2016, and US 11,098,286 B2, entitled “Scalable Purification Method for AAV9"’, which are incorporated by reference. Purification methods for AAV8, International Patent Application No.
[0365] PCT / US2016 / 065976, filed December 9, 2016, and US 11,015,174 B2, entitled “Scalable Purification Method for AAV 8”, which are incorporated herein by reference. Purification methods for rhlO, International Patent Application No. PCT / US16 / 066013, filed December 9, 2016, and US 11,028,372 B2, entitled “Scalable Purification Method for AAVrhlO”, which are incorporated herein by reference. Purification methods for AAV1, International Patent Application No. PCT / US2016 / 065974, filed December 9, 2016, and US 11,015,173 B2, entitled “Scalable Purification Method for AAV1”, which arc incorporated herein by reference. Other suitable methods may be selected. See also, International Patent Application No. PCT / US2023 / 076186, filed October 6, 2023, now' published WO 2024 / 081551, which is incorporated herein by reference.
[0366] To calculate empty and full particle content, VP3 band volumes for a selected sample (e.g., in examples herein an iodixanol gradient-purified preparation where # of genome copies (GC) = # of particles) are plotted against GC particles loaded. The resulting linear equation (y = mx+c) is used to calculate the number of particles in the band volumes of the test article peaks. The number of particles (pt) per 20 pL loaded is then multiplied
[0367]
[0368] by 50 to give particles (pt) / mL. Pt / mL divided by GC / mL gives the ratio of particles to genome copies (pt / GC). Pt / mL-GC / mL gives empty pt / mL. Empty pt / mL divided by pt / mL and x 100 gives the percentage of empty particles.
[0369] Generally, methods for assaying for empty capsids and AAV vector particles with packaged genomes have been known in the art. See. e.g., Grimm et al., Gene Therapy (1999) 6:1322-1330; Sommer et al., Molec. Then (2003) 7:122-128. To test for denatured capsid, the methods include subjecting the treated AAV stock to SDS-polyacrylamide gel electrophoresis, consisting of any gel capable of separating the three capsid proteins, for example, a gradient gel containing 3-8% Tris-acctatc in tire buffer, then running the gel until sample material is separated, and blotting the gel onto nylon or nitrocellulose membranes, preferably nylon. Anti-AAV capsid antibodies are then used as the primary antibodies that bind to denatured capsid proteins, preferably an anti-AAV capsid monoclonal antibody, most preferably the Bl anti-AAV-2 monoclonal antibody (Wobus et al., J. Virol. (2000) 74:9281-9293). A secondary antibody is then used, one that binds to the primary antibody and contains a means for detecting binding with the primary antibody, more preferably an anti-IgG antibody containing a detection molecule covalently bound to it, most preferably a sheep anti-mouse IgG antibody covalently linked to horseradish peroxidase. A method for detecting binding is used to semi-quantitatively determine binding between the primary and secondary antibodies, preferably a detection method capable of detecting radioactive isotope emissions, electromagnetic radiation, or colorimetric changes, most preferably a chemiluminescence detection kit. For example, for SDS-PAGE, samples from column fractions can be taken and heated in SDS-PAGE loading buffer containing reducing agent (e.g., DTT), and capsid proteins were resolved on pre-cast gradient polyacrylamide gels (e.g., Novcx). Silver staining may be performed using SilverXpress (Invitrogen, CA) according to the manufacturer's instructions or other suitable staining method, i.e., SYPRO ruby or coomassie stains. In one embodiment, the concentration of AAV vector genomes (vg) in column fractions can be measured by quantitative real time PCR (Q-PCR). Samples are diluted and digested with DNase I (or another suitable nuclease) to remove exogenous DNA. After inactivation of the nuclease, the samples are further diluted and amplified using primers and a TaqMan™ Anorogenic probe specific for tire DNA sequence betw een tire primers. The number of cycles required to reach a defined level of Auorescence (threshold cycle, Ct) is measured for each sample
[0370]
[0371] on an Applied Biosystems Prism 7700 Sequence Detection System. Plasmid DNA containing identical sequences to that contained in the AAV vector is employed to generate a standard curve in the Q-PCR reaction. The cycle threshold (Ct) values obtained from the samples are used to determine vector genome titer by normalizing it to the Ct value of the plasmid standard curve. End-point assays based on the digital PCR can also be used.
[0372] In one aspect, an optimized q-PCR method is used which utilizes a broad spectrum serine protease, e.g., proteinase K (such as is commercially available from Qiagen). More particularly, the optimized qPCR genome titer assay is similar to a standard assay, except that after the DNase I digestion, samples arc diluted with proteinase K buffer and treated with proteinase K followed by heat inactivation. Suitably samples are diluted with proteinase K buffer in an amount equal to the sample size. The proteinase K buffer may be concentrated to 2-fold or higher. Typically, proteinase K treatment is about 0.2 mg / mL, but may be varied from 0.1 mg / mL to about 1 mg / mL. The treatment step is generally conducted at about 55 °C for about 15 minutes, but may be performed at a lower temperahire (e.g., about 37 °C to about 50 °C) over a longer time period (e.g., about 20 minutes to about 30 minutes), or a higher temperature (e.g., up to about 60 °C) for a shorter time period (e.g., about 5 to 10 minutes). Similarly, heat inactivation is generally at about 95 °C for about 15 minutes, but the temperature may be lowered (e.g.. about 70 to about 90 °C) and the time extended (e.g.. about 20 minutes to about 30 minutes). Samples are then diluted (e.g., 1000-fold) and subjected to TaqMan analysis as described in the standard assay.
[0373] Additionally, or alternatively, droplet digital PCR (ddPCR) may be used. For example, methods for determining single-stranded and self-complementary AAV vector genome titers by ddPCR have been described. See, e.g., M. Lock ct al, Hu Gene Therapy Methods, Hum Gene Ther Methods. 2014 Apr;25(2): 115-25. doi: 10.1089 / hgtb.2013.131. Epub 2014 Feb 14.
[0374] In brief, the method for separating the rAAV capsid (mutant Clade F. AAVhu68 AAV9, AAV 1, rh9L AAVhu95 or AAVhu96) particles having packaged genomic sequences from genome-deficient AAV intermediates involves subjecting a suspension comprising recombinant AAV viral particles and AAV capsid intermediates to fast performance liquid chromatography, wherein the AAV viral particles and AAV intermediates are bound to a strong anion exchange resin equilibrated (e.g., at a high pH of
[0375]
[0376] about 10.2), and subjected to a salt gradient while monitoring eluate for ultraviolet absorbance at about 260 nanometers (mn) and about 280 nm. In other embodiments, isocratic methods may be used. Although less optimal for the mutant Clade F rAAV, or for hu68 or AAV9. the pH may be in the range of about 10 to 10.4. In this method, the AAV full capsids are collected from a fraction which is eluted when the ratio of A260 / A280 reaches an inflection point. In one example, for the Affinity Chromatography step, the diafiltered product may be applied to an affinity resin (Life Technologies) that efficiently captures the AAV serotype. Under these ionic conditions, a significant percentage of residual cellular DNA and proteins flow through the column, while AAV particles arc efficiently captured.
[0377] The rAAV is suspended in a suitable physiologically compatible composition (e g., a buffered saline). This composition may be frozen for storage, later thawed and optionally diluted with a suitable diluent. Alternatively, the vector may be prepared as a composition which is suitable for delivery to a patient without proceeding through the freezing and thawing steps.
[0378] Pharmaceutical Composition
[0379] Compositions may include liposomes, lipids, lipid complexes, microspheres, microparticles, nanospheres, and / or nanoparticles.
[0380] As used herein, tire term "lipid nanoparticle” refers to a vesicle formed by one or more lipid components. Lipid nanoparticles are typically used as carriers for nucleic acid delivery in the context of pharmaceutical development. They work by fusing with a cellular membrane and repositioning its lipid structure to deliver a drug or active pharmaceutical ingredient (API). Generally, lipid nanoparticlc compositions for such delivery arc composed of synthetic ionizable or cationic lipids, phospholipids (especially compounds having a phosphatidylcholine group), cholesterol, and a polyethylene glycol (PEG) lipid; however, these compositions may also include other lipids. The sum composition of lipids typically dictates the surface characteristics and thus the protein (opsonization) content in biological systems thus driving biodistribution and cell uptake properties.
[0381] As used herein, the “liposome” refers to lipid molecules assembled in a spherical configuration encapsulating an interior aqueous volume that is segregated from an aqueous exterior. Liposomes are vesicles that possess at least one lipid bilayer. Liposomes are
[0382]
[0383] typically used as carriers for drug / therapeutic delivery' in the context of pharmaceutical development. They work by fusing with a cellular membrane and repositioning its lipid structure to deliver a drug or active pharmaceutical ingredient. Liposome compositions for such delivery are typically composed of phospholipids, especially compounds having a phosphatidylcholine group, however these compositions may also include other lipids.
[0384] As used herein, the term '‘ionizable lipid” refers to lipids having at least one protonatable or deprotonatable group, such that the lipid is positively charged at a pH at or below physiological pH (e.g., pH 7.4), and neutral at a second pH, preferably at or above physiological pH. It will be understood by one of ordinary skill in the art that the addition or removal of protons as a function of pH is an equilibrium process, and that the reference to a charged or a neutral lipid refers to the nature of tire predominant species and does not require that all of the lipid be present in the charged or neutral form. Generally, ionizable lipids have a pKa of the protonatable group in the range of about 4 to about 7. Ionizable lipids are also referred to as cationic lipids herein. As used herein, the term “non-cationic lipid” refers to any amphipathic lipid as well as any other neutral lipid or anionic lipid. Accordingly, the non-cationic lipid can be a neutral uncharged, zwitterionic, or anionic lipid. As used herein, the term “conjugated lipid” refers to a lipid molecule conjugated with a non-lipid molecule, such as a PEG, polyoxazoline, polyamide, or polymer (e.g., cationic polymer).
[0385] As used herein, the term “excipient” refers to pharmacologically inactive ingredients that are included in a formulation with the active component (e.g., miR, viral vector) and / or lipid nanoparticles to bulk up and / or stabilize the formulation when producing a dosage form. General categories of excipients include, for example, sterile aqueous suspending fluids, diluents, buffers, surfactants, lubricants, preservatives, water, etiianol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and / or vegetable oils. Proper fluidity may be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in tire case of dispersion, and / or by tire use of surfactants. Sterile compositions can be prepared by incorporating the physiologically active component in an appropriate amount of a solvent with other optional ingredients (e g., as enumerated above), followed by fdtered sterilization. Generally, dispersions are prepared by incorporating the various sterilized physiologically active components into a sterile vehicle that contains the basic dispersion medium and the required other ingredients (e.g., from those enumerated above). In die case of sterile powders for the
[0386]
[0387] preparation of sterile injectable solutions, preferred methods of preparation can be vacuumdrying and freeze-drying techniques which yield a powder of the physiologically active components plus any additional desired ingredient from a previously sterile-fdtered solution thereof.
[0388] In one aspect, provided herein is a pharmaceutical composition comprising an rAAV vector as described herein in a formulation buffer. In one embodiment, provided is a pharmaceutical composition comprising a rAAV as described herein in a formulation buffer. In one embodiment, the rAAV is formulated at about 1 x 109genome copies (GC) / mL to about 1 x 1014GC / mL. In a further embodiment, the rAAV is formulated at about 3 x 109GC / mL to about 3 x 1013GC / mL. In yet a further embodiment, the rAAV is formulated at about 1 x 109GC / mL to about 1 x 1013GC / mL. In one embodiment, the rAAV is formulated at least about 1 x 1011GC / mL.
[0389] Provided herein also is a composition comprising an rAAV and an aqueous suspension media. In certain embodiments, the suspension is formulated for intravenous administration or intramuscular administration. In one aspect, the compositions contain at least one rAAV stock and an optional carrier, excipient and / or preservative.
[0390] As used herein, “carrier” includes solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Supplementary active ingredients can also be incorporated into the compositions. The phrase “pharmaceutically -acceptable” refers to molecular entities and compositions that do not produce an allergic or similar untoward reaction when administered to a host. Delivery vehicles such as liposomes, nanocapsulcs, microparticles, microsphcrcs, lipid particles, vesicles, and the like, may be used for the introduction of the compositions of the present invention into suitable host cells. In particular, the rAAV vector delivered vector genomes may be formulated for delivery either encapsulated in a lipid particle, a liposome, a vesicle, a nanosphere, or a nanoparticle or the like.
[0391] In one embodiment, a composition includes a final formulation suitable for delivery to a subject, e.g., is an aqueous liquid suspension buffered to a physiologically compatible pH and salt concentration. Optionally, one or more surfactants are present in the formulation. In another embodiment, the composition may be transported as a concentrate
[0392]
[0393] which is diluted for administration to a subject. In other embodiments, the composition may be lyophilized and reconstituted at tire time of administration.
[0394] A suitable surfactant, or combination of surfactants, may be selected from among non-ionic surfactants that are nontoxic. In one embodiment, a difunctional block copolymer surfactant terminating in primary hydroxyl groups is selected, e.g., such as Pluronic® F68 [BASF], also known as Poloxamer 188, which has a neutral pH, has an average molecular weight of 8400. Other surfactants and other Poloxamers may be selected, i.e., nonionic triblock copolymers composed of a central hydrophobic chain of polyoxypropylcnc (poly(propylcnc oxide)) flanked by two hydrophilic chains of polyoxyethylene (poly(ediylene oxide)), SOLUTOL HS 15 (Macrogol-15
[0395] Hydroxy stearate), LABRASOL (Polyoxy capryllic glyceride), polyoxy 10 oleyl ether, TWEEN (polyoxyethylene sorbitan fatty acid esters), ethanol and polyethylene glycol. In one embodiment, the formulation contains a poloxamer. These copolymers are commonly named with die letter "P" (for poloxamer) followed by three digits: the first two digits x 100 give the approximate molecular mass of the poly oxypropylene core, and the last digit x 10 gives the percentage polyoxyethylene content. In one embodiment Poloxamer 188 is selected. In one embodiment, die surfactant may be present in an amount up to about 0.0005 % to about 0.001% (based on weight ratio, wAv %) of the suspension. In another embodiment, the surfactant may be present in an amount up to about 0.0005 % to about 0.001% (based on volume ratio, v / v %) of the suspension. In yet another embodiment, the surfactant may be present in an amount up to about 0.0005 % to about 0.001% of the suspension, wherein n % indicates n gram per 100 mL of the suspension.
[0396] In another embodiment, die composition includes a carrier, diluent, excipient and / or adjuvant. Suitable carriers may be readily selected by one of skill in die art in view' of die indication for which die transfer virus is directed. For example, one suitable carrier includes saline, which may be fonnulated widi a variety of buffering solutions (e.g., phosphate buffered saline). Other exemplary carriers include sterile saline, lactose, sucrose, calcium phosphate, gelatin, dextran, agar, pectin, peanut oil, sesame oil, and water. The buffer / carrier should include a component that prevents the rAAV, from sticking to the infusion tubing but does not interfere with the rAAV binding activity in vivo. A suitable surfactant, or combination of surfactants, may be selected from among non-ionic surfactants that are nontoxic. In one embodiment, a difunctional block copolymer
[0397]
[0398] surfactant terminating in primary hydroxy I groups is selected, e.g., such as Poloxamer 188 (also known under the commercial names Pluronic® F68 [BASF], Lutrol® F68, Synperonic® F68, Kolliphor® Pl 88) which has a neutral pH, has an average molecular weight of 8400. Other surfactants and other Poloxamers may be selected, i.e.. nonionic triblock copolymers composed of a central hydrophobic chain of poly oxypropylene (polypropylene oxide)) flanked by two hydrophilic chains of polyoxyethylene (polyethylene oxide)), SOLUTOL HS 15 (Macrogol-15 Hydroxystearate), LABRASOL (Polyoxyrcapryllic glyceride), polyoxy -oleyl ether, TWEEN (polyoxyethylene sorbitan fatty’ acid esters), ethanol and polyethylene glycol. In one embodiment, tire formulation contains a poloxamer. These copolymers are commonly named with tire letter "P" (for poloxamer) followed by three digits: the first two digits x 100 give the approximate molecular mass of the poly oxypropylene core, and the last digit x 10 gives tire percentage polyoxyethylene content. In one embodiment Poloxamer 188 is selected. The surfactant may be present in an amount up to about 0.0005 % to about 0.001% of the suspension.
[0399] In certain embodiments, the formulation may contain a buffered saline aqueous solution not comprising sodium bicarbonate. Such a formulation may contain a buffered saline aqueous solution comprising one or more of sodium phosphate, sodium chloride, potassium chloride, calcium chloride, magnesium chloride and mixtures thereof, in water, such as a Harvard's buffer. In one embodiment, the buffer is PBS.
[0400] Optionally, the compositions may contain, in addition to the rAAV and carrier(s), other conventional pharmaceutical ingredients, such as preservatives, or chemical stabilizers. Suitable exemplary? preservatives include chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, the parabens, ethyl vanillin, glycerin, phenol, and parachlorophcnol. Suitable chemical stabilizers include gelatin and albumin.
[0401] The compositions may comprise a pharmaceutically acceptable carrier, such as defined above. Suitably, the compositions described herein comprise an effective amount of one or more AAV suspended in a pharmaceutically suitable carrier and / or admixed with suitable excipients designed for delivery to the subject via injection, or for delivery by another route and / or device.
[0402] In one embodiment, a therapeutically effective amount of said vector is included in the pharmaceutical composition.
[0403]
[0404] As used herein, a “therapeutically effective amount” refers to the amount of the composition comprising the nucleic acid sequence encoding hFAN 1 and / or a miR902, miR2482 and / or miR1331 (or an rAAV or a vector thereof) which delivers and expresses in the target cells an amount of the hFANl protein and / or miR sufficient to achieve efficacy. In one embodiment, the dosage of die vector is about I x lO9GC / kg mass to about 1 x 1014GC / kg, including all integers or fractional amounts within the range and the endpoints. In certain embodiments, the dosage is about 2 x 1013GC / kg mass. In certain embodiments, an effective amount may be determined based on an animal model, rather than a human patient. In certain embodiment, animal model is a commercially available mouse model, e.g., Httm5Mem / J, https: / / www.jax.org / strain / 003456.
[0405] The dosage is adjusted to balance the therapeutic benefit against any side effects and such dosages may vary depending upon the therapeutic application for which the recombinant vector is employed. The levels of expression of the transgene product can be monitored to determine the frequency of dosage resulting in viral vectors, preferably AAV vectors containing the minigene. Optionally, dosage regimens similar to those described for therapeutic purposes may be utilized for immunization using the compositions of the invention.
[0406] As used herein, the term “dosage” or “amount” can refer to the total dosage or amount delivered to the subject in the course of treatment, or the dosage or amount delivered in a single unit (or multiple unit or split dosage) administration.
[0407] Also, the replication-defective virus compositions can be formulated in dosage units to contain an amount of replication-defective virus that is in the range of about 1.0 x 109GC to about 1.0 x 1016GC (to treat an average subject of 70 kg in body weight) including all integers or fractional amounts within the range, and preferably 1.0 x 1012GC to 1.0 x 1014GC for a human patient. In one embodiment, the compositions are formulated to contain at least IxlO9, 2xl09. 3xl09, 4xl09. 5xl09, 6xl09. 7xl09, 8xl09. or 9xl09GC per dose including all integers or fractional amounts within the range. In another embodiment, the compositions are formulated to contain at least IxlO10, 2xlO10, 3xl010, 4xlO10, 5xl010, 6xlO10, 7xlO10, 8xl010, or 9xlO10GC per dose including all integers or fractional amounts within the range. In another embodiment, the compositions are formulated to contain at least IxlO11, 2x10”, 3x10", 4x10", 5x10", 6x10", 7x10", 8x10", or 9x10" GC per dose including all integers or fractional amounts within the range. In another embodiment, tire
[0408]
[0409] compositions are formulated to contain at least IxlO12, 2xl012, 3xl012, 4xl012, 5xl012, 6xl012, 7xl012, 8xl012, or 9xl012GC per dose including all integers or fractional amounts within the range. In another embodiment, the compositions are formulated to contain at least IxlO13, 2xl013, 3xl013, 4xl013, 5xl013. 6xl013. 7xl013, 8xl013, or 9xl013GC per dose including all integers or fractional amounts within the range. In another embodiment, the compositions are formulated to contain at least IxlO14, 2xl014, 3xl014, 4x1014, 5xl014, 6xl014, 7xl014, 8xl014, or 9xl014GC per dose including all integers or fractional amounts within the range. In another embodiment, the compositions are formulated to contain at least IxlO15, 2xl015, 3xl015, 4xl015, 5xl015, 6xl015, 7xl015, 8xl015, or 9xl015GC per dose including all integers or fractional amounts within the range. In one embodiment, for human application the dose can range from IxlO10to about IxlO12GC per dose including all integers or fractional amounts within the range.
