Target nucleic acid detection by LPHO-assisted cleavage and PTO extension assay

The LPHO-assisted PTO cleavage and extension assay allows for the simultaneous detection of multiple nucleic acids by generating extended duplexes with distinct melting temperatures, addressing the limitations of conventional methods and enhancing detection efficiency.

BR112025017577A2Pending Publication Date: 2026-07-07SEEGENE INC
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
BR · BR
Patent Type
Applications
Current Assignee / Owner
SEEGENE INC
Filing Date
2024-02-27
Publication Date
2026-07-07

AI Technical Summary

Technical Problem

Conventional real-time detection methods for nucleic acids can only detect a single target per marker, limiting the number of nucleic acids that can be simultaneously detected, and fusion analysis is inefficient for multiple targets.

Method used

A novel LPHO-assisted PTO cleavage and extension assay (L-PTOCE) using a primer, PTO, CTO, and LPHO to generate extended duplexes with distinct melting temperatures, allowing simultaneous detection of multiple targets with a single marker.

Benefits of technology

Enables the precise and efficient detection of multiple nucleic acids in real-time with reduced analysis time and minimized false positives, using a single marker in a single reaction vessel.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000000_0000_ABST
    Figure 00000000_0000_ABST
Patent Text Reader

Abstract

The present disclosure relates to detection of target nucleic acid by LPHO-assisted PTO cleavage and extension (L-PTOCE) assay. The method and composition according to the present disclosure ensures detection of one or more target nucleic acids with improved accuracy and convenience.
Need to check novelty before this filing date? Find Prior Art

Description

1 / 136 “TARGET NUCLEIC ACID DETECTION BY LPHO-ASSISTED CLEAVAGE AND PTO EXTENSION ASSAY” Technical Field

[001] This disclosure relates to the detection of a target nucleic acid by means of an LPHO-assisted PTO cleavage and extension assay (LPTOCE). Background of the Technique

[002] For the detection of target nucleic acids, real-time detection methods are widely used, capable of detecting target nucleic acids by monitoring target amplification in real time. Real-time detection methods generally use labeled probes or primers specifically hybridized with target nucleic acids.

[003] Examples of methods that use hybridization between label probes and target nucleic acids include the molecular signal method using double label probes with a hairpin structure (Tyagi et al., Nature Biotechnology v.14 MARCH 1996), the HyBeacon method (French DJ et al., Mol. Cell Probes, 15(6): 363-374 (2001)), the hybridization probe method using two probes, each labeled as donor and acceptor (Bernard et al., 147-148 Clin. Chem. 2000; 46) and the Lux method using individually labeled oligonucleotides (US Patent No. 7,537,886). The TaqMan method (US Patents Nos. 5,210,015 and 5,538,848), which utilizes the cleavage of double probes labeled by the 5'-nuclease activity of DNA polymerase, is also widely used in the technique.

[004] Examples of methods that use labeled primers include the Sunrise primer method (Nazarenko et al., 2516-2521 Nucleic Acids Research, 1997, v.25 no.12, and U.S. Patent No. 6,117,635), the Scorpion primer method (Whitcombe et al., 804-807, Nature Biotechnology v.17 AUGUST 1999 and U.S. Patent No. 6,326,145) and the TSG primer method (WO 2011 / 078441). Petition 870250073538, dated 08 / 20 / 2025, p. 9 / 185 2 / 136

[005] Because conventional real-time detection technologies described above can only detect a single target nucleic acid per marker, the number of target nucleic acids that can be detected simultaneously in a single reaction is limited by the number of markers that can be used (e.g., 5 or less).

[006] Although fusion analysis can be used to detect multiple target nucleic acids using a single marker, it has the disadvantage of requiring a longer throughput time compared to real-time detection technologies, and the design of probes with different Tm values ​​becomes increasingly challenging as the number of target nucleic acids increases.

[007] Thus, conventional real-time detection technologies or fusion analysis are limited in detecting multiple target nucleic acids.

[008] Therefore, there is a need for a real-time detection method that can simultaneously detect a plurality of target nucleic acids in a reaction, despite using a limited number of markers.

[009] Throughout this application, several patents and publications refer to it, and citations are provided in parentheses. Disclosure of these patents and publications in their respective entities is incorporated by reference to this application in order to more fully describe this invention and the state of the art to which this invention relates. Disclosure Technical Problem

[010] The present inventors have endeavored to develop a method for detecting multiple target nucleic acids in real time using a unique type of marker. As a result, we have established a novel protocol for detecting target nucleic acids, which involves probe hybridization, enzymatic reaction such as cleavage and 5' nucleolytic extension, and detection of extended duplexes using a Petition 870250073538, dated 08 / 20 / 2025, p. 10 / 185 3 / 136 Oligonucleotide Labeled Portion Hybridization (LPHO). This protocol ensures the detection of one or more target nucleic acids with greater precision and convenience.

[011] Therefore, it is an objective of the present disclosure to provide a method for detecting a target nucleic acid in a sample by means of the LPHO-assisted PTO Cleavage and Extension (L-PTOCE) assay.

[012] Another objective of this disclosure is to provide a composition for detecting a target nucleic acid in a sample.

[013] Another objective of the present disclosure is to provide a method for detecting n target nucleic acids in a sample.

[014] Another objective of the present disclosure is to provide a method for detecting a target nucleic acid in a sample using a Labeled Portion Hybridization Oligonucleotide (LPHO).

[015] Other objects and advantages of the present invention will become apparent from the detailed description that follows, taken together with the claims and accompanying drawings. Technical Solution

[016] According to one aspect of the present disclosure, a method is provided for detecting a target nucleic acid in a sample by the LPHO-assisted PTO Cleavage and Extension (L-PTOCE) assay, comprising: (a) hybridize a primer and a Probing and Labeling Oligonucleotide (PTO) with the target nucleic acid; wherein the primer comprises a hybridization nucleotide sequence with a first region of the target nucleic acid, wherein the PTO comprises, in a 5' to 3' direction: (i) a 5' labeling portion and (ii) a 3' targeting portion, wherein the 3' targeting portion comprises a sequence of Petition 870250073538, dated 08 / 20 / 2025, p. 11 / 185 4 / 136 nucleotide hybridization with a second region of the target nucleic acid, and the 5' labeling portion comprises a nucleotide sequence not hybridized with the target nucleic acid when the 3' targeting portion is hybridized with the second region of the target nucleic acid, where the primer is located upstream of the PTO; (b) contact the result of step (a) with a DNA polymerase with 5' nuclease activity under PTO cleavage conditions; wherein the primer is extended to induce cleavage of the PTO by DNA polymerase with 5' nuclease activity, such that cleavage releases a fragment comprising the 5' labeled portion of the PTO; (c) hybridize the released PTO fragment with a Capture and Modeling Oligonucleotide (CTO); wherein the CTO comprises, in a 3' to 5' direction: (i) a capture portion comprising a nucleotide sequence hybridized with the 5' tag portion of the PTO and (ii) a template portion comprising a nucleotide sequence not hybridized with the 5' tag portion and the 3' targeting portion of the PTO, wherein the CTO has a reporter molecule and a suppressor molecule that define a tagged portion, wherein the fragment is hybridized with the capture portion of the CTO; (d) perform an extension reaction using the resultant of step (c) and DNA polymerase with 5' nuclease activity in the presence of a Labeled Portion Hybridization Oligonucleotide (LPHO); wherein the LPHO comprises a hybridization nucleotide sequence with the labeled portion of the CTO, in which, when the target nucleic acid is present in the sample, the fragment hybridized with the capture portion of the CTO is extended to generate an extended strand. Petition 870250073538, dated 08 / 20 / 2025, p. 12 / 185 5 / 136 complementary to the CTO, thus generating an extended duplex between the extended strand and the CTO, in which the generation of the extended duplex prevents the formation of a CTO / LPHO hybrid between the labeled portion of the CTO and the LPHO, in which, when the target nucleic acid is not present in the sample, the extended strand is not generated and, instead, the CTO / LPHO hybrid is formed, in which the extended duplex has a melting temperature (Tm) different from the Tm of the CTO / LPHO hybrid; and (e) detect the presence of the extended duplex; where the extended duplex is detected by measuring a signal provided by the extended duplex, where the measurement is performed at a temperature at which the intensity of the signal provided by the extended duplex is different from the intensity of the signal provided by the CTO / LPHO hybrid, and where the presence of the extended duplex indicates the presence of the target nucleic acid.

[017] In one embodiment, the extended duplex is generated by (i) extending the hybridized fragment to the capture portion of the CTO before hybridization of the labeled portion of the CTO and the LPHO, (ii) extending the hybridized fragment to the capture portion of the CTO after hybridization between the labeled portion of the CTO and the LPHO, thereby cleaving the LPHO, or (iii) both items (i) and (ii).

[018] In one embodiment, the generation of the extended duplex prevents the formation of the CTO / LPHO hybrid, by preferring hybridization between the extended strip and the CTO over hybridization between the labeled portion of the CTO and the LPHO.

[019] In one embodiment, the generation of the extended duplex prevents the formation of the CTO / LPHO hybrid, through the cleavage of the LPHO during the extension of step (d).

[020] In one embodiment, when the CTO is not hybridized with the ribbon Petition 870250073538, dated 08 / 20 / 2025, p. 13 / 185 6 / 136 extended or with the LPHO, the reporter molecule and the suppressor molecule in the CTO are very close to each other, causing the suppressor molecule to suppress a signal from the reporter molecule.

[021] In one embodiment, when the CTO is hybridized with the extended strand or with LPHO, the reporter molecule and the suppressor molecule in the CTO are separated, causing the suppressor molecule not to suppress a signal from the reporter molecule.

[022] In one embodiment, (i) both the reporter molecule and the suppressor molecule are bound to the capture portion of the CTO, (ii) both the reporter molecule and the suppressor molecule are bound to the modeling portion of the CTO, or (iii) one of the reporter and suppressor molecules is bound to the capture portion of the CTO and the other is bound to the modeling portion of the CTO.

[023] In one embodiment, LPHO is hybridized with a complete or partial sequence of the labeled portion of the CTO, and the reporter molecule and the suppressor molecule in the CTO are separated, causing the suppressor molecule not to suppress a signal from the reporter molecule.

[024] In one embodiment, the Tm of the extended duplex is at least 3 °C higher than the Tm of the CTO / LPHO hybrid.

[025] In one embodiment, the Tm of the extended duplex is adjustable by (i) a fragment sequence and / or length, (ii) a CTO sequence and / or length, or (iii) both the fragment sequence and / or length and the CTO sequence and / or length, and the Tm of the CTO / LPHO hybrid is adjustable by an LPHO sequence and / or length.

[026] In one embodiment, the LPHO comprises a nucleotide sequence that competes with the fragment for hybridization with the CTO.

[027] In one embodiment, the LPHO is not cleaved by the fragment or its extension product. Petition 870250073538, dated 08 / 20 / 2025, p. 14 / 185 7 / 136

[028] In one embodiment, the LPHO comprises a nucleotide sequence that does not compete with the fragment for hybridization with the CTO.

[029] In one embodiment, the LPHO is cleaved by the fragment or its extension product.

[030] In one embodiment, the temperature for measurement depends on the Tm of the extended duplex and the Tm of the CTO / LPHO hybrid.

[031] In one embodiment, the method is performed in the presence of a plurality of PTOs, a plurality of CTOs and a plurality of LPHOs, and steps (a) to (e) are repeated with denaturation between repetition cycles.

[032] In one embodiment, the temperature for measurement allows (i) at least one of the extended duplexes to remain in its double-tape state and (ii) at least one of the CTO / LPHO hybrids to dissociate into a single-tape state.

[033] According to another aspect of the present disclosure, a composition is provided for detecting a target nucleic acid in a sample, comprising: (a) an initiator; wherein the primer comprises a hybridization nucleotide sequence with a first region of the target nucleic acid, (b) a Probing and Labeling Oligonucleotide (PTO); wherein the PTO comprises, in a 5' to 3' direction: (i) a 5' labeling portion and (ii) a 3' targeting portion, wherein the 3' targeting portion comprises a nucleotide sequence hybridizing with a second region of the target nucleic acid, and the 5' labeling portion comprises a nucleotide sequence not hybridized with the target nucleic acid when the 3' targeting portion is hybridized with the second region of the target nucleic acid, wherein the primer is located upstream of the PTO, wherein the primer is extended to induce cleavage of the PTO by DNA. Petition 870250073538, dated 08 / 20 / 2025, p. 15 / 185 8 / 136 polymerase with 5' nuclease activity, so that cleavage releases a fragment comprising the 5' tagged portion of PTO; (c) a Capture and Modeling Oligonucleotide (CTO); wherein the CTO comprises, in a 3' to 5' direction: (i) a capture portion comprising a nucleotide sequence hybridized with the 5' tag portion of the PTO and (ii) a template portion comprising a nucleotide sequence not hybridized with the 5' tag portion and the 3' targeting portion of the PTO, wherein the CTO has a reporter molecule and a suppressor molecule that defines a tagged portion, wherein the fragment is hybridized with the capture portion of the CTO; and (d) a Tagged Portion Hybridization Oligonucleotide (LPHO); wherein the LPHO comprises a hybridization nucleotide sequence with the labeled portion of the CTO, wherein, when the target nucleic acid is present in the sample, the fragment hybridized with the capture portion of the CTO is extended to generate an extended strand complementary to the CTO, thus generating an extended duplex between the extended strand and the CTO, wherein the generation of the extended duplex prevents the formation of a CTO / LPHO hybrid between the labeled portion of the CTO and the LPHO, wherein, when the target nucleic acid is not present in the sample, the extended strand is not generated and, instead, the CTO / LPHO hybrid is formed, in which the extended duplex has a melting temperature (Tm) different from the Tm of the CTO / LPHO hybrid.

[034] In one embodiment, when the CTO is not hybridized with the extended strand or with the LPHO, the reporter molecule and the suppressor molecule in the CTO are very close to each other, causing the suppressor molecule to suppress a signal from the reporter molecule. Petition 870250073538, dated 08 / 20 / 2025, p. 16 / 185 9 / 136

[035] In one embodiment, when the CTO is hybridized with the extended strand or with LPHO, the reporter molecule and the suppressor molecule in the CTO are separated, causing the suppressor molecule not to suppress a signal from the reporter molecule.

[036] In one embodiment, (i) both the reporter molecule and the suppressor molecule are bound to the capture portion of the CTO, (ii) both the reporter molecule and the suppressor molecule are bound to the modeling portion of the CTO, or (iii) one of the reporter and suppressor molecules is bound to the capture portion of the CTO and the other is bound to the modeling portion of the CTO.

[037] In one embodiment, LPHO is hybridized with a complete or partial sequence of the labeled portion of the CTO, and the reporter molecule and the suppressor molecule in the CTO are separated, causing the suppressor molecule not to suppress a signal from the reporter molecule.

[038] In one embodiment, the LPHO comprises a nucleotide sequence that competes with the fragment for hybridization with the CTO.

[039] In one embodiment, the LPHO comprises a nucleotide sequence that does not compete with the fragment for hybridization with the CTO.

[040] In one embodiment, the composition provides a signal dependent on the presence of the target nucleic acid.

[041] In one embodiment, the signal dependent on the presence of the target nucleic acid is a signal provided by the extended duplex.

[042] In one embodiment, the composition has a signal change temperature range (SChTR) in which the signal changes depending on the presence of the target nucleic acid, and two constant signal temperature ranges (SCoTRs) in which the signal is constant even in the presence of the target nucleic acid.

