SNAP25 Antisense Oligonucleotides, Composition and Their Use in Treating a Disease or Condition Involving the Expression of the Human SNAP25 Gene
A PNA derivative targeting SNAP25 pre-mRNA induces exon 7 skipping in SNAP25 mRNA, addressing the delivery challenges of botulinum toxin A and improving cellular permeability, offering a safer and more effective topical treatment for dermatological conditions.
Patent Information
- Application Number
- BR112019013203
- Authority / Receiving Office
- BR · BR
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2017-01-06
- Filing Date
- 2017-12-29
- Publication Date
- 2026-07-14
- Estimated Expiration
- 2037-12-29
Smart Images

Figure 00000063_0000 
Figure 00000063_0001 
Figure 00000064_0000
Abstract
Description
Descriptive Report of the Invention Patent for SNAP25 ANTISENSE OLIGONUCLEOTIDES, COMPOSITION AND THEIR USE TO TREAT A DISEASE OR CONDITION INVOLVING THE EXPRESSION OF THE HUMAN SNAP25 GENE.
[0001] The present invention relates to peptide nucleic acid derivatives targeting SNAP25 pre-mRNA for the treatment of dermatological indications or conditions mediated by the SNAP25 protein, and claims the benefit of priority under U.S. Provisional Application No. 62 / 443 262 filed January 6, 2017, which is incorporated herein by reference in its entirety. BACKGROUND OF THE INVENTION
[0002] Endocytosis is a process by which cells absorb large molecules into the cell. Meanwhile, exocytosis is a process by which cells secrete intracellular materials or contents outside the cell. There are abundant cell types that cleverly adopt exocytosis to secrete vesicular contents or materials outside the cell. Neuronal cells have evolved to secrete neurotransmitters via exocytosis for their intended physiological roles in communication with neighboring neuronal cells or surrounding tissues. As another example of exocytosis, mast cells release histamine via exocytosis and as a result recruit immune cells.
[0003] Secretory vesicles contain various types of vesicular materials that can vary depending on cell type. For example, presynaptic vesicles in neuronal cells are located in presynaptic neuronal terminals and contain a cocktail of neurotransmitters. The vesicular membrane fuses with the plasma membrane to release neurotransmitters into the synaptic region to control or physiologically affect neighboring cells or tissues. β cells in pancreatic islets possess vesicles loaded with insulin, and the vesicles undergo exocytosis involving membrane fusion to Petition 870240084853, dated 04 / 10 / 2024, page 8 / 141 2 / 50 Insulin release into the bloodstream in response to blood glucose levels [Cell Metabolism, vol 5, 237-252 (2007)].
[0004] Exocytosis is a cellular process involving a fusion of the vesicular membrane with the plasma membrane. There are two types of exocytosis, namely, constitutive and regulated. Constitutive exocytosis occurs spontaneously without a stimulating signal. Meanwhile, regulated exocytosis is triggered by a specific stimulating signal, for example, an increase in intracellular calcium ion concentration in neuronal motor cells [Am. Rev. Cell Dev. Biol. Vol 16, 19-49 (2000)].
[0005] Exocytosis at the synaptic junction: Neuronal cells communicate with each other using machinery called the synaptic junction, specialized in neuronal cells. The process of exocytosis occurring at the synaptic junction between neighboring neuronal cells is schematically illustrated in Figure 1A. First, vesicles containing neurotransmitter particles fuse with the presynaptic plasma membrane in response to a stimulatory signal such as a change in calcium ion concentration sensed by the neuronal axon. With membrane fusion, neurotransmitter particles are released at the presynaptic junction. Then, the neurotransmitter particles diffuse and bind to neurotransmitter receptors expressed on the dendritic membrane of a neighboring neuronal cell. Finally, the receptors are activated by complexation with the neurotransmitter molecule and transduce the neuronal signal transmitted from the axon of the neighboring neuronal cell.
[0006] Exocytosis at the Neuromuscular Junction: Motor neurons control muscle movement using exocytosis at the neuromuscular junction. In muscles, a motor neuron axon branches into a number of axon terminals to form junctions with the sarcolemma membrane of muscle cells, that is, neuromuscular junctions. Petition 870240084853, dated 04 / 10 / 2024, page 9 / 141 3 / 50 muscular. [Nat. Rev. Neuroscience, vol 2, 791-805 (2001)]. The gap between the neuronal axon terminal and the muscle cell membrane is called the synaptic cleft, with a dimension of approximately 30 nm.
[0007] When a nerve pulse in the form of an action potential reaches the axon terminal of a motor neuron, synaptic transmission begins at the neuromuscular junction. The motor neuron axon releases neurotransmitter molecules (i.e., acetylcholine in vertebrates) into the synaptic cleft via exocytosis, and acetylcholine receptors expressed on the muscle cell membrane are activated by complexation with acetylcholine, which triggers muscle fiber contraction. The exocytosis process occurring at the neuromuscular junction between the neuronal axon and the muscle cell is schematically illustrated in Figure 1B.
[0008] SNARE Proteins and Neuronal Exocytosis: The fusion of the vesicular membrane and neuronal cell membrane is essential for regulated exocytosis. Such regulated exocytosis is known to be mediated by SNARE proteins (soluble N-ethyl maleimide-sensitive factor-binding protein receptors). [Ann. Rev. Cell Dev. Biol. Vol 16, 1949 (2000)]. Three SNARE proteins are involved in neuronal exocytosis: vesicle-associated membrane protein (VAMP2, also known as synaptobrevin), a single-pass transmembrane protein located in the vesicular membrane (v-SNARE); 25 kDa synaptosome-associated protein (SNAP25); and syntaxin 1A, a single-pass transmembrane protein residing in the neuronal plasma membrane (t-SNARE). Syntaxin 1A and VAMP2 possess a C-terminal transmembrane domain for anchoring to the vesicular and neuronal plasma membranes, respectively.The membrane anchoring of SNAP25 is facilitated by palmitoyl groups covalently linked to several cysteine residues in the protein [Am. J. Physiol. Petition 870240084853, dated 04 / 10 / 2024, page 10 / 141 4 / 50 Cell Physiol. Vol 285, C237-249 (2003)].
[0009] The neuronal axon potential activates voltage-gated calcium channels and increases the concentration of calcium ions within the axon, which pulls down nearby synaptic vesicles from the presynaptic membrane through complexation of calcium ions with synaptotagmin. Then, the fusion of the synaptic vesicular membrane with the axonal plasma membrane is aided, as schematically illustrated in Figure 2A. The formation of the ternary complex of syntaxin, SNAP25, and snaptobrevin directs the two membranes toward proximity and then toward membrane fusion for the release of acetylcholine particles into the synaptic cleft. [Toxins vol. 2, 24-53 (2010)]. Thus, the formation of the ternary complex of SNARE proteins is the essential element of membrane fusion involved in neurotransmitter release.
[0010] Botulinum Toxin A: Botulinum toxin (BTX) is a neurotoxin produced by the bacterium Clostridium botulinum. The active form of the toxin is a simple polypeptide chain (150 kDa) consisting of a heavy chain (100 kDa) and a light chain (50 kDa) linked to each other by a disulfide bond. BTX is known to be readily absorbed into neuronal cells, cleave SNARE proteins, block the release of acetylcholine, consequently depriving the neuronal cell of a very essential function as a neuronal cell. Neuronal cells exposed to BTX fail to trigger the contraction of neighboring muscle fibers.
[0011] Upon entering a neuronal cell, BTX is cleaved into two parts, namely the light and heavy chains. The light chain is a zinc metalloprotease responsible for its role as a neurotoxin. Subtypes A, C, and E of BTX cleave SNAP25. Meanwhile, subtypes B, D, F, and G degrade VAMP, and subtype C hydrolyzes syntaxin. [Nature, vol. 365, 160-163 (1993)].
[0012] Cosmetic Use of Botulinum Toxin A: Botulinum Toxin A Petition 870240084853, dated 04 / 10 / 2024, page 11 / 141 5 / 50 was originally developed by Allergan for cosmetic use, primarily to treat facial wrinkles. Botox® is a well-known trademark of Allergan and is often used synonymously with BTX in public communities.
[0013] Given its physiological activity, BTX A can be used in principle to treat a number of disorders involving overactive muscle contractions or spasms of the head and neck, eyelids, limbs, jaw, and vocal cords. Additionally, BTX can be used to treat hypersecretion disorders including hypersalivation and hyperhidrosis. [Indian J. Dermatol. Vol 55, 8-14 (2010)].
[0014] Botox® injection was approved by the US FDA in 2002 for the treatment of facial wrinkles and is considered safe when properly administered by a skilled dermatologist. However, BTX is notorious for its toxicity. BTX types A and B, for example, are estimated to be lethal to humans if injected intravenously at 1.3–2.1 ng / kg [Indian J. Dermatol. Vol 55, 8–14 (2010)]. There are still concerns about the safety of BTX for cosmetic use. Facial paralysis, muscle weakness, and swallowing difficulties are the most common adverse events observed in individuals administered intramuscular BTX injections. More serious side effects are caused by systemic exposure due to overdose or poor local intramuscular injection skills and include headache, cold-like syndromes, and allergic reactions. Repeated BTX injections are known to induce antigenic responses, which limit the cosmetic use of BTX.Side effects from therapeutic use can be more serious than from cosmetic use, and may include arrhythmia, heart attack, seizures, respiratory failure, and death. [J. Am. Acad. Dermatol. Vol 53, 407-415 (2005)].
[0015] In order to minimize side effects in individuals receiving BTX injections for cosmetic use, localized release or Petition 870240084853, dated 04 / 10 / 2024, page 12 / 141 Topical 6 / 50 BTX may be much preferable to the conventional route of intramuscular injection. BTX is a macromolecule with a size of 150K. However, it remains an extreme challenge to topically deliver BTX deep into the muscle layer beneath the dermis without relying on invasive formulations.
[0016] Argireline: Argireline is a synthetic hexapeptide derived from the N-terminal of the SNAP25 protein. Argireline is marketed as a cosmetic product for facial wrinkles. The hexapeptide has been claimed to antagonize the formation of the SNARE complex with the SNAP25 protein. The hexapeptide is mimicking the function of BTX, and may be useful for reducing facial wrinkles with topical administration. Argireline has been reported to reduce facial wrinkles in human subjects with topical use. [Am. J. Clin. Dermatol. Vol 14(2), 147-153 (2013)].
[0017] Pre-mRNA: Genetic information is carried by DNA (2-deoxyribose nucleic acid). DNA is transcribed to produce pre-mRNA (pre-messenger ribonucleic acid) in the nucleus. Mammalian pre-mRNA usually consists of exons and introns, and exons and introns are interconnected as schematically provided below. Exons and introns are numbered as schematically illustrated in Figure 2B.
[0018] Pre-mRNA Splicing: Pre-mRNA is processed into mRNA following intron deletion through a series of complex reactions collectively called splicing, as schematically summarized in Figure 3A [Ann. Rev. Biochem. 72(1), 291-336 (2003); Nature Rev. Mol. Cell Biol. 6(5), 386-398 (2005); Nature Rev. Mol. Cell Biol. 15(2), 108-121 (2014)]. Splicing is initiated by the formation of the splicesome E complex (i.e., the initial splicesome complex) between pre-mRNA and splicing adapter factors. In the splicesome E complex, U1 binds to the N-exon and N-intron junction, and U2AF35 binds to the N-intron and (N+1) exon junction. Thus, exon / intron junctions or Petition 870240084853, dated 04 / 10 / 2024, page 13 / 141 7 / 50 intron / exon ratios are critical to the formation of the initial spliceosome complex. The spliceosome E complex evolves into the spliceosome A complex with additional complexation with U2. The spliceosome A complex undergoes a series of complex reactions to delete or remove the intron to remain in contact with neighboring exons.
[0019] Ribosomal Protein Synthesis: Proteins are encoded by DNA (2-deoxyribonucleic acid). In response to cellular stimulation or spontaneously, DNA is transcribed to produce premRNA (pre-messenger ribonucleic acid) in the nucleus. Introns from pre-mRNA are enzymatically removed to yield mRNA (messenger ribonucleic acid), which is then translocated into the cytoplasm. In the cytoplasm, a complex of translation machinery called the ribosome binds to the mRNA and performs protein synthesis by exploring the genetic information encoded along the mRNA. [Biochemistry vol 41, 4503-4510 (2002); Cancer Res. Vol 48, 2659-2668 (1988)].
[0020] Antisense oligonucleotide (ASO): An oligonucleotide that binds to nucleic acids, including DNA, mRNA, and pre-mRNA, in a sequence-specific manner (i.e., complementarily) is called an antisense oligonucleotide (ASO).
[0021] If an ASO binds strongly to an mRNA in the cytoplasm, for example, the ASO may be able to inhibit ribosomal protein synthesis along the mRNA. ASO needs to be present within the cytoplasm in order to inhibit ribosomal protein synthesis of its target protein.
[0022] If an ASO binds strongly to a premRNA in the nucleus, the ASO may be able to inhibit or modulate the separation of premRNA into mRNA. The ASO needs to be inside the nucleus in order to inhibit or modulate the separation of premRNA into mRNA. Such antisense inhibition of separation produces an mRNA or mRNAs lacking exon direction. Petition 870240084853, dated 04 / 10 / 2024, page 14 / 141 8 / 50 encoded by ASO. Such mRNAs are called splicing variants, and they encode proteins smaller than the protein encoded by the full-length mRNA.
[0023] In principle, splicing can be interrupted by inhibiting the formation of the spliceosome E complex. If an ASO binds strongly to an exon-intron junction (5'^3'), i.e., a 5' splice site, the ASO blocks the formation of a complex between pre-mRNA and U1 factor, and therefore the formation of the spliceosome E complex. Similarly, the spliceosome E complex cannot be formed if an ASO binds strongly to an intron-exon junction (5'^3'), i.e., a 3' splice site. The 3' splice site and the 5' splice site are schematically illustrated in Figure 3B.
[0024] Non-Natural Oligonucleotides: DNA Oligonucleotides or RNA is susceptible to degradation by endogenous nucleases, limiting its therapeutic usefulness. Currently, many types of non-natural (i.e., not naturally occurring) oligonucleotides have been developed and intensively studied. [Clin. Exp. Pharmacol. Physiol. Vol 33, 533-540 (2006)]. Some of them show extended metabolic stability compared to DNA and RNA. Chemical structures for some representative non-natural oligonucleotides are provided in Figure 4A. Such oligonucleotides predictably bind to complementary nucleic acid as DNA or RNA do.