[0410] It should be understood that the compositions in the pharmaceutical composition described herein are intended to be applied to other compositions, regiments, aspects, embodiments and methods described across the Specification.
[0411] Methods and Uses
[0412] The vector, compositions, and rAAV particles provided herein are useful for delaying onset of, treatment of. and / or amelioration of tire symptoms of a repeat expansion disease. In one embodiment, the condition is Huntington’s Disease (also termed Huntington’s chorea). Also provided are compositions, vectors, and rAAV particles useful in therapy for Fragile X Syndrome, myotonic dystrophy (DM1 and DM2), amyotrophic lateral sclerosis and / or frontotemporal dementia caused by somatic expansion in the C90RF72 gene, spinocerebellar ataxias (SCAs 1, 2, 3, 6, 7 and 17), Friedreich's ataxia (FRDA), Fragile X Tremor Ataxia Syndrome (FXS / FXTAS), dentatorubral-pallidoluysian atrophy (DRPLA), spinal and bulbar muscular atrophy (SBMA), or Unverricht-Lundborg myoclonic epilepsy (EPM1).
[0413] In addition to providing combinations of the rAAV particles, vectors, RNA inhibitory molecules and / or compositions provided herein, such constructs may be used in combination with another tirerapeutic. For example, one such combination may be Total Huntingtin Gene (HTT) gene replacement, a human cholesterol 24-hydroxylase gene (hCPY46Al), small molecule drugs to control movement (e.g., tetrabenazine,
[0414]
[0415] deuterabenazine, or valbenazine), antipsychotic medicines (e.g., haloperidol and fluphenazine, aolanzapine, and aripiprazole), or amantadine, levetiracetam, or clonazepam (Klonopin), amongst others.
[0416] In certain embodiments, a pharmaceutical composition comprising an rAAV particle in an aqueous suspension is administered to a subject. In certain embodiments, a pharmaceutical composition comprising an rAAV particle in an aqueous suspension is administered to a subject via an infusion. In certain embodiments, a pharmaceutical composition comprising an rAAV particle in an aqueous suspension is delivered via a infusion into a subject. In certain embodiments, tire infusion is delivered intrathccally. In certain embodiments, a pharmaceutical composition comprising an rAAV particle in an aqueous suspension is administered by intraparenchymal administration. In certain embodiments, the rAAV is administered via intraparenchymal (dentate nucleus) administration. In certain embodiments, the intraparenchymal (dentate nucleus) administration is performed unilaterally. In certain embodiments, the intraparenchymal (dentate nucleus) administration is performed bilaterally.
[0417] As used herein, the terms “intrathecal delivery ” or “intrathecal administration” refer to a route of administration via an injection into the spinal canal, more specifically into the subarachnoid space so that it reaches the cerebrospinal fluid (CSF). Intrathecal delivery may include lumbar puncture, intraventricular (including intracerebroventricular (1CV)), suboccipital / intracistemal, and / or Cl -2 puncture. For example, material may be introduced for diffusion throughout the subarachnoid space by means of lumbar puncture. In another example, injection may be into the cistema magna (i.e., intra cistema magna, or ICM). In certain embodiments, the intrathecal administration is performed as described in US Patent Publication No. 2018-0339065 Al, published November 29, 2019, which is incorporated herein by reference in its entirety. In certain embodiments, the CNS administration is performed using Ommaya Reservoir (also referred to as Ommaya device or Ommaya system). As used herein, the terms “intracistemal delivery” or “intracistemal administration” refer to a route of administration directly into the cerebrospinal fluid of the cistema magna cerebellomedularis, more specifically via a suboccipital puncture or by direct injection into the cistema magna or via permanently positioned tube.
[0418] As used herein, tire temr “intraparenchymal (dentate nucleus)” or IDN refers to a route of administration of a composition directly into dentate nuclei. IDN allows for
[0419]
[0420] targeting of dentate nuclei and / or cerebellum. In certain embodiments, the IDN administration is performed using ClearPoint® Neuro Navigation System (MRI Interventions, Inc., Memphis, TN) and ventricular cannula, which allows for MRI-guided visualization and administration. Alternatively, other devices and methods may be selected. Suitable suspension buffers (e.g., ITFFB or Elliot’s, among others), doses of rAAV, and volumes are provide herein.
[0421] Compositions comprising the RNA inhibitory molecule (e.g., miR902, miR2482, miR1331) and / or the hFAN 1 are generally targeted to one or more different cell types within the central nervous system, including, but not limited to, neurons (including, e.g., lower motor neurons, medium spiny neurons in striatum (caudate / putamen), and / or primary sensory neurons. These may include, e.g., pyramidal, purkinje, granule, spindle, and interneuron cells). In certain embodiments, the infusion is via intraparenchymal delivery. In certain embodiments, a bilateral infusion is used. In certain embodiments, the infusion is delivered via bilateral, intraparenchymal infusion into a subject’s caudate and putamen. In certain embodiments, the composition is delivered by intracranial administration into the pontine region of the brain
[0422] In certain embodiments, the patient may receive an infusion comprising two or more different vectors, rAAV particles and / or compositions as described herein.
[0423] Kit
[0424] In certain embodiments, a kit is provided which includes a concentrated vector suspended in a formulation (optionally frozen), optional dilution buffer, and devices and components required for intravenous administration. In another embodiment, the kit may additionally or alternatively include components for intravenous delivery. In one embodiment, the kit provides sufficient buffer to allow for injection. Such buffer may allow for about a 1 : 1 to a 1:5 dilution of the concentrated vector, or more. In other embodiments, higher or lower amounts of buffer or sterile water are included to allow for dose titration and other adjustments by the treating clinician. In still other embodiments, one or more components of the device are included in the kit. Suitable dilution buffer is available, such as, a saline, a phosphate buffered saline (PBS) or a glycerol / PBS.
[0425]
[0426] It should be understood that the compositions and kit described herein are intended to be applied to other compositions, regimens, aspects, embodiments and methods described across tire Specification.
[0427] Apparatus and Method for Delivery of a Pharmaceutical Composition
[0428] In one aspect, the vectors, rAAV or compositions thereof provided herein may be administered intrathecally via tire method and / or the device provided in this section and described in WO 2017 / 136500 and WO 2018 / 160582, which are incorporated by reference herein.
[0429] In certain embodiments, the apparatus is described in US Patent Publication No. 2018-0339065 Al, published November 29, 2019, which is incorporated herein by reference in its entirety. In certain embodiments, the vectors, rAAV or compositions thereof provided herein may be administered using Ommaya Reservoir.
[0430] In certain embodiments, the rAAV administration is performed using ClearPoint® Neuro Navigation System (MRI Interventions. Inc., Memphis, TN) and ventricular cannula, which allows for MRI-guided visualization and administration.
[0431] In certain embodiments, tire rAAV administration is performed using the ClearPoint® injection system wherein tire system consists of a monitor to visualize the brain and injection procedure in real time, a head fixation frame that is secured to the skull, and an MRI-compatible SmartFrame® (MRI Interventions Inc., Memphis, TN) trajectory device that enables MRI-guided alignment during the procedure. This system allows for the direct injection to be combined with real-time visualization of the injection tract by MRI.
[0432] Alternatively, other devices and methods may be selected. In certain embodiments, the rAAV administration is performed using Neurochase Platform (e.g., neurochase_com / neurochase-ced-drug-delivery-system).
[0433] It should be understood that the compositions in the device described herein are intended to be applied to other compositions, regiments, aspects, embodiments and methods described across the Specification.
[0434] Additional embodiments of tire present invention are listed in the enumerated paragraphs below.
[0435]
[0436] El. An expression cassette comprising a nucleic acid sequence encoding an miRNA comprising a guide strand and a passenger strand, wherein the guide strand comprises a nucleic acid sequence encoding the sequence of:
[0437] CAAACUGACUGCCGCAUUA (SEQ ID NO: 1, mu miR902 sense);
[0438] UAGCAACUUGACUGCAUUU (SEQ ID NO: 2, miR2482 sense); or AUCUGUUAGUGCAGGAUGA (SEQ ID NO: 3, miR1331 sense), and
[0439] wherein the nucleic acid sequence encoding the guide strand and the passenger strand is operatively linked to a 5’ flanking region and a 3’ flanking region.
[0440] E2. The expression cassette of E 1, wherein:
[0441] the nucleic acid sequence encoding SEQ ID NO: 1 comprises the sequence of CAAACTGACTGCCGCATTA (SEQ ID NO: 4, miR902 sense);
[0442] the nucleic acid sequence encoding SEQ ID NO: 2 comprises the sequence of TAGCAACTTGACTGCATTT (SEQ ID NO: 5, miR2482 sense); and
[0443] the nucleic acid sequence encoding SEQ ID NO: 3 comprises the sequence of ATCTGTTAGTGCAGGATGA (SEQ ID NO: 6, miR1331).
[0444] E3. The expression cassette of El, wherein the passenger strand comprises the nucleic acid sequence encoding die sequence of:
[0445] UAAUGCGGCAGUUUCAGUUUG (SEQ ID NO: 7), UGCUGAAAUGCAGUCAACAGUUGCUA (SEQ ID NO: 8). or GUCAUCCUGCACACUAACAGAU (SEQ ID NO: 9).
[0446] E4. The expression cassette of E3, wherein:
[0447] the nucleic acid sequence encoding SEQ ID NO: 7 comprises the sequence of TAATGCGGCAGTTTCAGTTTG (SEQ ID NO: 10);
[0448] the nucleic acid sequence encoding SEQ ID NO: 8 comprises the sequence of TGCTGAAATGCAGTCAACAGTTGCTA (SEQ ID NO: 11); and
[0449] the nucleic acid sequence encoding SEQ ID NO: 9 comprises the sequence of GTCATCCTGCACACTAACAGAT (SEQ ID NO: 12).
[0450] E5. The expression cassette of any one of El -4, wherein:
[0451] the guide strand comprises the nucleic acid sequence encoding SEQ ID NO: 1; and the passenger strand comprises the nucleic acid sequence encoding SEQ ID NO: 7;
[0452] the guide strand comprises the nucleic acid sequence encoding SEQ ID NO: 2; and the passenger strand comprises the nucleic acid sequence encoding SEQ ID NO: 8; or
[0453]
[0454] the guide strand comprises the nucleic acid sequence encoding SEQ ID NO: 3; and the passenger strand comprises the nucleic acid sequence encoding SEQ ID NO: 9.
[0455] E5. The expression cassette of any one of El -4, wherein:
[0456] the guide strand comprises the nucleic acid sequence of SEQ ID NO: 4; and the passenger strand comprises the nucleic acid sequence of SEQ ID NO: 10;
[0457] the guide strand comprises the nucleic acid sequence of SEQ ID NO: 5; and the passenger strand comprises the nucleic acid sequence of SEQ ID NO: 11; or
[0458] the guide strand comprises the nucleic acid sequence of SEQ ID NO: 6; and the passenger strand comprises the nucleic acid sequence of SEQ ID NO: 12.
[0459] E6. The expression cassette of El, wherein the nucleic acid sequence encoding the miRNA comprises a loop nucleic acid sequence that operatively links the guide strand and the passenger strand.
[0460] E7. The expression cassette of E6, wherein the loop sequence comprises the nucleic acid sequence of GTTTTGGCCACTGACTGAC (SEQ ID NO: 31).
[0461] E8. The expression cassette of any one of El-7, wherein the guide strand, the loop sequence, and the passenger strand comprises tire nucleic acid sequence encoding the sequence of:
[0462] UAAUGCGGCAGUUUCAGUUUGGUUUUGGCCACUGACUGACCAAACUGACUG CCGCAUUA (SEQ ID NO: 13, miR902);
[0463] UGCUGAAAUGCAGUCAACAGUUGCUAGUUUUGGCCACUGACUGACUAGCAA CUUGACUGCAUUU (SEQ ID NO: 14, miR2482); or GUCAUCCUGCACACUAACAGAUGUUUUGGCCACUGACUGACAUCUGUUAGU GCAGGAUGA (SEQ ID NO: 15, miR.1331).
[0464] E9. The expression cassette of E8, wherein:
[0465] the nucleic acid sequence encoding SEQ ID NO: 13 comprises the sequence of TAATGCGGCAGTTTCAGTTTGGTTTTGGCCACTGACTGACCAAACTGACTGCCG CATTA (SEQ ID NO: 16, miR902);
[0466] the nucleic acid sequence encoding SEQ ID NO: 14 comprises the sequence of TGCTGAAATGCAGTCAACAGTTGCTAGTTTTGGCCACTGACTGACTAGCAACTT GACTGCATTT (SEQ ID NO: 17, miR2482); and
[0467]
[0468] the nucleic acid sequence encoding SEQ ID NO: 15 comprises the sequence of GTCATCCTGCACACTAACAGATGTTTTGGCCACTGACTGACATCTGTTAGTGCA GGATGA (SEQ ID NO: 18, miR1331).
[0469] E10. The expression cassette of any one of El -9, wherein the 5’ flanking region comprises a nucleic acid sequence encoding the sequence of CUGGAGGCUUGCUGAAGGCUGUAUGCU (SEQ ID NO: 19), or CUGGAGGCUUGCUGAAGGCUGUA (SEQ ID NO: 20).
[0470] Ell. The expression cassette of E 10, wherein:
[0471] the nucleic acid sequence encoding SEQ ID NO: 19, comprises the sequence of ctggaggcttgctgaaggctgtatgct (SEQ ID NO: 21); and
[0472] the nucleic acid sequence encoding SEQ ID NO: 20, comprises the sequence of ctggaggcttgctgaaggctgta (SEQ ID NO: 22).
[0473] E12. The expression cassette of any one of El-11, wherein the 3’ flanking region comprises a nucleic acid sequence encoding the sequence of CAGGACACAAGGCCUGUUACUAGCACUCACAUGGAACAAAUGGCC (SEQ ID NO: 23).
[0474] E13. The expression cassette of E12, wherein the nucleic acid sequence encoding SEQ ID NO: 23, comprises the sequence of caggacacaaggcctgttactagcactcacatggaacaaatggcc (SEQ ID NO: 24).
[0475] E14. The expression cassette of any one of El-13, wherein the miRNA encodes the sequences of CUGGAGGCUUGCUGAAGGCUGUAUGCUGUAAUGCGGCAGUUUCAGUUUGGU UUUGGCCACUGACUGACCAAACUGACUGCCGCAUUACAGGACACAAGGCCUG UUACUAGCACUCACAUGGAACAAAUGGCC (SEQ ID NO: 25);
[0476] CUGGAGGCUUGCUGAAGGCUGUAUGCUGAAAUGCAGUCAACAGUUGCUAGU UUUGGCCACUGACUGACUAGCAACUUGACUGCAUUUCAGGACACAAGGCCU GUUACUAGCACUCACAUGGAACAAAUGGCC (SEQ ID NO: 26): or CUGGAGGCUUGCUGAAGGCUGUAUGCUGUCAUCCUGCACACUAACAGAUGU UUUGGCCACUGACUGACAUCUGUUAGUGCAGGAUGACAGGACACAAGGCCU GUUACUAGCACUCACAUGGAACAAAUGGCC (SEQ ID NO: 27).
[0477] E15. The expression cassette of E14, wherein:
[0478]
[0479] the nucleic acid sequence encoding SEQ ID NO: 25, comprises the sequence of ctggaggcttgctgaaggctgtatgctgTAATGCGGCAGTTTCAGTTTGGTTTTGGCCACTGACT GACCAAACTGACTGCCGCATTAcaggacacaaggcctgttactagcactcacatggaacaaatggcc (SEQ ID NO: 28);
[0480] the nucleic acid sequence encoding SEQ ID NO: 26, comprises the sequence of ctggaggcttgctgaaggctgtaTGCTGAAATGCAGTCAACAGTTGCTAGTTTTGGCCACTG ACTGACTAGCAACTTGACTGCATTTcaggacacaaggcctgttactagcactcacatggaacaaatggcc (SEQ ID NO: 29); and
[0481] the nucleic acid sequence encoding SEQ ID NO: 27, comprises the sequence of ctggaggcttgctgaaggctgtatgctGTCATCCTGCACACTAACAGATGTTTTGGCCACTGAC TGACATCTGTTAGTGCAGGATGAcaggacacaaggcctgttactagcactcacatggaacaaatggcc (SEQ ID NO: 30).
[0482] El 6. The expression cassette of any one of El -5, wherein the miRNA represses expression of MSH3.
[0483] El 7. The expression cassette of El, wherein the expression cassette comprises a promoter, and wherein the promoter is operatively linked to tire nucleic acid sequence encoding the miRNA.
[0484] E18. The expression cassette of E17, wherein the promoter is a human constitutive promoter, or a cell specific promoter.
[0485] El 9. The expression cassette of any one of E 17 or 18, wherein the promoter is selected from any one of CB7, CAG, synapsin, CMV, CMVe.mP84, calmodulin, or prion promoter.
[0486] E20. The expression cassette of El, wherein the expression cassette comprises Woodchuck Hepatitis Virus Posttranscriptional Regulatory Elements (WPRE), and wherein the WPRE is operatively linked to the nucleic acid sequence encoding the miRNA.
[0487] E21. The expression cassette of any one of El -20. wherein the expression cassette comprises an enhancer, such as a CMV enhancer, and wherein the enhancer is operatively linked to the nucleic acid sequence encoding the miRNA.
[0488] E22. The expression cassette of any one of El -21, wherein the expression cassette comprises a rabbit P-globin exon, and wherein the rabbit P-globin exon is operatively linked to the nucleic acid sequence encoding the miRNA.
[0489]
[0490] E23. The expression cassette of any one of El -22, wherein the expression cassette comprises a polyadenylation A (poly(A)) tail, such as an SV40 poly(A), or a rabbit globin poly(A), and wherein the poly(A) tail is operatively linked to the nucleic acid sequence encoding the miRNA.
[0491] E24. The expression cassette of any one of El-23, wherein the expression cassette comprises 3’ and 5’ adeno-associated virus (AAV) inverted terminal repeats (ITRs), or variants thereof.
[0492] E25. The expression cassette of any one of El -24, wherein the expression cassette comprises the nucleic acid sequence of SEQ ID NO: 32; SEQ ID NO: 33; or SEQ ID NO: 34.AA
[0493] E26. A vector comprising an expression cassette comprising a nucleic acid sequence encoding an miRNA comprising a guide strand and a passenger strand, wherein the guide strand comprises a nucleic acid sequence encoding the sequence of:
[0494] CAAACUGACUGCCGCAUUA (SEQ ID NO: 1, miR902 sense);
[0495] UAGCAACUUGACUGCAUUU (SEQ ID NO: 2, miR1331 sense); or AUCUGUUAGUGCAGGAUGA (SEQ ID NO: 3), and
[0496] wherein the nucleic acid sequence encoding tire guide strand and the passenger strand is operatively linked to a 5' flanking region and a 3‘ flanking region.
[0497] E27. The vector of E26. wherein the vector is a plasmid.
[0498] E28. The vector of E26 wherein:
[0499] the nucleic acid sequence encoding SEQ ID NO: 1 comprises the sequence of CAAACTGACTGCCGCATTA (SEQ ID NO: 4, mIR902);
[0500] the nucleic acid sequence encoding SEQ ID NO: 2 comprises the sequence of TAGCAACTTGACTGCATTT (SEQ ID NO: 5, mIR2482); and
[0501] the nucleic acid sequence encoding SEQ ID NO: 3 comprises the sequence of ATCTGTTAGTGCAGGATGA (SEQ ID NO: 6. miR1331 sense).
[0502] E29. The vector of E26. wherein the passenger strand comprises the nucleic acid sequence encoding the sequence of:
[0503] UAAUGCGGCAGUUUCAGUUUG (SEQ ID NO: 7), UGCUGAAAUGCAGUCAACAGUUGCUA (SEQ ID NO: 8), or GUCAUCCUGCACACUAACAGAU (SEQ ID NO: 9).
[0504] E30. The vector of E29. wherein:
[0505]
[0506] the nucleic acid sequence encoding SEQ ID NO: 7 comprises the sequence of TAATGCGGCAGTTTCAGTTTG (SEQ ID NO: 10);
[0507] the nucleic acid sequence encoding SEQ ID NO: 8 comprises the sequence of TGCTGAAATGCAGTCAACAGTTGCTA (SEQ ID NO: I I): and
[0508] the nucleic acid sequence encoding SEQ ID NO: 9 comprises the sequence of GTCATCCTGCACACTAACAGAT (SEQ ID NO: 12).