[043] In one embodiment, the signal change temperature range is greater than the first constant signal temperature range of the two ranges of Petition 870250073538, dated 08 / 20 / 2025, p. 17 / 185 10 / 136 constant signal temperature and lower than the second constant signal temperature range of the two constant signal temperature ranges.

[044] In one embodiment, the extended duplex remains in its double-stranded state and the CTO / LPHO hybrid dissociates into a single-stranded state at temperatures within the signal-switching temperature range in the presence of the target nucleic acid.

[045] According to another aspect of the present disclosure, a method is provided for detecting n target nucleic acids in a sample, comprising: (a) detect signals at n detection temperatures while incubating n compositions to detect the n target nucleic acids with a sample suspected of containing at least one of the n target nucleic acids in a reaction vessel; where n is an integer of 2 or more, where incubation comprises a plurality of reaction cycles and signal detection is performed in at least one of the reaction cycles, where each of the n compositions for detection of the n target nucleic acids provides a signal change at a corresponding detection temperature among the n detection temperatures in the presence of a corresponding target nucleic acid, where the signal change indicates the presence of a corresponding target nucleic acid, where a composition for detection of a / th target nucleic acid among the n compositions for detection of the n target nucleic acids provides a signal change at a / th detection temperature among the n detection temperatures and provides a constant signal at the other detection temperatures in the presence of the / th target nucleic acid, where the signal change indicates the presence of the / th target nucleic acid, where / represents an integer from 1 to n,and the / th detection temperature is less than the ( / +1)th detection temperature, Petition 870250073538, dated 08 / 20 / 2025, p. 18 / 185 11 / 136 wherein, within the temperature range encompassing all n detection temperatures, the composition for detecting the / th target nucleic acid has a signal-change temperature range (SChTR) in which the signal changes depending on the presence of the / th target nucleic acid, and one or two constant-signal temperature ranges (SCoTRs) in which the signal is constant even in the presence of the / th target nucleic acid, wherein the composition for detecting the / th target nucleic acid is any one of the following: (i) an Under-Signal-Change (UnderSC) type composition with a melting feature wherein the signal-change temperature range is smaller than the constant-signal temperature range, (ii) an Inter-Signal-Change (InterSC-type) type composition with a melting feature wherein the signal-change temperature range is larger than one of the two constant-signal temperature ranges and smaller than the other of the two constant-signal temperature ranges, and (iii) an Over-Signal-Change (OverSC) type composition with a melting feature wherein the signal-change temperature range is larger than the constant-signal temperature range, and wherein at least one of the n compositions for detection of n target nucleic acids is (ii) an InterSC type composition that generates the signal according to the L-PTOCE assay, as described above, and (b) determine the presence of the n target nucleic acids from the signals detected in step (a),where the presence of the / th target nucleic acid is determined by the signal change detected at the / th detection temperature.

[046] In one embodiment, the / th detection temperature is selected within the signal-change temperature range of the composition to detect the / th target nucleic acid, wherein the / th detection temperature is not Petition 870250073538, dated 08 / 20 / 2025, p. 19 / 185 12 / 136 included in the signal-change temperature ranges of the compositions to detect the other target nucleic acids.

[047] In one embodiment, the signal change temperature range of the composition for detection of the / th target nucleic acid partially overlaps with the signal change temperature range of a composition for detection of a target nucleic acid with an adjacent detection temperature and does not overlap with the signal change temperature range of a composition for detection of a target nucleic acid with a non-adjacent detection temperature.

[048] In one embodiment, when n is 2, the composition to detect the first target nucleic acid is an UnderSC or InterSC type composition, and the composition to detect the second target nucleic acid is an InterSC or OverSC type composition.

[049] In one embodiment, when n is 3 or more, the composition for detecting the first target nucleic acid is an UnderSC or InterSC type composition, the composition for detecting the nth target nucleic acid is an InterSC or OverSC type composition, and each of the compositions for detecting target nucleic acids other than the first target nucleic acid and the nth target nucleic acid is an InterSC type composition.

[050] In one embodiment, the composition for the detection of the / th target nucleic acid comprises a marker that provides a signal dependent on the presence of the / th target nucleic acid.

[051] In one embodiment, the marker is linked to an oligonucleotide or is incorporated into an oligonucleotide during incubation.

[052] In one embodiment, the composition for the detection of the / th target nucleic acid provides a duplex that provides a signal change.

[053] In one embodiment, the duplex that provides the signal change was initially included in the composition for the detection of the / th target nucleic acid. Petition 870250073538, dated 08 / 20 / 2025, page 20 / 185 13 / 136

[054] In one embodiment, the duplex that provides the sign change is generated by hybridization between a labeled oligonucleotide and an oligonucleotide that is hybridizable with the labeled oligonucleotide.

[055] In one embodiment, the duplex that provides the signal change is generated during incubation.

[056] In one embodiment, the duplex that provides the signal change is generated by hybridization between a labeled oligonucleotide and the corresponding target nucleic acid.

[057] In one embodiment, the duplex that provides the signal change is generated by a cleavage reaction dependent on the presence of the corresponding target nucleic acid.

[058] In one embodiment, the duplex that provides the signal change comprises a marker.

[059] In one embodiment, the composition for detecting the / th target nucleic acid provides a duplex that provides a signal change, and the signal change temperature range of the composition for detecting the / th target nucleic acid varies depending on the length and / or sequence of the duplex.

[060] In one embodiment, signal detection is performed in at least two of the plurality of reaction cycles.

[061] In one embodiment, the signal change is measured using signals detected in at least two of the plurality of reaction cycles.

[062] In one embodiment, the signal change at the / th detection temperature is measured using a signal detected in at least one of the reaction cycles and a reference signal value.

[063] In one embodiment, the reference signal value is obtained from a reaction in the absence of the target / th nucleic acid.

[064] In one embodiment, the detection of a signal in each of the n Petition 870250073538, dated 08 / 20 / 2025, page 21 / 185 14 / 136 temperature detection is performed using a unique type of detector.

[065] In one embodiment, the signals detected at the n detection temperatures are not differentiated from each other by the single type of detector.

[066] In one embodiment, incubation comprises a nucleic acid amplification reaction.

[067] According to another aspect of the present disclosure, a method is provided for detecting a target nucleic acid in a sample using a Labeled Portion Hybridization Oligonucleotide (LPHO), comprising: (a) provide a fragment produced by an enzymatic cleavage reaction of an oligonucleotide, depending on the presence of the target nucleic acid in the sample; (b) hybridize the fragment with a Capture and Modeling Oligonucleotide (CTO); wherein the CTO comprises, in a 3' to 5' direction: (i) a capture portion comprising a nucleotide sequence that hybridizes with the fragment and (ii) a template portion comprising a nucleotide sequence that does not hybridize with the fragment, wherein the CTO has a reporter molecule and a suppressor molecule that define a labeled portion, wherein the fragment is hybridized with the capture portion of the CTO; (c) perform an extension reaction using the resultant of step (b) and a DNA polymerase with 5' nuclease activity in the presence of LPHO; wherein the LPHO comprises a hybridization nucleotide sequence with the labeled portion of the CTO, wherein, when the target nucleic acid is present in the sample, the fragment hybridized with the capture portion of the CTO is extended to generate an extended strand complementary to the CTO, thus generating an extended duplex between the extended strand and the CTO, wherein the generation of the extended duplex prevents the formation of a hybrid. Petition 870250073538, dated 08 / 20 / 2025, p. 22 / 185 15 / 136 (a) CTO / LPHO between the labeled portion of the CTO and the LPHO, wherein, when the target nucleic acid is not present in the sample, the extended strand is not generated and, instead, the CTO / LPHO hybrid is formed, in which the extended duplex has a melting temperature (Tm) different from the Tm of the CTO / LPHO hybrid; and (d) detect the presence of the extended duplex; where the extended duplex is detected by measuring a signal provided by the extended duplex, where the measurement is performed at a temperature at which the signal intensity of the extended duplex is different from the signal intensity of the CTO / LPHO hybrid, and where the presence of the extended duplex indicates the presence of the target nucleic acid. Advantageous Effects

[068] The features and advantages of this disclosure will be summarized below: (a) The first feature of the present disclosure is to use (i) a PTO that hybridizes with the target nucleic acid, (ii) a CTO having a reporter molecule and a suppressor molecule defining a labeled portion and capable of generating an extended duplex in the presence of the target nucleic acid, and (iii) an LPHO comprising a nucleotide sequence hybridizing with the labeled portion of the CTO, for the detection of the target nucleic acid. In particular, the reporter and suppressor molecules in the CTO are very close to each other before the CTO is hybridized with another oligonucleotide (such as LPHO or extended strand), and the suppressor molecule suppresses the signal from the reporter molecule. However, after hybridization of the CTO with another oligonucleotide (such as LPHO or extended strand), the reporter and suppressor molecules in the CTO are separated, causing the suppressor molecule to no longer suppress the signal from the reporter molecule. Petition 870250073538, dated 08 / 20 / 2025, p. 23 / 185 16 / 136 (b) The second feature of the present disclosure is that the CTO / LPHO hybrid has a Tm adjustable by a sequence and / or length of the LPHO, and the extended duplex has a Tm adjustable by (i) a fragment sequence and / or length, (ii) a CTO sequence and / or length, or (iii) both the fragment sequence and / or length and the CTO sequence and / or length. By using this feature, the Tm of the CTO / LPHO hybrid and the Tm of the extended duplex can be predetermined to be different from each other. These two different Tm values ​​allow the composition for detection of a target nucleic acid, according to the present disclosure, to have a signal-change temperature range, in which the signal changes depending on the presence of the target nucleic acid, and two constant-signal temperature ranges, in which the signal is constant even in the presence of the target nucleic acid. (c) The composition according to the present disclosure, as an InterSC-type composition, allows the detection of one or more target nucleic acids using a single type of marker in a single reaction vessel. Specifically, by using a plurality of compositions to detect a plurality of target nucleic acids, a plurality of target nucleic acids can be detected in real time using a single type of marker by adjusting the signal-change temperature range of each of the compositions to detect a plurality of target nucleic acids, in particular, adjusting the signal-change temperature ranges so as not to overlap with each other. Furthermore, the method of the present disclosure has the advantage of drastically reducing its analysis time compared to conventional fusion analysis after target amplification to detect multiple target nucleic acids using a single type of marker. (d) Furthermore, the method described in this disclosure is effective in detecting nucleotide variations with a low occurrence of false positives. Description of the Drawings Petition 870250073538, dated 08 / 20 / 2025, p. 24 / 185 17 / 136

[069] Figure 1 illustrates the L-PTOCE assay of this disclosure.

[070] Figure 2A shows several embodiments in which the LPHO being hybridised with the labeled portion of the CTO completely (ii, iii, iv or vi) or partially (i or v) overlaps the PTO fragment being hybridised with the capture portion of the CTO.

[071] Figure 2B shows several embodiments in which the LPHO being hybridised with the labeled portion of the CTO does not overlap the PTO fragment to be hybridised with the capture portion of the CTO.

[072] Figure 3 shows, in the absence of the target nucleic acid or before the reaction between the target nucleic acid and the L-PTOCE composition, the conformational changes of CTO and LPHO (i.e., the CTO / LPHO hybrid) in the (i) first constant signal temperature range, (ii) in the signal change temperature range and (iii) in the second constant signal temperature range;

[073] Figure 4 shows, after the reaction of the target nucleic acid and the L-PTOCE composition, the conformational changes of the CTO and the extended strand (i.e., extended duplex) in (i) a first constant signal temperature range, (ii) a signal change temperature range and (iii) a second constant signal temperature range.

[074] Figure 5A shows the quantity (or abundance) proportions of the CTO / LPHO hybrid and the extended duplex in the initial, intermediate and final cycles of steps (a) to (e) of the L-PTOCE assay, along with their melting curves.

[075] Figure 5B represents a merged graph for three fusion curves in Figure 5A.

[076] Figure 6 shows the real-time PCR results for Combination 1 of Example 1.

[077] Figure 7 shows the real-time PCR results for Combination 2 from Example 1. Petition 870250073538, dated 08 / 20 / 2025, page 25 / 185 18 / 136

[078] Figure 8 shows the real-time PCR results for Combination 3 from Example 1.

[079] Figure 9 shows the real-time PCR results for Combination 4 from Example 1.

[080] Figure 10 shows the real-time RT-PCR results for the detection of nucleotide variation in Example 2.

[081] Figure 11 schematically shows the signal generation mechanisms of two compositions, an UnderSC type composition and an InterSC type composition, used in Example 3.

[082] Figure 12 shows the results of real-time multiplex PCR in Example 3. Best Mode

[083] The present inventors have endeavored to develop a method for detecting multiple target nucleic acids in real time using a unique type of marker. As a result, we have established a novel protocol for target nucleic acid detection, which involves probe hybridization, enzymatic reaction such as cleavage and 5' nucleolytic extension, and detection of extended duplexes using Labeled Portion Hybridization Oligonucleotide (LPHO). The present protocol ensures the detection of one or more target nucleic acids with greater accuracy and convenience. I. Target Nucleic Acid Detection Method using the L-PTOCE Assay

[084] In a first aspect of the present disclosure, a method is provided for detecting a target nucleic acid in a sample by means of the LPHO-Assisted PTO Cleavage and Extension (L-PTOCE) assay, comprising: (a) hybridize a primer and a Probing and Labeling Oligonucleotide (PTO) with the target nucleic acid; where the primer comprises a nucleotide sequence of Petition 870250073538, dated 08 / 20 / 2025, page 26 / 185 19 / 136 hybridization with a first region of the target nucleic acid, wherein the PTO comprises, in a 5' to 3' direction: (i) a 5' labeling portion and (ii) a 3' targeting portion, wherein the 3' targeting portion comprises a nucleotide sequence hybridizing with a second region of the target nucleic acid, and the 5' labeling portion comprises a nucleotide sequence not hybridized with the target nucleic acid when the 3' targeting portion is hybridized with the second region of the target nucleic acid, wherein the primer is located upstream of the PTO; (b) contact the result of step (a) with a DNA polymerase with 5' nuclease activity under PTO cleavage conditions; wherein the primer is extended to induce cleavage of the PTO by DNA polymerase with 5' nuclease activity, such that cleavage releases a fragment comprising the 5' label portion of the PTO; (c) hybridize the released PTO fragment with a Capture and Modeling Oligonucleotide (CTO); wherein the CTO comprises, in a 3' to 5' direction: (i) a capture portion comprising a nucleotide sequence hybridized with the 5' tag portion of the PTO and (ii) a template portion comprising a nucleotide sequence not hybridized with the 5' tag portion and the 3' targeting portion of the PTO, wherein the CTO has a reporter molecule and a suppressor molecule that define a tagged portion, wherein the fragment is hybridized with the capture portion of the CTO; (d) perform an extension reaction using the resultant of step (c) and DNA polymerase with 5' nuclease activity in the presence of a Labeled Portion Hybridization Oligonucleotide (LPHO); Petition 870250073538, dated 08 / 20 / 2025, page 27 / 185 20 / 136 wherein the LPHO comprises a hybridization nucleotide sequence with the labeled portion of the CTO, wherein, when the target nucleic acid is present in the sample, the fragment hybridized with the capture portion of the CTO is extended to generate an extended strand complementary to the CTO, thus generating an extended duplex between the extended strand and the CTO, wherein the generation of the extended duplex prevents the formation of a CTO / LPHO hybrid between the labeled portion of the CTO and the LPHO, wherein, when the target nucleic acid is not present in the sample, the extended strand is not generated and instead the CTO / LPHO hybrid is formed, wherein the extended duplex has a melting temperature (Tm) different from the Tm of the CTO / LPHO hybrid; and (e) detect the presence of the extended duplex; where the extended duplex is detected by measuring a signal provided by the extended duplex, where the measurement is performed at a temperature at which the intensity of the signal provided by the extended duplex is different from the intensity of the signal provided by the CTO / LPHO hybrid, and where the presence of the extended duplex indicates the presence of the target nucleic acid.