[0025] Phosphorothioate oligonucleotide: Phosphorothioate oligonucleotide (PTO) is a DNA analog with one of the oxygen atoms of the backbone phosphate replaced with a sulfur atom per monomer. This small structural change makes PTO comparatively resistant to degradation by endogenous nucleases. [Ann. Rev. Biochem. Vol 54, 367-402 (1985)].
[0026] Reflecting the structural similarity in the main chain of PTO and DNA both penetrate the cell membrane poorly in Petition 870240084853, dated 04 / 10 / 2024, page 15 / 141 9 / 50 most mammalian cell types. For some cell types abundantly expressing DNA transporter(s), however, DNA and PTOs show good cell penetration. Systemically administered PTOs are known to distribute readily to the liver and kidney. [Nucleic Acids Res. Vol 25, 3290-3296 (1997)].
[0027] In order to facilitate the cellular penetration of PTO in vitro, lipofection has been popularly employed. However, lipofection physically alters the cell membrane, triggers cytotoxicity, and therefore may not be ideal for long-term therapeutic use in vivo.
[0028] Over the last 30 years, PTOs antisense and variants of PTOs have been clinically evaluated for treating cancers, immunological disorders, metabolic diseases, and so on. [Biochemistry vol 41, 4503-4510 (2002); Clin. Exp. Pharmacol. Physiol. Vol 33, 533-540 (2006)]. Many such antisense drug candidates have not been successfully developed, in part due to the poor cellular permeability of PTOs. In order to overcome poor cellular permeability, PTOs need to be administered at high doses for therapeutic activity. However, PTOs are known to exhibit dose-limiting toxicity including increased clotting time, complement activation, tubular nephropathy, Kupffer cell activation, and immune stimulation including splenomegaly, lymphoid hyperplasia, and mononuclear cell infiltration. [Clin. Exp. Pharmacol. Physiol. Vol 33, 533-540 (2006)].
[0029] Many antisense PTOs have been observed exhibiting clinical activity for diseases with a significant contribution from the liver or kidney. Mipomersen is a PTO analog that inhibits the synthesis of apoB-100, a protein involved in LDL cholesterol transport. Mipomersen has shown therapeutic activity in a population of atherosclerosis patients most likely due to its Petition 870240084853, dated 04 / 10 / 2024, page 16 / 141 10 / 50 preferential distribution to the liver. [Circulation vol 118(7), 743-753 (2008)]. ISIS-113715 is an antisense analog of PTO inhibiting the synthesis of protein tyrosine phosphatase 1B (PTB1B), and has been found to show therapeutic activity in patients with type II diabetes [Curr. Opin. Mol. Ther. Vol 6, 331-336 (2004)].
[0030] Blocked Nucleic Acid: In blocked nucleic acid (LNA), the ribose ring of the RNA backbone is structurally restricted to increase binding affinity for RNA or DNA. Thus, LNA can be considered a high-affinity RNA or DNA analog. [Biochemistry vol 45, 7347-7355 (2006)].
[0031] Morpholino phosphorodiamidate oligonucleotide: In morpholino phosphorodiamidate (PMO) oligonucleotide, the phosphate and 2-deoxyribose backbones of DNA are replaced with phosphoroamidate and morpholine, respectively. [Appl. Microbiol. Biotechnol. Vol 71, 575586 (2006)]. Although the DNA backbone is negatively charged, the PMO backbone is not charged. Thus, the bond between PMO and RNA is free of electrostatic repulsion between the backbones and tends to be stronger than the bond between DNA and RNAs. Because PMO is structurally very different from DNA, PMO cannot be recognized by liver transporter(s) that recognize DNA or RNA. Nevertheless, PMO does not readily penetrate the cell membrane.
[0032] Peptide nucleic acid: Peptide nucleic acid (PNA) is a polypeptide with N-(2-aminoethyl)glycine as the unit backbone, and was discovered by Dr. Nielsen and colleagues [Science vol 254, 1497-1500 (1991)]. The chemical structure and abbreviated nomenclature of PNA are illustrated in Figure 4B. Like DNA and RNA, PNA also selectively binds to complementary nucleic acid. [Nature (London) vol 365, 566-568 (1992)]. In binding to complementary nucleic acid, the N-terminal of PNA is seen as equivalent to the end Petition 870240084853, dated 04 / 10 / 2024, page 17 / 141 11 / 50 5' of DNA or RNA, and the C-terminal of PNA as equivalent to the 3' end of DNA or RNA.
[0033] As PMO, the main PNA chain is not loaded. Thus, the binding between PNA and RNA tends to be stronger than the binding between DNA and RNA. Since PNA is markedly different from DNA in chemical structure, PNA cannot be recognized by the hepatic transporter(s) that recognize DNA, and may show a different tissue distribution profile than that of DNA or PTO. However, PNA also penetrates the mammalian cell membrane poorly. (Adv. Drug Delivery Rev. Vol 55, 267-280, 2003).
[0034] Modified nucleobases for improved membrane permeability of PNA: PNA was made highly permeable to the mammalian cell membrane through the introduction of modified nucleobases (i.e., bases) with a cationic lipid or its equivalent covalently linked to it, as exemplified in Figure 4C. Such modified cytosine, adenine, and guanine nucleobases were found to predictably and complementarily hybridize with guanine, thymine, and cytosine, respectively. [PCT Appl. No. PCT / KR2009 / 001256; EP2268607; US8680253].
[0035] Incorporation of such modified nucleobases onto PNA simulates lipofection situations. Through lipofection, oligonucleotide molecules with a phosphate backbone are bound to cationic lipid molecules such as lipofectamine, and such a lipofectamine / oligonucleotide complex tends to penetrate the cell membrane more easily compared to the bare oligonucleotide molecule.
[0036] In addition to good membrane permeability, those PNA derivatives were found to possess ultra-strong affinity for complementary nucleic acid. For example, introduction of 4 to 5 modified nucleobases onto 11- to 13-mer PNA derivatives easily yielded a Tm gain of 20°C or greater in the formation of Petition 870240084853, dated 04 / 10 / 2024, page 18 / 141 12 / 50 duplex with complementary DNA. Such PNA derivatives are highly sensitive to single base mismatch. A single base mismatch resulted in a Tm loss of 11 to 22°C depending on the type of base modified as well as the PNA sequence.
[0037] Small interfering RNA (siRNA): Small interfering RNA (siRNA) refers to a double-stranded RNA of 20-25 base pairs. [Microbiol. Mol. Biol. Rev. Vol 67(4), 657-685 (2003)]. The antisense strand of siRNA interacts slightly with proteins to form an RNA-induced silencing complex (RISC). Then the RISC binds to a certain portion of the mRNA complementary to the antisense strand of siRNA. The mRNA complexed with RISC undergoes cleavage to yield another copy of double-stranded siRNA. Thus, siRNA catalytically induces the cleavage of its target mRNA, and consequently inhibits protein expression by the mRNA. RISC does not always bind to the entire complementary sequence within its target mRNA, which gives rise to concepts of off-target effects in siRNA therapy.Like other classes of oligonucleotides with DNA or RNA backbones, siRNA has poor cell permeability and therefore tends to show poor therapeutic activity in vitro or in vivo unless properly formulated or chemically modified to exhibit good membrane permeability.
[0038] SNAP25 ASOs and siRNAs: SNAP25 ASOs and siRNAs have been primarily evaluated as a biological tool to better understand the physiological rules of the SNAP25 protein in neuronal cells. [Nature vol 364, 445-448 (1993); Eur. J. Neurosci. vol 20(6), 1593-1603 (2004); EMBO Reports vol 14(7) 645-651 (2013); J. Biol. Chem. vol 281(38), 28174-28184 (2006)]. Oligonucleotides downregulating SNAP25 protein activity still need to be investigated for topical use to reliably mimic therapeutic activities. Petition 870240084853, dated 04 / 10 / 2024, page 19 / 141 13 / 50 beneficial effects of BTX. It should be noted that transdermal delivery has been a huge technical challenge in the field of oligonucleotides. Brief Description of Figures
[0039] Figure 1A: Schematic illustration of the exocytosis process occurring at the synaptic junction between two neighboring neuronal cells.
[0040] Figure 1B: Schematic illustration of the exocytosis process occurring at the neuromuscular junction between the neuronal axon and the muscle cell.
[0041] Figure 2A. Schematic illustration of the fusion of the synaptic vesicular membrane with the axonal plasma membrane.
[0042] Figure 2B: Schematic illustration of the numbering of exons and introns within a pre-mRNA.
[0043] Figure 3A. Schematic illustration of the splicing process leading to the deletion of the N intron.
[0044] Figure 3B. Schematic illustration of the 3' splice site and the 5' splice site in relation to the spliceosome complex E.
[0045] Figure 4A. Representative chemical structures for DNA and non-natural nucleic acids.
[0046] Figure 4B. Illustration for the chemical structure and abbreviated nomenclature of PNA.
[0047] Figure 4C. Examples of modified nucleobases used to improve the permeability of peptide nucleic acid cells.
[0048] Figure 5. Examples of natural or non-natural (modified) nucleobases selectable for the peptide nucleic acid derivative of Formula I.
[0049] Figure 6A. Examples for substituted or unsubstituted alkyl radicals that are selectable for the peptide nucleic acid derivative of Formula I. Petition 870240084853, dated 04 / 10 / 2024, page 20 / 141 14 / 50
[0050] Figure 6B. Examples for substituted or unsubstituted alkyl acyl radicals, and substituted or unsubstituted aryl acyl radicals, which are selectable for the peptide nucleic acid derivative of Formula I.
[0051] Figure 6C. Examples for substituted alkyl amino radicals, substituted aryl amino radicals, substituted or unsubstituted aryl radicals, substituted or unsubstituted alkyl sulfonyl radicals, substituted or unsubstituted aryl sulfonyl radicals, substituted or unsubstituted alkyl phosphonyl radicals, and substituted or unsubstituted aryl phosphonyl radicals, which are selectable for the peptide nucleic acid derivative of Formula I.
[0052] Figure 6D. Examples for substituted or unsubstituted alkyloxy carbonyl radicals, substituted or unsubstituted aryloxy carbonyl radicals, substituted or unsubstituted alkyl amino carbonyl radicals, and substituted or unsubstituted aryl amino carbonyl radicals, which are selectable for the peptide nucleic acid derivative of Formula I.
[0053] Figure 6E. Examples for substituted or unsubstituted alkyloxy thiocarbonyl radicals, substituted or unsubstituted alkyl amino thiocarbonyl radicals, substituted or unsubstituted aryl amino thiocarbonyl radicals, and substituted or unsubstituted alkyloxy thiocarbonyl radicals, which are selectable for the peptide nucleic acid derivative of Formula I.
[0054] Figure 7. Chemical structures for PNA monomers abbreviated as A (adenine), G (guanine), T (thymine), C (cytosine), C(pOq), A(p), A(pOq), G(p), and G(pOq).
[0055] Figure 8. Chemical structures of abbreviations used to describe substituents for N-terminal or C-terminal PNA.
[0056] Figure 9. Chemical structure for the PNA derivative of 14mer abbreviated as (N ^ C) Fethoc-GA(5)AC(1O2)TT-A(5)TCCTA(5)-C(1O2)T-NH2.
[0057] Figure 10. Chemical structure for the 15mer PNA derivative abbreviated as (N^C)Fmoc-Val-CTC(1O2)-A(5)TC-CTA(6) Petition 870240084853, dated 04 / 10 / 2024, p. 21 / 141 15 / 50 C(103)TT-AA(2O2)C-NH2.
[0058] Figure 11. Chemical structures for exemplary Fmoc-PNA monomers used to synthesize the PNA derivatives of this invention.
[0059] Figure 12. Schematic illustration of a typical monomer elongation cycle adopted in SPPS of this invention.
[0060] Figure 13A. Reversed-phase HPLC chromatogram - Cw for ASO 1 before purification with HPLC.
[0061] Figure 13B. Reversed-phase HPLC chromatogram - Cw for ASO 1 after purification with HPLC.
[0062] Figure 14. ES-TOF mass spectral data obtained with ASO 1 after purification with HPLC.
[0063] Figure 15A. Electrophoretic analysis data for PCR products nested in PC12 cells treated with 0 (negative control), 10, 100 or 1000 zM ASO3 (top); along with a diagram illustrating the amplicon sizes of the PCR products for the full-length mRNA and the exon-skipping splicing variant mRNAs (bottom).
[0064] Figure 15B. Sanger sequencing data for the PCR product designated for the 5-7 exon skip.
[0065] Figure 16A. Changes in full-length SNAP25 mRNA level in PC12 cells treated with ASO 3 at 0 (negative control), 10, 100, or 1000 zM (error bar through standard error).
[0066] Figure 16B. Changes in full-length SNAP25 mRNA level in PC12 cells treated with ASO 1 at 0 (negative control), 10, 100, or 1000 zM. (error bar by standard error).
[0067] Figure 17A. Western blot data of SNAP25 (top diagram) and normalized relative expression levels of SNAP25 against β-actin (bottom diagram) in PC12 cells treated with ASO3 for 48 hours at 0 zM (negative control), 1 zM, 10 zM, 30 zM, 100 Petition 870240084853, dated 04 / 10 / 2024, page 22 / 141 16 / 50 zM, 300 zM, 1 aM, 3 aM, or 10 aM.
[0068] Figure 17B. Western blot data of SNAP25 in cells PC12 treated with ASO 1 in 0 (negative control), 100 or 1000 zM for either 48 hours or 72 hours.
[0069] Figure 18. IHC images of SNAP25 for skin samples from mice administered topically with ASO 1 at 0 (negative control), 1, 10 and 100 fM, BID for four days.
[0070] Figure 19A. Western blot data of SNAP25 (top diagram) and normalized relative expression levels of SNAP25 against β-actin (bottom diagram) in SiMa cells treated with ASO 3 for 48 hours at 0 zM (negative control), 1 zM, 10 zM, 100 zM, 1 aM, 10 aM, or 100 aM.