[0509] E31. The vector of any one of E26-30, wherein:
[0510] the guide strand comprises the nucleic acid sequence encoding SEQ ID NO: 1; and tire passenger strand comprises the nucleic acid sequence encoding SEQ ID NO: 7;
[0511] the guide strand comprises the nucleic acid sequence encoding SEQ ID NO: 2; and the passenger strand comprises the nucleic acid sequence encoding SEQ ID NO: 8; or the guide strand comprises the nucleic acid sequence encoding SEQ ID NO: 3; and the passenger strand comprises the nucleic acid sequence encoding SEQ ID NO: 9.
[0512] E32. The vector of any one of E26-30, wherein:
[0513] the guide strand comprises the nucleic acid sequence of SEQ ID NO: 4; and the passenger strand comprises the nucleic acid sequence of SEQ ID NO: 10;
[0514] tire guide strand comprises the nucleic acid sequence of SEQ ID NO: 5; and the passenger strand comprises the nucleic acid sequence of SEQ ID NO: 11; or
[0515] the guide strand comprises the nucleic acid sequence of SEQ ID NO: 6; and the passenger strand comprises the nucleic acid sequence of SEQ ID NO: 12.
[0516] E33. The vector of E26, wherein the nucleic acid sequence encoding the miRNA comprises a loop nucleic acid sequence that operatively links the guide strand and the passenger strand.
[0517] E34. The vector of E33, wherein the loop sequence comprises the nucleic acid sequence of GTTTTGGCCACTGACTGAC (SEQ ID NO: 31).
[0518] E35. The vector of any one of E26-34, wherein the guide strand, the loop sequence, and the passenger strand comprises the nucleic acid sequence encoding the sequence of:
[0519] UAAUGCGGCAGUUUCAGUUUGGUUUUGGCCACUGACUGACCAAACUG ACUGCCGCAUUA (SEQ ID NO: 13, miR902);
[0520] UGCUGAAAUGCAGUCAACAGUUGCUAGUUUUGGCCACUGACUGACUA GCAACUUGACUGCAUUU (SEQ ID NO: 14, miR2382); or
[0521]
[0522] GUCAUCCUGCACACUAACAGAUGUUUUGGCCACUGACUGACAUCUGU UAGUGCAGGAUGA (SEQ ID NO: 15, miR1331).
[0523] E36. The vector of E35. wherein:
[0524] the nucleic acid sequence encoding SEQ ID NO: 13 comprises tire sequence of TAATGCGGCAGTTTCAGTTTGGTTTTGGCCACTGACTGACCAAACTGACTGCCG CATTA (SEQ ID NO: 16, mIR902);
[0525] the nucleic acid sequence encoding SEQ ID NO: 14 comprises the sequence of TGCTGAAATGCAGTCAACAGTTGCTAGTTTTGGCCACTGACTGACTAGCAACTT GACTGCATTT (SEQ ID NO: 17, mIR2482); and
[0526] the nucleic acid sequence encoding SEQ ID NO: 15 comprises tire sequence of GTCATCCTGCACACTAACAGATGTTTTGGCCACTGACTGACATCTGTTAGTGCA GGATGA (SEQ ID NO: 18, mIR1331).
[0527] E37. The vector of any one of E26-36, wherein the 5’ flanking region comprises a nucleic acid sequence encoding the sequence of CUGGAGGCUUGCUGAAGGCUGUAUGCU (SEQ ID NO: 19), or CUGGAGGCUUGCUGAAGGCUGUA (SEQ ID NO: 20).
[0528] E38. The vector of E37, wherein:
[0529] the nucleic acid sequence encoding SEQ ID NO: 19, comprises the sequence of ctggaggcttgctgaaggctgtatgct (SEQ ID NO: 21); and
[0530] the nucleic acid sequence encoding SEQ ID NO: 20, comprises the sequence of ctggaggcttgctgaaggctgta (SEQ ID NO: 22).
[0531] E39. The expression cassette of any one of E26-38, wherein the 3’ flanking region comprises a nucleic acid sequence encoding the sequence of CAGGACACAAGGCCUGUUACUAGCACUCACAUGGAACAAAUGGCC (SEQ ID NO: 23).
[0532] E40. The vector of E39. wherein the nucleic acid sequence encoding SEQ ID NO: 23. comprises the sequence of caggacacaaggcctgttactagcactcacatggaacaaatggcc (SEQ ID NO: 24).
[0533] E41. The vector of any one of E26-40, wherein the miRNA encodes the sequences of
[0534]
[0535] CUGGAGGCUUGCUGAAGGCUGUAUGCUGUAAUGCGGCAGUUUCAGUUUGGU UUUGGCCACUGACUGACCAAACUGACUGCCGCAUUACAGGACACAAGGCCUG UUACUAGCACUCACAUGGAACAAAUGGCC (SEQ ID NO: 25):
[0536] CUGGAGGCUUGCUGAAGGCUGUAUGCUGAAAUGCAGUCAACAGUUGCUAGU UUUGGCCACUGACUGACUAGCAACUUGACUGCAUUUCAGGACACAAGGCCU GUUACUAGCACUCACAUGGAACAAAUGGCC (SEQ ID NO: 26); or CUGGAGGCUUGCUGAAGGCUGUAUGCUGUCAUCCUGCACACUAACAGAUGU UUUGGCCACUGACUGACAUCUGUUAGUGCAGGAUGACAGGACACAAGGCCU GUUACUAGCACUCACAUGGAACAAAUGGCC (SEQ ID NO: 27).
[0537] E42. The vector of E41. wherein:
[0538] the nucleic acid sequence encoding SEQ ID NO: 25, comprises the sequence of ctggaggcttgctgaaggctgtatgctgTAATGCGGCAGTTTCAGTTTGGTTTTGGCCACTGACT GACCAAACTGACTGCCGCATTAcaggacacaaggcctgttactagcactcacatggaacaaatggcc (SEQ ID NO: 28);
[0539] tire nucleic acid sequence encoding SEQ ID NO: 26, comprises the sequence of ctggaggcttgctgaaggctgtaTGCTGAAATGCAGTCAACAGTTGCTAGTTTTGGCCACTG ACTGACTAGCAACTTGACTGCATTTcaggacacaaggcctgttactagcactcacatggaacaaatggcc (SEQ ID NO: 29); and
[0540] the nucleic acid sequence encoding SEQ ID NO: l, comprises the sequence of ctggaggcttgctgaaggctgtatgctGTCATCCTGCACACTAACAGATGTTTTGGCCACTGAC TGACATCTGTTAGTGCAGGATGAcaggacacaaggcctgttactagcactcacatggaacaaatggcc (SEQ ID NO: 30).
[0541] E43. The vector of any one of E26-42, wherein the miRNA represses expression of MSH3.
[0542] E44. The vector of E26. wherein tire expression cassette comprises a promoter, and wherein the promoter is operatively linked to the nucleic acid sequence encoding the miRNA.
[0543] E45. The vector of E44, wherein the promoter is a human constitutive promoter, or a cell specific promoter.
[0544] E46. The vector of any one of E44 or 18, wherein the promoter is selected from any one of CB7, CAG, synapsin, CMV, CMVe.mP84, calmodulin, or prion promoter.
[0545]
[0546] E47. The vector of E26, wherein the expression cassette comprises Woodchuck Hepatitis Virus Posttranscriptional Regulatory Elements (WPRE), and wherein the WPRE is operatively linked to the nucleic acid sequence encoding tire miRNA.
[0547] E48. The vector of any one of E26-47, wherein the expression cassette comprises an enhancer, such as a CMV enhancer, and wherein the enhancer is operatively linked to the nucleic acid sequence encoding the miRNA.
[0548] E49. The vector of any one of E26-48, wherein the expression cassette comprises a rabbit P-globin exon, and wherein the rabbit -globin exon is operatively linked to the nucleic acid sequence encoding tire miRNA.
[0549] E50. The vector of any one of E26-49, wherein the expression cassette comprises a polyadenylation A (poly(A)) tail, such as an SV40 poly(A), or a rabbit globin poly(A), and wherein the poly(A) tail is operatively linked to the nucleic acid sequence encoding the miRNA.
[0550] E51. The vector of any one of E26-50, wherein the expression cassette comprises 3’ and 5’ adeno-associated virus (AAV) inverted terminal repeats (ITRs), or variants thereof.
[0551] E52. The vector of any one of E26-51, wherein the expression cassette comprises the nucleic acid sequence of SEQ ID NO: 32; SEQ ID NO: 33; or SEQ ID NO: 34.
[0552] E53. The vector of any one of E26-52, wherein the vector comprises the nucleic acid sequence of SEQ ID NO: 35; SEQ ID NO: 36: or SEQ ID NO: 37.
[0553] E54. A recombinant adeno-associated (rAAV) particle comprising the expression cassette of any one of El-25.
[0554] E55. The rAAV particle of E54, wherein the rAAV particle comprises a capsid protein.
[0555] E56. The rAAV particle of E55, wherein tire capsid protein is capable of crossing the blood-brain barrier.
[0556] E57. The rAAV particle of E55, wherein the capsid protein is selected from AAVhu68, AAV1, AAVrh91, AAV5, AAV8, and any variant thereof.
[0557] E58. An expression cassette comprising a nucleic acid sequence encoding a FAN 1 transgene, wherein the nucleic acid sequence encoding the FAN 1 transgene comprises tire sequence of SEQ ID NO: 38, or SEQ ID NO: 39.
[0558]
[0559] E59. The expression cassette of E58, wherein the nucleic acid sequence encoding the FAN 1 transgene is codon optimized.
[0560] E60. The expression cassette of any one of E58 or 59, wherein tire nucleic acid sequence comprises a promoter, and wherein the promoter is operatively linked to the nucleic acid sequence encoding the FAN 1 transgene.
[0561] E61. The expression cassette of E60, wherein the promoter is a human constitutive promoter, or a cell specific promoter.
[0562] E62. The expression cassette of any one of E60 or 61, wherein the promoter is selected from any one of CB7, CAG, synapsin, CMV, CMVc.mP84, calmodulin, or prion promoter.
[0563] E63. The expression cassette of any one of E58-E63, wherein the nucleic acid sequence comprises a terminator, such as an SV40 poly(A) terminator, and wherein the terminator is operatively linked to the nucleic acid sequence encoding the FAN1 transgene.
[0564] E65. The expression cassette of any one of E58-E64, wherein the expression cassette comprises a polyadenylation A (poly(A)) tail, such as an SV40 poly(A), or a rabbit globin poly(A), and wherein the poly(A) tail is operatively linked to the nucleic acid sequence encoding the FAN 1 transgene.
[0565] E66. The expression cassette of any one of E58-E65, wherein the expression cassette comprises 3 ’ and 5 ' adeno-associated virus (AAV) inverted terminal repeats (ITRs), or variants thereof.
[0566] E67. The expression cassette of any one of E58-66, wherein the expression cassette comprises the nucleic acid sequence of SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, or SEQ ID NO: 49.
[0567] E68. A vector comprising an expression cassette comprising a nucleic acid sequence encoding FAN 1 transgene, wherein the nucleic acid sequence encoding the FAN 1 transgene comprises the sequence of SEQ ID NO: 38. or SEQ ID NO: 39.
[0568] E69. The vector of E68, wherein the vector is a plasmid.
[0569] E70. The vector of E68, wherein the nucleic acid sequence comprises a promoter, and wherein the promoter is operatively linked to the nucleic acid sequence encoding the FAN1 transgene.
[0570]
[0571] 71. The vector of E70, wherein the promoter is a human constitutive promoter, or a cell specific promoter.
[0572] E72. The vector of any one of E70 or 71, wherein the promoter is selected from any one of CB7, CAG, synapsin, CMV. CMVe.mP84, calmodulin, or prion promoter.
[0573] E73. The vector of any one of E68-E72, wherein the nucleic acid sequence comprises a rabbit P-globin exon, and wherein the rabbit P-globin exon is operatively linked to the nucleic acid sequence encoding the FAN 1 transgene.
[0574] E74. The vector of any one of E68-E73, wherein the nucleic acid sequence comprises a terminator, such as an SV40 poly(A) terminator, and wherein the terminator is operatively linked to tire nucleic acid sequence encoding the FAN1 transgene.
[0575] E75. The vector of any one of E68-E74. wherein the expression cassette comprises a poly adenylation A (poly (A)) tail, such as an SV40 poly(A), or a rabbit globin poly (A), and wherein the poly(A) tail is operatively linked to the nucleic acid sequence encoding the FAN 1 transgene.
[0576] E76. The vector of any one of E68-E75, wherein the expression cassette comprises 3’ and 5’ adeno-associated virus (AAV) inverted terminal repeats (ITRs), or variants thereof.
[0577] E77. The vector of any one of E68-76, wherein the expression cassette comprises the nucleic acid sequence of SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42. SEQ ID NO: 43, SEQ ID NO: 44. SEQ ID NO: 45, SEQ ID NO: 46. SEQ ID NO: 47, SEQ ID NO: 48, or SEQ ID NO: 49.
[0578] E78. The vector of any one of E68-E77, wherein the vector comprises the nucleic acid sequence of SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, or SEQ ID NO: 59.
[0579] E79. A recombinant adeno-associated (rAAV) particle comprising the expression cassette of any one of E58-E67.
[0580] E80. The rAAV particle of E79, wherein the rAAV particle comprises a capsid protein.
[0581] E81. The rAAV particle of E80, wherein the capsid protein is capable of crossing the blood-brain barrier.
[0582]
[0583] E82. The rAAV particle of E80, wherein the capsid protein is selected from AAVhu68, AAV1, AAVrh91, AAV5, AAV8, and any variant thereof.
[0584] E83. An expression cassette comprising:
[0585] a nucleic acid sequence encoding a FAN1 transgene; and
[0586] a nucleic acid sequence encoding an miRNA comprising a guide strand and a passenger strand, wherein the guide strand comprises a nucleic acid sequence encoding the sequence of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, and
[0587] wherein the nucleic acid sequence encoding tire guide strand and the passenger strand is operatively linked to a 5’ flanking region and a 3’ flanking region, and wherein the nucleic acid sequence encoding the FAN 1 transgene and tire nucleic acid sequence encoding an miRNA are operatively linked to each other.
[0588] E84. The expression cassette of E83, wherein: the nucleic acid sequence encoding SEQ ID NO: 1 comprises the sequence of SEQ ID NO: 4; the nucleic acid sequence encoding SEQ ID NO: 2 comprises the sequence of SEQ ID NO: 5; and the nucleic acid sequence encoding SEQ ID NO: 3 comprises the sequence of SEQ ID NO: 6.
[0589] E85. The expression cassette of E83, wherein the passenger strand comprises the nucleic acid sequence encoding tire sequence of SEQ ID NO: 7, SEQ ID NO: 8, or SEQ ID NO: 9.
[0590] E86. The expression cassette of E85, wherein:
[0591] the nucleic acid sequence encoding SEQ ID NO: 7 comprises the sequence of SEQ ID NO: 10; the nucleic acid sequence encoding SEQ ID NO: 8 comprises the sequence of SEQ ID NO: 11; and the nucleic acid sequence encoding SEQ ID NO: 9 comprises the sequence of SEQ ID NO: 12.
[0592] E87. The expression cassette of any one of E83-D86, wherein:
[0593] the guide strand comprises tire nucleic acid sequence encoding SEQ ID NO: 1; and tire passenger strand comprises the nucleic acid sequence encoding SEQ ID NO: 7;
[0594] the guide strand comprises the nucleic acid sequence encoding SEQ ID NO: 2; and the passenger strand comprises the nucleic acid sequence encoding SEQ ID NO: 8; or the guide strand comprises the nucleic acid sequence encoding SEQ ID NO: 3: and the passenger strand comprises the nucleic acid sequence encoding SEQ ID NO: 9.
[0595] E88. The expression cassette of any one of E83-E86, wherein:
[0596]
[0597] the guide strand comprises the nucleic acid sequence of SEQ ID NO: 4; and the passenger strand comprises tire nucleic acid sequence of SEQ ID NO: 10;
[0598] the guide strand comprises the nucleic acid sequence of SEQ ID NO: 5; and the passenger strand comprises the nucleic acid sequence of SEQ ID NO: 11; or
[0599] the guide strand comprises the nucleic acid sequence of SEQ ID NO: 6; and the passenger strand comprises the nucleic acid sequence of SEQ ID NO: 12.
[0600] E89. The expression cassette of E83, wherein the nucleic acid sequence encoding tire miRNA comprises a loop nucleic acid sequence that operatively links the guide strand and the passenger strand.
[0601] E90. The expression cassette of E89, wherein the loop sequence comprises the nucleic acid sequence of SEQ ID NO: 31.
[0602] E91. The expression cassette of any one of E83-E90, wherein the guide strand, tire loop sequence, and the passenger strand comprises the nucleic acid sequence encoding tire sequence of SEQ ID NO: 13, SEQ ID NO: 14, or SEQ ID NO: 15.
[0603] E92. The expression cassette of E91, wherein: the nucleic acid sequence encoding SEQ ID NO: 13 comprises the sequence of SEQ ID NO: 16;
[0604] the nucleic acid sequence encoding SEQ ID NO: 14 comprises the sequence of SEQ ID NO: 17; and tire nucleic acid sequence encoding SEQ ID NO: 15 comprises the sequence of SEQ ID NO: 18.
[0605] E93. The expression cassette of any one of E83-E92, wherein the 5’ flanking region comprises a nucleic acid sequence encoding the sequence of SEQ ID NO: 19, or SEQ ID NO: 20.
[0606] E94. The expression cassette of E93, wherein: the nucleic acid sequence encoding SEQ ID NO: 19, comprises the sequence of SEQ ID NO: 21; and the nucleic acid sequence encoding SEQ ID NO: 20, comprises the sequence of SEQ ID NO: 22.
[0607] E95. The expression cassette of any one of E83-E94, wherein the 3’ flanking region comprises a nucleic acid sequence encoding the sequence of SEQ ID NO: 23.
[0608] E96. The expression cassette of E95, wherein the nucleic acid sequence encoding SEQ ID NO: 23, comprises the sequence of SEQ ID NO: 24.
[0609] E97. The expression cassette of any one of E83-ED96, wherein the miRNA encodes the sequences of SEQ ID NO: 25, SEQ ID NO: 26, or SEQ ID NO: 27.
[0610]
[0611] E98. The expression cassette of E97, wherein: the nucleic acid sequence encoding SEQ ID NO: 25, comprises die sequence of SEQ ID NO: 28; the nucleic acid sequence encoding SEQ ID NO: 26, comprises the sequence of SEQ ID NO: 29; and the nucleic acid sequence encoding SEQ ID NO: l, comprises the sequence of SEQ ID NO: 30.
[0612] E99. The expression cassette of any one of E83-98, wherein the miRNA represses expression of MSH3.
[0613] El 00. The expression cassette of E83, wherein the nucleic acid sequence encoding FAN1 transgcnc comprises the sequence of SEQ ID NO: 38, or SEQ ID NO: 39.
[0614] E101. The expression cassette of E 101, wherein the nucleic acid sequence encoding FAN1 transgene is codon optimized.
[0615] El 02. The expression cassette of E83. wherein the nucleic acid sequence encoding a FAN 1 transgene and the nucleic acid sequence encoding an miRNA are operatively linked to each other via a linker sequence of SEQ ID NO: 60.
[0616] E103. The expression cassette of any one of E83-E102, wherein the expression cassette comprises a promoter, and wherein the promoter is operatively linked to the nucleic acid sequence encoding die FAN 1 transgene.
[0617] E104. The expression cassete of E103, wherein the promoter is a human constitutive promoter, or a cell specific promoter.
[0618] El 05. The expression cassete of any one of El 03 or El 04, wherein the promoter is selected from any one of CB7, CAG, synapsin, CMV, CMVe.mP84, calmodulin, or prion promoter.
[0619] E106. The expression cassete of any one of E83-E105, wherein the expression cassete optionally comprises a rabbit -globin exon, and wherein die rabbit -globin exon is operatively linked to the nucleic acid sequence encoding the FAN 1 transgene.
[0620] E107. The expression cassete of any one of E83-E106, wherein the expression cassete comprises a terminator, such as an SV40 poly(A) terminator, and wherein the terminator is operatively linked to the nucleic acid sequence encoding the miRNA.
[0621] E108. The expression cassete of any one of E83-E107, wherein the expression cassete comprises a polyadenylation A (poly(A)) tail, such as an SV40 poly(A), or a rabbit globin poly(A), and wherein the poly(A) tail is operatively linked to the nucleic acid sequence encoding die miRNA.
[0622]
[0623] E109. The expression cassete of any one of E83-E108, wherein tire expression cassete comprises 3’ and 5’ adeno-associated virus (AAV) inverted terminal repeats (ITRs), or variants thereof.