[085] Denotations such as “first”, “second”, “A”, “B”, “(a)”, “(b)”, “(i)” and “(ii)” may be used to describe the components of this disclosure. These denotations are provided merely to distinguish one component from another, and the essence of the components is not limited by denotations based on order or sequence.

[086] The method according to this disclosure employs successive events occurring through probe hybridization, namely, PTO cleavage and extension; extended duplex generation; and extended duplex detection using LPHO, which is Petition 870250073538, dated 08 / 20 / 2025, p. 28 / 185 21 / 136 referred to as the “LPHO-assisted PTO cleavage and extension (L-PTOCE)” trial.

[087] The L-PTOCE assay of this disclosure is illustrated schematically in Figure 1. The L-PTOCE assay will be described in more detail below: Step (a): Hybridization of Primers and PTO with Target Nucleic Acid

[088] According to the present disclosure, a target nucleic acid in a sample is hybridized with a primer and a PTO (Probing and Labeling Oligonucleotide).

[089] The term “target nucleic acid”, “target nucleic acid sequence” or “target sequence”, as used in this document, refers to a nucleic acid sequence to be detected or quantified. The target nucleic acid sequence includes both single-stranded and double-stranded nucleic acids. The target nucleic acid sequence includes not only a newly generated sequence in a reaction, but also a sequence initially present in a nucleic acid sample.

[090] The target nucleic acid includes any DNA molecule (gDNA and cDNA) and RNA and their hybrids (chimeric nucleic acids). The sequence may be in a double-stranded or single-stranded form.

[091] Target nucleic acids include any naturally occurring prokaryotic, eukaryotic nucleic acid (e.g., protozoa and parasites, fungi, yeasts, higher plants, lower animals and higher animals, including mammals and humans) or viral (e.g., herpes virus, HIV, influenza virus, Epstein-Barr virus, hepatitis virus, poliovirus, etc.) or viroid. Furthermore, the nucleic acid molecule may be any nucleic acid molecule produced or that may be produced by recombination, or any nucleic acid molecule that is or may be chemically synthesized. Thus, the nucleic acid sequence may or may not be found in nature. The target nucleic acid sequence may be known or unknown. Petition 870250073538, dated 08 / 20 / 2025, page 29 / 185 22 / 136

[092] As used in this document, the term “sample” refers to cells, tissues, or fluid from a biological source or any other medium that may be demonstrably useful in the present invention, and includes viruses, bacteria, tissues, cells, blood, serum, plasma, lymph, milk, urine, feces, intraocular fluid, saliva, semen, brain extract, spinal fluid, appendix, spleen and tonsil tissue extracts, amniotic fluid, ascites, and non-biological samples (e.g., food and water). In addition, the sample includes naturally occurring nucleic acid molecules isolated from a biological source and synthesized nucleic acid molecules.

[093] As used in this document, the term “primer” refers to an oligonucleotide capable of acting as a starting point for synthesis when placed under conditions in which the synthesis of the primer extension product that is complementary to a target (template) nucleic acid is induced, i.e., in the presence of nucleotides and a polymerization agent, such as DNA polymerase, and at appropriate temperatures and pH. The primer must be long enough to initiate the synthesis of the extension product in the presence of the polymerization agent. The appropriate primer length will depend on many factors, including temperature, application, and primer source.

[094] The term “probe”, as used in this document, refers to a single-stranded nucleic acid molecule comprising one or more hybridization moieties for a target nucleic acid sequence. In this document, PTO serves as a probe.

[095] In particular, the probe and primer are single-stranded deoxyribonucleotide molecules. The probes or primers used in this invention may comprise naturally occurring dNMPs (i.e., dAMP, dGM, dCMP, and dTMP), modified nucleotides, or non-natural nucleotides. The probes or primers may also include ribonucleotides.

[096] The term “ringing” or “initiation”, as used in this document, if Petition 870250073538, dated 08 / 20 / 2025, page 30 / 185 23 / 136 refers to the apposition of an oligodeoxynucleotide or nucleic acid to a nucleic acid template, whereby the apposition enables the polymerase to polymerize nucleotides into a nucleic acid molecule that is complementary to the nucleic acid template or a portion thereof.

[097] The term “hybridize”, “hybridize” or “hybridization”, as used in this document, refers to the formation of double strands by non-covalent association between two complementary single-stranded polynucleotides under certain hybridization conditions or stringent conditions.

[098] Hybridization can occur between two perfectly matched or substantially matched nucleic acid strands with some mismatches (e.g., 1 to 4 mismatches). Hybridization complementarity can depend on hybridization conditions, primarily temperature.

[099] Hybridization of a target nucleic acid with primers and PTO can be performed under suitable hybridization conditions, routinely determined by optimization procedures. Conditions such as temperature, component concentration, hybridization and washing times, buffer components and their pH and ionic strength can vary depending on several factors, including the length and GC content of the oligonucleotide (primer and PTO) and the target nucleotide sequence. For example, when a relatively short oligonucleotide is used, it is preferable to adopt less stringent conditions. Detailed conditions for hybridization can be found in Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001); and MLM Anderson, Nucleic Acid Hybridization, Springer-Verlag New York Inc., NY (1999). NY (1999).

[0100] There is no intended distinction between the terms “annealing” and “hybridization”, and these terms will be used interchangeably. Petition 870250073538, dated 08 / 20 / 2025, p. 31 / 185 24 / 136

[0101] In one embodiment, the primer used in the present disclosure comprises a hybridization nucleotide sequence with a first region of the target nucleic acid.

[0102] In particular, the expression in this document that an oligonucleotide (e.g., primer or PTO) “comprises a hybridization nucleotide sequence” to another oligonucleotide (e.g., target nucleic acid) means that all or a portion of an oligonucleotide has a complementary nucleotide sequence required for hybridization with all or a portion of another oligonucleotide. Furthermore, when referring to the hybridization of a portion of an oligonucleotide with another oligonucleotide, the portion of an oligonucleotide may be considered as an individual oligonucleotide.

[0103] The term “complementary” is used in this document to mean that the primers or probes are sufficiently complementary to selectively hybridize with a target nucleic acid under the designated annealing conditions or stringent conditions, encompassing the terms “substantially complementary” and “perfectly complementary”, particularly perfectly complementary.

[0104] In contrast, the term “non-complementary” is used in this document to mean that the primers or probes are sufficiently non-complementary not to selectively hybridize with a target nucleic acid under the designated annealing conditions or stringent conditions, encompassing the terms “substantially non-complementary” and “perfectly non-complementary”, particularly perfectly non-complementary.

[0105] As used in this document, the term “Probing and Labeling Oligonucleotide (PTO)” means an oligonucleotide comprising in a 5' to 3' direction: (i) a 5' labeling portion and (ii) a 3' labeling portion, wherein the 3' labeling portion comprises a nucleotide sequence of Petition 870250073538, dated 08 / 20 / 2025, page 32 / 185 25 / 136 hybridization with a second region of the target nucleic acid, and the 5' label portion comprises a nucleotide sequence that is not hybridized with the target nucleic acid when the 3' label portion is hybridized with the second region of the target nucleic acid.

[0106] In one embodiment, the PTO comprises, in a 5' to 3' direction: (i) a 5' labeling portion comprising a non-hybridizing nucleotide sequence for the target nucleic acid and (ii) a 3' labeling portion comprising a hybridizing nucleotide sequence with a second region of the target nucleic acid; wherein the 5' labeling portion of the PTO is not hybridized with the target nucleic acid, but the 3' labeling portion of the PTO is hybridized with the target nucleic acid. In other words, the PTO comprises two portions, as follows: (i) a 3' targeting portion that serves as a probe and (ii) a 5' labeling portion that is nucleolytically released from the PTO after hybridization with the target nucleic acid. The 5' marking portion and the 3' direction portion on the PTO should be positioned in the order of 5' to 3'.

[0107] The expression in this document that an oligonucleotide (e.g., the 5' tag portion of PTO) “comprises a non-hybridizing nucleotide sequence” to another oligonucleotide (e.g., the target nucleic acid) means that an oligonucleotide has a non-complementary nucleotide sequence required for non-hybridization with another oligonucleotide.

[0108] In one embodiment, hybridization in step (a) is performed under strict conditions, such that the 3' targeting portion of the PTO is hybridized with the second region of the target nucleic acid and the 5' labeling portion of the PTO is not hybridized with the target nucleic acid.

[0109] A PTO does not require any specific length. For example, the length of a PTO can be 15 to 150 nucleotides, 15 to 100 nucleotides, 15 to 80 nucleotides, 15 to 60 nucleotides, 15 to 40 nucleotides, 20 to 150 nucleotides, Petition 870250073538, dated 08 / 20 / 2025, page 33 / 185 26 / 136 to 100 nucleotides, 20 to 80 nucleotides, 20 to 60 nucleotides, 20 to 50 nucleotides, 30 to 150 nucleotides, 30 to 100 nucleotides, 30 to 80 nucleotides, 30 to 60 nucleotides, 30 to 50 nucleotides, 35 to 100 nucleotides, 35 to 80 nucleotides, 35 to 60 nucleotides, or 35 to 50 nucleotides.

[0110] The 3' targeting portion of the PTO can be of any length, as long as it is specifically hybridized with the target nucleic acid sequences. For example, the 3' targeting portion of the PTO can be 10 to 100 nucleotides, 10 to 80 nucleotides, 10 to 50 nucleotides, 10 to 40 nucleotides, 10 to 30 nucleotides, 15 to 100 nucleotides, 15 to 80 nucleotides, 15 to 50 nucleotides, 15 to 40 nucleotides, 15 to 30 nucleotides, 20 to 100 nucleotides, 20 to 80 nucleotides, 20 to 50 nucleotides, 20 to 40 nucleotides, or 20 to 30 nucleotides in length.

[0111] The 5' tag portion can be of any length, provided it is specifically hybridized with the CTO template portion and then extended. For example, the 5' tag portion of the PTO can be 5 to 50 nucleotides, 5 to 40 nucleotides, 5 to 30 nucleotides, 5 to 20 nucleotides, 10 to 50 nucleotides, 10 to 40 nucleotides, 10 to 30 nucleotides, 10 to 20 nucleotides, 15 to 50 nucleotides, 15 to 40 nucleotides, 15 to 30 nucleotides, or 15 to 20 nucleotides in length.

[0112] In one embodiment, the 3' end of the PTO may have a 3'OH terminal. In particular, the 3' end of the PTO is “blocked” to prohibit its extension.

[0113] Blocking can be achieved using conventional methods. For example, blocking can be achieved by adding a chemical moiety to the 3'-hydroxyl group of the last nucleotide, such as biotin, markers, a phosphate group, an alkyl group, a non-nucleotide ligand, phosphorothioate, or alkanediol. Alternatively, blocking can be achieved by removing the 3'-hydroxyl group from the last nucleotide or by using a nucleotide without a 3'-hydroxyl group, such as Petition 870250073538, dated 08 / 20 / 2025, page 34 / 185 27 / 136 dideoxynucleotide.

[0114] Alternatively, the PTO can be designed to have a clamp-shaped structure.

[0115] Non-hybridization between the 5' label portion of the PTO and the target nucleic acid refers to the non-formation of a stable double strand between them under certain hybridization conditions. In one embodiment, the 5' label portion of the PTO not involved in hybridization with the target nucleic acid forms a single strand.

[0116] The primer used in this disclosure refers to a primer located upstream of the PTO. When the target nucleic acid is double-stranded, the primer and the PTO are hybridized with one strand of the double-stranded target nucleic acid, and the PTO is positioned downstream of the primer. The primer is hybridized with a specific portion (i.e., a first region of the target nucleic acid) in the 3' direction relative to the portion (i.e., a second region of the target nucleic acid) of the target nucleic acid strand to which the PTO is hybridized.

[0117] In one embodiment, when a target nucleic acid is double-stranded, a strand of the double-stranded target nucleic acid comprises both a first region and a second region of the target nucleic acid. In particular, a strand of the double-stranded target nucleic acid comprises, in the 3' to 5' direction: (i) a first region to be hybridized with the primer; and (ii) a second region to be hybridized with the PTO.

[0118] In one embodiment, the method is performed in the presence of an additional primer. The additional primer further generates a target nucleic acid to be hybridized with the PTO, increasing the sensitivity in target detection. The additional primer may also refer to a downstream primer.

[0119] In one embodiment, when the primer and the additional primer are used, a template-dependent nucleic acid polymerase is additionally employed for primer extension. The primer and the additional primer Petition 870250073538, dated 08 / 20 / 2025, p. 35 / 185 28 / 136 can also refer to a direct initiator and a reverse initiator, respectively.

[0120] In one embodiment, the primer, the additional primer and / or the 5' labeling portion of the PTO have a double-priming oligonucleotide (DPO) structure. Oligonucleotides with the DPO structure show significantly better target specificity compared with conventional primers and probes (see WO 2006 / 095981; Chun et al., Double-priming oligonucleotide system for multiplex detection of respiratory viruses and CYP2C19 gene SNP genotyping, Nucleic Acid Research, 35: 6e40(2007)).

[0121] In one embodiment, the 3' targeting portion of the PTO has a modified dual-specificity oligonucleotide (mDSO) structure. The modified dual-specificity oligonucleotide (mDSO) structure shows significantly better target specificity compared with conventional probes (see WO 2011 / 028041). Step (b): Release of the PTO Cleavage Fragment

[0122] Next, the result of step (a) is placed in contact with a DNA polymerase with 5' nuclease activity under PTO cleavage conditions. The primer is extended to induce PTO cleavage by the DNA polymerase with 5' nuclease activity, so that cleavage releases a fragment comprising the 5' label portion of the PTO.

[0123] In one embodiment, primer extension induces PTO cleavage by DNA polymerase with 5' nuclease activity. In particular, the primer is hybridized with a first target nucleic acid region, which is positioned away from the PTO, DNA polymerase with 5' nuclease activity promotes primer extension, and DNA polymerase with 5' nuclease activity bound to the extension product cleaves the PTO.

[0124] In another mode, the initiator is hybridized with a first Petition 870250073538, dated 08 / 20 / 2025, page 36 / 185 29 / 136 target nucleic acid region, which is positioned adjacent to the PTO in such a way as to be sufficient to induce cleavage of the PTO by DNA polymerase with 5' nuclease activity, and the DNA polymerase with 5' nuclease activity bound to the primer cleaves the PTO without an extension reaction.

[0125] Therefore, PTO cleavage induction can be performed in two different ways: (i) primer length-dependent cleavage induction and (ii) primer length-independent cleavage induction.

[0126] Depending on the selected method of cleavage induction, the primer may be located relative to the PTO. The primer may be located far from the PTO, such that it is sufficient to induce PTO cleavage in a length-dependent manner. In other words, the first and second regions of the target nucleic acid may be separated from each other. Alternatively, the primers may be located adjacent to the PTO such that they are sufficient to induce PTO cleavage in a length-independent manner. In other words, the first and second regions of the target nucleic acid may be very close to each other.