[0071] Figure 19B. Changes in full-length SNAP25 mRNA level in SiMa cells treated with ASO 3 at 0 zM (negative control), 1 zM, 10 zM, 100 zM, 1 aM, 10 aM, or 100 aM (error bar through standard error). Summary of the Invention
[0072] The present invention provides a peptide nucleic acid derivative represented by Formula I, or a pharmaceutically acceptable salt thereof: Formula 1 where,
[0073] n is an integer between 10 and 25;
[0074] the compound of Formula I has at least one complementary 10-mer overlap with a 14-mer pre-mRNA sequence of [(5' ^ 3') AUCCCAGGGUAACA] in human SNAP25 pre-mRNA;
[0075] the compound of Formula I is fully complementary to the Petition 870240084853, dated 04 / 10 / 2024, p. 23 / 141 17 / 50 human SNAP25 pre-mRNA, or partially complementary to human SNAP25 pre-mRNA with one or two mismatches;
[0076] Si, S2, ..., Sn-1, Sn, T1, T2, ..., Tn-1, and Tn independently represent deuteride [D], hydride [H}, substituted or unsubstituted alkyl radical, or substituted or unsubstituted aryl radical;
[0077] X and Y independently represent hydride radical, formyl [HC(=O)-], aminocarbonyl [NH2-C(=O)-], aminothiocarbonyl [NH2C(=S)-], substituted or unsubstituted alkyl, substituted or unsubstituted aryl, substituted or unsubstituted alkyl acyl, substituted or unsubstituted aryl acyl, substituted or unsubstituted alkyloxy carbonyl, substituted or unsubstituted aryloxy carbonyl, substituted or unsubstituted alkyl amino carbonyl, substituted or unsubstituted aryl amino carbonyl, substituted or unsubstituted alkyl amino thiocarbonyl, substituted or unsubstituted aryl amino thiocarbonyl, substituted or unsubstituted alkyloxy thiocarbonyl, substituted or unsubstituted aryloxy thiocarbonyl, substituted or unsubstituted alkyl sulfonyl, substituted or unsubstituted aryl sulfonyl, substituted or unsubstituted alkyl phosphonyl, or substituted or unsubstituted aryl phosphonyl;
[0078] Z represents hydride, hydroxy, substituted or unsubstituted amino, substituted or unsubstituted alkyl, or substituted or unsubstituted aryl radical;
[0079] B1, B2, ..., Bn-1, and Bn are selected independently from natural nucleobases including adenine, thymine, guanine, cytosine, and uracil, and non-natural nucleobases; and,
[0080] at least four of B1, B2, ..., Bn-1, and Bn are independently selected from non-natural nucleobases with a substituted or unsubstituted amino radical covalently bonded to the nucleobase moiety.
[0081] The compound of Formula I induces exon 7 skipping in the pre Petition 870240084853, dated 04 / 10 / 2024, p. 24 / 141 18 / 50 human SNAP25 mRNA yields human SNAP25 mRNA splice variant(s) lacking exon 7, and is therefore useful for inhibiting the functional activity of the gene by transcribing human SNAP25 pre-mRNA.
[0082] The condition adopted to describe the compound of Formula The statement that n is an integer between 10 and 25 literally establishes that n is a selectable integer from a group of integers 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, and 24.
[0083] The compound of Formula I binds complementarily to the 3' splice site of exon 7 of the human SNAP25 preRNA read from the human SNAP25 gene [accessed from NCBI Reference Sequence: NG_029626.1]. The 14-mer sequence [(5' ^ 3') AUCCCAGGGUAACA] extending the intron 6 and exon 7 junction in human SNAP25 premRNA is a 3' splice site consisting of a 7-mer from intron 6 and a 7-mer from exon 7. Thus, the 14-mer premRNA sequence can be conventionally represented as [(5' ^ 3') aucccag | GGUAACA], where the intron and exon sequences are represented with lowercase letters, respectively, and the intron-exon junction is marked with I. The conventional representation for premRNA is further illustrated by a 30-mer sequence [(5' ^ 3') cucuuuggaucccag | GGUAACAAAUGAUGC] extending the intron 6 and exon 7 junction in human SNAP25 premRNA. The exon numbering may vary depending on the reported SNAP25 mRNA transcripts.The provision for the 30-mer SNAP25 sequence is to unequivocally identify the target splice site of the Formula I compound independent of the SNAP25 mRNA exon numbering.
[0084] Chemical structures of natural (i.e., naturally occurring) or non-natural (i.e., not naturally occurring) nucleobases in the PNA derivative of Formula I are exemplified in the Figure Petition 870240084853, dated 04 / 10 / 2024, p. 25 / 141 19 / 50 5. Natural or non-natural nucleobases of this invention include, but are not limited to, the nucleobases provided in Figure 5. The provision of such natural and non-natural nucleobases is to illustrate the diversity of permissible nucleobases and should therefore not be interpreted as limiting the scope of the present invention.
[0085] The substituents adopted to describe the derivative of PNA of Formula I are exemplified in Figures 6 AE. Figure 6A provides examples for substituted or unsubstituted alkyl radicals. Substituted or unsubstituted alkyl acyl and aryl acyl radicals are exemplified in Figure 6B. Figure 6C illustrates examples for substituted alkyl amino, substituted aryl amino, substituted or unsubstituted aryl, substituted or unsubstituted alkyl sulfonyl, substituted or unsubstituted aryl sulfonyl, substituted or unsubstituted alkyl phosphonyl, and substituted or unsubstituted aryl phosphonyl. Figure 6D provides examples for substituted or unsubstituted alkyl oxy carbonyl radicals, substituted or unsubstituted aryl oxy carbonyl, substituted or unsubstituted alkyl amino carbonyl, and substituted or unsubstituted aryl amino carbonyl.Figure 6E provides examples of substituted or unsubstituted alkyloxy thiocarbonyl radicals, substituted or unsubstituted alkyl amino thiocarbonyl radicals, substituted or unsubstituted aryl amino thiocarbonyl radicals, and substituted or unsubstituted alkyloxy thiocarbonyl radicals. The provision of such substituents as examples is to illustrate the diversity of permissible substituents and should therefore not be interpreted as limiting the scope of the present invention. Those skilled in the field can readily understand that the oligonucleotide sequence is the primary factor for specific oligonucleotide sequence binding to the target pre-mRNA sequence on substituents at the N-terminus or C-terminus.
[0086] The compound with Formula I binds strongly to DNA with Petition 870240084853, dated 04 / 10 / 2024, p. 26 / 141 20 / 50 complementary as exemplified in the previous technique [PCT / KR2009 / 001256]. The duplex between the Formula I PNA derivative and its full-length complementary DNA or RNA has a Tm value that is too high to be reliably determined in aqueous buffer. The Formula I PNA compound yields high Tm values with shorter complementary DNAs.
[0087] The compound of Formula I binds strongly to the target 3' splice site of the human SNAP25 pre-mRNA transcribed from the human SNAP25 gene, and interferes with the formation of the initial spliceosome complex involving said target exon of the compound. Since the compound of this invention sterically inhibits the formation of the initial spliceosome complex, exon 7 of SNAP25 is removed to yield SNAP25 mRNA splicing variant(s) lacking exon 7. Consequently, the compound of this invention induces SNAP25 exon 7 skipping.
[0088] Due to the strong affinity of said compound for the complementary pre-mRNA sequence, the compound of this invention can also bind strongly to a partially complementary pre-mRNA sequence with one or two mismatches, and induce target exon hopping within SNAP25 pre-mRNA.
[0089] The compound of Formula I possesses good cell permeability and can be readily released into the cell as a bare oligonucleotide as exemplified in the prior art [PCT / KR2009 / 001256]. Thus, the compound of this invention induces exon 7 skipping in SNAP25 pre-mRNA to yield SNAP25 mRNA splicing variant(s) lacking SNAP25 exon 7 in cells treated with the compound of Formula I as a bare oligonucleotide. The compound of Formula I does not require any means or formulations for cell release to potentially induce target exon skipping in cells. The compound of Formula I readily induces SNAP25 exon 7 skipping. Petition 870240084853, dated 04 / 10 / 2024, page 27 / 141 21 / 50 in cells treated with the compound of this invention as a naked oligonucleotide at sub-fentomolar concentration.
[0090] Due to its good cell or membrane permeability, the PNA derivative of Formula I can be administered topically as a naked oligonucleotide to induce exon 7 SNAP25 jumping in target skin. Said compound does not require a formulation to enhance transdermal release in the target tissue for the intended therapeutic or biological activity. Usually, the compound of Formula I is dissolved in water and cosolvents and administered topically or transdermally at a subpicomolar concentration to trigger the desired therapeutic or biological activity around the administration site in the dermis. The compound of this invention does not need to be heavily or invasively formulated to trigger topical therapeutic activity.
[0091] The compound of Formula I can be used in combination with a pharmaceutically acceptable acid or base including but not limited to sodium hydroxide, potassium hydroxide, hydrochloric acid, methanesulfonic acid, citric acid, trifluoroacetic acid, and so on.
[0092] The PNA derivative of Formula I or a pharmaceutically acceptable salt thereof may be administered to an individual in combination with a pharmaceutically acceptable adjuvant including but not limited to citric acid, hydrochloric acid, tartaric acid, stearic acid, polyethylene glycol, polypropylene glycol, ethanol, isopropanol, sodium bicarbonate, distilled water, preservative(s), and so forth.
[0093] The compound of the present invention can be administered topically to an individual at a therapeutically or biologically effective concentration ranging from 1 aM (i.e., 10-18M) to greater than 1 nM, which may vary depending on the dosing schedule. Petition 870240084853, dated 04 / 10 / 2024, p. 28 / 141 22 / 50 conditions or situations of the individual, and so on.
[0094] A PNA derivative of Formula I, or a pharmaceutically acceptable salt thereof, is preferred: where,
[0095] n is an integer between 10 and 25;
[0096] the compound of Formula I has at least one complementary 10-mer overlap with a 14-mer pre-mRNA sequence of [(5' ^ 3') AUCCCAGGGUAACA] in human SNAP25 pre-mRNA;
[0097] the compound of Formula I is fully complementary to the SNAP25 pre-mRNA, or partially complementary to the SNAP25 pre-mRNA with one or two unpairings;
[0098] Si, S2, ..., Sn-1, Sn, T1, T2, ..., Tn-1, and Tn independently represent deuteride [D], hydride [H}, substituted or unsubstituted alkyl radical, or substituted or unsubstituted aryl radical;
[0099] X and Y independently represent hydride radical, formyl, aminocarbonyl, aminothiocarbonyl, substituted or unsubstituted alkyl, substituted or unsubstituted aryl, substituted or unsubstituted alkyl acyl, substituted or unsubstituted aryl acyl, substituted or unsubstituted alkyloxy carbonyl, substituted or unsubstituted aryloxy carbonyl, substituted or unsubstituted alkyl amino carbonyl, substituted or unsubstituted aryl amino carbonyl, substituted or unsubstituted alkyl aminothiocarbonyl, substituted or unsubstituted aryl aminothiocarbonyl, substituted or unsubstituted alkyloxy thiocarbonyl, substituted or unsubstituted aryloxy thiocarbonyl, substituted or unsubstituted alkyl sulfonyl, substituted or unsubstituted aryl sulfonyl, substituted or unsubstituted alkyl phosphonyl, or substituted or unsubstituted aryl phosphonyl;
[00100] Z represents hydride, hydroxy, substituted or unsubstituted amino, substituted or unsubstituted alkyl, or aryl radical. Petition 870240084853, dated 04 / 10 / 2024, p. 29 / 141 23 / 50 tuitated or not replaced;
[00101] Bi, B2, ..., Bn-1, and Bn are selected independently from natural nucleobases including adenine, thymine, guanine, cytosine, and uracil, and non-natural nucleobases; and,
[00102] at least four of Bi, B2, ..., Bn-i, and Bn are independently selected from non-natural nucleobases with a substituted or unsubstituted amino radical covalently bonded to the nucleobases represented by Formula II, Formula III, or Formula IV: where,
[00103] R1, R2, R3, RR4, R5 and Re are selected independently of hydride radical, and substituted or unsubstituted alkyl;
[00104] L1, L2 and L3 are a covalent ligand represented by Formula V covalently linking the basic amino group to the nucleobase moiety: where,
[00105] Q1 and Qm are substituted or unsubstituted methylene radicals (-CH2-), and Qm is directly attached to the basic amino group;
[00106] Q2, Q3, ..., and Qm.1 are independently selected from substituted or unsubstituted methylene, oxygen (-O-), sulfur (-S-), and substituted or unsubstituted amino radical [-N(H)-, or -N(substituent)-]; and,
[00107] m is an integer between 1 and 15.
[00108] The condition adopted to describe Formula V is that m is a Petition 870240084853, dated 04 / 10 / 2024, p. 30 / 141 24 / 50, an integer between 1 and 15, literally establishes that m is a selectable integer from the set of integers 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, and 14.
[00109] Of interest is a PNA oligomer of Formula I, or a pharmaceutically acceptable salt thereof: where,
[00110] n is an integer between 11 and 21;
[00111] the compound of Formula I has at least one complementary 10-mer overlap with a 14-mer pre-mRNA sequence of [(5' ^3') AUCCCAGGGUAACA] in human SNAP25 pre-mRNA;
[00112] the compound of Formula I is either fully complementary to human SNAP25 premRNA, or partially complementary to human SNAP25 premRNA with one or two mismatches;
[00113] Si, S2, ..., Sn-1, Sn, Ti, T2.....Tn-1, and Tn are hydrido radicals;
[00114] X and Y independently represent hydride radicals, substituted or unsubstituted alkyl, substituted or unsubstituted aryl, substituted or unsubstituted alkyl acyl, substituted or unsubstituted aryl acyl, substituted or unsubstituted alkyl oxy carbonyl, substituted or unsubstituted aryl oxy carbonyl, substituted or unsubstituted alkyl amino carbonyl, substituted or unsubstituted aryl amino carbonyl, substituted or unsubstituted alkyl sulfonyl, or substituted or unsubstituted aryl sulfonyl;
[00115] Z represents substituted or unsubstituted amino radical;
[00116] B1, B2, ..., Bn-1, and Bn are selected independently from natural nucleobases including adenine, thymine, guanine, cytosine, and uracil, and non-natural nucleobases;
[00117] At least four of B1, B2, ..., Bn-1, and Bn are selected independently of non-natural nucleobases represented by Petition 870240084853, dated 04 / 10 / 2024, p. 31 / 141 25 / 50 Formula II, Formula III, or Formula IV;
[00118] Ri, R2, R3, R4, R5 and Re are selected independently of hydride, and substituted or unsubstituted alkyl radical;
[00119] Qi and Qm are substituted or unsubstituted methylene radicals, and Qm is directly attached to the basic amino group;
[00120] Q2, Q3, ..., and Qm-1 are selected independently of substituted or unsubstituted methylene radical, oxygen, and amino; and,
[00121] m is an integer between 1 and 11.