[0624] E110. The expression cassete of any one of E83-E109, wherein the expression cassete comprises the nucleic acid sequence of SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, or SEQ ID NO: 70.
[0625] El 11. A vector comprising an expression cassete comprising: a nucleic acid sequence encoding a FAN 1 transgcnc; and
[0626] a nucleic acid sequence encoding an miRNA comprising a guide strand and a passenger strand, wherein the guide strand comprises a nucleic acid sequence encoding the sequence of SEQ ID NO: 1, SEQ ID NO: 2. or SEQ ID NO: 3, and
[0627] wherein the nucleic acid sequence encoding the guide strand and the passenger strand is operatively linked to a 5’ flanking region and a 3’ flanking region, and wherein the nucleic acid sequence encoding the FAN 1 transgene and tire nucleic acid sequence encoding an miRNA are operatively linked to each other.
[0628] El 12. The vector of El 11, wherein the vector is a plasmid.
[0629] El 13. The vector of El 11, wherein: the nucleic acid sequence encoding SEQ ID NO: 1 comprises the sequence of SEQ ID NO: 4; the nucleic acid sequence encoding SEQ ID NO: 2 comprises the sequence of SEQ ID NO: 5; and the nucleic acid sequence encoding SEQ ID NO: 3 comprises the sequence of SEQ ID NO: 6.
[0630] El 14. The vector of El 11, wherein the passenger strand comprises the nucleic acid sequence encoding the sequence of SEQ ID NO: 7, SEQ ID NO: 8, or SEQ ID NO: 9.
[0631] El 15. The vector of El 14, wherein: tire nucleic acid sequence encoding SEQ ID NO: 7 comprises the sequence of SEQ ID NO: 10; the nucleic acid sequence encoding SEQ ID NO: 8 comprises tire sequence of SEQ ID NO: 11; and the nucleic acid sequence encoding SEQ ID NO: 9 comprises the sequence of SEQ ID NO: 12.
[0632] El 16. The vector of any one ofEll l-E115, wherein:
[0633] the guide strand comprises the nucleic acid sequence encoding SEQ ID NO: 1: and the passenger strand comprises the nucleic acid sequence encoding SEQ ID NO: 7;
[0634] the guide strand comprises the nucleic acid sequence encoding SEQ ID NO: 2; and the passenger strand comprises the nucleic acid sequence encoding SEQ ID NO: 8; or
[0635]
[0636] the guide strand comprises the nucleic acid sequence encoding SEQ ID NO: 3; and the passenger strand comprises the nucleic acid sequence encoding SEQ ID NO: 9.
[0637] El 17. The vector of any one of El 11-E115, wherein:
[0638] the guide strand comprises the nucleic acid sequence of SEQ ID NO: 4; and the passenger strand comprises the nucleic acid sequence of SEQ ID NO: 10;
[0639] the guide strand comprises the nucleic acid sequence of SEQ ID NO: 5; and the passenger strand comprises the nucleic acid sequence of SEQ ID NO: 11; or
[0640] the guide strand comprises the nucleic acid sequence of SEQ ID NO: 6; and the passenger strand comprises the nucleic acid sequence of SEQ ID NO: 12.
[0641] El 18. The vector of El 11, wherein the nucleic acid sequence encoding tire miRNA comprises a loop nucleic acid sequence that operatively links the guide strand and the passenger strand.
[0642] El 19. The vector of El 18, wherein the loop sequence comprises the nucleic acid sequence of SEQ ID NO: 31.
[0643] E120. The vector of any one of E 111 - 119, wherein the guide strand, the loop sequence, and the passenger strand comprises tire nucleic acid sequence encoding the sequence of SEQ ID NO: 13, SEQ ID NO: 14, or SEQ ID NO: 15.
[0644] E121. The vector of E120, wherein: the nucleic acid sequence encoding SEQ ID NO: 13 comprises the sequence of SEQ ID NO: 16; the nucleic acid sequence encoding SEQ ID NO: 14 comprises the sequence of SEQ ID NO: 17; and the nucleic acid sequence encoding SEQ ID NO: 15 comprises the sequence of SEQ ID NO: 18.
[0645] El 22. The vector of any one ofEll l-E121, wherein the 5’ flanking region comprises a nucleic acid sequence encoding the sequence of SEQ ID NO: 19, or SEQ ID NO: 20.
[0646] E123. The vector of E122, wherein: the nucleic acid sequence encoding SEQ ID NO: 19, comprises the sequence of SEQ ID NO: 21; and tlie nucleic acid sequence encoding SEQ ID NO: 20, comprises the sequence of SEQ ID NO: 22.
[0647] E124. The vector of any one of El 11-E123, wherein the 3’ flanking region comprises a nucleic acid sequence encoding the sequence of SEQ ID NO: 23.
[0648] E125. The vector of E124, wherein the nucleic acid sequence encoding SEQ ID NO: 23, comprises the sequence of SEQ ID NO: 24.
[0649]
[0650] E126. The vector of any one of El 11-E125, wherein the miRNA encodes the sequences of SEQ ID NO: 25, SEQ ID NO: 26, or SEQ ID NO: 27.
[0651] E127. The vector of E126, wherein: the nucleic acid sequence encoding SEQ ID NO: 25, comprises the sequence of SEQ ID NO: 28; the nucleic acid sequence encoding SEQ ID NO: 26, comprises the sequence of SEQ ID NO: 29; and the nucleic acid sequence encoding SEQ ID NO: 27, comprises the sequence of SEQ ID NO: 30.
[0652] E128. The vector of any one of El 11-E127, wherein the miRNA represses expression of MSH3.
[0653] E129. The vector of El 11, wherein the nucleic acid sequence encoding FAN 1 transgene comprises tire sequence of SEQ ID NO: 38, or SEQ ID NO: 39.
[0654] E 130. The vector of E 111, wherein the nucleic acid sequence encoding a FAN 1 transgene and tire nucleic acid sequence encoding an miRNA are operatively linked to each other via a linker sequence of SEQ ID NO: 60.
[0655] E131. The vector of any one of El 11-E130, w herein the expression cassette comprises a promoter, and wherein the promoter is operatively linked to the nucleic acid sequence encoding the FAN 1 transgene.
[0656] E132. The vector of E131, wherein the promoter is a human constitutive promoter, or a cell specific promoter.
[0657] E133. The vector of any one of E131 or E132, wherein the promoter is selected from any one of CB7, CAG, synapsin, CMV, CMVe.mP84, calmodulin, or prion promoter.
[0658] E134. The vector of any one of El 11-E133, wherein the expression cassette optionally comprises a rabbit P-globin exon, and wherein the rabbit P-globin exon is operatively linked to the nucleic acid sequence encoding the FAN1 transgene.
[0659] E135. The vector of any one of El 11-E134, wherein the expression cassette comprises a terminator, such as an SV40 poly(A) terminator, and wherein the terminator is operatively linked to the nucleic acid sequence encoding the miRNA.
[0660] E136. The vector of any one of El 11-E135. wherein the expression cassette comprises a polyadenylation A (poly(A)) tail, such as an SV40 poly(A), or a rabbit globin poly(A), and wherein the poly(A) tail is operatively linked to the nucleic acid sequence encoding the miRNA.
[0661]
[0662] E137. The vector of any one of El 11-E136, wherein the expression cassette comprises 3 ’ and 5 ' adeno-associated virus (AAV) inverted terminal repeats (ITRs), or variants thereof.
[0663] El 38. The vector of any one of El 11-E137, wherein the expression cassette comprises the nucleic acid sequence of SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, or SEQ ID NO: 70.
[0664] E139. The vector of any one of El 11-E138, wherein the vector comprises the nucleic acid sequence of SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, or SEQ ID NO: 80.
[0665] E140. A recombinant adeno-associated (rAAV) particle comprising the expression cassette of any one of E83-E110.
[0666] E141. The rAAV particle of E140, wherein the rAAV particle comprises a capsid protein.
[0667] E142. The rAAV particle of E141, wherein the capsid protein is capable of crossing the blood-brain barrier.
[0668] E143. The rAAV particle of E141, wherein the capsid protein is selected from AAVhu68, AAV1, AAVrh91, AAV5, AAV8. and any variant thereof.
[0669] E144. An expression cassette comprising: a) a nucleic acid sequence encoding an miRNA comprising a guide strand and an passenger strand, wherein the guide strand comprises a nucleic acid sequence encoding tire sequence of SEQ ID NO: 1 (comprising the miR902 miRNA), SEQ ID NO: 2, or SEQ ID NO: 3, and wherein the nucleic acid sequence encoding the guide strand and tire passenger strand is operatively linked to a 5’ flanking region and a 3 ’ flanking region; b) a CB7 promoter operatively linked to the nucleic acid sequence encoding the miRNA; c) a Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element (WPRE) operatively linked to the nucleic acid sequence encoding the miRNA; d) a CMV enhancer operatively linked to the nucleic acid sequence encoding the miRNA; e) a rabbit P-globin exon operatively linked to the nucleic acid sequence encoding the miRNA; f) a rabbit globin poly(A) operatively linked to the nucleic acid sequence encoding the miRNA; and
[0670]
[0671] g) 3’ and 5‘ adeno-associated virus (AAV) inverted terminal repeats (ITRs), or variants thereof.
[0672] El 45. The expression cassette of El 44, wherein: the nucleic acid sequence encoding SEQ ID NO: 1 comprises the sequence of SEQ ID NO: 4; the nucleic acid sequence encoding SEQ ID NO: 2 comprises the sequence of SEQ ID NO: 5; and the nucleic acid sequence encoding SEQ ID NO: 3 comprises the sequence of SEQ ID NO: 6.
[0673] E146. The expression cassette of E144, wherein the passenger strand comprises the nucleic acid sequence encoding tire sequence of SEQ ID NO: 7, SEQ ID NO: 8, or SEQ ID NO: 9.
[0674] E147. The expression cassette of E 146, wherein: the nucleic acid sequence encoding SEQ ID NO: 7 comprises the sequence of SEQ ID NO: 10; the nucleic acid sequence encoding SEQ ID NO: 8 comprises the sequence of SEQ ID NO: 11; and the nucleic acid sequence encoding SEQ ID NO: 9 comprises the sequence of SEQ ID NO: 12.
[0675] E148. The expression cassette of any one of E144-E147, wherein: the guide strand comprises the nucleic acid sequence encoding SEQ ID NO: 1; and the passenger strand comprises the nucleic acid sequence encoding SEQ ID NO: 7; the guide strand comprises tire nucleic acid sequence encoding SEQ ID NO: 2; and the passenger strand comprises the nucleic acid sequence encoding SEQ ID NO: 8; or the guide strand comprises the nucleic acid sequence encoding SEQ ID NO: 3; and the passenger strand comprises the nucleic acid sequence encoding SEQ ID NO: 9.
[0676] E149. The expression cassette of any one of E144-E147, wherein: the guide strand comprises the nucleic acid sequence of SEQ ID NO: 4; and the passenger strand comprises the nucleic acid sequence of SEQ ID NO: 10; the guide strand comprises the nucleic acid sequence of SEQ ID NO: 5; and the passenger strand comprises the nucleic acid sequence of SEQ ID NO: 11; or the guide strand comprises the nucleic acid sequence of SEQ ID NO: 6; and the passenger strand comprises the nucleic acid sequence of SEQ ID NO: 12.
[0677] E150. The expression cassette of E144, wherein the nucleic acid sequence encoding the miRNA comprises a loop nucleic acid sequence that operatively links the guide strand and tire passenger strand.
[0678] E151. The expression cassette of E150, wherein the loop sequence comprises the nucleic acid sequence of SEQ ID NO: 31.
[0679]
[0680] El 52. The expression cassete of any one of E144-E151, wherein the guide strand, the loop sequence, and the passenger strand comprises the nucleic acid sequence encoding the sequence of SEQ ID NO: 13, SEQ ID NO: 14, or SEQ ID NO: 15.
[0681] E153. The expression cassete of E152, wherein: the nucleic acid sequence encoding SEQ ID NO: 13 comprises the sequence of SEQ ID NO: 16: the nucleic acid sequence encoding SEQ ID NO: 14 comprises the sequence of SEQ ID NO: 17; and the nucleic acid sequence encoding SEQ ID NO: 15 comprises the sequence of SEQ ID NO: 18.
[0682] E154. The expression cassette of any one of E144-E153, wherein the 5’ flanking region comprises a nucleic acid sequence encoding the sequence of SEQ ID NO: 19, or SEQ ID NO: 20.
[0683] El 55. The expression cassette of El 54, wherein: the nucleic acid sequence encoding SEQ ID NO: 19, comprises the sequence of SEQ ID NO: 21; and the nucleic acid sequence encoding SEQ ID NO: 20, comprises the sequence of SEQ ID NO: 22.
[0684] E156. The expression cassette of any one of E144-E155, wherein the 3’ flanking region comprises a nucleic acid sequence encoding the sequence of SEQ ID NO: 23.
[0685] E157. The expression cassette of E156, wherein the nucleic acid sequence encoding SEQ ID NO: 23, comprises the sequence of SEQ ID NO: 24.
[0686] E158. The expression cassete of any one of E144-E157, wherein the miRNA encodes the sequences of SEQ ID NO: 25, SEQ ID NO: 26, or SEQ ID NO: 27.
[0687] E159. The expression cassette of E158, wherein: the nucleic acid sequence encoding SEQ ID NO: 25, comprises the sequence of SEQ ID NO: 28; the nucleic acid sequence encoding SEQ ID NO: 26, comprises the sequence of SEQ ID NO: 29; and Etlre nucleic acid sequence encoding SEQ ID NO: 27, comprises the sequence of SEQ ID NO: 30.
[0688] E160. The expression cassete of any one of E144-E159, wherein the miRNA represses expression o MSH3.
[0689] E 161. The expression cassete of any one of E144-E160, wherein the expression cassete comprises the nucleic acid sequence of SEQ ID NO: 32; SEQ ID NO: 33; or SEQ ID NO: 34.
[0690] El 62. A vector comprising an expression cassette comprising: a) a nucleic acid sequence encoding an miRNA comprising a guide strand and an passenger strand, wherein
[0691]
[0692] the guide strand comprises a nucleic acid sequence encoding the sequence of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, and wherein tire nucleic acid sequence encoding the guide strand and tire passenger strand is operatively linked to a 5’ flanking region and a 3' flanking region; b) a CB7 promoter operatively linked to the nucleic acid sequence encoding the miRNA; c) a Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element (WPRE) operatively linked to the nucleic acid sequence encoding the miRNA; d) a CMV enhancer operatively linked to the nucleic acid sequence encoding the miRNA; e) a rabbit P-globin exon operatively linked to tire nucleic acid sequence encoding the miRNA; f) a rabbit globin poly(A) operatively linked to the nucleic acid sequence encoding the miRNA; and g) 3’ and 5’ adeno-associated virus (AAV) inverted terminal repeats (ITRs), or variants thereof.
[0693] E163. The expression cassette of E162, wherein: the nucleic acid sequence encoding SEQ ID NO: 1 comprises the sequence of SEQ ID NO: 4; the nucleic acid sequence encoding SEQ ID NO: 2 comprises the sequence of SEQ ID NO: 5; and the nucleic acid sequence encoding SEQ ID NO: 3 comprises the sequence of SEQ ID NO: 6.
[0694] E164. The vector of E162, wherein the passenger strand comprises the nucleic acid sequence encoding the sequence of SEQ ID NO: 7, SEQ ID NO: 8, or SEQ ID NO: 9.
[0695] El 65. The vector of El 64, wherein: the nucleic acid sequence encoding SEQ ID NO: 7 comprises the sequence of SEQ ID NO: 10; tire nucleic acid sequence encoding SEQ ID NO: 8 comprises the sequence of SEQ ID NO: 11; and the nucleic acid sequence encoding SEQ ID NO: 9 comprises the sequence of SEQ ID NO: 12.
[0696] E166. The vector of any one of E162-165, wherein: the guide strand comprises the nucleic acid sequence encoding SEQ ID NO: 1; and the passenger strand comprises the nucleic acid sequence encoding SEQ ID NO: 7; the guide strand comprises the nucleic acid sequence encoding SEQ ID NO: 2; and the passenger strand comprises tire nucleic acid sequence encoding SEQ ID NO: 8; or the guide strand comprises the nucleic acid sequence encoding SEQ ID NO: 3: and the passenger strand comprises the nucleic acid sequence encoding SEQ ID NO: 9.
[0697] E167. The vector of any one of E162-165, wherein: the guide strand comprises the nucleic acid sequence of SEQ ID NO: 4; and the passenger strand comprises the nucleic acid sequence of SEQ ID NO: 10; the guide strand comprises the nucleic acid sequence of SEQ ID NO: 5; and the passenger strand comprises the nucleic acid sequence of SEQ ID
[0698]
[0699] NO: 11; or the guide strand comprises the nucleic acid sequence of SEQ ID NO: 6; and the passenger strand comprises tire nucleic acid sequence of SEQ ID NO: 12.
[0700] El 68. The vector of El 62, wherein the nucleic acid sequence encoding the miRNA comprises a loop nucleic acid sequence that operatively links the guide strand and the passenger strand.
[0701] El 69. The vector of El 68, wherein the loop sequence comprises the nucleic acid sequence of SEQ ID NO: 31.
[0702] E170. The vector of any one of E162-E169, wherein the guide strand, the loop sequence, and the passenger strand comprises the nucleic acid sequence encoding the sequence of SEQ ID NO: 13, SEQ ID NO: 14, or SEQ ID NO: 15.
[0703] El 71. The vector of El 70, wherein: the nucleic acid sequence encoding SEQ ID NO: 13 comprises the sequence of SEQ ID NO: 16: the nucleic acid sequence encoding SEQ ID NO: 14 comprises the sequence of SEQ ID NO: 17; and the nucleic acid sequence encoding SEQ ID NO: 15 comprises the sequence of SEQ ID NO: 18.
[0704] E172. The vector of any one of E162-E171, wherein the 5’ flanking region comprises a nucleic acid sequence encoding tire sequence of SEQ ID NO: 19, or SEQ ID NO: 20.
[0705] E173. The vector of E172, wherein: the nucleic acid sequence encoding SEQ ID NO: 19, comprises the sequence of SEQ ID NO: 21; and tire nucleic acid sequence encoding SEQ ID NO: 20, comprises the sequence of SEQ ID NO: 22.
[0706] E174. The vector of any one of E162-E173, wherein the 3’ flanking region comprises a nucleic acid sequence encoding the sequence of SEQ ID NO: 23.
[0707] E175. The vector of E174, wherein the nucleic acid sequence encoding SEQ ID NO: 23, comprises the sequence of SEQ ID NO: 24.
[0708] E176. The vector of any one of E162-E175, wherein the miRNA encodes the sequences of SEQ ID NO: 25, SEQ ID NO: 26, or SEQ ID NO: 27.
[0709] E177. The vector of E176, wherein: the nucleic acid sequence encoding SEQ ID NO: 25, comprises the sequence of SEQ ID NO: 28; the nucleic acid sequence encoding SEQ ID NO: 26, comprises the sequence of SEQ ID NO: 29; and the nucleic acid sequence encoding SEQ ID NO: 27, comprises the sequence of SEQ ID NO: 30.
[0710] E178. The vector of any one of E162-E177, wherein the miRNA represses expression oiMSH3.
[0711]
[0712] El 79. The vector of any one of E162-E178, wherein the expression cassette comprises the nucleic acid sequence of SEQ ID NO: 32; SEQ ID NO: 33; or SEQ ID NO: 34.
[0713] E180. The vector of any one of E162-E179, wherein the vector comprises the nucleic acid sequence of SEQ ID NO: 35; SEQ ID NO: 36; or SEQ ID NO: 37.
[0714] E 181. A recombinant adeno-associated (rAAV) particle comprising the expression cassette of any one of E144-E161.
[0715] El 82. The rAAV particle of El 81, wherein the rAAV particle comprises a capsid protein.
[0716] El 83. The rAAV particle of El 82, wherein the capsid protein is capable of crossing the blood-brain barrier.
[0717] El 84. The rAAV particle of El 82, wherein the capsid protein is selected from AAVhu68, AAV1, AAVrh91, AAV5, AAV8, and any variant thereof.
[0718] E185. A pharmaceutical composition comprising the vector of any one of E26-E53, E68-E78, El 11-E139, or E162-E180, or the rAAV particle of any one of E54-E57, E79-E82, E140-E143, or E181-E184, a pharmaceutically acceptable carrier, and optionally a delivery vehicle.
[0719] E186. The pharmaceutical composition of E185, wherein the delivery vehicle comprises a liposome or a lipid nanoparticle (LNP).