[0127] As used in this document, the term “adjacent,” referring to positions or locations, means that the primer is located adjacent to the 3' targeting portion of the PTO to form a cut. Additionally, the term means that the primer is located 1 to 30 nucleotides, 1 to 20 nucleotides, or 1 to 15 nucleotides away from the 3' targeting portion of the PTO.

[0128] As used in this document, the term “located far from”, referring to positions or locations, includes any positions or locations sufficient to warrant extension reactions.

[0129] In one embodiment, the initiator is located far enough from the PTO to induce PTO cleavage in an extent-dependent manner.

[0130] In one embodiment, conventional technologies for reactions of Petition 870250073538, dated 08 / 20 / 2025, p. 37 / 185 30 / 136 cleavage by primers can be applied to the present invention, provided that the primer hybridized with the first region of the target nucleic acid induces cleavage of the PTO hybridized with the second region of the target nucleic acid to release a fragment comprising the 5' label portion or a portion of the 5' label portion of the PTO. For example, U.S. Patents Nos. 5,210,015, 5,487,972, 5,691,142, 5,994,069 and 7,381,532 and U.S. Application Publication No. 2008-0241838 can be applied to the present invention.

[0131] The phrase “conditions for PTO cleavage”, as used in this document, means conditions sufficient to digest PTO hybridized with the target nucleic acid by an enzyme with 5' nuclease activity (e.g., DNA polymerase with 5' nuclease activity), such as temperature, pH, ionic strength, buffer, oligonucleotide length and sequence, and enzymes. For example, when Taq DNA polymerase is used as the enzyme with 5' nuclease activity, the conditions for PTO cleavage include Tris-HCl buffer, KCl, MgCl2, and temperature.

[0132] When PTO is hybridized with the target nucleic acid, its 3' targeting portion is involved in hybridization and its 5' labeling portion forms a single strand without hybridization with the target nucleic acid (see Figure 1). In this way, an oligonucleotide comprising single-stranded and double-stranded structures can be digested using an enzyme with 5' nuclease activity by a variety of technologies known to a person skilled in the art.

[0133] PTO cleavage sites vary depending on the primer type, primer hybridization sites, and cleavage conditions (see U.S. Patents Nos. 5,210,015, 5,487,972, 5,691,142, 5,994,069, and 7,381,532 and U.S. Patent Application Publication No. 2008-0241838).

[0134] Several conventional technologies can be employed for the cleavage reaction of PTO, releasing a fragment comprising the portion of Petition 870250073538, dated 08 / 20 / 2025, page 38 / 185 31 / 136 marking 5' or portion of the marking portion 5'.

[0135] Briefly, there may be three cleavage sites in step (b). The first cleavage site is a junction site between a hybridization portion of the PTO (3' targeting portion) and a non-hybridization portion (5' labeling portion). The second cleavage site is a site located several nucleotides in the 3' direction, distant from the 3' end of the 5' labeling portion of the PTO. The second cleavage site is located at the 5' end of the 3' targeting portion of the PTO. The third cleavage site is a site located several nucleotides in the 5' direction, beyond the 3' end of the 5' labeling portion of the PTO.

[0136] In one embodiment, the starting site for PTO cleavage by DNA polymerase with 5' nuclease activity after primer extension is a double-strand departure point between PTO and the target nucleic acid or a site 1 to 3 nucleotides away from the departure point.

[0137] In this sense, the phrase “a PTO fragment comprising the 5' tag portion of PTO” in the context of PTO cleavage by DNA polymerase with 5' nuclease activity, as used in this document, is used to encompass (i) the 5' tag portion, (ii) the 5' tag portion and the 5' end portion of the 3' targeting portion (e.g., the first nucleotide at the 5' end of the 3' targeting portion, the first and second nucleotides at the 5' end of the 3' targeting portion, the first to third nucleotides at the 5' end of the 3' targeting portion, the first to fourth nucleotide at the 5' end of the 3' targeting portion, or the first to fifth nucleotide at the 5' end of the 3' targeting portion) and (iii) a portion of the 5' tag portion. The phrase “a fragment comprising the 5' marking portion of the PTO” may be abbreviated in this document as “PTO fragment” or “fragment”.

[0138] The term “portion” used in conjunction with the PTO or the CTO, such as the portion of the 5' marking portion of the PTO, the 5' end portion of the portion of Petition 870250073538, dated 08 / 20 / 2025, p. 39 / 185 32 / 136 targeting the 3' end of the PTO and the 5' end portion of the CTO capture portion, refers to a nucleotide sequence composed of 1 to 40, 1 to 30, 1 to 20, 1 to 15, 1 to 10 or 1 to 5 nucleotides, particularly 1, 2, 3 or 4 nucleotides.

[0139] PTO has a blocker that is resistant to cleavage by enzymes with 5' nuclease activity, and the blocker is used to control the site of initial cleavage and / or subsequent cleavage. For example, the 5' end portion of the 3' targeting portion of PTO can be blocked with a blocker to induce cleavage at the junction site between the hybridization portion (3' targeting portion) and the non-hybridization portion (5' labeling portion) of PTO.

[0140] In one embodiment, the 5' nuclease DNA polymerase is a thermostable 5' nuclease DNA polymerase. Alternatively, the present disclosure may employ a 5' nuclease DNA polymerase modified to have less polymerase activity.

[0141] A suitable DNA polymerase with 5' nuclease activity in this disclosure is a thermostable DNA polymerase obtained from a variety of bacterial species, including Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis, Thermus flavus, Thermococcus literalis, Thermus antranikianii, Thermus caldophilus, Thermus chliarophilus, Thermus flavus, Thermus igniterrae, Thermus lacteus, Thermus oshimai, Thermus ruber, Thermus rubens, Thermus scotoductus, Thermus silvanus, Thermus species Z05, Thermus species sps 17, Thermus thermophilus, Thermotoga maritima, Thermotoga neapolitana, Thermosipho africanus, Thermococcus litoralis, Thermococcus barossi, Thermococcus gorgonarius, Thermotoga maritima, Thermotoga neapolitana, Thermosiphoafricanus, Pyrococcus woesei, Pyrococcus horikoshii, Pyrococcus abyssi, Pyrodictium occultum, Aquifex pyrophilus and Aquifex aeolieus. In particular, the thermostable DNA polymerase is Taq polymerase.

[0142] In another embodiment, an enzyme with 5' nuclease activity and a Petition 870250073538, dated 08 / 20 / 2025, p. 40 / 185 33 / 136 template-dependent polymerases can be used instead of DNA polymerases with 5' nuclease activity. For example, FEN (flap endonuclease) can be used as an enzyme with 5' nuclease activity.

[0143] FEN is a nuclease specific for the 5' flap.

[0144] FEN suitable for the present disclosure comprises FEN obtained from a variety of bacterial species, including Sulfolobus solfataricus, Pyrobaculum aerophilum, Thermococcus littoralis, Archaeaglobus veneficus, Archaeaglobus profundus, Acidianus brierlyi, Acidianus ambivalens, Desulfurococcus amylolyticus, Desulfurococcus mobilis, Pyrodictium brockii, Thermococcus gorgonarius, Thermococcus zilligii, Methanopyrus kandleri, Methanococcus igneus, Pyrococcus horikoshii, Aeropyrum pernix and Archaeaglobus veneficus.

[0145] Template-dependent nucleic acid polymerase may include any nucleic acid polymerase, for example, the Klenow fragment of E. coli DNA polymerase I, a thermostable DNA polymerase, and the T7 bacteriophage DNA polymerase.In particular, the polymerase is a thermostable DNA polymerase that can be obtained from several bacterial species, including Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis, Thermis flavus, Thermococcus literalis, Thermus antranikianii, Thermus caldophilus, Thermus chliarophilus, Thermus flavus, Thermusigniterrae, Thermus lacteus, Thermus oshimai, Thermus ruber, Thermus rubens, Thermus scotoductus, Thermus silvanus, Thermus species Z05, Thermus species sps 17, Thermus thermophilus, Thermotoga maritima, Thermotoga neapolitana, Thermosipho africanus, Thermococcus litoralis, Thermococcus barossi, Thermococcus gorgonarius, Thermotoga maritima, Thermotoga neapolitana, Thermosipho africanus, Pyrococcus furiosus (Pfu), Pyrococcus woesei, Pyrococcus horikoshii, Pyrococcus abyssi, Pyrodictium hidden, Aquifex pyrophilus from Aquifex aeolianus. More specifically, a template-dependent nucleic acid polymerase is Taq polymerase. Petition 870250073538, dated 08 / 20 / 2025, page 41 / 185 34 / 136

[0146] In one embodiment, the conditions for PTO cleavage comprise the extension reaction of the initiator.

[0147] In one embodiment, a template-dependent polymerase is used for primer extension, and the template-dependent polymerase is identical to the enzyme with 5' nuclease activity. Alternatively, a template-dependent polymerase is used for primer extension, and the template-dependent polymerase is different from the enzyme with 5' nuclease activity. Step (c): Hybridization of the Fragment with CTO

[0148] The fragment released from the PTO is hybridized with a Capture and Modeling Oligonucleotide (CTO).

[0149] The CTO comprises, in a 3' to 5' direction: (i) a capture portion comprising a nucleotide sequence hybridized with the 5' tag portion of the PTO and (ii) a modeling portion comprising a nucleotide sequence not hybridized with the 5' tag portion and the 3' targeting portion of the PTO.

[0150] In particular, the CTO used in this disclosure has a reporter molecule and a suppressor molecule that define a labeled portion (see Figure 2A and Figure 2B). In other words, the labeled portion can be defined by positions where the reporter molecule and the suppressor molecule are attached.

[0151] As used in this document, the term “tagged portion” refers to a nucleotide sequence comprising a nucleotide to which the reporter molecule is attached, a nucleotide to which the suppressor molecule is attached, and intermediate nucleotides. For example, when the reporter molecule and the suppressor molecule are attached to the 3rd and 15th nucleotides of the 5' end of the CTO, respectively, the tagged portion may be a total of 13 nucleotides, including from the 3rd nucleotide to which the reporter molecule is attached to the 15th nucleotide to which the suppressor molecule is attached. Petition 870250073538, dated 08 / 20 / 2025, page 42 / 185 35 / 136

[0152] In one embodiment, the reporter molecule and the suppressor molecule are located in positions such that (i) the reporter molecule and the suppressor molecule are very close to each other before hybridization of the CTO with another oligonucleotide (e.g., LPHO or extended strand), causing the signal from the reporter molecule to be suppressed (see Figure 3 (ii) to (iii) and Figure 3 (iv)), LPHO or extended strand), causing the suppressor molecule to suppress a signal from the reporter molecule (see Figure 3 (ii) to (iii) and Figure 4 (iii)), and (ii) the reporter molecule and the suppressor molecule are separated from each other after hybridization of the CTO with another oligonucleotide, causing the suppressor molecule not to suppress a signal from the reporter molecule (see Figure 3 (i) and Figure 4 (i) to (ii)).

[0153] In one embodiment, a reporter molecule and the suppressor molecule in the CTO are located at its 5' end or 1 to 5 nucleotides away from its 5' end and the other is located to suppress or not the signal from the reporter molecule, depending on the conformation of the CTO.

[0154] In one embodiment, a reporter molecule and the suppressor molecule in the CTO are located at its 3' end or 1 to 5 nucleotides away from its 3' end and the other is located to suppress or not the signal from the reporter molecule, depending on the conformation of the CTO.

[0155] In one embodiment, the reporter molecule and the suppressor molecule are positioned no more than 80 nucleotides, no more than 60 nucleotides, no more than 30 nucleotides, or no more than 25 nucleotides apart from each other. In another embodiment, the reporter molecule and the suppressor molecule are separated by at least 4 nucleotides, at least 6 nucleotides, at least 10 nucleotides, or at least 15 nucleotides.

[0156] In certain embodiments, the reporter molecule and the suppressor molecule are separated by 10 to 25 nucleotides, 10 to 20 nucleotides, or 10 to 15 nucleotides. Petition 870250073538, dated 08 / 20 / 2025, page 43 / 185 36 / 136

[0157] The positions of the reporter molecule and the suppressor molecule must be determined, taking into account an LPHO nucleotide sequence described later.

[0158] The expression in this document “the reporter molecule and the suppressor molecule are very close to each other” means that (i) an oligonucleotide with a reporter molecule and a suppressor molecule forms a specific conformational structure, for example, a random spiral or a hairpin structure, so that the reporter molecule and the suppressor molecule are three-dimensionally adjacent to each other or (ii) an oligonucleotide with the reporter molecule and an oligonucleotide with the suppressor molecule form a double strand so that the reporter molecule and the suppressor molecule are close to each other.

[0159] In one embodiment, the CTO forms a random spiral or hairpin structure before hybridization of the CTO with another oligonucleotide, thus allowing the suppressor molecule to intramolecularly suppress a signal from the reporter molecule.

[0160] The expression in this document “the reporter molecule and the suppressor molecule are separated from each other” means that (i) an oligonucleotide that has a reporter molecule and a suppressor molecule forms a double strand with another oligonucleotide to undergo its conformational change, such as the disruption of a hairpin structure, so that the reporter molecule and the suppressor molecule are separated or (ii) an oligonucleotide with the reporter molecule and an oligonucleotide with the suppressor molecule in a double-stranded state dissociate from each other, so that the reporter molecule and the suppressor molecule are separated.

[0161] In one embodiment, the CTO forms a double strand after hybridization of the CTO with another oligonucleotide, thus allowing the suppressor molecule to remove a signal from the reporter molecule. Petition 870250073538, dated 08 / 20 / 2025, page 44 / 185 37 / 136

[0162] In one embodiment, (i) both the reporter molecule and the suppressor molecule may be bound to the capture portion of the CTO, (ii) both the reporter molecule and the suppressor molecule may be bound to the modeling portion of the CTO, or (iii) one of the reporter and suppressor molecules may be bound to the capture portion of the CTO and the other may be bound to the modeling portion of the CTO.

[0163] The reporter molecule and the suppressor molecule used in this disclosure are interactive markers.

[0164] As a representative of interactive labeling systems, the FRET (fluorescence resonance energy transfer) labeling system includes a fluorescent reporter molecule (donor molecule) and a suppressor molecule (acceptor molecule). In FRET, the energy donor is fluorescent, but the energy acceptor may be fluorescent or non-fluorescent. In another form of interactive labeling systems, the energy donor is non-fluorescent, for example, a chromophore, and the energy acceptor is fluorescent. In another form of interactive labeling systems, the energy donor is luminescent, for example, bioluminescent, chemiluminescent, electrochemiluminescent, and the acceptor is fluorescent. The donor molecules and the acceptor molecules may be described in this disclosure as reporter molecules and suppressor molecules, respectively.The interactive marker system includes a pair of markers based on “contact-mediated extinction” (Salvatore et al., Nucleic Acids Research, 2002 (30) no 21 and 122 and Johansson et al., J. AM. CHEM. SOC 2002 (124) pp 6950-6956). The interactive marker system includes any marker systems that induce signal changes through interactions between at least two molecules (e.g., dyes).