[00122] Of particular interest is a PNA derivative of Formula I, or a pharmaceutically acceptable salt thereof: where,
[00123] n is an integer between 11 and 19;
[00124] the compound of Formula I has at least one complementary 10-mer overlap with a 14-mer pre-mRNA sequence of [(5' ^ 3') AUCCCAGGGUAACA] in human SNAP25 pre-mRNA;
[00125] the Formula I compound is fully complementary to human SNAP25 premRNA;
[00126] S1, S2, ..., Sn-1, T1, T2.....Tn-1, and Tn are hydrido radical;
[00127] X and Y independently represent a hydric radical, substituted or unsubstituted alkyl, substituted or unsubstituted aryl, substituted or unsubstituted alkyl acyl, substituted or unsubstituted aryl acyl, substituted or unsubstituted alkyl oxy carbonyl, substituted or unsubstituted alkyl amino carbonyl, substituted or unsubstituted alkyl sulfonyl, or substituted or unsubstituted aryl sulfonyl;
[00128] Z represents substituted or unsubstituted amino radical;
[00129] B1, B2, ..., Bn-1, and Bn are independently selected from nucleobases including adenine, thymine, guanine, cytosine, and uracil, and non-natural nucleobases; Petition 870240084853, dated 04 / 10 / 2024, p. 32 / 141 26 / 50
[00130] at least four of Bi, B2, ..., Bn-1, and Bn are selected independently of non-natural nucleobases represented by Formula II, Formula III, or Formula IV;
[00131] Ri, R2, R3, R4, R5 and R6 are selected independently of hydride radical, and substituted or unsubstituted alkyl;
[00132] Q1 and Qm are methylene radicals, and Qm is directly attached to the basic amino group;
[00133] Q2, Q3, ..., and Qm-1 are selected independently of methylene, oxygen, and amino radicals; and,
[00134] m is an integer between 1 and 9.
[00135] Of high interest is an oligomer of Formula I, or a pharmaceutically acceptable salt thereof: where,
[00136] n is an integer between 11 and 19;
[00137] the compound of Formula I has at least one complementary 10-mer overlap with a 14-mer pre-mRNA sequence of [(5' ^ 3') AUCCCAGGGUAACA] in human SNAP25 pre-mRNA;
[00138] the Formula I compound is fully complementary to human SNAP25 premRNA;
[00139] S1, S2, ..., Sn-1, Sn, T1, T2.....Tn-1, and Tn are hydrido radical;
[00140] X and Y independently represent hydride radical, substituted or unsubstituted alkyl, substituted or unsubstituted aryl, substituted or unsubstituted alkyl acyl, substituted or unsubstituted aryl acyl, or substituted or unsubstituted alkoxy carbonyl;
[00141] Z represents substituted or unsubstituted amino radical;
[00142] B1, B2, ..., Bn-1, and Bn are selected independently from natural nucleobases including adenine, thymine, guanine, cytosine, and uracil, and non-natural nucleobases;
[00143] at least four of B1, B2, ..., Bn-1, and Bn are selected Petition 870240084853, dated 04 / 10 / 2024, p. 33 / 141 27 / 50 regardless of non-natural nucleobases represented by Formula II, Formula III, or Formula IV;
[00144] Ri, R3, and R5 are hydride radicals, and R2, R4, and R6 independently represent hydride radicals, or substituted or unsubstituted alkyl groups;
[00145] Q1 and Qm are methylene radicals, and Qm is directly attached to the basic amino group;
[00146] Q2, Q3, ..., and Qm-1 are selected independently of methylene radical, oxygen; and,
[00147] m is an integer between 1 and 8.
[00148] Of greater interest is a PNA derivative of Formula I, or a pharmaceutically acceptable salt thereof: where,
[00149] n is an integer between 11 and 19;
[00150] the compound of Formula I has at least one complementary 10-mer overlap with a 14-mer pre-mRNA sequence of [(5' ^ 3') AUCCCAGGGUAACA] in human SNAP25 pre-mRNA;
[00151] the Formula I compound is fully complementary to human SNAP25 premRNA;
[00152] Si, S2, ..., Sn-1, Sn, T1, T2.....Tn-1, and Tn are hydrido radical;
[00153] X is a hybrid radical;
[00154] Y represents substituted or unsubstituted alkyl acyl radical, substituted or unsubstituted aryl acyl radical, or substituted or unsubstituted alkyloxy carbonyl radical;
[00155] Z represents substituted or unsubstituted amino radical;
[00156] B1, B2, ..., Bn-1, and Bn are selected independently of adenine, thymine, guanine, cytosine, and non-natural nucleobases;
[00157] at least five of B1, B2, ..., Bn-1, and Bn are selected independently of non-natural nucleobases represented by Petition 870240084853, dated 04 / 10 / 2024, p. 34 / 141 28 / 50 Formula II, Formula III, or Formula IV;
[00158] Ri, R2, R3, R4, R5, and Re are hydride radicals;
[00159] Qi and Qm are methylene radicals, and Qm is directly attached to the basic amino group;
[00160] Q2, Q3, ..., and Qm-i are selected independently of methylene radical, oxygen; and,
[00161] m is an integer between 1 and 8.
[00162] Of greater interest is a PNA derivative of Formula I, or a pharmaceutically acceptable salt thereof: where,
[00163] the Formula I compound is fully complementary to human SNAP25 premRNA;
[00164] S1, S2, ..., Sn-1, Sn, T1, T2, ..., Tn-1, and Tn are hydrido radical;
[00165] X and Y independently represent hydride radical, substituted or unsubstituted alkyl, substituted or unsubstituted aryl, substituted or unsubstituted alkyl acyl, substituted or unsubstituted aryl acyl, or substituted or unsubstituted alkoxy carbonyl;
[00166] Z represents substituted or unsubstituted amino radical;
[00167] B1, B2, ..., Bn-1, and Bn are selected independently from natural nucleobases including adenine, thymine, guanine, cytosine, and non-natural nucleobases;
[00168] at least five of B1, B2, ..., Bn-1, and Bn are selected independently of non-natural nucleobases represented by Formula II, Formula III, or Formula IV;
[00169] R1, R2, R3, R4, R5, and R6 are hydride radicals;
[00170] L1 represents -(CH2)2-O-(CH2)2-, -CH2-O-(CH2)2-, -CH2-O(CH2)3-, -CH2-O-(CH2)4-, or -CH2-O-(CH2)5- with the right end being directly attached to the basic amino group; and
[00171] L2 and L3 are selected independently of -(CH2)2-, (CH2)3-, -(CH2)4-, -(CH2)5-, -(CH2)6-, -(CH2)7-, -(CH2)8-, -(CH2)2-O. (Reference 870240084853, dated 04 / 10 / 2024, page 35 / 141) 29 / 50 (CH2)2-, -(CH2)3-O-(CH2)2-, and -(CH2)2-O-(CH2)3- with the right end being directly attached to the basic amino group.
[00172] De específico interesse é um derivado de PNA de Fórmula I que é selecionado do grupo de compostos provido abaixo, ou um sal farmaceuticamente aceitável do mesmo: (N ^ C) Fethoc-A(6)TT-TG(6)T-TA(6)C-CC(1O2)T-GG(6)G-A(6)-NH2; (N ^ C) Fethoc-A(6)TC-TG(6)T-TA(6)C-CC(1O2)T-GG(6)G-A(6)-NH2; (N ^ C) Piv-A(6)TT-TG(6)T-TA(6)C-CC(1O2)T-GG(6)G-A(6)-NH2; (N ^ C) Fethoc-A(6)TT-TG(6)T-TA(2O2)C-CC(1O2)T-GG(5)G-A(5)NH2; (N ^ C) Fmoc-Lys-A(6)TT-TG(6)T-TA(6)C-CC(1O2)T-GG(6)G-A(6)NH2; (N ^ C) Fethoc-TG(5)T-TA(6)C-C(1O2)CT-GG(5)G-A(5)-NH2; (N ^ C) Fethoc-TG(5)T-TA(6)C-C(1O2)CT-GG(5)T-A(5)-NH2; (N ^ C) Fethoc-TG(5)T-TA(6)C-C(1O3)CT-GG(5)G-A(5)-NH2; (N ^ C) Fethoc-Lys-Leu-TG(5)T-TA(5)C-CC(1O2)T-GG(5)G-A(2O2)TLys-NH2; (N ^ C) H-TG(5)T-TA(5)C-CC(1O2)T-GG(3)G-A(5)T-NH2; (N ^ C) Benzoil-TG(5)T-TA(6)C-C(1O3)CT-GG(5)G-A(5)-Val-Lys-NH2; (N ^ C) Benzoil-TG(5)T-TA(5)C-CC(1O3)T-GG(5)G-A(5)T-NH2; (N ^ C) n-Hexanoil-TG(5)T-TA(8)C-CC(1O2)T-GG(5)G-A(5)T-NH2; (N ^ C) n-Propil-TG(5)T-TA(6)C-C(1O3)CT-GG(5)G-A(5)-NH2; (N ^ C) Ac-TG(5)T-TA(6)C-C(1O3)CT-GG(5)G-A(5)-NH2; (N ^ C) [N-(2-fenil etil) amino] carbonil-TG(5)T-TA(4)C-CC(1O2)TGG(5)G-A(5)T-NH2; (N ^ C) n-Propil-TG(2O2)T-TA(5)C-CC(2O2)T-GG(5)G-A(5)T-NH2; (N ^ C) FAM-HEX-HEX-TG(2O2)T-TA(5)C-CC(2O2)T-GG(5)G-A(5)TNH2; (N ^ C) n-Propil-TG(2O2)T-TA(5)C-CC(2O2)T-GG(5)G-A(5)T-ArgNH2; Petição 870240084853, de 04 / 10 / 2024, pág. 36 / 141 30 / 50 (N ^ C) n-Benzoil-Gly-TG(2O2)T-TA(5)C-CC(2O2)T-GG(5)G-A(5)TNH2; (N ^ C) N-Me-N-fenill-TG(5)T-TA(5)C-CC(1O5)T-GG(5)G-A(5)T-NH2; (N ^ C) p-Tolueno sulfonil-TG(2O3)T-TA(5)C-CC(1O2)T-GG(5)GA(5)T-Lys-NH2 (N ^ C) Fethoc-TG(5)T-TA(6)C-C(1O2)CT-GG(5)G-A(6)T-NH2; (N ^ C) Bezeno sulfonil-TG(5)T-TA(2O3)C-CC(1O5)T-GG(5)G-A(6)TNH2; (N ^ C) fenil-TG(5)T-TA(6)C-C(1O2)CT-GG(5)G-A(6)T-NH2; (N ^ C) Fethoc-TG(5)G-TA(5)C-C(1O2)CT-TG(5)G-A(5)T-NH2; (N ^ C) Fethoc-TG(5)T-AA(5)C-CC(1O2)T-GG(5)T-A(5)T-NH2; (N ^ C) Fethoc-TG(6)T-TA(3)C-CC(1O5)T-GG(6)G-A(3)T-NH2; (N ^ C) Fethoc-G(5)TT-A(5)CC(1O2)-CTG-G(5)GA(5)-TC(1O2)-NH2; (N ^ C) Benzil-G(5)TT-A(5)CC(1O2)-CTG-G(5)GA(5)-TC(1O2)-NH2; (N ^ C) Fethoc-GTT-A(3)CC(1O5)-CTG(6)-GGA(3)-TC(1O5)-NH2; (N ^ C) Fethoc-TA(5)C-C(1O2)CT(1O5)-GG(5)G-A(5)TC-C(1O2)ANH2; (N ^ C) Fmoc-Leu-TA(4)C-C(1O3)CT-GG(5)G-A(4)TC-C(1O3)A-NH2; (N ^ C) Fethoc-C(1O2)AT-TTG(6)-TTA(5)-CCC(1O2)-TG(6)-NH2; (N ^ C) Fethoc-CA(6)T-TTG(5)-TTA(5)-CCC(1O2)-TG(5)-NH2; (N ^ C) Fethoc-A(6)TT-TG(5)T-TA(5)C-C(1O2)CT-G(5)-NH2; (N ^ C) Fethoc-CA(6)T-CA(6)T-TTG(5)-TTA(5)-CCC(1O2)-TG(5)-NH2; (N ^ C) Fethoc-A(5)TT-TG(5)T-TA(5)C-CC(1O2)T-GG(5)GA(5)-NH2; (N ^ C) Fethoc-A(6)TT-TG(5)T-TA(6)CC(1O2)CT-GG(5)GA(5)-NH2; and (N^C) Fethoc-A(6)TT-TG(5)T-TA(6)CC(1O2)CT-G(5)G-NH2: where,
[00173] A, G, T, and C are PNA monomers with a natural nucleobase of adenine, guanine, thymine, and cytosine, respectively;
[00174] C(pOq), A(p), A(pOq), G(p), and G(pOq) are PNA monomers Petition 870240084853, dated 04 / 10 / 2024, p. 37 / 141 31 / 50 with a non-natural nucleobase represented by Formula VI, Formula VII, Formula VIII, Formula IX, and Formula X, respectively; Formula VI where,
[00175] peq are integers; and,
[00176] the abbreviations for the N- and C-terminal substituents are specifically defined as follows: Fmoc- is the abbreviation for [(9-fluorenyl)methyloxy]carbonyl-; Fethoc- for [2-(9-fluorenyl)ethyl1-oxy]carbonyl; Ac- for acetyl-; Benzoyl- for benzenecarbonyl-; Piv- for pivalyl-; n-propyl- for 1-(n-propyl)-, H- for hydride group; p-toluenesulfonyl for (4-methylbenzene)-1sulfonylaa-; -Lys- for lysine amino acid residue; -Val- for valine amino acid residue; -Leu- for leucine amino acid residue; -Arg- for arginine amino acid residue; -Gly- for glycine amino acid residue; [N-(2-phenyl ethyl) amino] carbonyl- to [N-1-(2-phenyl ethyl) amino] carbonyl-; benzyl- to 1-(phenyl) methyl; phenyl- to phenyl-; Me- to methyl-; -HEX- to 6-amino-1-hexanoyl-; FAM- to 5, or 6-fluorescein carbonyl- (isomeric mixture), and -NH2 to unsubstituted -amino group.