[0720] E 187. The pharmaceutical composition of any one of E 185 or E 186, wherein the delivery vehicle is a lipid nanoparticle comprising: a) one or more ionizable lipids; b) one or more structural lipids; c) one or more PEGylated lipids; and d) one or more phospholipids.
[0721] E188. A cell comprising the expression cassette of any one of E1-E25, E58-E67, E83-E110, or E144-E161, the vector of any one of E26-E53, E68-E78, Ell 1-E139, or E162-E180, or the rAAV particle of any one of E54-E57, E79-E82, E140-E143. or E181-E184.
[0722] El 89. The cell of El 88, wherein the cell is a mammalian cell, such as a human cell. El 90. The cell of El 88 or El 89, wherein the is cell is in a subject.
[0723] E191. A method of treating, preventing or delaying the onset of a repeat expansion disease in a subject in need thereof, wherein the method comprises administering to the
[0724]
[0725] subject the vector of any one of E26-E53, E68-E78, Ell 1-E139, or E162-E180, or the rAAV particle of any one of E54-E57, E79-E82, E140-E143, orE181-E184.
[0726] E192. The method of E191, wherein the repeat expansion disease is selected from Huntington's disease. Fragile X Syndrome, myotonic dystrophy (DM1 and DM2), amyotrophic lateral sclerosis and / or frontotemporal dementia caused by somatic expansion in the C90RF72 gene, spinocerebellar ataxias (SCAs 1, 2, 3, 6, 7 and 17), Friedreich's ataxia (FRDA), Fragile X Tremor Ataxia Syndrome (FXS / FXTAS), dentatorubral-pallidoluysian atrophy (DRPLA), spinal and bulbar muscular atrophy (SBMA), and Unvcrricht-Lundborg myoclonic epilepsy (EPM1).
[0727] El 93. The method of El 92, wherein the repeat expansion disease is Huntington's Disease.
[0728] El 94. A method of treating, preventing or delaying the onset of Huntington's Disease in a subject in need thereof, wherein the method comprises administering to the subject the vector of any one of E26-E53, E68-E78, Ell 1-E139, or E162-E180, or the rAAV particle of any one of E54-E57, E79-E82, E140-E143, or E181-E184.
[0729] A “replication-defective virus” or “viral vector” refers to a synthetic or artificial viral particle in which an expression cassette containing a gene of interest is packaged in a viral capsid or envelope, where any viral genomic sequences also packaged within the viral capsid or envelope are replication-deficient; i.e., they cannot generate progeny virions but retain the ability to infect target cells. In one embodiment, the genome of the viral vector does not include genes encoding the enzymes required to replicate (the genome can be engineered to be “gutless” - containing only tire transgene of interest flanked by the signals required for amplification and packaging of tire artificial genome), but these genes may be supplied during production. Therefore, it is deemed safe for use in gene therapy since replication and infection by progeny virions cannot occur except in the presence of the viral enzyme required for replication.
[0730] As used herein, microRNAs (or miRNA or miR) comprise 19-25 nucleotide noncoding RNAs that bind to the sites of nucleic acid targets and down-regulate gene expression either by reducing nucleic acid molecule stability or by inhibiting translation. rniRNAs are at least partially complementary’ to one or more mRNA to downregulate gene expression by inducing translational repression, mRNA cleavage or deadenylation. In some
[0731]
[0732] embodiments, a microRNA sequence comprises a seed region, e.g., a sequence in the region of positions 2-8 of tire mature microRNA, which has Watson-Crick sequence fully or partially complementarity to the miRNA target sequence of the nucleic acid.
[0733] As used herein, the terms “rAAV” and “artificial AAV” used interchangeably, mean, without limitation, a AAV comprising a capsid protein and a vector genome packaged therein, wherein the vector genome comprising a nucleic acid heterologous to the AAV. In one embodiment, the capsid protein is a non-naturally occurring capsid. Such an artificial capsid may be generated by any suitable technique, using a selected AAV sequence (e.g., a fragment of a vpl capsid protein) in combination with heterologous sequences which may be obtained from a different selected AAV, non-contiguous portions of the same AAV, from a non-AAV viral source, or from a non-viral source. An artificial AAV may be, without limitation, a pseudotyped AAV, a chimeric AAV capsid, a recombinant AAV capsid, or a ‘'humanized” AAV capsid. Pseudotyped vectors, wherein the capsid of one AAV is replaced with a heterologous capsid protein, are useful in the invention. In one embodiment, AAV2 / 5 and AAV2 / 8 are exemplary pseudotyped vectors. The selected genetic element may be delivered by any suitable method, including transfection, electroporation, liposome delivery, membrane fusion techniques, high velocity DNA-coated pellets, viral infection and protoplast fusion. The methods used to make such constructs are known to those with skill in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, e.g., Green and Sambrook, Molecular Cloning: A Laboratory' Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY (2012).
[0734] The term “nuclease-resistant” indicates that the AAV capsid has assembled around the expression cassette which is designed to deliver a transgcnc to a host cell and protects these packaged genomic sequences from degradation (digestion) during nuclease incubation steps designed to remove contaminating nucleic acids which may be present from the production process.
[0735] In many instances, rAAV particles are referred to as DNase resistant. However, in addition to this endonuclease (DNase), other endo- and exo- nucleases may also be used in the purification steps described herein, to remove contaminating nucleic acids. Such nucleases may be selected to degrade single stranded DNA and / or double-stranded DNA,
[0736]
[0737] and RNA. Such steps may contain a single nuclease, or mixtures of nucleases directed to different targets, and may be endonucleases or exonucleases.
[0738] As used herein, the term “host cell’' may refer to the packaging cell line in which the rAAV is produced from the plasmid. In the alternative, the term “host cell” may refer to the target cell in which expression of the transgene is desired.
[0739] As used herein, a “variant capsid” or a “variant AAV” or “variant AAV capsid” refers to a modified capsid, engineered capsid or a mutated capsid, wherein the capsid protein comprises an insertion of a tissue-specific targeting peptide, wherein modified insert is not a naturally occurring mutant.
[0740] The term “expression” is used herein in its broadest meaning and comprises the production of RNA or of RNA and protein. Expression may be transient or may be stable.
[0741] The term “substantial homology” or “substantial similarity." when referring to a nucleic acid, or fragment thereof, indicates that, when optimally aligned with appropriate nucleotide insertions or deletions with another nucleic acid (or its complementary strand), there is nucleotide sequence identity in at least about 95 to 99% of the aligned sequences. Preferably, the homology is over full-length sequence, or an open reading frame thereof, or another suitable fragment which is at least 15 nucleotides in length. Examples of suitable fragments are described herein.
[0742] The term “heterologous” as used to describe a nucleic acid sequence or protein means that the nucleic acid or protein was derived from a different organism or a different species of the same organism than the host cell or subject in which it is expressed. The term "heterologous" when used with reference to a protein or a nucleic acid in a plasmid, expression cassette, or vector, indicates that tire protein or the nucleic acid is present with another sequence or subsequence which with which the protein or nucleic acid in question is not found in the same relationship to each other in nature.
[0743] The term “exogenous” as used to describe a nucleic acid sequence or protein means that the nucleic acid or protein does not naturally occur in the position in which it exists in a chromosome, or host cell. An exogenous nucleic acid sequence also refers to a sequence derived from and inserted into the same host cell or subject, but which is present in a nonnatural state, e.g., a different copy number, or under tire control of different regulatory elements.
[0744]
[0745] As described above, the terms “increase” “decrease” “reduce” “ameliorate” “improve” “delay” or any grammatical variation thereof, or any similar terms indication a change, means a variation of about 5 fold, about 2 fold, about 1 fold, about 90%, about 80%, about 70%, about 60%, about 50%, about 40%, about 30%, about 20%, about 10%, about 5 % compared to the corresponding reference (e.g., inhibition of MSH3 expression in a subject relative to a healthy human subject and / or overexpression of hFANl as compared to expression levels in a healthy human subject).
[0746] The rAAV and compositions provided herein are useful in a systemic gene therapy approach (e.g., intravcnous / IV administration). The resulting vector is formulated for deliver}’ to a human subject for treatment of one or more symptoms associated with Huntingdon’s Disease including, e.g.. movement symptoms such as involuntary jerking or fidgeting of the limbs and body; difficulty walking, standing, or sitting up; muscle stiffness or rigidity; difficulty swallowing or eating; loss of balance and posture; cognitive symptoms such as difficult ' concentrating, learning new things, or making decisions; memory lapses; forgetting facts; trouble driving; difficulty prioritizing or organizing; or mood and behavioral symptoms, including, Depression, irritability. or mood swings;
[0747] Personality changes; Hallucinations, paranoia, or psychosis; angry outbursts or thoughts of suicide; social withdrawal; difficulty speaking clearly, breathing problems, weight loss, loss of bowel and bladder control.
[0748] As used herein, the term “administration” or any grammatical variations thereof refers to delivery of composition described herein to a subject.
[0749] The term “percent (%) identity”, “sequence identity”, “percent sequence identity”, or “percent identical” in the context of nucleic acid sequences refers to the residues in the two sequences which arc the same when aligned for correspondence. The length of sequence identity comparison may be over the full-length of the genome, the full-length of a gene coding sequence, or a fragment of at least about 500 to 5000 nucleotides, is desired. However, identity among smaller fragments, e.g.. of at least about nine nucleotides, usually at least about 20 to 24 nucleotides, at least about 28 to 32 nucleotides, at least about 36 or more nucleotides, may also be desired.
[0750] Percent identity may be readily determined for amino acid sequences over the full-length of a protein, polypeptide, about 32 amino acids, about 330 amino acids, or a peptide fragment thereof or tire corresponding nucleic acid sequence coding sequences. A suitable
[0751]
[0752] amino acid fragment may be at least about 7 amino acids in length, and may be up to about 700 amino acids.
[0753] Examples of suitable fragments are described herein. By the term ‘‘highly conserved” is meant at least 80% identity, preferably at least 90% identity, and more preferably, over 97% identity. Identity is readily determined by one of skill in the art by resort to algorithms and computer programs known by those of skill in the art.
[0754] Generally, when referring to “identity’ ’, “homology”, or “similarity” between two different sequences, “identity”, “homology” or “similarity” is determined in reference to “aligned” sequences. “Aligned” sequences or “alignments” refer to multiple nucleic acid sequences or protein (amino acids) sequences, often containing corrections for missing or additional bases or amino acids as compared to a reference sequence.
[0755] Identity may be determined by preparing an alignment of the sequences and through the use of a variety of algorithms and / or computer programs known in the art or commercially available (e.g., BLAST, ExPASy; Clustal Omega; FASTA; using, e.g., Needleman-Wunsch algorithm, Smith-Waterman algorithm). Alignments are performed using any of a variety of publicly or commercially available Multiple Sequence Alignment Programs. Multiple sequence alignment programs are available for nucleic acid sequences. Examples of such programs include, “Clustal Omega”, “Clustal W”, “MUSCLE”, “CAP Sequence Assembly”, “BLAST”, “MAP”, and “MEME”, which are accessible through Web Servers on tire internet. Other sources for such programs are known to those of skill in the art. Alternatively, Vector NTI utilities are also used. There are also a number of algorithms known in the art that can be used to measure nucleotide sequence identity, including those contained in the programs described above. As another example, polynucleotide sequences can be compared using Fasta™, a program in GCG Version 10.1. Fasta™ provides alignments and percent sequence identity of the regions of the best overlap between the query and search sequences. For instance, percent sequence identity between nucleic acid sequences can be determined using Fasta™ with its default parameters (a word size of 6 and the NOPAM factor for the scoring matrix) as provided in GCG Version 10.1, herein incorporated by reference. Sequence alignment programs are also available for amino acid sequences, e.g., the “Clustal Omega”, “Clustal X”, “MUSCLE”, “MAP”, “PIMA”, “MSA”, “BLOCKMAKER”, “MEME”, and “Match-Box” programs. Generally, any of these programs are used at default settings, although one of
[0756]
[0757] skill in the art can alter these settings as needed. Alternatively, one of skill in the art can utilize another algorithm or computer program which provides at least the level of identity or alignment as that provided by the referenced algorithms and programs. See, e.g., J. D. Thomson et al, Nucl. Acids. Res.. “A comprehensive comparison of multiple sequence alignments’; 27(13): 2682-2690 (1999).
[0758] As used herein, the term “administration” or any grammatical variations thereof refers to delivery of composition described herein to a subject.
[0759] “Patient” or “subject” as used herein means a male or female human, and animal models (including, e.g., dogs, non-human primates, rodents, or other suitable models) used for clinical research. In one embodiment, the subject of these methods and compositions is a human diagnosed with HD or another repeat expansion disorder. In certain embodiments, the human subject of these methods and compositions is a prenatal, a newborn, an infant, a toddler, a preschool, a grade-schooler, a teen, a young adult or an adult. In a further embodiment, the subject of these methods and compositions is a pediatric patient.
[0760] As used herein the term “HD-related symptoms” refers to symptom(s) found in HD patients. Such symptoms may include one or more of associated with Huntingdon’s Disease including, e.g., movement symptoms such as involuntary jerking or fidgeting of the limbs and body; difficulty walking, standing, or sitting up; muscle stiffness or rigidity; difficulty swallowing or eating; loss of balance and posture; cognitive symptoms such as difficulty concentrating, learning new things, or making decisions; memory lapses; forgetting facts; trouble driving; difficulty prioritizing or organizing; or mood and behavioral symptoms, including, Depression, irritability, or mood swings; Personality changes; Hallucinations, paranoia, or psychosis; angry outbursts or thoughts of suicide; social withdrawal; difficulty speaking clearly, breathing problems, weight loss, loss of bowel and bladder control.
[0761] As used throughout this specification and the claims, the terms “comprise” and “contain” and its variants including, “comprises”, “comprising”, “contains” and “containing”, among other variants, is inclusive of other components, elements, integers, steps and the like. The term “consists of’ or “consisting of’ are exclusive of other components, elements, integers, steps and the like.
[0762]
[0763] It is to be noted that the term “a” or “an"’, refers to one or more, for example, “an enhancer'’, is understood to represent one or more enhancer(s). As such, tire terms “a” (or “an”), “one or more,” and “at least one” is used interchangeably herein.
[0764] As used herein, the term "about" or
[0765]
[0766] refers to a variant of ±10% from the reference integer and values therebetween, unless otherwise specified. For example, “about” 500 pM includes ±50 (i.e., 450 - 550, which includes the integers therebetween). For other values, particularly when reference is to a percentage (e.g., 90% of taste), the term “about” is inclusive of all values within the range including both the integer and fractions.
[0767] As described above, the term “about” when used to modify a numerical value means a variation of ±10%, (±10%, e.g., ±1, ±2, ±3. ±4. ±5, ±6, ±7, ±8, ±9, ±10, or values therebetween) from the reference given, unless otherwise specified.
[0768] In certain instances, the term “E±#” or the term “e±#” is used to reference an exponent. For example, “5E10” or “5el0” is 5 x 1010. These terms may be used interchangeably.
[0769] As used throughout this specification and the claims, the recitations of numerical ranges by endpoints include all numbers subsumed within that range (e.g., 1 to 5 includes 1, 1.5, 2, 2.75, 3, 3.80, 4, 5, etc.). Herein, “up to” a number (for example, up to 50) includes the number (for example. 50). The term “in the range” or “within a range” (and similar statements) includes the endpoints of the stated range.
[0770] With regard to the description of various embodiments herein, it is intended that each of the compositions herein described, is useful, in another embodiment, in the methods of the invention. In addition, it is also intended that each of the compositions herein described as useful in the methods, is, in another embodiment, itself an embodiment of the invention.
[0771] Unless defined otherwise in this specification, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs and by reference to published texts, which provide one skilled in the art with a general guide to many of the terms used in the present application.
[0772] EXAMPLES
[0773]
[0774] The following examples are provided to illustrate certain aspects of the claimed invention. The invention is not limited to these examples.
[0775] Example 1. Production of rAAV.
[0776] In the studies herein, an engineered human FAN 1 (hFAN 1 or hFanl) sequence and rAAV comprising hFanl, mFanl, the artificial miR: miR902, miR1331, miR2482, and / or combination of hFanl and miR, or mFanl and miR were generated and comparative studies were performed.
[0777] The rAAV are generated in HEK293 cells in culture using triple transfection techniques, utilizing (1) a trans plasmid encoding AAV2 rep proteins and the AAVhu68 VP1 cap gene (e.g.. SEQ ID NO: 142, SEQ ID NO: 144) (or alternatively AAV1, AAV5, AAV8, AAVrh91, AAVhu95, AAV9, or mutant AAV9 cap gene), (2) a trans plasmid comprising adenovirus helper genes not provided by the packaging cell line which expresses adenovirus El a, and (3) a cis plasmid containing the vector genome for packaging in the AAV capsid. See, e.g., US 2020 / 0056159, WO 2022 / 082109, WO 2023 / 056399, WO 2022 / 036220. The cis plasmid is designed to contain either the vector genome comprising engineered hFanl, mFanl, miR902, miR1331, miR2482, and / or combination of hFanl and miR (miR902, miR1331. miR2482), or mFanl and miR (miR902. miR1331, miR2482). These cis plasmids with the vector genomes (5’ AAV2 ITR - expression cassette - a 3’ AAV2 ITR) were used in the triple transfection. The vector genomes / expression cassettes used to generate the rAAV are provided in SEQ ID NOs: 81-103.
[0778]
[0779]
[0780]
[0781] The vector genome contains an AAV 5 ’ inverted terminal repeat (ITR) and an AAV 3’ ITR at the extreme 5’ and 3’ end, respectively. The ITRs flank the sequences of the expression cassette packaged into the AAV capsid which comprise a sequence encoding a hFanl (artificial SEQ ID NO: 104 encoding SEQ ID NO: 105), mFanl (artificial SEQ ID NO: 106 encoding SEQ ID NO: 107), miR902, miR1331, miR2482, and / or combination of hFanl and miR (miR902, miR1331, miR2482, e.g., SEQ ID NOs: 108-116), or mFanl and miR (miR902, miR1331, miR2482 e.g., SEQ ID NOs: 108-116). The expression cassette further comprises regulatory sequences operably linked to the fusion protein coding sequences, including a promoter (CAG (SEQ ID NO: 122), CB7 (SEQ ID NO: 117), human Synapsin (hSyn) (SEQ ID NO: 125), CMV-E.pP-84 (SEQ ID
[0782]
[0783] NO: 126), CALM1 (SEQ ID NO: 129), Prion 148 (SEQ ID NO: 130)), optionally an intron (e.g., chimeric intron comprising chicken beta actin intron (SEQ ID NO: 123) and rabbit beta globin exon (SEQ ID NO: 121)), SV40 poly A (SEQ ID NO: 132. and SV40 poly A terminator (EQ ID NO: 132).
[0784] Example 2. In vitro and in vivo construct screening
[0785] In these studies, we examined strategies of MSH3 knockdown with miRNA. FAN1 overexpression, and dual MSH3 knockdown with miRNA with FAN 1 expression.
[0786] FIG. 1 shows results (plotted as fold change in MSH3 mRNA and fold change in MSH3 protein levels) of an in vitro screen of miRNAs targeting mouse MSH3 in mouse N2a cells. N2a cells are a fast growing neuroblastoma cell line having a neuronal and ameboid stem cell morphology, allowing it to differentiate. The differentiated cells have many properties of neurons, including neurofilaments. These cells may be obtained from the American Type Culture Collection.
[0787] Briefly in these studies, in vitro versions of the 3 miRNAs (i.e., in plasmids containing eGFP for transduction efficiency and blasticidin resistance for selection, obtained from Invitrogen) were used. Plasmids were transfected into HEK293 cells in 6-well plates using Minis LT1. After 24 hours the cells were re-plated in 10-cm plates for expansion and selection with blasticidin. After about 72 hours HEK293 cells were harvested and lysed with RIPA buffer for western blotting analysis. Western blot was probed with antibodies against MSH3 and a loading control b-actin. Western Blot was quantified using Bio-rad ImageLab software.
[0788] FIG. 22 shows MSH3 protein expression, plotted as percent MSH3 expression, as measured in striatum via Western blot.
[0789] We observed that mouse MSH3 miR902 cross-reacts with human MSH3 in HEK293 cells, and that human miR1331 and 2482 knock down was at an equivalent amount of MSH3 in vitro.
[0790] Further, in these studies we examined MSH3 / FAN 1 mRNA levels via RT-qPCR. Briefly, striatum tissue was homogenized with TRIzol reagent and RNA was extracted. DNA was removed using TURBO Dnasel. RNA was reverse transcribed to cDNA with random hexamer primers using ThermoFisher High-capacity RT kit. Next, qPCR was performed with TaqMan primers specific to MSH3 or hFAN 1 or mFanl and a
[0791]
[0792] housekeeping control transcript (mGapdh). qPCR used NEB Luna MasterMix for TaqMan and samples were run on a thermal cycler.