[0165] The reporter molecule and the suppressor molecule useful in the present invention may include any molecules known in the art. Examples of such molecules include, but are not limited to, Cy2™ (506), YO-PRO™-1 (509), YOYO™ Petition 870250073538, dated 08 / 20 / 2025, page 45 / 185 38 / 136 (509), Calceína (517), FITC (518), FluorX™ (519), Alexa™ (520), Rodamina 110 (520), Oregon Green™ 500 (522), Oregon Green™ 488 (524), RiboGreen™ (525), Rhodamine Green™ (527), Rhodamine 123 (529), Magnesium Green™ (531), Calcium Green™ (533), TO-PRO™-1 (533), TOTO1 (533), JOE (548), BODIPY530 / 550 (550), Dil (565), BODIPY TMR (568), BODIPY558 / 568 (568), BODIPY564 / 570 (570), Cy3™ (570), Alexa™ 546 (570), TRITC (572), Magnesium Orange™ (575), Phycoerythrin R&B (575), Rhodamine Phalloidin (575), Calcium Orange™ (576), Pyronin Y (580), Rhodamine B (580), TAMRA (582), Rhodamine Red™ (590), Cy3.5™ (596), ROX (608), Calcium Crimson™ (615), Alexa™ 594 (615), Texas Red (615), Nile Red (628), YO-PRO™-3 (631), YOYO™-3 (631), Ficocianina (642), C-Ficocianina (648), TO-PRO™-3 (660), TOTO3 (660), DiD DilC(5) (665), Cy5™(670), Tiadicarbocianina (671), Cy5.5 (694), HEX (556), TET (536), Biosearch Blue (447), CAL Fluor Gold 540 (544), CAL Fluor Orange 560 (559), CAL Fluor Red 590 (591), CAL Fluor Red 610 (610), CAL Fluor Red 635 (637), FAM (520), Fluorescein (520), Fluorescein-C3 (520), Pulsar 650 (566), Quasar 570 (667), Quasar 670 (705) and Quasar 705 (610). The number in parentheses is the maximum emission wavelength in nanometers. Preferably, the reporter molecule and the suppressor molecule include JOE, FAM, TAMRA, ROX and a fluorescein-based marker.

[0166] Suitable reporter-sequencer pairs are reported in a variety of publications, as follows: Pesce et al., editors, Fluorescence Spectroscopy (Marcel Dekker, New York, 1971); White et al., Fluorescence Analysis: A Practical Approach (Marcel Dekker, New York, 1970); Berlman, Handbook of Fluorescence Spectra of Aromatic Molecules, 2nd edition (Academic Press, New York, 1971); Griffiths, Color and Constitution of Organic Molecules (Academic Press, New York, 1976); Bishop, editor, Indicators (Pergamon Press, Oxford, 1972); Haugland, Handbook of Fluorescent Probes and Research Chemicals (Molecular Probes, Petition 870250073538, dated 08 / 20 / 2025, p. 46 / 185 39 / 136 Eugene, 1992); Pringsheim, Fluorescence and Phosphorescence (Interscience Publishers, New York, 1949); Haugland, RP, Handbook of Fluorescent Probes and Research Chemicals, 6th Edition (Molecular Probes, Eugene, Oreg., 1996); U.S. Patents Nos. 3,996,345 and 4,351,760.

[0167] A non-fluorescent black suppressor molecule capable of suppressing fluorescence over a wide range of wavelengths or at a specific wavelength may be used in the present disclosure. Examples of this are BHQ and DABCYL.

[0168] In the FRET marker adopted for this disclosure, the reporter encompasses one FRET donor and the suppressor encompasses the other FRET partner (acceptor). For example, a fluorescein dye is used as a reporter and a rhodamine dye as a suppressor.

[0169] The CTO serves as a template for extending the fragment released from the PTO. The fragment as an initiator is hybridized with the CTO and extended to generate an extended duplex.

[0170] The CTO modeling portion may comprise any sequence, provided it is not complementary to the 5' marking portion and the 3' targeting portion of the PTO. Furthermore, the CTO modeling portion may comprise any sequence, provided it can serve as a template for the extension of the released fragment of the PTO.

[0171] As described above, when the fragment comprising the 5' tag portion of the PTO is released, it is preferable that the OTC capture portion be designed to comprise a hybridization nucleotide sequence with the 5' tag portion. When the fragment comprising the 5' tag portion and a 5' end portion of the 3' targeting portion of the PTO is released, it is preferable that the CTO capture portion be designed to comprise a hybridization nucleotide sequence with the 5' tag portion and the 3' end portion. Petition 870250073538, dated 08 / 20 / 2025, page 47 / 185 40 / 136 5' end of the 3' targeting portion. When the PTO fragment comprising a portion of the 5' tagging portion of the PTO is released, it is preferable that the OTC capture portion be designed to comprise a hybridization nucleotide sequence with the portion of the 5' tagging portion.

[0172] Furthermore, it is possible to design the CTO capture portion with anticipation of the PTO cleavage sites. For example, when the CTO capture portion is designed to comprise a hybridization nucleotide sequence for the 5' tag portion, the fragment comprising a portion of the 5' tag portion or the fragment comprising the 5' tag portion can be hybridized with the CTO capture portion and then extended.

[0173] In one embodiment, the nucleotide sequence of the 5' end portion of the CTO capture portion hybridized with the cleaved 5' end portion of the 3' targeting portion can be selected depending on the cleavage sites predicted in the 3' targeting portion of the PTO. The nucleotide sequence of the 5' end portion of the CTO capture portion hybridized with the cleaved 5' end portion of the 3' targeting portion is 1 to 10 nucleotides, 1 to 5 nucleotides, or 1 to 3 nucleotides in length.

[0174] The term used “capture portion comprising a nucleotide sequence complementary to the 5' tag portion or a portion of the 5' tag portion” is described in this document to encompass various designs and compositions of the CTO capture portion, as discussed above.

[0175] In one embodiment, the CTO may be designed to have a hook structure or no hook structure.

[0176] The length of the CTO can vary considerably. For example, the CTO is 5 to 1000 nucleotides, 5 to 500 nucleotides, 5 to 300 nucleotides, 5 to 100 nucleotides, 5 to 80 nucleotides, 5 to 60 nucleotides, 5 to 40 nucleotides, 7 to 1000 nucleotides, 7 to 500 nucleotides, 7 to 300 nucleotides, 7 to 100 nucleotides, 7 to Petition 870250073538, dated 08 / 20 / 2025, page 48 / 185 41 / 136 nucleotides, 7 to 60 nucleotides, 7 to 40 nucleotides, 15 to 1000 nucleotides, 15 to 500 nucleotides, 15 to 300 nucleotides, 15 to 100 nucleotides, 15 to 80 nucleotides, 15 to 60 nucleotides, 15 to 40 nucleotides, 20 to 1000 nucleotides, 20 to 500 nucleotides, 20 to 300 nucleotides, 20 to 100 nucleotides, 20 to 80 nucleotides, 20 to 60 nucleotides, 20 to 40 nucleotides, 30 to 1000 nucleotides, 30 to 500 nucleotides, 30 to 300 nucleotides, 30 to 100 nucleotides, 30 to 80 nucleotides, 30 to 60 nucleotides, or 30 to 40 nucleotides in length.

[0177] The CTO capture portion can be of any length, as long as it is specifically hybridized with the fragment. For example, the CTO capture portion is 5 to 100 nucleotides, 5 to 60 nucleotides, 5 to 40 nucleotides, 5 to 30 nucleotides, 5 to 20 nucleotides, 10 to 100 nucleotides, 10 to 60 nucleotides, 10 to 40 nucleotides, 10 to 30 nucleotides, 10 to 20 nucleotides, 15 to 100 nucleotides, 15 to 60 nucleotides, 15 to 40 nucleotides, 15 to 30 nucleotides, or 15 to 20 nucleotides in length.

[0178] The CTO modeling portion can be of any length, as long as it can act as a model across the fragment's extent. For example, the CTO model portion is 1 to 900 nucleotides, 1 to 400 nucleotides, 1 to 300 nucleotides, 1 to 100 nucleotides, 1 to 80 nucleotides, 1 to 60 nucleotides, 1 to 40 nucleotides, 1 to 20 nucleotides, 2 to 900 nucleotides, 2 to 400 nucleotides, 2 to 300 nucleotides, 2 to 100 nucleotides, 2 to 80 nucleotides, 2 to 60 nucleotides, 2 to 40 nucleotides, 2 to 20 nucleotides, 5 to 900 nucleotides, 5 to 400 nucleotides, 5 to 300 nucleotides, 5 to 100 nucleotides, 5 to 80 nucleotides, 5 to 60 nucleotides, 5 to 40 nucleotides, 5 to 30 nucleotides, 10 to 900 nucleotides, 10 to 400 nucleotides, 10 to 300 nucleotides, 15 to 900 nucleotides, 15 to 100 nucleotides, 15 to 80 nucleotides, 15 to 60 nucleotides, 15 to 40 nucleotides, or 15 to 20 nucleotides in length.

[0179] In one embodiment, the 3' end of the CTO may have a terminal Petition 870250073538, dated 08 / 20 / 2025, p. 49 / 185 42 / 136 3'-OH. Alternatively, the 3' end of the CTO is blocked to prohibit its extension. The CTO block can be described in detail by referring to the descriptions of the PTO block described above.

[0180] The fragment is hybridized with the CTO, providing a suitable shape for fragment extension. Although an uncleaved PTO is also hybridized with the capture portion of the CTO via its 5' tag portion, its 3' targeting portion is not hybridized with the CTO, which prevents the generation of an extended duplex.

[0181] Hybridization in step (c) can be described in detail by referring to the descriptions in step (a). Step (d): Fragment Extension and Extended Duplex Generation

[0182] The extension reaction is performed using the result of step (c) and DNA polymerase with 5' nuclease activity in the presence of a Labeled Portion Hybridization Oligonucleotide (LPHO). The fragment hybridized with the CTO capture portion is extended to generate an extended strand comprising an extended sequence complementary to the CTO template portion. This results in an extended duplex between the extended strand and the CTO. Conversely, the uncleaved PTO hybridized with the CTO capture portion is not extended, so no extended duplex is generated.

[0183] In step (d), the hybridized fragment with the capture portion of the CTO is extended along the template portion of the CTO as a template by a DNA polymerase with 5' nuclease activity.

[0184] The terms “extended sequence”, “extended tape” and “extended duplex”, as used in connection with the fragment extension reaction in step (d), have the following meanings:

[0185] As used in this document, the term “extended sequence” refers to a sequence newly generated by extending the fragment in step (d). In Petition 870250073538, dated 08 / 20 / 2025, p. 50 / 185 43 / 136 In other words, the extended sequence refers to a portion of the extended tape, as will be described below, excluding the fragment.

[0186] As used in this document, the term “extended tape” refers to a sequence that encompasses both the fragment and the extended sequence. In other words, the extended tape refers to a portion of the extended duplex, as will be described below, excluding the CTO.

[0187] As used in this document, the term “extended duplex” refers to a hybrid or duplex (through complementarity) between the extended tape and the CTO. In other words, the extended duplex means a duplex between the extended tape, composed of the fragment and the extended sequence, and the CTO.

[0188] In one embodiment, the extended duplex Tm is adjustable by (i) a fragment sequence and / or length, (ii) a CTO sequence and / or length, or (iii) both the fragment sequence and / or length and the CTO sequence and / or length.

[0189] The term “Tm” used in this document refers to a melting temperature at which half of a population of double-stranded nucleic acid molecules is dissociated into single-stranded molecules. The value of Tm is determined by the length and G / C content of the hybridized nucleotides. The value of Tm can be calculated by conventional methods such as Wallace's rule (RB Wallace, et al., Nucleic Acids Research, 6: 3543-3547(1979)) and the nearest neighbor method (Santa Lucia J. Jr., et al., Biochemistry, 35: 3555-3562(1996); Sugimoto N., et al., Nucleic Acids Res., 24: 4501-4505(1996)).

[0190] In certain embodiments, the value of Tm refers to actual values ​​of Tm under reaction conditions.

[0191] Step (d) is performed in the presence of Labeled Portion Hybridization Oligonucleotide (LPHO).

[0192] The term “Tagged Portion Hybridization Oligonucleotide Petition 870250073538, dated 08 / 20 / 2025, page 51 / 185 “LPHO”, as used in this document, refers to an oligonucleotide comprising a hybridization nucleotide sequence with a labeled portion that provides signals of varying intensities depending on whether it is hybridized with the labeled portion. For example, when LPHO is hybridized with a labeled portion of the CTO, the reporter molecule and the suppressor molecule in the CTO are separated, causing the suppressor molecule not to suppress a signal from the reporter molecule, whereas when LPHO is not hybridized with the labeled portion of the CTO and the CTO is not hybridized with any oligonucleotide, the reporter molecule and the suppressor molecule in the CTO are close to each other, causing the suppressor molecule to suppress a signal from the reporter molecule.

[0193] In one embodiment, the LPHO can be hybridized with a complete or partial sequence of the labeled portion of the CTO, provided that the LPHO provides signals of different intensities, depending on whether the LPHO is hybridized with the labeled portion of the CTO.

[0194] In one embodiment, LPHO is hybridized with a complete or partial sequence of the labeled portion of the CTO, and the reporter molecule and the suppressor molecule in the CTO are separated, causing the suppressor molecule not to suppress a signal from the reporter molecule.

[0195] LPHO comprises a nucleotide sequence that hybridizes with the labeled portion of the CTO. For example, when the reporter molecule and the suppressor molecule are bound to the capture portion (or modeling portion) of the CTO, the LPHO must be designed to comprise a nucleotide sequence that hybridizes with the capture portion (or modeling portion) of the CTO to which the reporter molecule and the suppressor molecule are bound. In this case, it should be understood by a person skilled in the art that the LPHO may have additional nucleotide sequences beyond the hybridization sequence with the labeled portion of the CTO described above. Petition 870250073538, dated 08 / 20 / 2025, p. 52 / 185 45 / 136

[0196] In certain embodiments, when the reporter molecule is linked to the 12th nucleotide from the 5' end of the CTO and the suppressor molecule is linked to the 25th nucleotide from the 5' end of the CTO, the LPHO may comprise a nucleotide sequence complementary to a nucleotide sequence from the 12th nucleotide to the 25th nucleotide from the 5' end in the CTO defined as the labeled portion.

[0197] The length of the LPHO can vary considerably. For example, LPHO is 5 to 100 nucleotides, 5 to 80 nucleotides, 5 to 60 nucleotides, 5 to 40 nucleotides, 5 to 20 nucleotides, 5 to 10 nucleotides, 7 to 100 nucleotides, 7 to 80 nucleotides, 7 to 60 nucleotides, 7 to 40 nucleotides, 7 to 20 nucleotides, 7 to 10 nucleotides, 10 to 100 nucleotides, 10 to 80 nucleotides, 10 to 60 nucleotides, 10 to 40 nucleotides, 10 to 30 nucleotides, 10 to 20 nucleotides, 10 to 15 nucleotides, 15 to 100 nucleotides, 15 to 80 nucleotides, 15 to 60 nucleotides, 15 to 40 nucleotides, 15 to 30 nucleotides, 15 to 20 nucleotides, 20 to 100 nucleotides, 20 to 80 nucleotides, 20 to 60 nucleotides, 20 to 40 nucleotides, or 20 to 30 nucleotides in length.

[0198] One of the features of the present disclosure is that, when the target nucleic acid is present in the sample, the extended duplex is generated between the extended strand and the CTO, thus preventing the formation of the CTO / LPHO hybrid between the labeled portion of the CTO and the LPHO; when the target nucleic acid is not present in the sample, the extended strand is not generated (i.e., the extended duplex is not generated) and, instead, the CTO / LPHO hybrid is formed.