[00177] Figure 7 collectively provides the chemical structures for PNA monomers abbreviated as A, G, T, C, C(pOq), A(p), A(pOq), G(p), and G(pOq). As discussed in the prior art [PCT / KR2009 / 001256], Petition 870240084853, dated 04 / 10 / 2024, page 38 / 141 32 / 50 C(pOq) is seen as a modified PNA monomer corresponding to cytosine due to its preferred hybridization to guanine. A(p) and A(pOq) are taken as modified PNA monomers acting as adenine due to their high affinity for thymine. Similarly, G(p) and G(pOq) are considered to be modified PNA monomers equivalent to guanine due to their productive base pairing with cytosine.
[00178] Figure 8 unequivocally provides the chemical structures for a variety of abbreviations for substituents used to introduce diversity at the N-terminal or C-terminal of the PNA derivative of Formula I in this invention.
[00179] In order to illustrate the abbreviations used for such PNA derivatives, the chemical structure for a 14-mer PNA derivative abbreviated as (N ^ C) Fethoc-GA(5)AC(1°2)TT-A(5)TCCTA(5)-C(1°2)T-NH2 is provided in Figure 9. As another illustration, the chemical structure for a 15-mer PNA derivative abbreviated as (N ^ C) Fmoc-Val-CTC(1O2)-A(5)TC-CTA(6)-C(1O3)TTAA(2O2)C-NH2 is provided in Figure 10.
[00180] A 16-mer PNA sequence of (N^C)FethocA(6)TT-TG(6)T-TA(6)C-CC(1O2)T-GG(6)GA(6)-NH2 is equivalent to the DNA sequence (5'^3')ATT-TGT-TAC-CCT-GGG-A for complementary binding to pre-mRNA. The 16-mer PNA has a complementary 16-mer overlap with the human SNAP25 pre-mRNA as marked in bold and underlined in the 30-mer pre-mRNA sequence of [(5'^3')cucuuuggaucccag | GGUAACAAAUGAUGC] extending the intron 6 and exon 7 junction in the human SNAP25 pre-mRNA.
[00181] A 14-mer PNA sequence of (N^C)Fmoc-LeuTA(4)CC(1O3)CT-GG(5)GA(4)TC-C(1O3)A-NH2 is equivalent to the DNA sequence of (5'^3')TAC-CCT-GGG-ATC-CA for linkage. Petition 870240084853, dated 04 / 10 / 2024, p. 39 / 141 33 / 50 complementary to pre-mRNA. The 14-mer PNA has a complementary 14-mer overlap with the human SNAP25 pre-mRNA as marked in bold and underlined in the 30-mer pre-mRNA sequence [(5' ^ 3') cucuuuggaucccag | GGUAACAAAUGAUGC].
[00182] A 16-mer PNA sequence of (N^C)FethocA(6)TC-TG(6)T-TA(6)C-CC(1O2)T-GG(6)GA(6)-NH2 is equivalent to the DNA sequence of (5'^3')ATC-TGT-TAC-CCT-GGG-A for complementary binding to pre-mRNA. The 16-mer PNA has a complementary 15-mer overlap with the 16-mer sequence as marked in bold and underlined in the 30-mer pre-mRNA sequence of [(5'^3')cucuuuggaucccag | GGUAACAAAUGAUGC], where the single mismatch is marked with a quotation mark (). The 16-mer PNA is partially complementary to the 3' splice site of exon 7 of SNAP25 with a simple mismatch with exon 7. Detailed Description of the Invention General Procedures for Preparing PNA Oligomers
[00183] PNA oligomers were synthesized by solid-phase peptide synthesis (SPPS) based on Fmoc-chemistry according to the process shown in the prior art [US 6,133,444; WO 96 / 40685] with minor modifications if necessary. The solid support employed in this study was H-Rink Amide-ChemMatrix purchased from PCAS BioMatrix Inc. (Quebec, Canada). Fmoc-PNA monomers with a modified nucleobase were synthesized as described in the prior art [PCT / KR 2009 / 001256] or with minor modifications. Such Fmoc-PNA monomers with a modified nucleobase and Fmoc-PNA monomers with a natural nucleobase were used to synthesize the PNA derivatives of the present invention. FmocPNA monomers with a modified nucleobase are provided in Figure 11. For a person skilled in the art, however, there are many variations. Petition 870240084853, dated 04 / 10 / 2024, page 40 / 141 34 / 50 smaller obviously possible for the protection groups on such PNA monomers. Thus, the Fmoc-PNA monomers in Figure 11 should be taken as examples, and therefore should not be taken to limit the scope of the present invention. PNA oligomers were purified by reverse-phase HPLC-Cw (water / acetonitrile or water / methanol with 0.1% TFA) and characterized by mass spectrometry including ESI / TOF / MS.
[00184] Figure 12 schematically illustrates a typical monomer elongation cycle adopted in SPPS in this study, and the synthetic details are provided as below. For those skilled in the art, however, there are lots of minor variations obviously possible in the actual running of such SPPS reactions on an automated peptide synthesizer or manual peptide synthesizer. Each reaction step is briefly provided as follows.
[00185] [Activation of H-Rink-ChemMatrix Resin]. 0.01 mmol (approximately 20 mg of resin) of ChemMatrix resin in 1.5 mL of 20% piperidine / DMF was vortexed in a pound tube for 20 minutes, and the DeFmoc solution was filtered. The resin was washed for 30 seconds each in series with 1.5 mL of methylene chloride (MC), 1.5 mL of dimethylformamide (DMF), 1.5 mL of MC, 1.5 mL of DMF, and 1.5 mL of MC. The resulting free amines on the solid support were subjected to coupling with either an Fmoc-PNA monomer or with an amino acid-protected Fmoc derivative.
[00186] [DeFmoc]. The resin was vortexed in 1.5 mL of 20% piperidine / DMF for 7 minutes, and the DeFmoc solution was filtered. The resin was washed for 30 seconds each time in series with 1.5 mL of MC, 1.5 mL of DMF, 1.5 mL of MC, 1.5 mL of DMF, and 1.5 mL of MC. The resulting free amines on the solid support were immediately coupled with an Fmoc-PNA monomer.
[00187] [Coupling with Fmoc-PNA Monomer]. Free amines Petition 870240084853, dated 04 / 10 / 2024, page 41 / 141 35 / 50 on the solid support were coupled with an Fmoc-PNA monomer as follows. 0.04 mmol of an Fmoc-PNA monomer, 0.05 mmol of HBTU [hexafluorophosphate of 2-(1H-benzotriazol-1-yl)-1,1,3,3-tetramethyluronium], and 10 mmol of DIEA (N,N-diisopropyl ethyl amine) were incubated for 2 minutes in 1 mL of anhydrous DMF, and added to the resin with free amines. Then the resin was washed for 30 seconds each in series with 1.5 mL of MC, 1.5 mL of DMF, and 1.5 mL of MC.
[00188] [Capping]. Following the coupling reaction, unreacted free amines were capped by stirring for 5 minutes in 1.5 mL of capping solution (5% acetic anhydride and 6% 2,6-leutidine in DMF). Then the capping solution was filtered and washed for 30 seconds each in series with 1.5 mL of MC, 1.5 mL of DMF, and 1.5 mL of MC.
[00189] [Introduction of Fethoc- radical at the N-terminal]. A Fethoc- radical was introduced to the N-terminal via reaction of free amines on the resin with Fethoc-OSu under usual basic coupling conditions. The chemical structure of Fethoc-OSu [CAS No. 179337-69-0, C20H17NO5, MW 351.36] is provided as follows. Fethoc-OSu
[00190] [Cleavage from resin]. Resin-bound PNA oligomers were cleaved from the resin by stirring for 3 hours in 1.5 mL of cleavage solution (2.5% tri-isopropyl silane and 2.5% water in trifluoroacetic acid). The resin was filtered and the filtrate was concentrated under reduced pressure. The resulting residue was ground with diethyl ether and the resulting precipitate was collected by filtration for purification by reverse-phase HPLC.
[00191] [Analysis and Purification with HPLC]. Following a cleavage Petition 870240084853, dated 04 / 10 / 2024, page 42 / 141 36 / 50 from resin, the crude product of a PNA derivative was purified by reverse-phase HPLC - C18 eluting with water / acetonitrile or water / methanol (gradient process) containing 0.1% TFA. Figures 13A and 13B are exemplary HPLC chromatograms for ASO 1 before and after HPLC purification, respectively. The oligomer sequence of ASO 1 is as provided in Table 1. Synthetic examples for PNA derivatives of Formula I
[00192] In order to complementarily target the 3' splice site of exon 7 in human SNAP25 premRNA, PNA derivatives of this invention have been prepared according to the synthetic procedures provided above or with minor modifications. Provision of such PNA derivatives targeting human SNAP25 premRNA is to exemplify the PNA derivatives of Formula I, and should not be construed to limit the scope of the present invention.
[00193] Table 1 provides PNA derivatives complementarily targeting the 3' splice site of exon 7 in human SNAP25 pre-mRNA along with structural characterization data by mass spectrometry. The provision of SNAP25 ASOs in Table 1 is to exemplify the PNA derivatives of Formula 1, and should not be interpreted as limiting the scope of the present invention. Table 1. PNA derivatives complementarily targeting the 3' splice site extending the intron 6 and exon 7 junction in human SNAP25 pre-mRNA along with structural characterization data by mass spectrometry. Exemplo de PNA Sequência de PNA (N ^ C) Massa exata, m / z teor.a obs.b ASO 1 Fethoc-A(6)TT-TG(6)T-TA(6)C-CC(1O2)T-GG(6)G- A(6)-NH2 5190,39 5188,38 ASO 2 Fethoc-TG(5)T-TA(6)C-C(1O2)CT-GG(5)G-A(5)-NH2 4266,93 4266,95 ASO 3 Fethoc-TG(5)T-TA(6)C-C(1O2)CT-GG(5)G-A(6)T-NH2 4533,03 4533,04 ASO 4 Fethoc-TG(5)G-TA(5)C-C(1O2)CT-TG(5)G-A(5)T-NH2 4519,01 4518,95 ASO 5 Fethoc-TG(6)T-TA(3)C-CC(1O5)T-GG(6)G-A(3)T-NH2 4533,03 4533,04 Petição 870240084853, de 04 / 10 / 2024, pág. 43 / 141 37 / 50 ASO 6 Fethoc-G(5)TT-A(5)CC(1O2)-CTG-G(5)GA(5)- TC(1O2)-NH2 4601,07 4601,08 ASO 7 Fethoc-C(1O2)AT-TTG(6)-TTA(5)-CCC(1O2)-TG(6)- NH2 4478,98 4478,99 ASO 8 Fethoc-CA(6)T-TTG(5)-TTA(5)-CCC(1O2)-TG(5)-NH2 4468,02 4468,04 ASO 9 Fethoc-A(6)TT-TG(5)T-TA(5)C-C(1O2)CT-G(5)-NH2 4216,91 4216,93 ASO 10 Fethoc-CA(6)T-CA(6)T-TTG(5)-TTA(5)-CCC(1O2)- TG(5)-NH2 5374,45 5374,44 ASO 11 Fethoc-A(6)TT-TG(5)T-TA(6)C-C(1O2)CT-GG(5)G- A(5)-NH2 5188,36 5188,35 ASO 12 Fethoc-A(6)TT-TG(5)T-TA(6)C-C(1O2)CT-G(5)G-NH2 4522,04 4522,05 ASO 13 Fethoc-A(5)TT-TG(5)T-TA(5)C-CC(1O2)T-GG(5)G- A(5)-NH2 5160,33 5160,31 ASO 14 p-Tolueno sulfonil-TG(2O3)T-TA(5)C-CC(1O2)T- GG(5)G-A(5) T-Lys-NH2 4581,03 4581,05 ASO 15 n-Hexanoil-TG(5)T-TA(8)C-CC(1O2)T-GG(5)G-A(5)T- NH2 4423,05 4423,03 ASO 16 Fethoc-Lys-Leu-TG(5)T-TA(5)C-CC(1O2)T-GG(5)G- A(2O2)T-Lys-NH2 4890,27 4890,27 ASO 17 [N-(2-fenil etil)amino]carbonil-TG(5)T-TA(4)C- CC(1O2)T-GG (5)G-A(5)T-NH2 4415,98 4416,14 ASO 18 H-TG(5)T-TA(5)C-CC(1O2)T-GG(3)G-A(5)T-NH2 4254,90 4254,64 ASO 19 n-Propyl-TG(2O2)T-TA(5)C-CC(2O2)T-GG(5)GA(5)T- NH2 4340.97 4341.03 ASO 20 Fethoc-TG(5)T-AA(5)C-CC(1O2)T-GG(5)TA(5)T-NH2 4503.02 4503.04 ASO 21 N-Me-N-Phenyl-TG(5)T-TA(5)C-CC(1O5)T-GG(5)G- A(5)T-NH2 4415.03 4415.00 ASO 22 Benzoyl-TG(5)T-TA(5)C-CC(1O3)T-GG(5)GA(5)T-NH2 4400.97 4401.44, a) exact theoretical mass, b) exact observed mass
[00194] Figure 13A is an HPLC chromatogram obtained with a crude ASO₄ product. The crude product was purified by preparative HPLC RP-C18. Figure 13B is an HPLC chromatogram for a purified ASO₄ product. The purity of ASO₄ improved markedly following purification with preparative HPLC. Figure 14 provides an ESI-TOF mass spectrum obtained with the purified ASO₄ product. Provision of analytical data for ASO₄ is Petition 870240084853, dated 04 / 10 / 2024, page 44 / 141 Figure 38 / 50 illustrates how the PNA derivatives of Formula I were purified and identified in the present invention, and should not be interpreted as limiting the scope of this invention. Binding affinity of PNA-derived models for complementary DNA
[00195] The PNA derivatives in Table 1 were evaluated for their binding affinity with 10-mer DNAs by complementarily targeting both the N-terminus and the C-terminus. Binding affinity was assessed using Tm values for the duplex between PNA and complementary 10-mer DNA. The duplex between PNA derivatives in Table 1 and fully complementary DNAs showed Tm values that were too high to be reliably determined in aqueous buffer solution, as the buffer solution tended to boil during Tm measurement.