[0793] Further, in these studies we examined MSH3 miRNA levels via stem-loop RT-qPCR. Briefly, striatum tissue was homogenized with TRIzol reagent and RNA was extracted. DNA was removed using TURBO Dnasel. RNA was reverse transcribed with stem-loop primers using ThermoFisher High-capacity RT kit. Next, qPCR was performed with TaqMan primers specific to MSH3 miRNA or to a housekeeping control transcript (U6 snRNA). qPCR used NEB Luna MasterMix for TaqMan and samples were run on a thermal cycler.
[0794] Further, in these studies we examined MSH3 / FAN 1 / HTTExonla protein levels via western blot. Tissue from striatum was homogenized and protein extracted with RIPA buffer. Samples were mixed with loading buffer and loaded and run on pre-cast gels. Gels were blotted onto western blot membranes. Membranes were probed with antibodies against MSH3 / FANl / HTTExonla and a loading control (b-actin). Blot was quantified using Bio-rad ImageLab software.
[0795] Further, in these studies we examined somatic instability in striatum or liver. DNA was extracted from tissues using the Qiagen DNeasy Blood and Tissue Kit. DNA was amplified by PCR using fluorescently-labeled primers flanking the CAG repeat. PCR fragments are then separated by size using capillary electrophoresis. CAG size determinations can be made with peak analysis software.
[0796] FIG. 2 shows results (plotted as relative expression of mouse MSH3 mRNA) of an in vitro screen of miRNAs targeting mouse MSH3 in human HEK293 cells. These results show float miRNA902 cross-react with human MSH3.
[0797] FIG. 3 shows results (plotted as fold change in MSH3 mRNA and fold change in MSH3 protein levels) of an in vitro screen of miRNAs targeting human MSH3 in mouse N2a cells. These results show possible cross-reactivity’, but sequence mismatch leads to translational repression rather than degradation.
[0798] FIG. 4A shows confirmation of cross-reactivity of mouse miRNA (miR902 or human miR1331) on human MSH3 protein in HEK293 cells, plotted as relative levels of MSH3 protein. FIG. 4B shows confirmation of knockdown by human miRNA (miR2482) on human MSH3 protein, plotted as relative levels of MSH3 protein.
[0799]
[0800] FIG. 5 shows western blot confirming mouse and human FAN 1 expression in mouse N2a cells following 48 hours after plasmid (pAAV.CAG.CI.hFANlco.SV40 (comprising engineered human FAN 1 coding sequence) and pAAV.CAG.CI.msFANlnat.SV40 (comprising mouse FAN1 native coding sequence) transfection in N2a cells.
[0801] In vivo screen of FAN1 expression and MSH3 knockdown with miRNAs was performed in C57B1 / 6 male mice (8-week old, n=5) using AAV9-PHP.eB.CB7.CI.miR.NT.WPRE.rBG, AAV9-PHP.cB.CB7.CI.mMSH3.miR902.WPRE.rBG, AAV9-PHP.eB.CB7.CI.hMSH3.miR1331.WPRE.rBG, AAV9-PHP.eB.CB7.CI.mMSH3.miR2482.WPRE.rBG, AAV9-PHP.eB.CAG.CI.hFANlco.SV40 administered intravenously (i.e., IV-tail vein injection) at a dose of 3x10" GC in lOOpL. wherein necropsy was performed on day 14 following injection.
[0802] FIG. 6A shows expression of MSH3 mRNA in mouse cortex as measured by RT-qPCR, following administration with AAV9-PHP.eB.CB7.CI.mMSH3.miR902.WPRE.rBG. FIG. 6B shows expression of MSH3 mRNA in mouse cortex as measured by RT-qPCR, following administration with AAV9-PHP.eB.CB7.CI.hMSH3.miR1331.WPRE.rBG. FIG. 6C shows expression of MSH3 mRNA in mouse cortex as measured by RT-qPCR, following administration with AAV9-PHP.eB.CB7.CI.mMSH3.miR2482.WPRE.rBG. These results show that miR 902 and miR 2482 injected animals have reduced MSH3 mRNA and that human miR2482 has crossreactivity' with mouse MSH3.
[0803] MSH3 protein knockdow n w as also confirmed in mouse cortex via western blot analysis. FIG. 7A shows a w estern blot analysis confirming MSH3 protein knockdown. FIG. 7B show s quantified relative expression of MSH3 protein (from western blot of FIG.
[0804] 7A). These results confirm that miRNA902 appears to have reduced MSH3 protein expression in vivo, and while miR NT (non-targeting miRNA, ThermoFisher Invitrogen Block-iT negative control) appeared to have effect. See also, BLOCK-iT™ Pol II miR RNAi Expression Vector Kits, User Manual, assets.thermofisher.com / TFS-Assets / LSG / manuals / blockit miRNAexpressionvector man.pdf
[0805]
[0806] FIG. 7C shows miRNA assay results as performed with stem-loop qPCR, plotted as fold change, of MSH3 miRNA expression in mouse cortex. These results show' that mature miRNA 902 expression w as detected.
[0807] We examined mouse FAN1 expression in vivo in brain in wild-type 9- 11 -weeks old mice (n=5) administered with PBS or AAV-PHP.eB.CAG.Cl.mFANl.SV40 intravenously at a dose of 3x10’1GC, w herein necropsy w as performed on day 14 following administration. FIG. 8A show s western blot analysis confirming FAN 1 expression. FIG. 8B show's quantification of mouse FAN 1 expression in vivo in mice, plotted as fold change in mFanl protein levels.
[0808] We examined MSH3 mRNA and FAN 1 expression in liver in 9- 11 -weeks old mice administered with PBS. AAVhu68.CB7.CI.mMSH3.miR902.WPRE.rBG. or AAVhu68.CAG.CI.mFANl.SV40 intravenously at a dose of 3xl0nGC. FIG. 9A shows MSH3 mRNA expression levels, plotted as fold-change, following administration with PBS or AAVhu68.CB7.CI.mMSH3.miR902.WPRE.rBG. FIG. 9B shows miR902 expression levels, plotted as fold-change, following administration with PBS or AAVhu68.CB7.CI.mMSH3.miR902.WPRE.rBG (Ct, PCR Cycle Threshold). FIG. 9C shows mouse Fanl mRNA expression levels, plotted as fold change as measured by RT-qPCR, following administration with PBS or AAVhu68.CAG.CI.mFANl.SV40.
[0809] In a further study, we examined expression levels of FAN 1 in vivo in P0 / 1 neonatal mice administered with PBS, AAVhu68.CB7.CI.miR.NT. WPRE.rBG, AAVhu68.hSyn.hFANlco.SV40, AAVhu68.hSyn.mFANnat.SV40, AAVhu68.hSyn.hFANlco.mMSH3-miR902.SV40, AAVhu68.hSyn.mFANnat.mMSH3-miR902.SV40, or AAVhu68.CAG.CI.mFANl.SV40 intravenously at a dose of IxlO11GC. FIG, 10A shows human FAN1 RNA expression levels, plotted as fold change. FIG. 10B shows amplification of human FAN1 RNA amplification as well as GAPDH amplification, plotted as RFU (Ct. PCR Cycle Threshold). FIG. 11A shows mouse Fanl protein expression, plotted as fold change, as quantified from a western blot. FIG. 1 IB shows mouse Fanl protein expression, plotted as fold change, as quantified from separate western blot. These results show CAG.mFanlnat (AAVhu68.CAG.CI.mFANl.SV40) vector resulted in highest expression, while expression from the dual vector (i.e., AAVhu68.hSyn.mFANnat.mMSH3-miR902.SV40) is minimal. FIG. 11C shows mouse FAN1 RNA expression, plotted as fold change. These results show' that CAG.mFanlnat
[0810]
[0811] (AAVhu68.CAG.CI.mFANl.SV40) vector resulted in highest expression, and confirmed that mouse FAN 1 RNA was expressed from vectors comprising Synapsin promoter.
[0812] FIGs. 12A and 12B show knockdown of MSH3 in vivo. FIG. 12A shows MSH3 RNA expression levels, plotted as fold change. FIG. 12B shows MSH3 miRNA902 expression levels, plotted as units RFU (U6, endogenous control miRNA: Ct, PCR Cycle Threshold).
[0813] FIG. 13 A shows FAN 1 expression levels, plotted as fold change as compared to untransfected control, in HEK cells following transfection w ith vectors comprising CMV-E.pP-84 promoter (VI: pAAV.CMV-E(+).uP-84.mFANnat.SV40; V2: pAAV.CMV-E(+).uP-84.mFANnat.mMSH3-miR902.SV40; V3: pAAV.CAG.CI.mFANl.SV40 NGS; V4: pAAV.CAG.CI.mFANnat.link.mMSH3miR902.SV40). FIG. 13B show FAN1 expression levels, plotted as fold change as compared to untransfected control, in N2A cells following transfection with vectors comprising CMV-E.pP-84 promoter (VI: pAAV.CMV-E(+).uP-84.mFANnat.SV40; V2: pAAV.CMV-E(+).uP-84.mFANnat.mMSH3-miR902.SV40; V3: pAAV.CAG.CI.mFANl.SV40 NGS; V4: pAAV.CAG.CLmFANnat.link.mMSH3miR902.SV40).
[0814] FIG. 14A shows FAN 1 expression levels, plotted as fold change as compared to untransfected control, in HEK cells follow ing transfection w ith vectors comprising CMV-E.pP-84 promoter (V5: pAAV.CMV-E(+).uP-84.hFANlco.SV40; V6: pAAV.CMV-E(+).uP-84.hFANlco.mMSH3-miR902.SV40; V7: pAAV.CAG.Cl.hFANl.SV40 NGS; V8: pAAV.CAG.hFANlco.link.miR902.SV40). FIG. 14B shows FAN1 expression levels, plotted as fold change as compared to untransfected control, in N2A cells following transfection w ith vectors comprising CMV-E.pP-84 promoter (V5: pAAV.CMV-E(+).uP-84.hFANlco.SV40_v2; V6: pAAV.CMV-E(+).uP-84.hFANlco.mMSH3-miR902.SV40; V7: pAAV.CAG.CI.hFANl.SV40 NGS; V8: pAAV.CAG.hFANlco.link.miR902.SV40).
[0815] FIG. 15A shows MSH3 mRNA levels, plotted as fold change as compared to untransfected control, in HEK293 cells following transfection with vectors comprising CMV-E.pP-84 promoter V6: pAAV.CMV-E(+).uP-84.hFANlco.mMSH3-miR902.SV40; V8: pAAV.CAG.hFANlco.link.miR902.SV40). FIG. 15B shows MSH3 miR902 expression in HEK293 cells, plotted as fold change, following transfection with vectors comprising CMV-E.pP-84 promoter (V6: pAAV.CMV-E(+). uP-84. hFANlco.mMSH3-miR902.SV40; V8: pAAV.CAG.hFANlco.link.miR902.SV40).
[0816]
[0817] We performed in vitro FAN 1 screening to examine promoter efficiency in HdhQ 111 (striatal neurons) mouse cells. FIG. 21 shows quantification of FAN 1 protein in mouse striatal neurons. The results of this screen revealed differential expression patterns, wherein the engineered human Fanl (hFanl) was better expressed in mouse striatal neurons when in a vector under control of CAG promoter, in comparison to CMV-E.pP-84 promoter or CALM1 promoter.
[0818] We performed in vivo vector testing in mice. In this study, 3-month-old mice were administered intravenously (IV, tail vein) with a dose of 3x10" GC of rAAV (AAVhu68.CAG.CI.hFANlco.SV40; AAVhu68.CMV-E(+).mP-84.hFANlco.SV40;
[0819] AAVhu68.Prionl48.hFANlco.SV40p, AAVl.CB7.CLTestTransgenel.rBG, AAV5.CB7.CI.TestTransgenel.rBG, AAVrh91.CB7.TestTransgene2.rBG, AAV8.CB7.CI.TestTransgene2.rBG or PBS. Following 14-days necropsy was performed.
[0820] FIG. 16 shows hFAN 1 mRNA expression in liver, plotted as fold expression as compared to PBS-administered control, following administration of PBS, AAVhu68.CAG.CI.hFANlco.SV40 (CAG), AAVhu68.CMV-E(+).mP-84.hFANlco.SV40 (uP84), AAVhu68.Prionl48.hFANlco.SV40p (Prion) (Ct, PCR Cycle Threshold).
[0821] FIG. 17 shows relative transgene mRNA expression, plotted as fold expression as compared to PBS-administered control, following administration with AAV1.CB7.CI. TestTransgenel.rBG (AAV1), AAV5.CB7.CI. TestTransgenel.rBG (AAV5), AAVrh91.CB7.CI. TestTransgene2.rBG (rh91 ), AAV8.CB7.C1. TestTransgene2.rBG (AAV8) (Ct, PCR Cycle Threshold).
[0822] Next, we examined MSH3 expression in 3-month-old mice (HdhQ 111;
[0823]
[0824] jax.org / strain / 003456) following administration with PBS, AAVhu68.CB7.CI.mMSH3.miR902.WPRE.rBG, AAVhu68.CB7.CI.miR.NT.WPRE.rBG at a dose of IxlO10GC / side (administered bilaterally to the striatum), with necropsy performed at 6 months after administration.
[0825] FIG. 18A shows MSH3 mRNA expression, plotted as fold expression, as measured in striatum. FIG. 18B shows miR902 expression, plotted as fold expression, as measured in striatum (Ct, PCR Cycle Threshold). FIG. 18C shows MSH3 protein expression, plotted as percent MSH3 expression, as measured in striatum.
[0826] FIG. 19A shows somatic instability’ indices in striatum. FIG. 19B shows somatic instability indices in liver. These results show that miR902 reduces somatic instability in
[0827]
[0828] striatum as compared to Vehicle (PBS) treated mice, that miR902 had no effect on liver somatic instability likely due to ROA (route of administration, striatal delivery ), and that miRNT also causes a reduction in somatic instability, however most non-targeting miRNAs do have some effect on overall global gene expression that is unavoidable.
[0829] We examined FAN 1 expression in 3-month-old mice (HdhQl 11 mice; obtained from Jackson Labs to have CAG repeats of increased length) following administration with AAVhu68. CAG.CI.mFAN 1. SV40, AAVhu68.hSyn.mFANnat. SV40, AAVhu68.hSyn.hFANlco.SV40 and PBS at a dose of IxlO10GC / side (administered bilaterally to the striatum), with necropsy performed at 6 months after administration. FIG.
[0830] 20A shows mouse FAN 1 (mFANl) mRNA expression, plotted as fold expression, as measured in striatum (Ct, PCR Cycle Threshold). FIG. 20B shows human FAN1 (hFANl) expression, plotted as fold expression, as measured in striatum. We also examined effect of FAN 1 on somatic instability (Ct, PCR Cycle Threshold).
[0831] FIG. 21 demonstrates expression of an artificial hFANl coding sequence in striatal tissue from the HdhQl 11 mice, HEK293, or N2A cells, under the control of a CAG promoter, a uP84 promoter, or a CALM Ip promoter.
[0832] FIG. 23 shows expression of FAN 1 (western blot) in striatum tissue.
[0833] Further, we examined FAN 1 effect on somatic instability. FIG. 24A shows FAN 1 effect on somatic instability in striatum (PBS control used from data as shown in FIG. 18 and 19). FIG. 24B shows effect in FAN 1 on somatic instability in liver tissue (PBS control used from data as shown in FIG. 18 and 19).
[0834] Next, we performed a further confirmatory study examining various promoters in vectors. Groups (cohorts) were as follows: (1) AAVhu68.CAG.CI.hFANlco.SV40, (2) AAVhu68.CMV-E(+).mP-84.hFANlco.SV40, (3) AAVhu68.Prionl48.hFANlco.SV40, and (4) un-injected control mice (added group for control), Mice (3-month old HdhQl 11 mice) were injected lelO genome copies (GC) / striatum, via bilateral striatal route of administration. For CAG expansion mice, controls for cohorts must be littermates, therefore, for Cohort 3, an un-injected control littermate group was added.
[0835] We examined somatic instability, and observed that in Cohort 3 vectors do not significantly change somatic instability in striatum, and liver tissue somatic instability' is consistent and unchanged amongst groups. FIG. 25A shows somatic instability' index in striatum. FIG. 25B shows somatic instability index in liver. FIG. 25C shows FAN1
[0836]
[0837] expression (as measured by qPCR, and plotted as fold hFanl protein). These results show diat human FAN 1 RNA is expressed at high levels in striatum following AAV-injections (for comparison, the housekeeping gene GAPDH Ct = 22 (cycle threshold)). Further, the results showed that vector comprising CAG.hFAN 1 expresses the most human FAN 1 protein.
[0838] FIG. 26 shows FAN 1 effect on somatic instability in striatum (combined view from FIG. 19A, 24A, and 25 A). Overall, these results show that vector comprising Syn.hFAN 1 presented die lowest overall somatic instability (SI) of all human FAN 1 vectors. FAN 1 protein expressing vectors:
[0839] Example 3. Comparative study of rAAV vectors in mice
[0840] In this study, we compared (1) AAVhu68.CB7.MSH3 miR902, (2) AAVhu68. hSyn.hFANlco, and (3) AAVhu68. hSyn.hFANlco.link.mMSH3.miR902. Briefly, mice (6-8 week old HdhQl 11 mice, with 12 mice / group (M / F)) were injected via stereotaxic injection (bilateral striatal injection) with 2pL / hemisphere (at IxlO10per hemi (i.e., lelO GC / Striatum), and 2x1010total). Duration of the study is 4 months in life, and necropsy is performed at 6 months. Treatment groups were as follows: (a) HdhQl 11 (no treatment, necropsied at 6-8 wks of age for baseline control), (b) HdhQl 11 + Vehicle, (c) HdhQl 11 + AAVhu68.CB7.MSH3 miR902, (d) HdhQl 11 + AAVhu68. Syn.hFAN Ico, (e) HdhQl 11 + AAVhu68.hSyn.hFanl.mMSH3 miR902. Data collected: weekly body weight (BW), somatic instability in striatum, HTT exon 1 protein analysis, MSH3 and FAN 1 RNA / protein analysis, MSH3 miRNA analysis, HTT aggregates (histopathology).
[0841] We further examined HTTExl A smear fragments via western blot from striatum crude homogenate tissue samples (data not shown). We observed that miR902 vector reduces the amount of HTT Exon 1 smear fragments. Further, we observed that miR902 and Dual vectors (i.e., comprising Fanl) reduced the presence of a secondary HMW (high molecular weight) band as seen in PBS samples and other vectors.
[0842] Further, we examined MSH3 knockdown levels in striatum using western blot analysis. FIG. 27 show s quantification of average percent MSH3 protein in striatum (Baseline: PBS; miR902: AAVhu68.CB7.MSH3 miR902; hFANl: AAVhu68. Syn.hFANlco; Dual:
[0843] AAVhu68 hFANlco.link.mMSH3.miR902). These results show' that miR902 and the dual
[0844]
[0845] vector reduces the amount of MSH3 protein. Additionally, we observed that both vectors containing Fanl transgene expressed hFanl in detectable levels (data not shown).
[0846] Example 4. Examination of rAAV vectors in Non-Human Primates (NHP) and sheep In one study, we examine AAVhu68.CB7.CI.TTl.WPRE (TT 1 - test transgene 1) vectors administration effect in NHP, wherein the rAAV is administered using ClearPoint® system (e.g., clearpointneuro.com) at a dose of IxlO10GC (right side) and IxlO11GC (left side) at a volume of 100 pL (CP, caudoputamen trajectory).
[0847] In a further study, wc examined AAVhu68.CB7.CI.TTl.WPRE (TT1 - test transgene 1) and AAV2retro.CB7.CI.TT2.WPRE (TT2 - Test Transgene 2) vectors administration effect in NHP. wherein the rAAV.TTl (right side) and rAAV.TT2 (left side) are administered using ClearPoint® system (e.g., clearpointneuro.com) at a dose of IxlO11GC at a volume of 100 pL (CN, caudate nucleus trajectory) and 250 pL (CP, caudoputamen trajectory). We observed that more vector was detected in anterior caudate nucleus with second CN trajectory (data not shown). Further, we observed that AAVhu68 vector flowed outside of the target regions in the posterior brain of NHP due perivascular leakage and issues with positioning of the NHP in the frame due to anatomy (data not shown). Further, we observed that AAV2retro spread to outer cortical layers, and that AAV2retro was detected on the contralateral side, and that AAV2retro did not spread across putamen and CN, as AAVhu68 did (data not shown). Overall, these results show that increased volumes and second CN trajectory improved spread of AAVhu68.TTl transgene throughout target (putamen and CN regions), and that AAV2retro.TT2 showed low transduction efficiency, predominately localizing to the Cortex as well as the putamen, and contralateral spread was also evident.