[0199] In one embodiment, when the target nucleic acid is present in the sample, the fragment hybridized with the capture portion of the CTO is extended to generate the extended strand comprising the extended sequence complementary to the template portion of the CTO, thus generating the extended duplex between the extended strand and the CTO. Petition 870250073538, dated 08 / 20 / 2025, p. 53 / 185 46 / 136

[0200] In one embodiment, when the target nucleic acid is present in the sample, the extended duplex can be generated by (i) extending the hybridized fragment to the capture portion of the CTO before hybridization of the labeled portion of the CTO and LPHO, (ii) extending the hybridized fragment to the capture portion of the CTO after hybridization between the labeled portion of the CTO and LPHO, thereby cleaving LPHO, or (iii) both (i) and (ii).

[0201] LPHO can be hybridized with CTO before fragment extension and involved in the extension reaction. In one embodiment, when LPHO is hybridized with CTO before fragment extension, fragment extension cleaves or displaces LPHO from CTO. For example, as the fragment is extended, the CTO-hybridized LPHO can be released (displaced) from CTO by strand displacement or it can be cleaved.

[0202] In one embodiment, the cleavage and / or displacement of the LPHO strand along the fragment length depends on the types of enzymes (e.g., DNA polymerase) or the reaction conditions.

[0203] In one embodiment, the generation of the extended duplex avoids the formation of the CTO / LPHO hybrid by preferentially hybridizing the extended ribbon with the CTO, i.e., forming the extended duplex, rather than hybridizing the marked portion of the CTO with the LPHO, i.e., forming the CTO / LPHO hybrid. In other words, the CTO is hybridized with the extended ribbon to generate the extended duplex, resulting in CTO consumption and a low probability of hybridization between the CTO and the LPHO.

[0204] In one embodiment, the generation of the extended duplex prevents the formation of the CTO / LPHO hybrid by cleaving the LPHO during the extension of step (d). In other words, the LPHO is cleaved and removed, resulting in a low possibility of hybridization between the CTO and the LPHO.

[0205] In one embodiment, the extended duplex has a temperature of Petition 870250073538, dated 08 / 20 / 2025, p. 54 / 185 47 / 136 fusion (Tm) which is different from the Tm of the CTO / LPHO hybrid.

[0206] In particular, the preference for extended duplex formation over CTO / LPHO hybrid formation can be obtained through differences in the stability of the extended duplex and the CTO / LPHO hybrid, such as differences in Tm values.

[0207] In the present disclosure, the extended duplex may be more stable than the CTO / LPHO hybrid. For example, the Tm of the extended duplex is higher than the Tm of the CTO / LPHO hybrid. In particular, the Tm of the extended duplex is at least 2 °C, 3 °C, 4 °C, 5 °C, 7 °C, 10 °C, 15 °C or 20 °C higher than the Tm of the CTO / LPHO hybrid.

[0208] In one embodiment, the 3' end of the LPHO is blocked to prevent its extension. The LPHO blocking can be described in detail by referring to the PTO blocking descriptions described above.

[0209] The LPHO to be hybridized with the labeled portion of the CTO may refer to the PTO fragment to be hybridized with the capture portion of the CTO in either of two ways: (i) the LPHO overlaps the PTO fragment totally or partially; and (ii) the LPHO does not overlap the PTO fragment.

[0210] Aspects (i) and (ii) above will be described with reference to Figures 2A and 2B. (i) When the LPHO to be hybridized with the labeled portion of the CTO overlaps totally or partially with the PTO fragment to be hybridized with the capture portion of the CTO

[0211] In this case, the LPHO comprises a nucleotide sequence that competes with the fragment for hybridization with the CTO. For example, the LPHO comprising a nucleotide sequence hybridizable with all or part of the capture portion of the CTO may compete with the fragment for hybridization with the CTO. Petition 870250073538, dated 08 / 20 / 2025, p. 55 / 185 48 / 136

[0212] The expression in this document “the LPHO comprises a nucleotide sequence that competes with the fragment for hybridization with the CTO” means that the LPHO comprises a hybridizable nucleotide sequence with the same portion to which the fragment is hybridized. The same portion is used to encompass a portion that is partially or totally identical to the portion to which the fragment is hybridized. In other words, the LPHO may comprise a nucleotide sequence that totally or partially overlaps the 5' tag portion of the PTO (see Figure 2A).

[0213] The term “a hybridizable nucleotide sequence with the CTO capture portion”, as used in this document in conjunction with an LPHO sequence, refers to a portion of the LPHO that forms a double strand by hybridization with the CTO capture portion. The hybridizable LPHO nucleotide sequence with the CTO capture portion may be the complete sequence or a partial sequence of the LPHO. The hybridizable nucleotide sequence with the CTO capture portion corresponds to the complete or partial sequence (e.g., 10%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%) of the LPHO.

[0214] In one embodiment, when the LPHO comprises a nucleotide sequence that competes with the fragment for hybridization with the CTO, the LPHO is not cleaved or displaced by the fragment or its extension product during the extension reaction.

[0215] In one embodiment, when the LPHO comprises a nucleotide sequence that competes with the fragment for hybridization with the CTO, the LPHO is less competitive than the fragment (specifically, the extended strand of the fragment) and more competitive than the 5' tag portion of the uncleaved PTO in terms of hybridization with the CTO.

[0216] In certain embodiments, step (d) is carried out under conditions more favorable to hybridization between the fragment and the CTO than to hybridization between the LPHO and the CTO. These favorable conditions can be obtained by various methods. Petition 870250073538, dated 08 / 20 / 2025, p. 56 / 185 49 / 136 For example, the 3' end of the LPHO can be blocked under favorable conditions. The LPHO with the 3' end is hybridized with the CTO, but is not extended, which increases the probability of CTO dissociation due to competition with the fragment. The fragment hybridized with the CTO is extended to generate the extended strand, which can be maintained more stably. Therefore, the extended duplex is much more prevalent than the CTO / LPHO hybrid in step (d). Consequently, the number (or quantity) of CTO / LPHO hybrids refers to a relative decrease due to the extended duplex in the presence of the target nucleic acid compared to the absence of the target nucleic acid.

[0217] When the target nucleic acid is absent, PTO cleavage does not occur and PTO exists as uncleaved PTO. When both uncleaved PTO and LPHO exist, the 5' label portion of uncleaved PTO competes with LPHO for hybridization with CTO because they have an overlapping sequence. When the target nucleic acid is absent, LPHO should be more favorable for hybridization with CTO than the 5' label portion of uncleaved PTO because the underlying principle of this disclosure requires hybridization of LPHO with CTO. For example, when the Tm value of the fragment is greater than that of LPHO, the fragment is more favorable for hybridization with CTO than with LPHO.

[0218] In one embodiment, the LPHO may comprise a hybridization sequence with the complete CTO sequence (see Figure 2A, (vi)). In other words, the LPHO may have the same length as the extended ribbon. In this case, the LPHO may be designed to have unnatural bases or to have some incompatibilities with the CTO, so that hybridization of the CTO with the extended ribbon is more favorable than with the LPHO.

[0219] The LPHO must be properly designed, considering the factors or problems described above. In one embodiment, the difference between the Tm values ​​of the CTO / LPHO hybrid and the CTO / fragment hybrid is within ± 40 °C, ± 30 Petition 870250073538, dated 08 / 20 / 2025, p. 57 / 185 50 / 136 °C, ± 20 °C, ± 15 °C, ± 10 °C, ± 5 °C, ± 3 °C or ± 1 °C.

[0220] In one embodiment, the difference between the Tm values ​​of the CTO / LPHO hybrid and the CTO / 5' labeling portion of the uncleaved PTO hybrid is within ± 40 °C, ± 30 °C, ± 20 °C, ± 15 °C, ± 10 °C, ± 5 °C, ± 3 °C or ± 1 °C.

[0221] In an embodiment in which LPHO competes with uncleaved PTO for hybridization with CTO, the Tm value of the CTO / LPHO hybrid may be higher (for example, at least 2 °C, 4 °C, 6 °C, 8 °C, 10 °C, 15 °C or 20 °C higher) than that of the uncleaved CTO / PTO hybrid.

[0222] The Tm value of the uncleaved CTO / PTO hybrid is determined by a portion of the PTO to be hybridized with the CTO. For example, when the 5' labeled portion of the uncleaved PTO is to be hybridized with the CTO, the Tm value of the 5' labeled portion is a determining factor for the Tm value of the uncleaved CTO / PTO hybrid.

[0223] The term “Tm value of the uncleaved PTO”, as used in this document, means a Tm value determined by a portion of the uncleaved PTO sequence to be hybridized with the CTO, unless otherwise indicated.

[0224] In one embodiment, the extended tape has a Tm value greater than the LPHO, which has a Tm value greater than the 5' marking portion of the PTO.

[0225] In one embodiment, given hybridization with CTO, the Tm value of the extended strand is greater than that of LPHO, which is greater than that of the uncleaved PTO. (ii) When the LPHO to be hybridized with the labeled portion of the CTO does not overlap with the PTO fragment to be hybridized with the capture portion of the CTO

[0226] In one embodiment, the LPHO can be designed to comprise a hybridization nucleotide sequence with a different portion to which the fragment is hybridized. For example, the LPHO comprises a hybridization nucleotide sequence with the template portion of the CTO, and the fragment and the LPHO are hybridized with different portions of the CTO, as shown in Figure 2B, Petition 870250073538, dated 08 / 20 / 2025, p. 58 / 185 51 / 136 (i) a (iii). In this case, LPHO may not compete with the fragment (or with the uncleaved PTO) in terms of hybridization with the CTO.

[0227] In one embodiment, hybridization between LPHO and CTO may or may not be favorable to non-hybridization, depending on the conditions for the extension of the hybridized fragment with the CTO.

[0228] In one embodiment, the CTO-hybridized fragment can be extended before hybridization of the labeled portion of CTO and LPHO.

[0229] In one embodiment, the fragment hybridized with the CTO can be extended after hybridization between the labeled portion of the CTO and the LPHO. In this case, the LPHO hybridized with the labeled portion of the CTO is released (separated) or cleaved from the CTO by the fragment or its extension product. Step (e): Detection of the Presence of Extended Duplex

[0230] Finally, the presence of the extended duplex is detected. The presence of the extended duplex indicates the presence of the target nucleic acid.

[0231] Step (e) can be performed by detecting a signal indicating the presence of the extended duplex.

[0232] The term “signal”, as used in this document, means any signal capable of indicating the presence of the extended duplex. For example, the signal includes a change in the sign of the markers (signal generation or extinction, or signal increase or decrease), a melting curve, a melting pattern, and a melting temperature (or Tm value).

[0233] In one embodiment, a signal is provided by the extended duplex and the extended duplex is detected by measuring the signal provided by the extended duplex. The measurement is performed at a temperature at which the intensity of the signal provided by the extended duplex is different from the intensity of the signal provided by the CTO / LPHO hybrid. For example, at the measurement temperature, the reporter molecule signal is either not suppressed or is suppressed, depending on whether it is the extended duplex or the hybrid. Petition 870250073538, dated 08 / 20 / 2025, p. 59 / 185 52 / 136 CTO / LPHO, providing signals of varying intensities.

[0234] In one embodiment, the signal provided by the extended duplex is a signal after the association of the CTO and the extended tape in the extended duplex or the dissociation of the extended duplex in the CTO and the extended tape. In particular, the signal provided by the extended duplex is a signal after the association of the CTO and the extended tape in the extended duplex.

[0235] The term “association” or “dissociation” has the same meaning as the term “hybridization” or “denaturation”, respectively.

[0236] In another embodiment, a signal is provided by the CTO / LPHO hybrid and the extended duplex is detected by measuring the signal provided by the CTO / LPHO hybrid. As described above, the generation of the extended duplex prevents the formation of the CTO / LPHO hybrid, which alters the signal provided by the CTO / LPHO hybrid. Therefore, the presence of the extended duplex can be detected by measuring this signal change provided by the CTO / LPHO hybrid.

[0237] In one embodiment, the Tm of the extended duplex is adjustable by (i) a fragment sequence and / or length, (ii) a CTO sequence and / or length, or (iii) both the fragment sequence and / or length and the CTO sequence and / or length, and the Tm of the CTO / LPHO hybrid is adjustable by an LPHO sequence and / or length.

[0238] In one embodiment, the temperature for measurement depends on the Tm of the extended duplex and the Tm of the CTO / LPHO hybrid.

[0239] In one embodiment, the method is performed in the presence of a plurality of PTOs, a plurality of CTOs and a plurality of LPHOs, and steps (a) to (e) are repeated with denaturation between repetition cycles.

[0240] In the method according to the present disclosure, the extended duplex is generated depending on the presence of a target nucleic acid, and the amount of the extended duplex increases as the reaction progresses. On the other hand, the Petition 870250073538, dated 08 / 20 / 2025, p. 60 / 185 53 / 136 The amount of the CTO / LPHO hybrid decreases as the extended duplex is generated, depending on the presence of the target nucleic acid. This change in the amount of the extended duplex or the CTO / LPHO hybrid results in a change in the signal indicating the presence of the target nucleic acid. In other words, the proportions of the extended duplex and the CTO / LPHO hybrid change according to the presence of the target nucleic acid, thus altering the signal.

[0241] The term “quantity,” as used in this document when referring to the extended duplex or the CTO / LPHO hybrid, refers to the quantity of the two nucleic acid strands that make up the duplex or hybrid. In one embodiment, the two nucleic acid strands that constitute the duplex may be dissociated or associated, depending on the temperature. In this case, the quantity of the duplex refers to the sum of the quantity of duplexes in the dissociated form and the quantity of duplexes in the associated form.

[0242] In one embodiment, when a target nucleic acid is present, the CTO can be hybridized with the extended strand to form the extended duplex or hybridized with the LPHO to form the CTO / LPHO hybrid. In this case, the amount of the extended duplex is calculated based on the amount of the extended strand, and then the amount of the CTO / LPHO hybrid is calculated based on the amount of CTO remaining, excluding the CTO hybridized with the extended strand. For example, before the reaction with the target nucleic acid, the amount of the CTO / LPHO hybrid can be calculated based on the assumption that all CTOs in the composition for target nucleic acid detection are involved in the formation of the CTO / LPHO hybrid.On the other hand, when the extended strand is generated depending on the presence of the target nucleic acid, the amount of extended duplex and the amount of CTO / LPHO hybrid can be calculated based on the assumption that most of the CTOs in the composition for target nucleic acid detection are preferentially hybridized with the extended strand to form the extended duplex, and the remaining CTOs are hybridized. Petition 870250073538, dated 08 / 20 / 2025, p. 61 / 185 54 / 136 with LPHO to form the CTO / LPHO hybrid.

[0243] The detection of the presence of the extended duplex in step (e) can be performed by (i) measuring a signal at a predetermined temperature, or (ii) measuring a signal by melt analysis or melt followed by hybridization analysis. (i) Measuring a signal at a predetermined temperature

[0244] Detection in step (e) is performed by measuring a signal indicative of the presence of the extended duplex at a predetermined temperature. For example, the predetermined temperature is a temperature at which the intensity of the signal provided by the extended duplex is different from the intensity of the signal provided by the CTO / LPHO hybrid.

[0245] For example, at a predetermined temperature, the suppressor molecule in the extended duplex suppresses the signal of the reporter molecule in the extended duplex, while the suppressor molecule in the CTO / LPHO hybrid suppresses the signal of the reporter molecule in the CTO / LPHO hybrid, or vice versa. That is, the signal is not suppressed or is suppressed depending on whether the suppressor molecule is in the extended duplex or in the CTO / LPHO hybrid at a predetermined temperature, thus providing signals of different intensities.