[00196] Tm values were determined using a UV / Vis spectrometer as follows. A mixed solution of 4 μM PNA oligomer and 4 μM complementary 10-mer DNA in 4 mL of aqueous buffer (pH 7.16, 10 mM sodium phosphate, 100 mM NaCl) in a 15 mL polypropylene falcon tube was incubated at 90°C for one minute and slowly cooled to room temperature. The solution was then transferred to a 3 mL quartz UV cuvette fitted with an airtight lid and subjected to a Tm measurement at 260 nm using a UV / Vis spectrophotometer as described in the prior art [PCT / KR2009 / 001256] or with minor modifications. Complementary 10-mer DNAs for Tm measurement were acquired from Bioneer (www.bioneer.com. Dajeon, Republic of Korea) and used without prior purification.
[00197] Observed Tm values of Formula I PNA derivatives were very high for a complementary 10-mer DNA-binding compound, and are provided in Table 2 as uncorrected. For example, ASO 3 showed a Tm value of 77.3°C for the duplex with DNA. Petition 870240084853, dated 04 / 10 / 2024, page 45 / 141 39 / 50 complementary 10-mer directing the N-terminal of 10-mer in PNA as marked in bold and underlined in [(N ^ C) FethocTG(5)T-TA(6)CC(1O2)CT-GG(5)GA(6)T-NH2]. Meanwhile, ASO 3 showed a Tm of 88.7oC for the duplex with the complementary 10-mer DNA directing the C-terminal of 10-mer in PNA as marked in bold and underlined in [(N ^ C) Fethoc-TG(5)T-TA(6)CC(1O2)CT-GG(5)GA(6)T-NH2]. Table 2. Tm values between PNAs in the Table and complementary 10-mer DNA targeting both the N-terminal and C-terminal of PNA. PNA Tm Value, °C 10-mer DNA versus Nterminal 10-mer DNA versus C-terminal ASO 2 76.0 87.6 ASO 3 77.3 88.7 ASO 4 83.0 77.0 ASO 5 73.0 85.8 ASO 6 84.0 91.8 ASO 8 58.0 68.0 ASO 9 62.0 76.0 ASO 10 61.0 68.0 ASO 12 62.0 74.0 Examples of biological activities of PNA derivatives of Formula I
[00198] PNA derivatives of Formula I specified in Table 1 were evaluated for SNAP25 antisense activity in rat-derived PC12 cells and human-derived SiMa cells, and for their ability to inhibit SNAP25 expression in the skin of C57BL / 6 mice with topical administration. The biological examples were provided as examples to illustrate the antisense activity of the PNA derivatives of Formula I, and therefore should not be interpreted as limiting the scope of the present invention for the compounds listed in Table 1. Petition 870240084853, dated 04 / 10 / 2024, page 46 / 141 40 / 50 Example 1. ASO3-induced exon jump.
[00199] The specified ASO 3 is a 14-mer ASO that is fully complementary to a 14-mer sequence at the 3' splice site extending the intron 6 and exon 7 junction in the human SNAP25 premRNA. ASO 3 complementarily overlaps with the 14-mer premRNA sequence as marked in bold and underlined in the 30-mer premRNA sequence [(5' ^ 3') cucuuuggaucccag | GGUAACAAAUGAUGC]. ASO 3 has a 7-mer overlap with intron 6, and another 7-mer overlap with exon 7.
[00200] Meanwhile, the 14-mer ASO has a complementary 13-mer overlap with the mouse SNAP25 pre-mRNA read from mouse genomic DNA [accessed from NCBI Reference Sequence: NC_005012] as marked in bold and underlined in the 25-mer pre-mRNA sequence [(5' ^ 3') uggcucccag | GGUAACAAACGAUGC], in which the single mismatch is marked with a quotation mark ().
[00201] ASO 3 was evaluated for its ability to induce exon skipping in PC12 cells (Cat. Number CRL-1721, ATCC) as provided below.
[00202] [Cell Culture & ASO Treatment]. PC12 cells were maintained in RPMI 1640 medium supplemented with 5% FBS, 10% horse serum, 1% streptomycin / penicillin, 1% L-glutamine, and 1% sodium pyruvate under a 5% CO2 atmosphere at 37°C. Cells grown in 60 mm culture plates containing 5 mL of culture medium were treated with ASO 3 at 0 (negative control), 10, 100, or 1000 µM.
[00203] [RNA Extraction & cDNA Synthesis via One-Step PCR]. Following incubation with ASO3 for 42 hours, cells were treated with 100 pg / mL of cycloheximide for another 6 hours. Petition 870240084853, dated 04 / 10 / 2024, page 47 / 141 41 / 50 hours in order to freeze ribosomal translation. Then total RNA was extracted using Universal RNA Extraction Kit (Cat. Number 9767, Takara) according to the manufacturer's instructions. 200 ng of RNA template were subjected to a 25 pL reverse transcription reaction using Super Script One-Step RT-PCR kit with Platinum Taq polymerase (Cat. Number 10928-042, Invitrogen) against a set of specific primers - exon [exon 1_forward: (5' ^ 3') ATGGCCGAGGACGCAGACA; and exon 14_reverse: (5' ^ 3') AGCATCTTTGTTGCACGTTG] according to the following cycle conditions: 50o+C for 30 minutes and 94o+C for 2 minutes, which were followed by 40 cycles of 30 seconds at 94oC, 30 seconds at 50oC, and 1 minute at 72oC.
[00204] [Nested PCR Amplification]. 1 pL of cDNA was subjected to a 20 pL nested PCR reaction (Cat. Number K2612, Bioneer) against a set of exon-specific primers [foreex 1: (5'^3') ATGGCCGAGGACGCAGACA; reverse exon 14: (5'^3') TTGTTGGAGTCAGCGCCT] under the following cycle conditions: 95°C for 2 minutes followed by 34 cycles of 30 seconds at 95°C, 30 seconds at 55°C, and 1 minute at 72°C.
[00205] [Identification of Exon Skip Products]. PCR products were subjected to electrophoretic separation on a 2% agarose gel. Target-size bands were collected and analyzed by Sanger sequencing.
[00206] Figure 15A provides the electrophoresis data for the PCR products, in which the 10 zM ASO treatment sample yielded a weak PCR band assignable to exon 5-7 skipping. Even if the cells were treated with cycloheximide to destabilize the full-length mRNA by freezing ribosomal translation, the exon skipping band was only weakly detected. Thus, the SNAP25 mRNA splice variant that can be assigned to exon 5-7 skipping is likely to show poor stability. Petition 870240084853, dated 04 / 10 / 2024, pp. 48 / 141 42 / 50 metabolic activity in cells compared to full-length mRNA. The exon skip PCR product was sequenced to be the skip of exons 5-7 as shown in Figure 15B. Since the PCR product designated for the skip of exon 6 was observed independent of ASO concentration, the skip of exon 6 is considered to occur spontaneously.
[00207] The intensity of full-length SNAP25 mRNA decreased more in cells treated with ASO 3 10 zM. Full-length mRNA intensity gradually increased to that of the negative control (i.e., no ASO treatment) when the ASO concentration was increased from 10 to 1000 zM. The inverted dose-response pattern in the nested PCR data may be due to an upregulation of transcription by exon intron circular RNA (ElciRNA) accumulated during exon hopping with ASO 3. [Nature Struc. Mol. Biol. Vol 22(3), 256-264 (2015)]. Example 2. qPCR for SNAP25 mRNA in PC12 cells treated with ASO3
[00208] ASO 3 was evaluated by nested qPCR of SNAP25 for its ability to induce changes in the level of mouse SNAP25 mRNA in PC12 cells as follows.
[00209] [Cell Culture & ASO Treatment]. PC12 cells grown in 60 mm culture plates containing 5 mL of culture medium were treated with ASO 3 at 0 (negative control), 10, 100 or 1000 µM. (2 culture plates per ASO concentration).
[00210] [One-Step RNA Extraction & cDNA Synthesis by RT-PCR]. Following incubation with SNAP-ASO 3 for 42 hours, cells were treated with 100 pg / mL of cycloheximide for another 6 hours to freeze ribosomal translation. Then total RNA was extracted from cells using a Universal RNA Extraction Kit (Cat. Number 9767, Takara), and 200 ng of RNA template were subjected to a Petition 870240084853, dated 04 / 10 / 2024, pp. 49 / 141 43 / 50 reverse transcription reaction of 25 pL using One Step RT-PCR kit (Invitrogen, USA) against a set of exon-specific primers [exon 1_forward: (5'^3') ATGGCCGAGGACGCAGACA; and exon 14_reverse: (5'^3') AGCATCTTTGTTGCACGTTG] according to the following cycle conditions: 50oC for 30 minutes and 94oC for 2 minutes, which was followed by 20 cycles of 30 seconds at 94oC, 30 seconds at 55oC, and 1 minute at 72oC.
[00211] [Nested qPCR Amplification]. 1 pL of each cDNA solution diluted by 100X was subjected to a 20 pL real-time PCR reaction against a set of exon-specific primers [exon 7q_forward: (5'^3') ATGGATGAAAACCTAGAGC; and exon 8q_reverse: (5'^3') CTTCCCAGCA-TCTTTGTT] according to the following cycling conditions: 95°C for 3 minutes followed by 40 cycles of 10 seconds at 95°C, and 30 seconds at 60°C. The qPCR reaction was followed with a Taqman probe of [(5'^3')5,6-FAM-CAGCCTTCTZEN-CCATGATCCT-3IABkFQ] targeting the exon 7 and exon 8 junction to specifically quantify the full-length SNAP25 mRNA.
[00212] Figure 16A provides the qPCR data, in which the full-length mRNA level decreased significantly (Student's t-test) in cells treated with ASO 3 at 10 zM and 100 zM by approximately 50% and 20%, respectively. However, the full-length mRNA level in cells treated with 1000 zM ASO 3 was slightly higher than the level in untreated cells (i.e., negative control). The inverted dose-response pattern of the qPCR data is poorly consistent with the dose-response pattern of full-length mRNA level observed during the exon skip described in Example 1, suggesting an upregulation of transcription when the ASO dose was increased from 10 to 1000 zM. Petition 870240084853, dated 04 / 10 / 2024, page 50 / 141 44 / 50 Example 3. qPCR for SNAP25 mRNA in PC12 cells treated with ASO1
[00213] ASO 1 specified in Table 1 is a 16-mer ASO that is fully complementary to a 16-mer sequence of the 3' splice site extending the intron 6 and exon 7 junction in the human SNAP25 premRNA. ASO 1 complementarily overlaps with the target 16-mer sequence as marked in bold and underlined in the human 30-mer premRNA sequence [(5' ^ 3') cucuuuggaucccag | GGUAACAAAUGAUGC]. ASO 1 has a 6-mer overlap with intron 6 and a 10-mer overlap with exon 7. However, ASO has a single mismatch with the mouse SNAP25 premRNA as marked in bold and underlined in the 25-mer premRNA sequence [(5' ^ 3') uggcucccag | GGUAACAAACGAUGC], where the single mismatch is marked with a quotation mark ( ).
[00214] ASO 1 was evaluated by nested SNAP25 qPCR for its ability to induce changes in mouse SNAP25 mRNA levels in PC12 cells as described in Example 2, unless otherwise noted.
[00215] Figure 16B provides the qPCR data, where the total length mRNA level decreased significantly (Student's t-test) in cells treated with SNAP-ASO 1 at 10 zM, 100 zM, and 1000 zM by approximately 50%, 40%, and 70%, respectively. As with ASO 3, the inverted dose-response pattern was partially reproduced with ASO 1 when the dose was increased from 10 to 100 zM. Given that the total length mRNA level still decreased when the ASO concentration was increased to 1000 zM, however, the exon-skipping efficacy of ASO 1 appears to be stronger than the efficacy of ASO 3. Example 4. Inhibition of SNAP25 protein expression in cells Petition 870240084853, dated 04 / 10 / 2024, page 51 / 141 45 / 50 PC12 by ASO 3
[00216] ASO 3 was evaluated for its ability to inhibit SNAP25 protein expression in PC12 cells as follows.
[00217] PC12 cells were grown in 60 mm culture plates containing 5 mL of culture medium and treated with ASO3 at 0 zM (negative control), 1 zM, 10 zM, 30 zM, 100 zM, 300 zM, 1 aM, 3 aM, or 10 aM for 48 hours. Four negative control culture plates were provided to compensate for potential technical artifacts during western blot analysis.
[00218] [Cell Lysis]. Then the cells were subjected to lysis on ice with 200 pL of 1X RIPA buffer (Cat. Number 9806, Cell Signaling Tech) supplemented with 1% SDS and a 1X proteinase inhibitor cocktail (cOmplete Mini, Roche). Lysates were collected in 1.5 mL e-tubes, mixed with 100 pL of 5X sample buffer, and boiled for 5 minutes.
[00219] [Western Blot]. The lysates were subjected to electrophoretic separation on a 4-15% TGX-PAGE gradient gel (Cat. Number 456-1086, Bio-Rad) and then transferred onto a 0.45 µm PVDF membrane. The membrane was probed with an anti-SNAP25 antibody (Cat. Number S9684, Sigma) and an anti-β-actin antibody (Cat. Number A3845, Sigma).
[00220] Figure 17A provides western blot data for SNAP25 obtained from PC12 cell lysates (top diagram) along with β-actin normalized relative SNAP25 expression levels via densitometry (bottom diagram). SNAP25 protein levels decreased by 10 to 60% in cells treated with ASO3. The negative control expression level (i.e., 0 zM ASO3) is the average expression level of the 4 samples. Example 5. Inhibition of SNAPO25 protein expression in PC12 cells by ASO1 Petition 870240084853, dated 04 / 10 / 2024, page 52 / 141 46 / 50
[00221] ASO 1 was evaluated for its ability to inhibit SNAP25 protein expression in PC12 cells as described in Example 4, unless otherwise noted. PC12 cells were treated with ASO 1 at 0 (negative control), 100 or 1000 zM for either 48 hours or 72 hours (one culture plate for each ASO concentration).
[00222] Figure 17B provides western blot data for ASO treatment at 48 hours (left) and 72 hours (right). ASO 1 significantly inhibited SNAP25 protein expression in PC12 cells at both time points. Example 6. Inhibition of SNAP25 protein expression in skin treated topically with ASO1 in mice.
[00223] ASO 1 is fully complementary to the 3' splice site of exon 7 in mouse SNAP25 premRNA. ASO 1 was evaluated for its ability to inhibit SNAP25 protein expression in the skin with topical administration as described below.