[0848] In a further study, we examined AAVhu68.CB7.CI.TTl.WPRE (right side) and AAVrh91.CB7.CI.TT2.WPRE (left side) vectors administration effect in NHP (Cynomolgus monkeys (4 year old. at about 6.6 kg)), wherein NHPs are administered with AAV (using ClearPoint®) at a dose of 1x1012 GC per hemisphere via intraparenchymal injection suing CN and Putamen trajectories at a dose of 250pL for Putamen and 150pL for Caudate trajectories. Summary of the rAAV delivery analysis is in table below.
[0849]
[0850]
[0851] We observed that there was no contralateral spread of either rh91 or hu68 rAAV vectors, and no travel of either vector to brain regions outside delivery regions except due to perivascular leakage.
[0852] In further study, we examine effect of administering rAAV (AAVhu68.CB7.CITTl.WPRE (right side) and AAVrh9LCB7.CLTT2.WPRE (left side)) in sheep via striatum (375 pL, with 200 pLp, and 100 pL caudate) and pons (250 pL), at low dose (5xl012GC / mL) and high dose (IxlO13GC / mL).
[0853] All documents cited in this specification are incorporated herein by reference are incorporated by reference. US Provisional Patent Application No. 63 / 761,907. filed February 22, 2025, is incorporated herein by reference. While the invention has been described with reference to particular embodiments, it will be appreciated that modifications can be made without departing from the spirit of the invention. Such modifications are intended to fall within the scope of the appended claims.
Claims
CLAIMS:
1. A composition useful for treating, slowing, preventing, or delaying the onset of a repeat expansion disease, the composition comprising(a) a nucleic acid sequence encoding at least one MHS3 inhibitory molecule which inhibits expression o£MSH3 in a human subject, optionally wherein the at least one molecule is a microRNA (miRNA), a short hairpin RNA (shRNA), an siRNA, or an antisense oligonucleotide sequence (ASO),wherein the at least one MHS3 inhibitory molecule comprises at least one of:(i) one or more of CAAACTGACTGCCGCATTA (SEQ ID NO: 4, miR902S) or a variant of SEQ ID NO: 4 sequence having 1 or 2 nucleotide changes; and / or TAATGCGGCAGTTTCAGTTTG (SEQ ID NO:
10. miR902AS) or a or a variant of SEQ ID NO: 10 sequence having 1 or 2 nucleotide changes;(ii) one or more of TAGCAACTTGACTGCATTT (SEQ ID NO: 5, miR2482S) or a variant of SEQ ID NO: 5 sequence having 1 or 2 nucleotide changes, and / or TGCTGAAATGCAGTCAACAGTTGCTA (SEQ ID NO: 11, miR2482 AS) or a variant of SEQ ID NO: 11 sequence having 1 or 2 nucleotide changes; and / or(iii) one or more of ATCTGTTAGTGCAGGATGA (SEQ ID NO: 6, miR133 IS) or a variant of SEQ ID NO: 6 sequence having 1 or 2 nucleotide changes, and / or GTCATCCTGCACACTAACAGAT (SEQ ID NO: 12, miR133 IAS) or a variant of SEQ ID NO: 11 sequence having 1 or 2 nucleotide changes; and(b) a carrier or vehicle for delivery of the nucleic acid sequence encoding the at least o icMSH3 inhibitory molecule to the human subject, wherein the composition optionally comprises an expression cassette comprising the nucleic acid sequence encoding tire at least onsMSH3 inhibitory molecule operably linked to expression control sequences therefor, optionally when tire expression cassette is in a viral vector.
2. A recombinant adeno-associated viral (rAAV) particle comprising:(a) an adeno-associated virus capsid and(b) a vector genome comprising an expression cassette which comprises a nucleic acid sequence encoding at least one MHS3 inhibitory molecule which inhibitsexpression of MSH3 in a subject and binds a target sequence comprising at least 10 consecutive nucleotides of CAAACTGAAACTGCCGCATTA (SEQ ID NO: 108) or CAAACTGAAACTGCAGCATTA (SEQ ID NO: 109), the coding sequence being operably linked to expression control sequences therefor.
3. The rAAV particle of claim 2, or the composition of claim 1, wherein the expression cassette comprises a nucleic acid sequence encoding at least two different MSH3 inhibitory molecules comprising a mature miRNA, wherein the MHS3 inhibitory molecule comprises a sense sequence and an antisense sequence.
4. The rAAV particle of claim 2 or claim 3, or the composition of claim 1 or claim 3 wherein the MHS3 inhibitory molecule comprises a 5’ miR flanking region, a sense sequence, an RNA loop sequence, an antisense sequence, and a 3’ miR flanking region.
5. The rAAV particle of claim 4, wherein the 5’ miR flanking region comprises a sequence of SEQ ID NO: 140 and / or the 3’ miR flanking region comprises a sequence of SEQ ID NO: 141.
6. The rAAV particle of any one of claims 3 to 5, wherein(i) the sense sequence is CAAACTGACTGCCGCATTA (SEQ ID NO: 4, miR902S) or a variant of SEQ ID NO: 4 sequence having 1 or 2 nucleotide changes; and / or the antisense sequence is TAATGCGGCAGTTTCAGTTTG (SEQ ID NO: 10, miR902AS) or a or a variant of SEQ ID NO: 10 sequence having 1 or 2 nucleotide changes;(ii) the sense sequence is TAGCAACTTGACTGCATTT (SEQ ID NO: 5, miR2482S) or a variant of SEQ ID NO: 5 sequence having 1 or 2 nucleotide changes, and / or the antisense sequence is TGCTGAAATGCAGTCAACAGTTGCTA (SEQ ID NO:
11. miR2482 AS) or a variant of SEQ ID NO: 11 sequence having 1 or 2 nucleotide changes; and / or(iii) the sense sequence is ATCTGTTAGTGCAGGATGA (SEQ ID NO: 6, miR133 IS) or a variant of SEQ ID NO: 6 sequence having 1 or 2 nucleotide changes, and / or the antisense sequence is GTCATCCTGCACACTAACAGAT (SEQ ID NO: 12, miR133 IAS) or a variant of SEQ ID NO: 12 sequence having 1 or 2 nucleotide changes.
7. The rAAV particle of any one of claim 2 to 6, wherein the expression cassette comprises a nucleic acid sequence encoding at least one MHS3 inhibitory molecule comprising at least one of:(i) one or more of CAAACTGACTGCCGCATTA (SEQ ID NO: 4, miR902S) or a variant of SEQ ID NO: 4 sequence having 1 or 2 nucleotide changes; and / or TAATGCGGCAGTTTCAGTTTG (SEQ ID NO: 10, miR902AS) or a or a variant of SEQ ID NO: 10 sequence having 1 or 2 nucleotide changes;(ii) one or more of TAGCAACTTGACTGCATTT (SEQ ID NO: 5, miR2482S) or a variant of SEQ ID NO: 5 sequence having 1 or 2 nucleotide changes, and / or TGCTGAAATGCAGTCAACAGTTGCTA (SEQ ID NO: 11, miR2482 AS) or a variant of SEQ ID NO: 11 sequence having 1 or 2 nucleotide changes; and / or(in) one or more of ATCTGTTAGTGCAGGATGA (SEQ ID NO: 6, miR133 IS) or a variant of SEQ ID NO: 6 sequence having 1 or 2 nucleotide changes, and / or GTCATCCTGCACACTAACAGAT (SEQ ID NO: 12, miR1331AS) or a variant of SEQ ID NO: 12 sequence having 1 or 2 nucleotide changes.
8. The rAAV particle of claim 7. or the composition of claim 1, wherein the nucleic acid sequence encoding at least one MHS3 inhibitory molecule encodes SEQ ID NO: 1 and comprises the sequence of at least 7, at least 15, or at least 17 consecutive nucleotides of CAAACTGACTGCCGCATTA (SEQ ID NO: 4).
9. The rAAV particle of any one of claims 2 to 8, or composition of any one of claims 1 or 8, wherein the nucleic acid sequence encoding at least one MHS3 inhibitory- molecule encodes SEQ ID NO: 1 comprises the full-length sequence of SEQ ID NO: 4, optionally with 1 or 2 modified nucleotides.
10. The rAAV particle of any one of claims 2 to 9, or the composition of any one of claims 1 or 8 to 9, wherein the expression cassette comprises at least onsMSH3 inhibitory nucleic acid sequence of about 16 nucleotides to about 28 nucleotides in length encoding a miR902 antisense sequence of 7 to 21 consecutive nucleotides of:UAAUGCGGCAGUUUCAGUUUG (SEQ ID NO: 7).
11. The rAAV particle of any one of claims 2 to 10, or the composition of any one of claims 1 or 8 to 10, wherein each of the at least one MSH3 inhibitory sequence is independently a sequence of 18 to 26 nucleotides in length, or 19 to 23 nucleotides in length, and encodes the sequence of at least 11 consecutive nucleotides, at least 15 consecutive nucleotides, or at least 18 to 21 consecutive nucleotides.
12. The rAAV of any one of claims 2 to 11, or the composition of any one of claims 1, or 8 to 11, wherein the MSH3 inhibitory nucleic acid sequence encoding SEQ ID NO: 7 comprises the sequence of at least 7, at least 15, or 19 to 21 consecutive nucleotides of TAATGCGGCAGTTTCAGTTTG (SEQ ID NO: 10).
13. The rAAV particle of any one of claims 2 to 11. or composition of any one of claims 1, or 8 to 11, wherein the MSH3 inhibitory nucleic acid sequence encoding SEQ ID NO: 1 comprises the full-length sequence of SEQ ID NO: 10, optionally with 1 or 2 modified nucleotides.
14. The rAAV particle of any one of claims 2 to 11, or a composition of any one of claims 1 or 8 to 13, wherein the MSH3 inhibitory nucleic acid sequence encoding the MSH3 inhibitory molecule comprises a loop nucleic acid sequence that operatively links a sense sequence and an antisense sequence.
15. The rAAV particle of any one of claims 2 to 14, or a composition of any one of claims 1 or 8 to 14, the MSH3 inhibitory nucleic acid sequence further comprises an RNA loop sequence of the nucleic acid sequence of GTTTTGGCCACTGACTGAC (SEQ ID NO: 31).
16. The rAAV particle of any one of claims 2 to 15, or a composition of any one of claims 1 or 8 to 15, wherein the sense sequence, the loop sequence, and the antisense sequence comprises a nucleic acid sequence encoding the sequence of:UAAUGCGGCAGUUUCAGUUUGGUUUUGGCCACUGACUGACCAAACUGACUG CCGCAUUA (SEQ ID NO: 13).
17. The rAAV particle of claim 16, or a composition of claim 16, wherein the MSH3 inhibitory nucleic acid sequence encoding SEQ ID NO: 13 comprises the sequence of TAATGCGGCAGTTTCAGTTTGGTTTTGGCCACTGACTGACCAAACTGACTGCCG CATTA (SEQ ID NO: 16).
18. The rAAV particle of any one of claims 2 to 17, or a composition of any one of claims 2 or 8 to 17, wherein the 5’ flanking region comprises a nucleic acid sequence encoding the sequence of CUGGAGGCUUGCUGAAGGCUGUAUGCU (SEQ ID NO: 19).
19. The rAAV particle of claim 18, or a composition of claim 18, wherein the MSH3 inhibitory nucleic acid sequence encoding SEQ ID NO: 19, comprises the sequence of ctggaggcttgctgaaggctgtatgct (SEQ ID NO: 21).
20. The rAAV particle of any one of claims 2 to 17, or a composition of any one of claims 2 or 8 to 17, wherein the 3’ flanking region comprises a nucleic acid sequence encoding the sequence of CAGGACACAAGGCCUGUUACUAGCACUCACAUGGAACAAAUGGCC (SEQ ID NO: 23).
21. The rAAV particle of claim 20, or the composition of claim 20, wherein the MSH3 inhibitory nucleic acid sequence encoding SEQ ID NO: 23, comprises the sequence of caggacacaaggcctgttactagcactcacatggaacaaatggcc (SEQ ID NO: 24).
22. The rAAV particle of any one of claims 2 to 21. or the composition of any one of claims 1 or 8 to 21, wherein the MSH3 inhibitory' nucleic acid sequence encoding the miR902 comprises the sequence of: SEQ ID NO: 25:CUGGAGGCUUGCUGAAGGCUGUAUGCUGUAAUGCGGCAGUUUCAGUUUGGU UUUGGCCACUGACUGACCAAACUGACUGCCGCAUUACAGGACACAAGGCCUG UUACUAGCACUCACAUGGAACAAAUGGCC.
23. The rAAV particle of claim 22, or the composition of claim 22, wherein the MSH3 inhibitory nucleic acid sequence encoding SEQ ID NO: 25 comprises the sequence of SEQ ID NO: 28: ctggaggcttgctgaaggctgtatgctgTAATGCGGCAGTTTCAGTTTGGTTTTGGCCACTGACT GACCAAACTGACTGCCGCATTAcaggacacaaggcctgttactagcactcacatggaacaaatggcc.
24. The rAAV particle of any one of claims 2 to 23, or the composition of any one of claims 1 or 3 to 23, wherein the miR902 coding scqucncc(s) arc operably linked to a constitutive promoter.
25. The rAAV particle of any one of claims 2 to 23. or the composition of any one of claims 1 or 3 to 23, wherein the miR902 coding sequence(s) are operably linked to a neuron specific and / or immune specific cell promoter.
26. The rAAV particle of claim 7, or the composition of claim 1, wherein the nucleic acid sequence encoding at least one MHS3 inhibitory molecule encodes SEQ ID NO: 2 and comprises the sequence of at least 7, at least 15, or at least 17 consecutive nucleotides of TAGCAACTTGACTGCATTT (SEQ ID NO: 5).
27. The rAAV particle of any one of claims 2 to 7 or 26, or composition of any one of claims 1 or 26, wherein the nucleic acid sequence encoding at least one MHS3 inhibitory' molecule encodes SEQ ID NO: 2 comprises the full-length sequence ofSEQ ID NO: 5, optionally with 1 or 2 modified nucleotides.
28. The rAAV particle of any one of claims 2 to 7 or 26 to 27. or the composition of any one of claims 1 or 26 to 27, wherein the expression cassette comprises at least one MSH3 inhibitory nucleic acid sequence of about 16 nucleotides to about 28 nucleotides in length encoding a miR2482 antisense sequence of 7 to 21 consecutive nucleotides of: UGCUGAAAUGCAGUCAACAGUUGCUA (SEQ ID NO: 8).
29. The rAAV particle of any one of claims 2 to 7 or 26 to 28, or the composition of any one of claims 1 or 26 to 28, wherein each of the at least one MSH3 inhibitory sequence is independently a sequence of 18 to 26 nucleotides in length, or 19 to 23 nucleotides in length, and encodes the sequence of at least 11 consecutive nucleotides, at least 15 consecutive nucleotides, or at least 18 to 21 consecutive nucleotides.
30. The rAAV of any one of claims 2 to 7 or 26 to 29, or the composition of any one of claims 1, or 26 to 29, wherein the MSH3 inhibitory nucleic acid sequence encoding SEQ ID NO: 8 comprises tire sequence of at least 7, at least 15, or 19 to 21 consecutive nucleotides of TGCTGAAATGCAGTCAACAGTTGCTA (SEQ ID NO: 11).
31. The rAAV particle of any one of claims 2 to 7 or 26 to 29. or composition of any one of claims 1, or 26 to 29, wherein the MSH3 inhibitory nucleic acid sequence encoding SEQ ID NO: 2 comprises the full-length sequence of SEQ ID NO: 11, optionally with 1 or 2 modified nucleotides.
32. The rAAV particle of any one of claims 2 to 7 or 26 to 31, or composition of any one of claims 1, or 26 to 31, wherein the MSH3 inhibitory nucleic acid sequence encoding the RNA molecule comprises a loop nucleic acid sequence tliat operatively links a sense sequence and an antisense sequence.
33. The rAAV particle of any one of claims 2 to 7 or 26 to 32, or composition of any one of claims 1, or 26 to 32, the MS773 inhibitory- nucleic acid sequence further comprises an RNA loop sequence of the nucleic acid sequence of GTTTTGGCCACTGACTGAC (SEQ ID NO: 31).
34. The rAAV particle of any one of claims 2 to 7 or 26 to 33, or composition of any one of claims 1, or 26 to 33, wherein the sense sequence, the loop sequence, and die antisense sequence comprises a nucleic acid sequence encoding the sequence of:UAAUGCGGCAGUUUCAGUUUGGUUUUGGCCACUGACUGACCAAACUGACUG CCGCAUUA (SEQ ID NO: 14).
35. The rAAV particle of claim 34, or a composition of claim 34, wherein the MSH3 inhibitory nucleic acid sequence encoding SEQ ID NO: 14 comprises the sequence of TAATGCGGCAGTTTCAGTTTGGTTTTGGCCACTGACTGACCAAACTGACTGCCG CATTA (SEQ ID NO: 17).
36. The rAAV particle of any one of claims 2 to 7 or 26 to 35, or composition of any one of claims 1, or 26 to 35, wherein the 5’ flanking region comprises a nucleic acid sequence encoding the sequence of CUGGAGGCUUGCUGAAGGCUGUAUGCU (SEQ ID NO: 19).
37. The rAAV particle of claim 36, or a composition of claim 36, wherein the MSH3 inhibitory nucleic acid sequence encoding SEQ ID NO: 19, comprises the sequence of ctggaggcttgctgaaggctgtatgct (SEQ ID NO: 21).
38. The rAAV particle of any one of claims 2 to 7 or 26 to 37, or composition of any one of claims 1, or 26 to37, wherein the 3’ flanking region comprises a nucleic acid sequence encoding the sequence of CAGGACACAAGGCCUGUUACUAGCACUCACAUGGAACAAAUGGCC (SEQ ID NO: 23).
39. The rAAV particle of claim 38, or the composition of claim 38, wherein the MSH3 inhibitory nucleic acid sequence encoding SEQ ID NO: 23, comprises the sequence of caggacacaaggcctgttactagcactcacatggaacaaatggcc (SEQ ID NO: 24).
40. The rAAV particle of any one of claims 2 to 7 or 26 to 39. or composition of any one of claims 1, or 26 to 39, wherein the MSH3 inhibitory nucleic acid sequence encoding the miR2482 comprises the sequence of: SEQ ID NO: 26:CUGGAGGCUUGCUGAAGGCUGUAUGCUGAAAUGCAGUCAACAGUUGCUAGU UUUGGCCACUGACUGACUAGCAACUUGACUGCAUUUCAGGACACAAGGCCU GUUACUAGCACUCACAUGGAACAAAUGGCC.
41. The rAAV particle of claim 40, or the composition of claim 40, wherein the MSH3 inhibitory nucleic acid sequence encoding SEQ ID NO: 26 comprises the sequence of SEQ ID NO: 29: ctggaggcttgctgaaggctgtaTGCTGAAATGCAGTCAACAGTTGCTAGTTTTGGCCACTG ACTGACTAGCAACTTGACTGCATTTcaggacacaaggcctgttactagcactcacatggaacaaatggcc.
42. The rAAV particle of any one of claims 2 to 7 or 26 to 41, or composition of any one of claims 1, or 26 to 41, wherein the miR2482 coding sequence(s) are operably linked to a constitutive promoter.
43. The rAAV particle of any one of claims 2 to 7 or 26 to 41, or composition of any one of claims 1, or 26 to 41, wherein the miR2482 coding sequence(s) are operably linked to a neuron specific and / or immune specific cell promoter.
44. The rAAV particle of claim 7, or the composition of claim 1, wherein the nucleic acid sequence encoding at least one MHS3 inhibitory molecule encodes SEQ ID NO: 3 and comprises tire sequence of at least 7, at least 15, or at least 17 consecutive nucleotides of ATCTGTTAGTGCAGGATGA (SEQ ID NO: 6).
45. The rAAV particle of any one of claims 2 to 7 or 44, or composition of any one of claims 1 or 44, wherein the nucleic acid sequence encoding at least one MHS3 inhibitory molecule encodes SEQ ID NO: 3 comprises the full-length sequence ofSEQ ID NO: 6, optionally with 1 or 2 modified nucleotides.