[0246] In one embodiment, the temperature for measurement allows (i) at least one of the extended duplexes to remain in its double-tape state and (ii) at least one of the CTO / LPHO hybrids to dissociate into a single-tape state.

[0247] In particular, the signal is measured at a temperature within a temperature range at which all or some of the CTO / LPHO hybrids exist in dissociated form and all or some of the extended duplexes exist in associated form. In other words, the temperature at which all CTO / LPHO hybrids and extended duplexes exist in associated form (e.g., a temperature at least 2 °C, 3 °C, 4 °C, 6 °C, 8 °C, or 10 °C lower than the Tm value of the CTO / LPHO hybrid) or the temperature at which all CTO / LPHO hybrids and the Petition 870250073538, dated 08 / 20 / 2025, p. 62 / 185 55 / 136 extended duplexes exist in dissociated form (e.g., a temperature at least 2 °C, 3 °C, 4 °C, 6 °C, 8 °C, or 10 °C higher than the Tm value of the extended duplex), no signal indicating the presence of the extended duplex is detected.

[0248] With regard to the expression “all or some of the duplexes (e.g., CTO / LPHO hybrids or extended duplexes) exist in dissociated form (or in associated form) within a specified temperature range (or at specified temperatures)”, the term “all” is used to mean all or substantially all duplexes, such as a significant number of duplexes or most duplexes, within a specified temperature range. For example, the expression “all extended duplexes exist in dissociated form at a temperature of 4 °C or more than the Tm value of the extended duplex” may mean that most extended duplexes are dissociated at a temperature of 4 °C or more than the Tm value of the extended duplex.

[0249] With regard to the expression “all or some of the duplexes (for example, CTO / LPHO hybrids or extended duplexes) exist in dissociated form (or in associated form) in a specified temperature range (or at specified temperatures)”, the term “some” refers to a portion of the total amount of duplex, such as at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70% or at least 80% of the total amount of duplex.

[0250] In one embodiment, the temperature range in which all or some of the CTO / LPHO hybrids are in the dissociated form and all or some of the extended duplexes are in the associated form is 10 °C lower than the Tm value of the CTO / LPHO hybrid to 10 °C higher than the Tm value of the extended duplex.

[0251] In one embodiment, the temperature at which all or some of the CTO / LPHO hybrids are in dissociated form is within ±2 °C, ±3 °C, ±4 °C, ±6 Petition 870250073538, dated 08 / 20 / 2025, p. 63 / 185 56 / 136 °C, ±8 °C or ±10 °C refers to the Tm value of the CTO / LPHO hybrid.

[0252] In one embodiment, the temperature at which all or some of the extended duplexes are in the associated form is within ±2 °C, ±3 °C, ±4 °C, ±6 °C, ±8 °C or ±10 °C refers to the Tm value of the extended duplex.

[0253] In one embodiment, the signal indicating the presence of the extended duplex is measured at a temperature within a temperature range above the Tm value of the CTO / LPHO hybrid and below the Tm value of the extended duplex.

[0254] In certain embodiments, the signal is measured at a temperature within the temperature range in which all CTO / LPHO hybrids are in dissociated form and all extended duplexes are in associated form. This temperature range extends from 4 °C or more relative to the Tm value of the CTO / LPHO hybrid to 4 °C or less relative to the Tm value of the extended duplex.

[0255] In certain embodiments, the signal is measured at a temperature within a temperature range in which all CTO / LPHO hybrids are in dissociated form and some of the extended duplexes are in associated form. This temperature range is 4 °C or more relative to the Tm value of the CTO / LPHO hybrid and is within ±4 °C relative to the Tm value of the extended duplex.

[0256] In certain embodiments, the signal is measured at a temperature within a temperature range in which some of the CTO / LPHO hybrids are in dissociated form and some of the extended duplexes are in associated form. This temperature range is within ±4 °C relative to the Tm value of the CTO / LPHO hybrid and is 4 °C or less relative to the Tm value of the extended duplex.

[0257] In one embodiment, the temperature for signal measurement depends on the Tm of the extended duplex and the Tm of the hybrid CTO / LPHO.

[0258] As described above, the Tm of the extended duplex and the Tm of the CTO / LPHO hybrid are different from each other. In particular, the Tm value of the extended duplex is higher than that of the CTO / LPHO hybrid. The difference in Tm values Petition 870250073538, dated 08 / 20 / 2025, p. 64 / 185 57 / 136 allows a change in the signal to be provided depending on the presence of the target nucleic acid only within a specific temperature range. At temperatures lower or higher than the specific temperature range, the signal is constant, even if the target nucleic acid is present.

[0259] In this regard, further details are found in the second aspect of this disclosure, “Composition for detection of a target nucleic acid” and in the third aspect of this disclosure, “Method for detection of n target nucleic acids in a sample”. (ii) Measurement of a signal by fusion analysis or fusion followed by hybridization analysis.

[0260] In one embodiment, detection in step (e) is performed by measuring a signal indicative of the presence of the extended duplex by means of a fusion analysis or fusion followed by hybridization analysis.

[0261] In one embodiment, the extended duplex and / or the CTO / LPHO hybrid is fused or hybridized within a given temperature range, and then the presence of the extended duplex in step (e) is detected by measuring a signal from the extended duplex and / or a signal from the CTO / LPHO hybrid. In particular, the resultant of step (d) (e.g., the extended duplex and / or the CTO / LPHO hybrid) is merged to provide a signal or merged followed by hybridization to provide a signal, and then the presence of the extended duplex is detected by measuring the signal.

[0262] In one embodiment, detection of the presence of the extended duplex in step (e) is performed by fusion analysis, in which the extended duplex is fused to give a signal indicative of the presence of the target nucleic acid.

[0263] The term “fusion analysis”, as used in this document, means a method in which an indicative signal of the presence of the extended duplex is obtained by merging the extended duplex, including analysis of the fusion curve, analysis of the pattern of Petition 870250073538, dated 08 / 20 / 2025, page 65 / 185 58 / 136 Melting and melting peak analysis. Specifically, melting analysis is a melting curve analysis.

[0264] In one embodiment, extended duplex detection in step (e) is performed by fusion followed by hybridization analysis. In particular, extended duplex detection in step (e) is performed by fusion of the extended duplex and / or CTO / LPHO hybrid and hybridization of the result at a given temperature to generate an indicative signal of the extended duplex.

[0265] The term “fusion analysis followed by hybridization”, as used in this document, refers to a method of fusion of the extended duplex and then hybridization of the fused extended duplex again, to provide an indicative signal of the extended duplex. In particular, fusion analysis followed by hybridization is a fusion curve analysis.

[0266] The fusion curve or hybridization curve can be obtained by conventional technologies, for example, as described in US Patents Nos. 6,174,670 and 5,789,167, Drobyshev et al., Gene 188: 45 (1997); Kochinsky and Mirzabekov Human Mutation 19: 343 (2002); Livehits et al. J. Biomol. Structure Dynam. 11: 783 (1994); and Howell et al. Nature Biotechnology 17: 87 (1999). For example, a fusion curve or a hybridization curve may consist of a graph or display of the variation of the output signal with the hybridization rigor parameter. The output signal can be plotted directly against the hybridization parameter. Typically, a fusion or hybridization curve will have the output signal, for example, fluorescence, which indicates the degree of duplex structure (i.e., the extent of hybridization), on the Y-axis and the hybridization parameter on the X-axis.

[0267] A plot of the first derivative of fluorescence with respect to temperature, i.e., a plot of the rate of change of fluorescence with respect to temperature (dF / dT vs. T or dF / dT vs. T) gives a melting peak.

[0268] In one embodiment, the method of this disclosure may also Petition 870250073538, dated 08 / 20 / 2025, page 66 / 185 59 / 136 understand the repetition of all or a portion of steps (a) to (e) with denaturation between repetition cycles. The repetition results in the amplification of the target nucleic acid and / or the amplification of a signal indicating the presence of the target nucleic acid.

[0269] In one embodiment, the repeat step involving denaturation may comprise at least the denaturation of the extended duplex. Other components (e.g., primers, downstream primers, and enzymes) may be used in sufficient quantities so that they are not limiting factors.

[0270] In one embodiment, the composition for detecting a target nucleic acid according to the present disclosure comprises LPHOs in an amount equal to or greater than the amount of CTO. This is to ensure that all CTOs in the composition form CTO / LPHO hybrids, so that no single-stranded CTO exists. In particular, the amount of CTO / LPHO hybrid initially included in the L-PTOCE composition decreases as an extended duplex is generated, depending on the presence of the target nucleic acid, and provides a signal indicating the presence of the extended duplex. In one embodiment, LPHO is included in the L-PTOCE composition in an amount 1, 2, 3, 4, 5 or more times greater than that of CTO.

[0271] Denaturation can be achieved by conventional technologies, including but not limited to heating, treatment with alkalis, formamide, urea and glycoxal, enzymatic methods (e.g., helicase action) and protein binding. For example, denaturation can be achieved by heating at a temperature ranging from 80 °C to 105 °C. General methods for performing this treatment are provided by Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001).

[0272] Step (e) detection can be performed in real time, in a Petition 870250073538, dated 08 / 20 / 2025, p. 67 / 185 60 / 136 endpoint or at a predetermined time interval. When the present disclosure further comprises repeating steps (a) to (e), it is preferable that the signal detection be performed for each repetition cycle at a predetermined temperature (i.e., in real time), at the end of the repetition at a predetermined temperature (i.e., at the endpoint) or at each of the predetermined time intervals during the repetition at a predetermined temperature. Preferably, the detection may be performed for each repetition cycle in real time to improve the accuracy and quantification of the detection.

[0273] In the repetition, the method of the present disclosure is carried out in the presence of a downstream primer, particularly by a real-time PCR method.

[0274] In one embodiment, steps (a) to (e) are carried out in one reaction vessel or some of steps (a) to (e) are carried out in separate reaction vessels.

[0275] This disclosure does not require that a target nucleic acid to be detected and / or amplified have any specific sequence or length, including any DNA (gDNA and cDNA) and RNA molecules.

[0276] When mRNA is used as starting material, a reverse transcription step is required before performing the annealing step, details of which can be found in Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001); and Noonan, KF et al., Nucleic Adds Res. 16: 10366 (1988). For reverse transcription, a random hexamer or a dT oligonucleotide primer hybridizable to mRNA can be used.

[0277] In one embodiment, the target nucleic acid used in the present disclosure is a pre-amplified nucleic acid. The use of pre-amplified nucleic acid allows for a significant increase in the sensitivity and specificity of Petition 870250073538, dated 08 / 20 / 2025, p. 68 / 185 61 / 136 detection of the target of this disclosure.

[0278] This disclosure is also useful in detecting a nucleotide variation. In particular, the target nucleic acid comprises a nucleotide variation. The term “nucleotide variation,” as used in this document, refers to any single or multiple nucleotide substitution, deletion, or insertion in a DNA sequence at a specific location between contiguous DNA segments that are otherwise similar in sequence. These contiguous DNA segments include a gene or any other portion of a chromosome. These nucleotide variations can be variations of mutant or polymorphic alleles. For example, the nucleotide variation detected in this disclosure includes SNPs (single nucleotide polymorphisms), mutations, deletions, insertions, substitutions, and translocations.The exemplified nucleotide variation includes numerous variations within a human genome (e.g., variations in the MTHFR (methylenetetrahydrofolate reductase) gene), variations involved in drug resistance of pathogens, and variations causing tumorigenesis. The term "nucleotide variation," as used in this document, includes any variation at a specific location in a nucleic acid sequence. In other words, the term "nucleotide variation" includes a wild type and any mutant type at a specific location in a nucleic acid sequence. II. Composition for Detection of the Target Nucleic Acid

[0279] In a second aspect of the present disclosure, a composition is provided for detecting a target nucleic acid in a sample, comprising: (a) an initiator; wherein the primer comprises a hybridization nucleotide sequence with a first region of the target nucleic acid, (b) a Probing and Labeling Oligonucleotide (PTO); wherein the PTO comprises, in a direction from 5' to 3': (i) a portion of Petition 870250073538, dated 08 / 20 / 2025, page 69 / 185 62 / 136 5' labeling and (ii) a 3' targeting portion, wherein the 3' targeting portion comprises a nucleotide sequence hybridizing with a second region of the target nucleic acid, and the 5' labeling portion comprises a nucleotide sequence not hybridized with the target nucleic acid when the 3' targeting portion is hybridized with the second region of the target nucleic acid, wherein the primer is located upstream of the PTO, wherein the primer is extended to induce cleavage of the PTO by a DNA polymerase with 5' nuclease activity, such that cleavage releases a fragment comprising the 5' labeling portion of the PTO; (c) a Capture and Modeling Oligonucleotide (CTO); wherein the CTO comprises, in a 3' to 5' direction: (i) a capture portion comprising a nucleotide sequence hybridized with the 5' tag portion of the PTO and (ii) a template portion comprising a nucleotide sequence not hybridized with the 5' tag portion and the 3' targeting portion of the PTO, wherein the CTO has a reporter molecule and a suppressor molecule that define a tagged portion, wherein the fragment is hybridized with the capture portion of the CTO; and (d) a Tagged Portion Hybridization Oligonucleotide (LPHO); wherein the LPHO comprises a hybridization nucleotide sequence with the labeled portion of the CTO, wherein, when the target nucleic acid is present in the sample, the fragment hybridized with the capture portion of the CTO is extended to generate an extended strand complementary to the CTO, thus generating an extended duplex between the extended strand and the CTO, wherein the generation of the extended duplex prevents the formation of a CTO / LPHO hybrid between the labeled portion of the CTO and the LPHO. Petition 870250073538, dated 08 / 20 / 2025, p. 70 / 185 63 / 136 where, when the target nucleic acid is not present in the sample, the extended strand is not generated and, instead, the CTO / LPHO hybrid is formed, in which the extended duplex has a melting temperature (Tm) different from the Tm of the CTO / LPHO hybrid.

[0280] As the second aspect of this disclosure follows the principles of the first aspect of this disclosure described above, descriptions common to both are omitted to avoid undue redundancies that increase the complexity of this descriptive report.

[0281] The composition according to this disclosure was created to perform the method of detecting a target nucleic acid by the L-PTOCE assay described above, which is referred to as the “LPHO-assisted PTO Cleavage and Extension (L-PTOCE) composition”.

[0282] In one embodiment, when the CTO is not hybridized with the extended strand or with the LPHO, the reporter molecule and the suppressor molecule in the CTO are very close to each other, causing the suppressor molecule to suppress a signal from the reporter molecule.

[0283] In one embodiment, when the CTO is hybridized with the extended strand or with LPHO, the reporter molecule and the suppressor molecule in the CTO are separated, causing the suppressor molecule not to suppress a signal from the reporter molecule.

[0284] In one embodiment, (i) both the reporter molecule and the suppressor molecule are bound to the capture portion of the CTO, (ii) both the reporter molecule and the suppressor molecule are bound to the modeling portion of the CTO, or (iii) one of the reporter and suppressor molecules is bound to the capture portion of the CTO and the other is bound to the modeling portion of the CTO.

[0285] In one embodiment, LPHO is hybridized with the complete or partial sequence of the labeled portion of CTO, and the reporter molecule and the suppressor molecule Petition 870250073538, dated 08 / 20 / 2025, p. 71 / 185 64 / 136 in the CTO are separated, causing the suppressor molecule not to suppress a signal from the reporter molecule.