[00224] [Hair clipping and grouping]. On Day 0, 8 female C57BL / 6 mice (5 weeks old) were anesthetized with zoletil / rompun, and the hair on their backs (approximately 3 cm x 4 cm) was clipped with clippers. Mice were randomly assigned to four groups, i.e., no group with ASO treatment (negative control) and 3 groups with 1 fM, 10 fM, and 100 fM of ASO treatment (2 animals per group).
[00225] [Topical Administration]. Topical solutions of ASO 1 were prepared by diluting an aqueous stock mother solution in 30% (v / v) aqueous ethanol supplemented with 3% (v / v) glycerin to 0 (negative control), 1, 10, and 100 fM of ASO 1. Each animal was administered topically with approximately 100 pL of a topical solution twice daily (morning & then afternoon) for Days 0 to 4 on the skin of the back of clipped fur using a cotton ball. Petition 870240084853, dated 04 / 10 / 2024, page 53 / 141 47 / 50
[00226] [Skin Sampling]. On the afternoon of Day 4, the animals were sacrificed after anesthesia with zoletil / rompun in order to sample the portion of skin treated topically with ASO. The skin samples were then subjected to immunohistochemical (IHC) analysis against the SNAP25 protein as described below.
[00227] [SNAP25 IHC]. Skin samples were cryosectioned and immunolabeled serially with a primary anti-SNAP25 antibody (Cat. Number ab41455, Abcam) at a 1:200 dilution, with a secondary anti-IgG antibody (Cat. Number BA-1100, Vector) at a 1:200 dilution, and then with Dylight 594-steptavidin (Cat. Number AS5594, Vector, CA, USA) at a 1:200 dilution for red fluorescence labeling. The anti-SNAP25 antibody probes the C-terminal of the SNAP25 protein. IHC images were captured on a Zeiss slide scanner to assess changes in full-length SNAP25 expression. DAPI staining was additionally performed to localize dermal microstructure.
[00228] Figure 18 provides a representative set of IHC images of SNAP25 by group. In the negative control group, full-length SNAP25 protein expression was high in the muscle layer beneath the dermis. SNAP25 protein expression in the muscle layer is thought to originate from SNAP25 protein expression in motor neuron axons embedded in the muscle layer. Full-length SNAP25 protein expression in the muscle layer decreased sharply in the ASO treatment groups. The most notable decrease was observed in the ASO 1 100 fM treatment group. The inhibitory extent of full-length SNAP25 protein expression in the skin was much stronger than the extent observed in PC12 cells (cf. Example 5).
[00229] Given that BTX has been widely used to treat facial wrinkles (for anti-aging) through injection, the inhibition of Petition 870240084853, dated 04 / 10 / 2024, page 54 / 141 48 / 50 SNAP25 protein expression in the muscle layer beneath the dermis is of pharmacological and therapeutic importance. A BTX injection is associated with a risk that a certain fraction of the injection potentially distributes to muscle tissue – a safety concept. If BTX distributes to pulmonary smooth muscle tissue, for example, the individual is at high risk of pulmonary insufficiency.
[00230] The inhibitory activity of SNAP25 depends on the concentration of ASO in the target tissue. With topical administration, the concentration of ASO decreases rapidly in tissues distal to the dermal layer of ASO administration. It is unlikely that target tissues of safety concept will be exposed to ASO at a concentration high enough to raise the safety concept. Thus, the PNA derivative of Formula I for topical use is distinctly advantageous over BTX injection for safety as well as individual compliance. Example 7. Inhibition of SNAP25 protein expression in SiMa cells by ASO3
[00231] ASO 3 was evaluated for its ability to inhibit SNAP25 protein expression in human SiMa neuroblastoma cells as follows.
[00232] [Cell culture and ASO treatment]. SiMa cells (Cat. Number ACC164, DSMZ) were maintained in RPMI 1640 medium supplemented with 10% FBS, 1% streptomycin / penicillin, 1% L-glutamine, and 1% sodium pyruvate under a 5% CO2 atmosphere at 37°C. SiMa cells were grown in 60 mm culture plates containing 5 mL of culture medium and treated for 48 hours with ASO 3 at 0 µM (negative control), 1 µM at 100 µM. Three culture plates were used as negative controls to compensate for potential technical artifacts during western blot analysis.
[00233] [Lysis]. The cells were subjected to lysis on ice with 200 pL of 1X RIPA buffer (Cat. Number 9806, Cell Signalling Tech) Petition 870240084853, dated 04 / 10 / 2024, page 55 / 141 49 / 50 supplemented with 0.1% SDS and a 1X proteinase inhibitor cocktail (cOmplete Mini, Roche). Then the lysates were collected in 1.5 mL tubes, mixed with 100 µL of 5X sample buffer, and boiled for 5 minutes.
[00234] [Western Blot]. The lysates were subjected to electrophoretic separation on a 12% SDS-PAGE gel and transferred onto a 0.2 µm polyvinylidene difluoride (PVDF) membrane. The membrane was probed with an anti-SNAP25 antibody (Cat. Number ab41455, Sigma) and an anti-ε-actin antibody (Cat. Number A3845, Sigma).
[00235] Figure 19A provides the western blot data of SNAP25 obtained from cell lysates (top diagram) along with the relative SNAP25 expression levels normalized against β-actin by densitometry (bottom diagram). The expression level of the negative control (i.e., 0 zM ASO 3) is the average expression level of the 3 samples. The SNAP25 protein level decreased by 40 to 50% in cells treated with ASO 3. Example 8. qPCR for SNAP25 mRNA in SiMa cells treated with ASO3
[00236] ASO 3 was evaluated by nested SNAP25 qPCR for its ability to induce changes in human SNAP25 mRNA levels in SiMa cells as follows.
[00237] [Cell Culture & ASO Treatment]. SiMa cells were grown in 60 mm culture plates containing 5 mL of culture medium, and were treated with ASO 3 at 0 zM (negative control), 1 zM, 10 zM, 100 zM, or 1 aM, 10 aM, or 100 aM. (2 culture plates per ASO concentration).
[00238] [RNA Extraction & cDNA Synthesis]. Total RNA was extracted from cells using Rneasy Mini Kit (Cat. Number 74106, Qiagen) according to the manufacturer's instructions. 200 ng of RNA template were Petition 870240084853, dated 04 / 10 / 2024, p. 56 / 141 50 / 50 samples were subjected to a 25 pL reverse transcription reaction using the PrimeScript 1ststrand cDNA synthesis kit (Cat. No. 6110B, Takara) against random hexameters.
[00239] [qPCR Amplification]. PCR reactions were monitored with a Taqman probe [(5'^3') 56-FAM-CGGCTTCAT-ZENCCGCAGGGTAACAA-3IABkFQ] targeting the junction of exon 6 and exon 7 against an exon-specific primer set [exon 6_front: (5'^3') GACGAAC-GGGAGCAGATG; and exon 8_reverse(2): (5' ^ 3') ATCTCATTGCCCATATCCAGG]. Cycle conditions: 95oC for 3 minutes followed by 40 cycles of 15 seconds at 95oC, and 30 seconds at 60oC.
[00240] Figure 19B provides the qPCR data, where the level of full-length human SNAP25 mRNA decreased significantly (Student's t-test) in cells treated with ASO 3 at 1 µM, 100 µM, 1 µM and 100 µM by 20 to 40%. Cells treated with ASO at 100 µM showed the strongest inhibition of 40%.
Claims
CLAIMS 1. A peptide nucleic acid derivative, characterized in that it is represented by Formula I, or a pharmaceutically acceptable salt thereof: wherein n is an integer between 10 and 25; the compound of Formula I has at least one complementary 10-mer overlap with a 14-mer pre-mRNA sequence of [(5'^3')AUCCCAGGGUAACA] in human SNAP25 pre-mRNA; the compound of Formula I is fully complementary to human SNAP25 pre-mRNA, or partially complementary to human SNAP25 pre-mRNA with one or two mismatches; Si, S2, ..., Sn-1, Sn, T1, T2.....Tn-1 and Tn independently represent deuteride [D], hydride [H], substituted or unsubstituted alkyl radical, or substituted or unsubstituted aryl; X and Y independently represent hydride radical, formyl [HC(=O)-], aminocarbonyl [NH2-C(=O)-], aminothiocarbonyl [NH2C(=S)-], substituted or unsubstituted alkyl, substituted or unsubstituted aryl, substituted or unsubstituted alkyl acyl, substituted or unsubstituted aryl acyl, substituted or unsubstituted alkyloxy carbonyl, substituted or unsubstituted aryloxy carbonyl, substituted or unsubstituted alkyl amino carbonyl, substituted or unsubstituted aryl amino carbonyl, substituted or unsubstituted alkyl amino thiocarbonyl, substituted or unsubstituted aryl amino thiocarbonyl, substituted or unsubstituted alkyloxy thiocarbonyl, substituted Petition 870240084853, dated 04 / 10 / 2024, p.58 / 141 2 / 12 substituted or unsubstituted, substituted or unsubstituted alkyl sulfonyl, substituted or unsubstituted aryl sulfonyl, substituted or unsubstituted alkyl phosphonyl, or substituted or unsubstituted aryl phosphonyl; Z represents hydrido, hydroxy, substituted or unsubstituted alkyloxy, substituted or unsubstituted aryloxy, substituted or unsubstituted amino, substituted or unsubstituted alkyl, or substituted or unsubstituted aryl; Bi, B2, ..., Bn-1, and Bn are independently selected from natural nucleobases including adenine, thymine, guanine, cytosine, and uracil, and non-natural nucleobases; and at least four of Bi, B2, ..., Bn-1, and Bn are independently selected from non-natural nucleobases with a substituted or unsubstituted amino radical covalently linked to the nucleobase moiety.
2. A peptide nucleic acid derivative, or a pharmaceutical salt thereof, according to claim 1, characterized in that: n is an integer between 10 and 25; the compound of Formula I has at least one complementary 10-mer overlap with a 14-mer pre-mRNA sequence of [(5' ^3') AUCCCAGGGUAACA] in human SNAP25 pre-mRNA; the compound of Formula I is fully complementary to human SNAP25 pre-mRNA, or partially complementary to human SNAP25 pre-mRNA with one or two mismatches; S1, S2, ..., Sn-1, Sn, T1, T2, ..., Tn-1, and Tn independently represent deuteride, hydride, substituted or unsubstituted alkyl, or substituted or unsubstituted aryl radicals;X and Y independently represent hydride radicals, for Petition 870240084853, dated 04 / 10 / 2024, page 59 / 141 3 / 12 amyla, amino carbonyl, amino thiocarbonyl, substituted or unsubstituted alkyl, substituted or unsubstituted aryl, substituted or unsubstituted alkyl acyl, substituted or unsubstituted aryl acyl, substituted or unsubstituted alkyloxy carbonyl, substituted or unsubstituted aryloxy carbonyl, substituted or unsubstituted alkyl amino carbonyl, substituted or unsubstituted aryl amino carbonyl, substituted or unsubstituted alkyl amino thiocarbonyl, substituted or unsubstituted aryl amino thiocarbonyl, substituted or unsubstituted alkyloxy thiocarbonyl, substituted or unsubstituted aryloxy thiocarbonyl, substituted or unsubstituted alkyl sulfonyl, substituted or unsubstituted aryl sulfonyl, substituted or unsubstituted alkyl phosphonyl, or substituted or unsubstituted aryl phosphonyl;Z represents hydride, hydroxy, substituted or unsubstituted alkyloxy, substituted or unsubstituted aryloxy, substituted or unsubstituted amino, substituted or unsubstituted alkyl, or substituted or unsubstituted aryl; Bi, B2.....Bn-1, and Bn are independently selected from natural nucleobases including adenine, thymine, guanine, cytosine, and uracil, and non-natural nucleobases; and, at least four of B1, B2, ..., Bn-1, and Bn are independently selected from non-natural nucleobases represented by Formula II, Formula III, or Formula IV: wherein, R1, R2, R3, R4, R5, and R6 are independently selected from hydride, and substituted or unsubstituted alkyl;L1, L2, and L3 are a covalent ligand represented by Fór Petition 870240084853, dated 04 / 10 / 2024, page 60 / 141 4 / 12 mula V covalently linking the basic amino group to the nucleobase moiety: where, Qi and Qm are substituted or unsubstituted methylene radicals (-CH2-), and Qm is directly linked to the basic amino group; Q2, Q3, ..., and Qm-1 are independently selected from substituted or unsubstituted methylene, oxygen (-O-), sulfur (-S-), and substituted or unsubstituted amino radical [-N(H)-, or N(substituent)-]; and, m is an integer between 1 and 15.
3. A peptide nucleic acid derivative according to claim 2, or a pharmaceutical salt thereof, characterized in that: n is an integer between 11 and 21; the compound of Formula I has at least one complementary 10-mer overlap with a 14-mer pre-mRNA sequence of [(5'^3')AUCCCAGGGUAACA] in human SNAP25 pre-mRNA; the compound of Formula I is fully complementary to human SNAP25 pre-mRNA, or partially complementary to human SNAP25 pre-mRNA with one or two Si, S2, ..., Sn-1, Sn, T1, T2, ... mismatches.Tn-1 and Tn are hydride radicals; X and Y independently represent hydride radicals, substituted or unsubstituted alkyl, substituted or unsubstituted aryl, substituted or unsubstituted alkyl acyl, substituted or unsubstituted aryl acyl, substituted or unsubstituted alkyloxy carbonyl, substituted or unsubstituted aryloxy carbonyl, substituted or unsubstituted alkyl amino carbonyl, substituted or unsubstituted aryl amino carbonyl, substituted or unsubstituted alkyl sulfonyl, or substituted or unsubstituted aryl sulfo; Z represents substituted or unsubstituted amino radicals; Bi, B2, ..., Bn-1, and Bn are independently selected from natural nucleobases including adenine, thymine, guanine, cytosine, and uracil, and non-natural nucleobases; at least four of Bi, B2, ..., Bn-i, and Bn are selected independently of non-natural nucleobases represented by Formula II, Formula III, or Formula IV; Ri, R2, R3, R4, R5, and Re are selected independently of hydride radical, and substituted or unsubstituted alkyl; Qi and Qm are substituted or unsubstituted methylene radical, and Qm is directly linked to the basic amino group; Q2, Q3, ..., and Qm-i are selected independently of substituted or unsubstituted methylene radical, oxygen, and amino; and m is an integer between ie ii.