46. The rAAV particle of any one of claims 2 to 7 or 44 to 45, or composition of any one of claims 1 or 44 to 45, wherein the expression cassette comprises at least one MSH3 inhibitory nucleic acid sequence of about 16 nucleotides to about 28 nucleotides in length encoding a miR.1331 antisense sequence of 7 to 21 consecutive nucleotides of: GUCAUCCUGCACACUAACAGAU (SEQ ID NO: 9).
47. The rAAV particle of any one of claims 2 to 7 or 44 to 46, or composition of any one of claims 1 or 44 to 46, wherein each of the at least one MSH3 inhibitorysequence is independently a sequence of 18 to 26 nucleotides in length, or 19 to 23 nucleotides in length, and encodes the sequence of at least 11 consecutive nucleotides, at least 15 consecutive nucleotides, or at least 18 to 21 consecutive nucleotides.
48. The rAAV particle of any one of claims 2 to 7 or 44 to 47, or composition of any one of claims 1 or 44 to 47, wherein the MSH3 inhibitory7nucleic acid sequence encoding SEQ ID NO: 9 comprises the sequence of at least 7, at least 15, or 19 to 21 consecutive nucleotides of GTCATCCTGCACACTAACAGAT (SEQ ID NO: 12).
49. The rAAV particle of any one of claims 2 to 7 or 44 to 48, or composition of any one of claims 1 or 44 to 48, wherein the MSH3 inhibitory nucleic acid sequence encoding SEQ ID NO: 3 comprises the full-length sequence of SEQ ID NO: 12, optionally with 1 or 2 modified nucleotides.
50. The rAAV particle of any one of claims 2 to 7 or 44 to 49, or composition of any one of claims 1 or 44 to 49, wherein the MSH3 inhibitory7nucleic acid sequence encoding the RNA molecule comprises a loop nucleic acid sequence that operatively links a sense sequence and an antisense sequence.
51. The rAAV particle of any one of claims 2 to 7 or 44 to 50. or composition of any one of claims 1 or 44 to 50, the MSH3 inhibitory nucleic acid sequence further comprises an RNA loop sequence of the nucleic acid sequence of GTTTTGGCCACTGACTGAC (SEQ ID NO: 31).
52. The rAAV particle of any one of claims 2 to 7 or 44 to 51, or composition of any one of claims 1 or 44 to 51, wherein the sense sequence, the loop sequence, and the antisense sequence comprises a nucleic acid sequence encoding the sequence of:GUCAUCCUGCACACUAACAGAUGUUUUGGCCACUGACUGACAUCUGUUAGU GCAGGAUGA (SEQ ID NO: 15).
53. The rAAV particle of claim 52, or a composition of claim 52, wherein the MSH3 inhibitory nucleic acid sequence encoding SEQ ID NO: 13 comprises the sequenceof GTCATCCTGCACACTAACAGATGTTTTGGCCACTGACTGACATCTGTTAGTGCA GGATGA (SEQ ID NO: 18).
54. The rAAV particle of any one of claims 2 to 7 or 44 to 53, or composition of any one of claims 1 or 44 to 53, wherein the 5’ flanking region comprises a nucleic acid sequence encoding the sequence of CUGGAGGCUUGCUGAAGGCUGUAUGCU (SEQ ID NO: 19).
55. The rAAV particle of claim 54, or a composition of claim 54, wherein the MSH3 inhibitory nucleic acid sequence encoding SEQ ID NO: 19, comprises the sequence of ctggaggcttgctgaaggctgtatgct (SEQ ID NO: 21).
56. The rAAV particle of any one of claims 2 to 7 or 44 to 55, or composition of any one of claims 1 or 44 to 55, wherein the 3’ flanking region comprises a nucleic acid sequence encoding the sequence of CAGGACACAAGGCCUGUUACUAGCACUCACAUGGAACAAAUGGCC (SEQ ID NO: 23).
57. The rAAV particle of claim 56, or the composition of claim 56, wherein the MSH3 inhibitory nucleic acid sequence encoding SEQ ID NO: 23, comprises the sequence of caggacacaaggcctgttactagcactcacatggaacaaatggcc (SEQ ID NO: 24).
58. The rAAV particle of any one of claims 2 to 7 or 44 to 57, or composition of any one of claims 1 or 44 to 57, wherein the MSH3 inhibitory nucleic acid sequence encoding the miR1331 comprises the sequence of: SEQ ID NO: 27:CUGGAGGCUUGCUGAAGGCUGUAUGCUGUCAUCCUGCACACUAACAGAUGU UUUGGCCACUGACUGACAUCUGUUAGUGCAGGAUGACAGGACACAAGGCCU GUUACUAGCACUCACAUGGAACAAAUGGCC.
59. The rAAV particle of claim 58, or the composition of claim 58, wherein the MSH3 inhibitory nucleic acid sequence encoding SEQ ID NO: 27 comprises the sequenceof SEQ ID NO: 30: ctggaggcttgctgaaggctgtatgctGTCATCCTGCACACTAACAGATGTTTTGGCCACTGAC TGACATCTGTTAGTGCAGGATGAcaggacacaaggcctgttaclagcactcacatggaacaaatggcc.
60. The rAAV particle of any one of claims 2 to 7 or 44 to 59, or composition of any one of claims 1 or 44 to 59, wherein the miR1331 coding sequence(s) are operably linked to a constitutive promoter.
61. The rAAV particle of any one of claims 2 to 7 or 44 to 59, or composition of any one of claims 1 or 44 to 59, wherein the miR1331 coding sequence(s) are operably linked to a neuron specific and / or immune specific cell promoter.
62. The rAAV particle of any one of claims 2 to 23, 26-41, 44-59, or the composition of any one of claims 1 or 23, 26-41, 44-59, wherein the expression control sequences comprise a promoter which is human synapsin, a chicken beta actin promoter, a CMVe.mP84, a calmodulin promoter or a prion promoter, optionally wherein the chicken beta actin promoter is a CB7 promoter element or a CAG promoter element.
63. The rAAV particle of any one of claims 2 to 62, or a composition of any one of claims 1, 3 to 62, wherein the vector genome comprises one or more of: an AAV25’ inverted terminal repeat (ITR), the expression control sequence further comprise one or more of: a post-transcription regulatory element which is optionally a Woodchuck Hepatitis Virus Posttranscriptional Regulatory Elements (WPRE); a rabbit -globin exon; or a rabbit globin poly(A), and an AAV23’ ITR.
64. The rAAV particle of any one of claims 2 to 7, wherein tire expression cassette comprises the nucleic acid sequence of SEQ ID NO: 81.
65. The rAAV particle of any one of claims 2 to 7, wherein the expression cassette comprises the nucleic acid sequence of SEQ ID NO: 82.
66. The rAAV particle of any one of claims 2 to 7, wherein the expression cassette comprises the nucleic acid sequence of SEQ ID NO: 83.
67. The rAAV particle of any one of claims 2 to 7, wherein the vector genome comprises the nucleic acid sequence of SEQ ID NO: 32.
68. The rAAV particle of any one of claims 2 to 7, wherein tire vector genome comprises the nucleic acid sequence SEQ ID NO: 33.
69. The rAAV particle of any one of claims 2 to 7, wherein the vector genome comprises tire nucleic acid sequence of SEQ ID NO: 34.
70. The rAAV particle of any one of claims 2 to 63 or the composition of any one of claims 1 or 3 to 4, 8 to 63 which further comprises a nucleic acid sequence encoding a peptide, polypeptide, protein, or ASO operably linked to expression control sequences which direct expression thereof, optionally wherein the peptide, polypeptide, ASO, or miRNA is therapeutic for a repeat expansion disease, optionally wherein the therapeutic is an Total Huntingtin Gene (HTT) gene, or a human cholesterol 24-hydroxylase gene (hCPY46Al).
71. The rAAV particle or the composition of claim 63, wherein the repeat expansion disease is Huntington's disease, Fragile X Syndrome, myotonic dystrophy (DM1 and DM2), amyotrophic lateral sclerosis and / or frontotemporal dementia caused by somatic expansion in the C90RF72 gene, spinocerebellar ataxias (SCAs 1, 2, 3, 6, 7 and 17), Friedreich's ataxia (FRDA), Fragile X Tremor Ataxia Syndrome (FXS / FXTAS), dentatorubral-pallidoluysian atrophy (DRPLA), spinal and bulbar muscular atrophy (SBMA). or Unverricht-Lundborg myoclonic epilepsy (EPM1).
72. The rAAV particle of any one of claims 2 to 71, wherein the AAV capsid is a naturally occurring or a non-naturally occurring clade F capsid, and / or a capsid which is capsid of crossing the blood-brain barrier.
73. The rAAV particle of any one of claims 2 to 71, wherein the AAV capsid is AAVhu68, AAVrh91, AAV1, AAV9, AAV5 or AAV8 capsid.
74. The rAAV particle of any one of claims 1 to 73, wherein the vector genome further comprises a FAN 1 nucleic acid encoding human FAN 1 (hFAN 1) operably linked to expression control sequences.
75. The rAAV particle of claim 74, w herein the hFAN 1 has an amino acid sequence of SEQ ID NO: 105.
76. A composition comprising:(a) a delivery vehicle for a FAN 1 nucleic acid sequence encoding human FAN 1 gene operably linked to expression control sequences; and(b) a delivery vehicle for at least one MSH3 inhibitory nucleic acid sequence encoding an RNA molecule which inhibits expression of MSH3 in a human subject, optionally wherein the RNA inhibitory molecule is an microRNA (miRNA), an short hairpin RNA (shRNA), an siRNA, or an anti-sense oligonucleotide sequence (ASO), wherein the at least OIIQMSH3 inhibitory nucleic acid sequence comprises at least one of:(i) one or more of CAAACTGACTGCCGCATTA (SEQ ID NO: 4, miR902S) or a variant of SEQ ID NO: 4 sequence having 1 or 2 nucleotide changes; and / or TAATGCGGCAGTTTCAGTTTG (SEQ ID NO: 10, miR902AS) or a or a variant of SEQ ID NO: 10 sequence having 1 or 2 nucleotide changes;(ii) one or more of TAGCAACTTGACTGCATTT (SEQ ID NO: 5, miR2482S) or a variant of SEQ ID NO: 5 sequence having 1 or 2 nucleotide changes, and / or TGCTGAAATGCAGTCAACAGTTGCTA (SEQ ID NO: 11, miR2482 AS) or a variant of SEQ ID NO: 11 sequence having 1 or 2 nucleotide changes; and / or(in) one or more of ATCTGTTAGTGCAGGATGA (SEQ ID NO: 6, miR133 IS) or a variant of SEQ ID NO: 6 sequence having 1 or 2 nucleotide changes, and / or GTCATCCTGCACACTAACAGAT (SEQ ID NO: 12, miR133 IAS) or a variant of SEQ ID NO: 11 sequence having 1 or 2 nucleotide changes, optionally when the expression cassette is in a viral vector.
77. A recombinant adeno-associated virus (rAAV) particle comprising:(a) an AAV capsid; and(b) a vector genome in the AAV capsid, the vector genome comprising an expression cassette, wherein the expression cassette comprises a nucleic acid sequence of SEQ ID NO: 104 or a sequence at least 95% identical thereto encoding a human FANC1-associated nuclease (hFAN 1) having SEQ ID NO: 105, wherein the hFANl nucleic acid sequence is operably linked to expression control sequences.
78. The rAAV particle of claim 77, wherein tire hFAN 1 coding sequence is SEQ ID NO: 104 or a sequence at least 99% identical thereto encoding the hFAN 1 amino acid sequence of SEQ ID NO: 105.
79. The rAAV particle of claim 77 or claim 78, wherein the hFAN 1 coding sequence is operably linked to a constitutive promoter.
80. The rAAV particle of any one of claims 77 to 79, w herein the hFAN 1 coding sequence is operably linked to a cell specific promoter, optionally a neuron specific or an immune cell specific promoter.
81. The rAAV particle of any 77 to 80, wherein the expression control sequences comprise a promoter w hich is human synapsin, a chicken beta actin promoter, a CMVe.mP84, a calmodulin promoter or a prion promoter, optionally wherein the chicken beta actin promoter is a CB7 promoter element or a CAG promoter element.
82. The rAAV particle of any one of claims 77 to 81, wherein the vector genome comprises one or more of: an AAV25' inverted terminal repeat (ITR), the expression control sequence further comprise one or more of: a post-transcription regulatory element which is optionally a Woodchuck Hepatitis Virus Posttranscriptional Regulatory Elements (WPRE); a rabbit P-globin exon; or a rabbit globin poly(A), and an AAV23’ ITR.
83. The rAAV particle of any one of claims 77 to 82, wherein the expression cassette comprises the nucleic acid sequence of SEQ ID NO: 84, 86, 88, 90, 92, 94, 96, 98, 100, or 102.
84. The rAAV particle of any one of claims 77 to 83, wherein the expression cassette further comprises a nucleic acid sequence encoding a second therapeutic molecule, optionally wherein the nucleic acid sequence encodes an RNA inhibitory molecule that inhibits expression of MSH3 in a human subject.
85. The rAAV particle of any one of claims 77 to 84, wherein the vector genome further comprises at least one nucleic acid sequence comprising at least one of:(i) one or more of CAAACTGACTGCCGCATTA (SEQ ID NO: 4, miR902S) or a variant of SEQ ID NO: 4 sequence having 1 or 2 nucleotide changes; and / or TAATGCGGCAGTTTCAGTTTG (SEQ ID NO: 10, miR902AS) or a or a variant of SEQ ID NO: 10 sequence having 1 or 2 nucleotide changes;(ii) one or more of TAGCAACTTGACTGCATTT (SEQ ID NO: 5, miR2482S) or a variant of SEQ ID NO: 5 sequence having 1 or 2 nucleotide changes, and / or TGCTGAAATGCAGTCAACAGTTGCTA (SEQ ID NO: 11, miR2482 AS) or a variant of SEQ ID NO: 11 sequence having 1 or 2 nucleotide changes; and / or(in) one or more of ATCTGTTAGTGCAGGATGA (SEQ ID NO: 6, miR133 IS) or a variant of SEQ ID NO: 6 sequence having 1 or 2 nucleotide changes, and / or GTCATCCTGCACACTAACAGAT (SEQ ID NO: 12, miR133 IAS) or a variant of SEQ ID NO: 11 sequence having 1 or 2 nucleotide changes.
86. The rAAV particle of claim 84 or claim 85, wherein the expression cassette comprises a linker between the coding sequence of hFAN 1 and the sequence encoding the RNA inhibitory molecule.
87. The rAAV particle of claim 86, wherein the linker is a self-cleaving 2A linker.
88. The rAAV particle of any one of claims 77 to 87, wherein the expression cassette comprises the hFANl coding sequence, a linker, and mMSH3 inhibitory nucleic acid sequence encoding an RNA molecule which inhibits expression of MSH3 , wherein the hFANl coding sequence and the MSH3 inhibitory nucleic acid sequence are operably linked to expression control sequences which comprise at least one promoter, at least enhancer, and the linker encoding a self-cleaving peptide.
89. The rAAV particle of claim 88, wherein the vector genome comprises an enhancer upstream of tire hFAN 1 coding sequence and the MSH3 inhibitory nucleic acid sequence and optionally a post-transcription regulatory element which is downstream of the hFANl coding sequence and the MSH3 inhibitory nucleic acid sequence.
90. The rAAV particle according to any one of claims 77 to 89, wherein the AAV capsid is a naturally occurring or a non-naturally occurring clade F capsid, and / or a capsid which is capsid of crossing the blood-brain barrier.
91. The rAAV particle of any one of claims 77 to 89, wherein tire AAV capsid is AAVhu68, AAVrh91, AAV1, AAV9, AAV5 or AAV8 capsid.
92. A pharmaceutical composition comprising an rAAV particle according to any one of claims 77 to 91 and one or more of a pharmaceutically acceptable suspending agent, a carrier, and / or an excipient.
93. The pharmaceutical composition according to claim 92, further comprising an rAAV particle according to any one of claims 2 to 92, the composition of any one of claims 1 or 3 to 70 or 76.
94. A nucleic acid molecule useful for rAAV production comprising:(a) an adeno-associated vims 5’ inverted terminal repeat:(b) a nucleic acid sequence encoding an miRNA which inhibits MSH3 expression in a subject comprising a 5’ flanking region, a sense sequence, a loop, anantisense sequence, and a 3 ’ flanking region, wherein the at least one nucleic acid sequence comprises at least one of:(i) one or more of CAAACTGACTGCCGCATTA (SEQ ID NO: 4, miR902S) or a variant of SEQ ID NO: 4 sequence having 1 or 2 nucleotide changes; and / or TAATGCGGCAGTTTCAGTTTG (SEQ ID NO:
10. miR902AS) or a or a variant of SEQ ID NO: 10 sequence having 1 or 2 nucleotide changes;(ii) one or more of TAGCAACTTGACTGCATTT (SEQ ID NO: 5, miR2482S) or a variant of SEQ ID NO: 5 sequence having 1 or 2 nucleotide changes, and / or TGCTGAAATGCAGTCAACAGTTGCTA (SEQ ID NO: 11, miR2482 AS) or a variant of SEQ ID NO: 11 sequence having 1 or 2 nucleotide changes; and / or(iii) one or more of ATCTGTTAGTGCAGGATGA (SEQ ID NO: 6, miR133 IS) or a variant of SEQ ID NO: 6 sequence having 1 or 2 nucleotide changes, and / or GTCATCCTGCACACTAACAGAT (SEQ ID NO: 12, miR133 IAS) or a variant of SEQ ID NO: 11 sequence having 1 or 2 nucleotide changes;(c) regulatory control sequences operably linked to the miR encoding sequence; and(d) an AAV 3’ inverted terminal repeat (ITR).
95. The nucleic acid molecule of claim 94, wherein the nucleic acid sequence comprises SEQ ID NO:
81.
82. 83, 86, 87, 90, 91.
94.
95. 98, 99, 102. or 103.
96. An rAAV packaging cell comprising the nucleic acid molecule according to claim 95.
97. A nucleic acid molecule useful for rAAV production comprising:(a) an adeno-associated virus 5' inverted terminal repeat;(b) a nucleic acid sequence comprising a nucleic acid sequence of SEQ ID NO: 104 or a sequence at least 95% identical thereto encoding a human FANCI-associated nuclease (hFAN 1) having SEQ ID NO: 105, wherein the hFAN 1 nucleic acid sequence is operably linked to expression control sequences; and(c) an AAV 3’ inverted terminal repeat (ITR).
98. The nucleic acid sequence of claim 97 comprising SEQ ID NO: 84, 86, 88, 90, 92, 94, 96, 98, 100, or 102.
99. An rAAV packaging cell comprising the nucleic acid molecule according to claim 98.
100. Use of an rAAV according to any one of claims 2 to 75 or 77 to 91, or a composition according to any one of claims 1, 3-4, 8-63, 70-71, or 76 for a infusion into a subject for treatment of Huntington’s disease and / or a disorder associated with a repeat expansion disease, optionally wherein the disorder is Fragile X Syndrome, myotonic dystrophy (DM1 and DM2), amyotrophic lateral sclerosis and / or frontotemporal dementia caused by somatic expansion in the C90RF72 gene, spinocerebellar ataxias (SCAs 1, 2, 3.6, 7 and 17), Friedreich's ataxia (FRDA), Fragile X Tremor Ataxia Syndrome (FXS / FXTAS), dentatorubral-pallidoluysian atrophy (DRPLA), spinal and bulbar muscular atrophy (SBMA), or Unverricht-Lundborg myoclonic epilepsy (EPM1).
101. Use according to claim 100, wherein the infusion is delivered intrathecally.
102. Use according to claim 100. wherein tlie infusion is delivered via bilateral, intraparenchymal infusion into a subject’s caudate and putamen.
103. A method of treating, preventing or delaying the onset of a repeat expansion disease in a subject in need thereof, wherein the method comprises administering to the subject the rAAV particle of any one of 2 to 75 or 77 to 91.
104. The method of 103, wherein the repeat expansion disease is selected from Huntington’s disease. Fragile X Syndrome, myotonic dystrophy (DM1 and DM2), amyotrophic lateral sclerosis and / or frontotemporal dementia caused by somatic expansion in the C90RF72 gene, spinocerebellar ataxias (SCAs 1, 2, 3, 6, 7 and 17), Friedreich's ataxia (FRDA), Fragile X Tremor Ataxia Syndrome (FXS / FXTAS), dentatorubral-pallidoluysian atrophy (DRPLA), spinal and bulbar muscular atrophy (SBMA), and Unverricht-Lundborg myoclonic epilepsy (EPM1).
105. The method of 103, wherein the repeat expansion disease is Huntington's Disease.
106. A method of treating, preventing or delaying the onset of Huntington's Disease in a subject in need thereof, wherein the method comprises administering to the subject the rAAV particle of any one of 2 to 75 or 77 to 91.