4. A peptide nucleic acid derivative according to claim 2, or a pharmaceutical salt thereof, characterized in that: n is an integer between 11 and i9; the compound of Formula 1 has at least one complementary i0-mer overlap with an i4-mer pre-mRNA sequence of [(5'^3')AUCCCAGGGUAACA] in human SNAP25 pre-mRNA; the compound of Formula 1 is fully complementary to human SNAP25 pre-mRNA; Si, S2, ..., Sn-i, Sn, Ti, T2, ..., Tn-i, and Tn are hydride radicals; X and Y independently represent hydride radical, substituted or unsubstituted alkyl, substituted or unsubstituted aryl, substituted or unsubstituted alkyl acyl, substituted or unsubstituted aryl acyl, substituted or unsubstituted alkyl oxy carbonyl, al Petition 870240084853, dated 04 / 10 / 2024, p.62 / 141 6 / 12 substituted or unsubstituted amino carbonyl, substituted or unsubstituted alkyl sulfonyl, or substituted or unsubstituted aryl sulfonyl; Z represents substituted or unsubstituted amino radical; Bi, B2, ..., Bn-1, and Bn are selected independently of natural nucleobases including adenine, thymine, guanine, cytosine, and uracil, and non-natural nucleobases; at least four of Bi, B2, ..., Bn-1, and Bn are selected independently of non-natural nucleobases represented by Formula II, Formula III, or Formula IV; R1, R2, R3, R4, R5, and R6 are selected independently of hydride radical, and substituted or unsubstituted alkyl; Q1 and Qm are methylene radical, and Qm is directly bonded to the basic amino group; Q2, Q3, ..., and Qm-1 are selected independently of methylene radical, oxygen, and amino; e, m is an integer between 1 and 9.
5. A peptide nucleic acid derivative according to claim 2, or a pharmaceutical salt thereof, characterized in that: n is an integer between 11 and 19; the compound of Formula I has at least one complementary 10-mer overlap with a 14-mer pre-mRNA sequence of [(5'^3')AUCCCAGGGUAACA] in human SNAP25 pre-mRNA; the compound of Formula I is fully complementary to human SNAP25 pre-mRNA; S1, S2, ..., Sn-1, Sn, T1, T2, ..., Tn-1, and Tn are hydride radicals; X and Y independently represent hydride radicals, substituted or unsubstituted alkyl, substituted or unsubstituted aryl. Petition 870240084853, dated 10 / 04 / 2024, p. 63 / 141 7 / 12 da, substituted or unsubstituted alkyl acyl, or substituted or unsubstituted aryl acyl, or substituted or unsubstituted alkyloxy carbonyl, Z representing substituted or unsubstituted amino radical; Bi, B2, ...Bn-1 and Bn are selected independently from natural nucleobases including adenine, thymine, guanine, cytosine, and uracil, and non-natural nucleobases; at least four of Bi, B2, ..., Bn-1, and Bn are selected independently from non-natural nucleobases represented by Formula II, Formula III, or Formula IV; R1, R3, and R5 are hydride radicals, and R2, R4, and R6 independently represent hydride radicals, or substituted or unsubstituted alkyl groups; Q1 and Qm are methylene radicals, and Qm is directly bonded to the basic amino group; Q2, Q3, ..., and Qm-1 are selected independently from methylene radicals, oxygen; and m is an integer between 1 and 8.
6. A peptide nucleic acid derivative according to claim 2, or a pharmaceutical salt thereof, characterized in that: n is an integer between 11 and 19; the compound of Formula I has at least one complementary 10-mer overlap with a 14-mer pre-mRNA sequence of [(5'^3')AUCCCAGGGUAACA] in human SNAP25 pre-mRNA; the compound of Formula I is fully complementary to human SNAP25 pre-mRNA; S1, S2, ..., Sn-1, Sn, T1, T2, ..., Tn-1, and Tn are hydride radicals; X and Y independently represent hydride radicals, substituted or unsubstituted alkyl acyl, substituted or unsubstituted aryl acyl. Petition 870240084853, dated 10 / 04 / 2024, p. 64 / 141 8 / 12 substituted, or substituted or unsubstituted alkyloxy carbonyl; Z represents substituted or unsubstituted amino radical; Bi, B2, ..., Bn-1, and Bn are selected independently of adenine, thymine, guanine, cytosine, and non-natural nucleobases; at least five of Bi, B2, ...Bn-1 and Bn are selected independently of non-natural nucleobases represented by Formula II, Formula III, or Formula IV; R1, R2, R3, R4, R5, and R6 are hydride radicals; Q1 and Qm are methylene radicals, and Qm is directly bonded to the basic amino group; Q2, Q3, ..., and Qm-1 are selected independently of methylene radicals, oxygen; and m is an integer between 1 and 8.
7. A peptide nucleic acid derivative according to claim 2, or a pharmaceutical salt thereof, characterized in that: n is an integer between 11 and 19; the compound of Formula I has at least one complementary 10-mer overlap with a 14-mer pre-mRNA sequence of [(5'^3')AUCCCAGGGUAACA] in human SNAP25 pre-mRNA; the compound of Formula I is fully complementary to human SNAP25 pre-mRNA; S1, S2, ..., Sn-1, Sn, T1, T2, ..., Tn-1, and Tn are hydride radicals; X is a hydride radical; Y represents a substituted or unsubstituted alkyl acyl radical, substituted or unsubstituted aryl acyl radical, or substituted or unsubstituted alkyloxy carbonyl radical; Z represents a substituted or unsubstituted amino radical; Bi, B2, ..., Bn-1, and Bn are independently selected Petition 870240084853, dated 04 / 10 / 2024, page 65 / 141 9 / 12 from adenine, thymine, guanine, cytosine, and non-natural nucleobases; at least five of Bi, B2, ..., Bn-1, and Bn are selected independently from unnatural nucleobases represented by Formula II, Formula III, or Formula IV; R1, R2, R3, R4, R5, and Re are hydride radicals; Li represents -(CH2)2-O-(CH2)2-, -CH2-O-(CH2)2-, -CH2-O(CH2)3-, -CH2-O-(CH2)4-, or -CH2-O-(CH2)5- with the right end directly attached to the basic amino group; L2 and L3 are independently selected from -(CH2)2-, (CH2)3-, -(CH2)4-, -(CH2)5-, -(CH2)6-, -(CH2)7-, -(CH2)8-, -(CH2)2-O(CH2)2-, -(CH2)3-O-(CH2)2-, and -(CH2)2-O-(CH2)3- with the right end directly attached to the basic amino group.
8. Peptide nucleic acid derivative according to claim 1, characterized in that it is selected from the group of peptide nucleic acid derivatives provided below, or a pharmaceutically acceptable salt thereof: (N^C) Fethoc-A(6)TT-TG(6)T-TA(6)C-CC(1O2)T-GG(6)GA(6)-NH2; (N^C) Fethoc-A(6)TC-TG(6)T-TA(6)C-CC(1O2)T-GG(6)GA(6)-NH2; (N^C) Piv-A(6)TT-TG(6)T-TA(6)C-CC(1O2)T-GG(6)GA(6)-NH2; (N ^ C) Fethoc-A(6)TT-TG(6)T-TA(2O2)C-CC(1O2)T-GG(5)GA(5)NH2; (N ^ C) Fmoc-Lys-A(6)TT-TG(6)T-TA(6)C-CC(1O2)T-GG(6)GA(6)NH2; (N ^ C) Fethoc-TG(5)T-TA(6)CC(1O2)CT-GG(5)GA(5)-NH2; (N ^ C) Fethoc-TG(5)T-TA(6)CC(1O2)CT-GG(5)TA(5)-NH2; (N ^ C) Fethoc-TG(5)T-TA(6)CC(1O3)CT-GG(5)GA(5)-NH2; (N ^ C) Fethoc-Lys-Leu-TG(5)T-TA(5)C-CC(1O2)T-GG(5)GA(2O2)TLys-NH2; (N ^ C) H-TG(5)T-TA(5)C-CC(1O2)T-GG(3)GA(5)T-NH2; (N ^ C) Benzoyl-TG(5)T-TA(6)CC(1O3)CT-GG(5)GA(5)-Val-Lys-NH2;Petição 870240084853, de 04 / 10 / 2024, pág. 66 / 141 10 / 12 (N ^ C) Benzoil-TG(5)T-TA(5)C-CC(1O3)T-GG(5)G-A(5)T-NH2; (N ^ C) n-Hexanoil-TG(5)T-TA(8)C-CC(1O2)T-GG(5)G-A(5)T-NH2; (N ^ C) n-Propil-TG(5)T-TA(6)C-C(1O3)CT-GG(5)G-A(5)-NH2; (N ^ C) Ac-TG(5)T-TA(6)C-C(1O3)CT-GG(5)G-A(5)-NH2; (N ^ C) [N-(2-fenil etil) amino] carbonil-TG(5)T-TA(4)C-CC(1O2)TGG(5)G-A(5)T-NH2; (N ^ C) n-Propil-TG(2O2)T-TA(5)C-CC(2O2)T-GG(5)G-A(5)T-NH2; (N ^ C) FAM-HEX-HEX-TG(2O2)T-TA(5)C-CC(2O2)T-GG(5)G-A(5)TNH2; (N ^ C) n-Propil-TG(2O2)T-TA(5)C-CC(2O2)T-GG(5)G-A(5)T-ArgNH2; (N ^ C) n-Benzoil-Gly-TG(2O2)T-TA(5)C-CC(2O2)T-GG(5)G-A(5)TNH2; (N ^ C) N-Me-N-fenil-TG(5)T-TA(5)C-CC(1O5)T-GG(5)G-A(5)T-NH2; (N ^ C) p-Tolueno sulfonil-TG(2O3)T-TA(5)C-CC(1O2)T-GG(5)GA(5)T-Lys-NH2; (N ^ C) Fethoc-TG(5)T-TA(6)C-C(1O2)CT-GG(5)G-A(6)T-NH2; (N ^ C) Bezeno sulfonil-TG(5)T-TA(2O3)C-CC(1O5)T-GG(5)G-A(6)TNH2; (N ^ C) fenil-TG(5)T-TA(6)C-C(1O2)CT-GG(5)G-A(6)T-NH2; (N ^ C) Fethoc-TG(5)G-TA(5)C-C(1O2)CT-TG(5)G-A(5)T-NH2;(N ^ C) Fethoc-TG(5)T-AA(5)C-CC(1O2)T-GG(5)T-A(5)T-NH2; (N ^ C) Fethoc-TG(6)T-TA(3)C-CC(1O5)T-GG(6)G-A(3)T-NH2; (N ^ C) Fethoc-G(5)TT-A(5)CC(1O2)-CTG-G(5)GA(5)-TC(1O2)-NH2; (N ^ C) Benzil-G(5)TT-A(5)CC(1O2)-CTG-G(5)GA(5)-TC(1O2)-NH2; (N ^ C) Fethoc-GTT-A(3)CC(1O5)-CTG(6)-GGA(3)-TC(1O5)-NH2; (N ^ C) Fethoc-TA(5)C-C(1O2)CT(1O5)-GG(5)G-A(5)TC-C(1O2)ANH2; (N ^ C) Fmoc-Leu-TA(4)C-C(1O3)CT-GG(5)G-A(4)TC-C(1O3)A-NH2; (N ^ C) Fethoc-C(1O2)AT-TTG(6)-TTA(5)-CCC(1O2)-TG(6)-NH2; Petição 870240084853, de 04 / 10 / 2024, pág. 67 / 141 11 / 12 (N ^ C) Fethoc-CA(6)T-TTG(5)-TTA(5)-CCC(1O2)-TG(5)-NH2; (N ^ C) Fethoc-A(6)TT-TG(5)T-TA(5)C-C(1O2)CT-G(5)-NH2; (N ^ C) Fethoc-CA(6)T-CA(6)T-TTG(5)-TTA(5)-CCC(1O2)-TG(5)NH2;\ (N ^ C) Fethoc-A(5)TT-TG(5)T-TA(5)C-CC(1O2)T-GG(5)G-A(5)-NH2; (N ^ C) Fethoc-A(6)TT-TG(5)T-TA(6)C-C(1O2)CT-GG(5)G-A(5)-NH2;and, (N ^ C) Fethoc-A(6)TT-TG(5)T-TA(6)CC(1O2)CT-G(5)G-NH2: wherein, A, G, T, and C are PNA monomers with a natural nucleobase of adenine, guanine, thymine, and cytosine, respectively; C(pOq), A(p), A(pOq), G9p), and G9pOq) are PNA monomers with a non-natural nucleobase represented by Formula VI, Formula VII, Formula VIII, Formula IX, and Formula X, respectively; Formula VI Formula IX Formula X where, peq are integers; and, the abbreviations for the N- and C-terminal substituents are specifically defined as follows: Fmoc- is the abbreviation for [(9-fluorenyl)methyloxy]carbonyl-; Fethoc- for [2-(9-fluorenyl)ethyl1-oxy]carbonyl; Ac- for acetyl-; Benzoyl- for benzene; Petition 870240084853, dated 04 / 10 / 2024, p. 68 / 141 12 / 12; benzoyl-; Piv- for pivalyl-; n-propyl- for l-(n-propyl)-; H- for hydride group; p-toluenesulfonyl for (4-methylbenzene)-1sulfonyl-; -Lys- for lysine amino acid residue; -Val- for valine amino acid residue;-Leu- for leucine amino acid residue; -Arg- for arginine amino acid residue; -Gly- for glycine amino acid residue; [N-(2-phenylethyl)amino] carbonyl- for [N-1-(2-phenylethyl)amino] carbonyl-; benzyl- for 1-(phenyl)methyl; Phenyl- for phenyl-; Me- for methyl-; -HEX- for 6-amino-1-hexanoyl-; FAM- for 5- or 6-fluorescein carbonyl- (isomeric mixture), and -NH2 for unsubstituted -amino group.
9. Composition, characterized in that it comprises a peptide nucleic acid derivative, as defined in claim 1, and a pharmaceutically acceptable adjuvant.
10. Use of a peptide nucleic acid derivative, as defined in claim 1, characterized in that it is used in the manufacture of a medicament and / or a composition for treating a disease or condition involving the expression of the human SNAP25 gene in a human individual.
11. Use of a peptide nucleic acid derivative, as defined in claim 1, characterized in that it is used in the manufacture of a topical medicament and / or a topical composition to treat a disease or condition involving the expression of the human SNAP25 gene in a human individual.