[0286] In one embodiment, the LPHO comprises a nucleotide sequence that competes with the fragment for hybridization with the CTO.

[0287] In one embodiment, the LPHO comprises a nucleotide sequence that does not compete with the fragment for hybridization with the CTO.

[0288] In one embodiment, the composition for detecting the target nucleic acid reacts with the target nucleic acid to provide a signal dependent on the presence of the target nucleic acid. In particular, the composition provides a signal change as the target nucleic acid is amplified.

[0289] In one embodiment, the signal dependent on the presence of the target nucleic acid is a signal provided by the extended duplex.

[0290] In one embodiment, the reaction between the composition and the target nucleic acid may include an amplification reaction and may include, for example, a signal amplification reaction and / or a nucleic acid amplification reaction.

[0291] WO 2022-265463 reveals that several known signal generation mechanisms in the art for detecting a target nucleic acid have a signal change temperature range (SChTR) in which the signal changes depending on the presence of the target nucleic acid, and one or two constant signal temperature ranges (SCoTRs) in which the signal is constant even in the presence of the target nucleic acid.

[0292] Furthermore, WO 2022-265463 reveals that several conventional signal generation mechanisms can be classified into three types, according to the number and / or order of this signal change temperature range and constant signal temperature range: (i) an Under-Signal-Change (UnderSC) type signal generation mechanism with a fusion feature in which the temperature range of Petition 870250073538, dated 08 / 20 / 2025, page 72 / 185 65 / 136 signal change is less than the constant signal temperature range, (ii) an Inter-Signal-Change (InterSC) type signal generation mechanism with a fusion feature wherein the signal change temperature range is greater than one of the two constant signal temperature ranges and less than the other of the two constant signal temperature ranges, and (iii) an Over-Signal-Change (OverSC) type signal generation mechanism with a fusion feature wherein the signal change temperature range is greater than the constant signal temperature range.

[0293] The compositions for executing the three types of signal generation mechanisms can be classified into UnderSC type compositions, InterSC type compositions and OverSC type compositions, respectively.

[0294] The extended duplex generated by the reaction between the composition for detecting a target nucleic acid according to the present disclosure and the target nucleic acid has a melting temperature (Tm) different from that of the CTO / LPHO hybrid. By using the extended duplex and the CTO / LPHO hybrid with such different Tm values, the composition according to the present disclosure has a signal change temperature range (SChTR) in which the signal changes depending on the presence of the target nucleic acid and two constant signal temperature ranges (SCoTRs) in which the signal is constant even in the presence of the target nucleic acid.

[0295] Therefore, the L-PTOCE assay and composition according to this disclosure can be classified in the InterSC type signal generation method and the InterSC type composition according to WO 2022-265463.

[0296] In one embodiment, the L-PTOCE composition has a signal change temperature range (SChTR), in which the signal changes depending on the presence of the target nucleic acid, and two constant signal temperature ranges (SCoTR), in which the signal is constant even in the presence of the target nucleic acid.

[0297] In one embodiment, the signal change temperature range is Petition 870250073538, dated 08 / 20 / 2025, page 73 / 185 66 / 136 greater than the first constant signal temperature range of the two constant signal temperature ranges and less than the second constant signal temperature range of the two constant signal temperature ranges.

[0298] In one embodiment, the extended duplex remains in its double-stranded state and the CTO / LPHO hybrid dissociates into a single-stranded state at temperatures within the signal-switching temperature range in the presence of the target nucleic acid.

[0299] In one embodiment, both the extended duplex and the CTO / LPHO hybrid remain in their double-stranded state at temperatures within the first constant signal temperature range in the presence of the target nucleic acid.

[0300] In one embodiment, both the extended duplex and the CTO / LPHO hybrid dissociate into a single-stranded state at temperatures within the second constant signal temperature range in the presence of the target nucleic acid.

[0301] In this regard, the L-PTOCE test will be described in more detail with reference to the drawings as follows:

[0302] Figures 3 and 4 show the predominant conformation of oligonucleotides, depending on the presence of the target nucleic acid and temperatures.

[0303] In the present disclosure, the extended duplex is not generated in the absence of the target nucleic acid or before the reaction between the target nucleic acid and the composition for detection of the target nucleic acid. Figures 3(i) to 3(iii) show, in the absence of the target nucleic acid or before the reaction between the target nucleic acid and the L-PTOCE composition, the conformation of the CTO and LPHO (i.e., the CTO / LPHO hybrid) within (i) the first constant signal temperature range, (ii) the signal change temperature range, and (iii) the second constant signal temperature range. In particular, the CTO is hybridized with the LPHO at a temperature within the first constant signal temperature range, and the reporter molecule and the molecule Petition 870250073538, dated 08 / 20 / 2025, p. 74 / 185 67 / 136 suppressor molecules in the CTO are separated, causing the suppressor molecule not to suppress a signal from the reporter molecule (see Figure 3(i)). On the other hand, the CTO is not hybridized with LPHO at a temperature within the signal-change temperature range and the second constant-signal temperature range, and the reporter molecule and the suppressor molecule in the CTO are close to each other, causing the suppressor molecule to suppress a signal from the reporter molecule (see Figure 3(ii) and Figure 3(iii)).

[0304] Meanwhile, when a target nucleic acid is present, the L-PTOCE composition reacts with the target nucleic acid to generate the extended duplex. Figures 4(i) to 4(iii) show, after the reaction of the target nucleic acid and the L-PTOCE composition, the conformation of the CTO and the extended strand (i.e., extended duplex) within (i) the first constant signal temperature range, (ii) the signal change temperature range, and (iii) the second constant signal temperature range. In particular, the CTO is hybridized with the extended strand at a temperature within the first constant signal temperature range and the signal change temperature range, and the reporter molecule and the suppressor molecule in the CTO are separated, causing the suppressor molecule not to suppress a signal from the reporter molecule (see Figure 4(i) and Figure 4(ii)).On the other hand, the CTO is not hybridized with the extended ribbon at a temperature within the second constant signal temperature range, and the reporter molecule and the suppressor molecule in the CTO are close to each other, causing the suppressor molecule to suppress a signal from the reporter molecule (see Figure 4 (iii)). In this document, there may be CTOs that do not participate in the reaction and LPHOs that do not participate in the reaction and are not cleaved (or separated). LPHOs and CTOs that do not participate in the reaction may exist in the conformation of Figure 3 (i) to Figure 3 (iii).

[0305] Within the first constant signal temperature range, where the target nucleic acid is absent (Figure 3 (i)) or where the target nucleic acid is Petition 870250073538, dated 08 / 20 / 2025, p. 75 / 185 68 / 136 present (Figure 4 (i)), the CTO is hybridized with LPHO or extended strand, and the reporter molecule and the suppressor molecule in the CTO are separated, causing the suppressor molecule not to suppress a signal from the reporter molecule. In other words, the L-PTOCE composition provides a constant signal even in the presence of the target nucleic acid within the first constant signal temperature range.

[0306] Within the second constant signal temperature range, in which the target nucleic acid is absent (Figure 3 (iii)) or in which the target nucleic acid is present (Figure 4 (iii)), the CTO is not hybridized with LPHO or with the extended strand, and the reporter molecule and the suppressor molecule in the CTO are very close to each other, causing the suppressor molecule to suppress a signal from the reporter molecule. In other words, the L-PTOCE composition provides a constant signal even in the presence of the target nucleic acid within the second constant signal temperature range.

[0307] Within the signal-change temperature range, in which the target nucleic acid is absent (Figure 3 (ii)), the CTO is not hybridized with LPHO, and the reporter molecule and the suppressor molecule in the CTO are very close to each other, causing the suppressor molecule to suppress a signal from the reporter molecule. On the other hand, within the signal-change temperature range, in which the target nucleic acid is present (Figure 4 (ii)), the CTO is hybridized with the extended strand, and the reporter molecule and the suppressor molecule in the CTO are separated, causing the suppressor molecule not to suppress a signal from the reporter molecule. In other words, the L-PTOCE composition provides a signal change depending on the presence of the target nucleic acid within the signal-change temperature range.

[0308] Figure 5A shows the quantity (or abundance) proportions of the CTO / LPHO hybrid and the extended duplex in the initial, intermediate and final cycles of steps (a) to (e) of the L-PTOCE assay, along with their melting curves.

[0309] Figure 5B represents a merged graph for three fusion curves. Petition 870250073538, dated 08 / 20 / 2025, p. 76 / 185 69 / 136 in Figure 5A.

[0310] Specifically, in Figure 5A, the numerical values ​​in row (i), “100”, “50”, and “0”, represent the quantity ratios of CTO / LPHO, which can exist in any of the forms from Figure 3 (i) to Figure 3 (iii), and the numerical values ​​in row (ii), “0”, “50”, and “100”, represent the quantity ratios of the extended duplex, which can exist in any of the forms from Figure 4 (i) to Figure 4 (iii). The quantity ratios in rows (i) and (ii) change as the cycle increases, i.e., as the target nucleic acid is amplified. In particular, a graph like that in Figure 5B can be obtained by merging the fusion curves for the initial, intermediate, and final cycles.

[0311] As shown in Figure 5B, the L-PTOCE composition according to the present disclosure has a signal-change temperature range (SChTR), in which the signal changes depending on the presence of the target nucleic acid, and two constant-signal temperature ranges (SCoTR), the first and second constant-signal temperature ranges, in which the signal is constant even in the presence of the target nucleic acid. Furthermore, the signal-change temperature range is higher than the first constant-signal temperature range and lower than the second constant-signal temperature range.

[0312] The signal switching temperature range and the constant signal temperature range of the InterSC type composition can be controlled by adjusting the Tm value of the extended duplex and the Tm value of the CTO / LPHO hybrid.

[0313] In one embodiment, the extended duplex Tm is adjustable by (i) a fragment sequence and / or length, (ii) a CTO sequence and / or length, or (iii) both the fragment sequence and / or length and the CTO sequence and / or length.

[0314] In one embodiment, the Tm of the CTO / LPHO hybrid is adjustable by a sequence and / or length of the LPHO. Petition 870250073538, dated 08 / 20 / 2025, p. 77 / 185 70 / 136

[0315] In one embodiment, the composition further comprises an enzyme with 5' nuclease activity.

[0316] In certain embodiments, the enzyme with 5' nuclease activity may be a DNA polymerase with 5' nuclease activity.

[0317] In one form, the composition also includes an additional initiator.

[0318] The composition, as described in this document, may optionally include reagents necessary for carrying out target nucleic acid amplification reactions (e.g., PCR reactions), such as buffers, DNA polymerase cofactors, and deoxyribonucleotide-5-triphosphates. Optionally, the composition may also include various polynucleotide molecules, reverse transcriptase, various buffers and reagents, and antibodies that inhibit DNA polymerase activity. The composition may also include reagents necessary for carrying out positive and negative control reactions. The ideal amounts of reagents to be used in a given reaction can be readily determined by a person skilled in the art with the benefit of this disclosure. The constituents of the composition described above may be present in separate containers, or a plurality of constituents may be present in a single container. III. Method for Detecting Multiple Target Nucleic Acids Using the L-PTOCE Assay

[0319] In a third aspect of the present disclosure, a method is provided for detecting n target nucleic acids in a sample, comprising: (a) detect signals at n detection temperatures, while incubating with n compositions to detect the n target nucleic acids, a sample suspected of containing at least one of the n target nucleic acids in a reaction vessel; where n is an integer of 2 or more, Petition 870250073538, dated 08 / 20 / 2025, p. 78 / 185 71 / 136 wherein the incubation comprises a plurality of reaction cycles and signal detection is performed in at least one of the reaction cycles, wherein each of the n compositions for detection of the n target nucleic acids provides a signal change at a corresponding detection temperature among the n detection temperatures in the presence of a corresponding target nucleic acid, wherein the signal change indicates the presence of a corresponding target nucleic acid, wherein a composition for detection of a / th target nucleic acid among the n compositions for detection of the n target nucleic acids provides a signal change at a / th detection temperature among the n detection temperatures and provides a constant signal at the other detection temperatures in the presence of the / th target nucleic acid, wherein the signal change indicates the presence of the / th target nucleic acid, wherein / represents an integer from 1 to n,and the / th detection temperature is lower than the ( / +1)th detection temperature, wherein, within the temperature range encompassing all n detection temperatures, the composition for detection of the / th target nucleic acid has a signal-altering temperature range (SChTR), in which the signal changes depending on the presence of the / th target nucleic acid, and one or two signal-constant temperature ranges (SCoTRs), in which the signal is constant even in the presence of the / th target nucleic acid, wherein the composition for detection of the / th target nucleic acid is any of the following:, (i) an Under-Signal-Change (UnderSC) type composition with a fusion characteristic in which the signal-change temperature range is smaller than the constant-signal temperature range, (ii) an Inter-Signal-Change (InterSC-type) type composition with a Petition 870250073538, dated 08 / 20 / 2025, p. 79 / 185 72 / 136 fusion characteristic in which the signal change temperature range is greater than one of the two constant signal temperature ranges and less than the other of the two constant signal temperature ranges, and (iii) an Over-Signal-Change (OverSC) type composition with a fusion characteristic in which the signal change temperature range is greater than the constant signal temperature range, and in which at least one of the n compositions for detection of n target nucleic acids is (ii) an InterSC type composition that generates the signal according to the method described above, and (b) determine the presence of the n target nucleic acids from the signals detected in step (a), in which the presence of the / th target nucleic acid is determined by the signal change detected at the / th detection temperature.

[0320] Since the third aspect of this disclosure uses the method of the first aspect of this disclosure and the composition of the second aspect of this disclosure described above, descriptions common to them are omitted to avoid undue redundancy that would lead to complexity in this descriptive report.

[0321] The method for detecting n target nucleic acids according to the present disclosure uses (i) a plurality of L-PTOCE compositions, which are InterSC type compositions and / or (ii) various combinations of the L-PTOCE composition with one or more UnderSC, InterSC and OverSC type compositions, which employ various signal generation mechanisms known in the art to detect target nucleic acids. The method of the present disclosure can detect multiple target nucleic acids using a single type of marker and a single type of detector in a single reaction vessel.

[0322] In particular, by adjusting the signal-change temperature ranges of the n compositions for detection of n target nucleic acids, so that only one signal indicating the presence of a corresponding target nucleic acid is Petition 870250073538, dated 08 / 20 / 2025, p. 80 / 185 73 / 136 provided at each detection temperature, the presence of a specific target nucleic acid can be determined only by a signal change measured at a given detection temperature.

[0323] The present disclosure will be described in detail as follows. Stage (a): Incubation and Signal Detection

[0324] First, signals are detected at n detection temperatures, during incubation with n compositions to detect the n target nucleic acids, a sample suspected of containing at least one of the n target nucleic acids in a reaction vessel.

[0325] In one embodiment, the n target nucleic acids may include a nucleotide variation. For example, one of the n target nucleic acids may include one type of nucleotide variation, and another of the n target nucleic acids may include a different type of nucleotide variation.

[0326] The n target nucleic acids in this document may be genes from n different organisms, n different genes from the same organism, or a combination thereof.

[0327] Incubation in this document refers to any reaction that induces a signal change depending on the presence of a corresponding target nucleic acid at a corresponding detection temperature, since each of the target nucleic acids reacts with a corresponding composition to detect a target nucleic acid.

[0328] In one modality, incubation includes a plurality of cycles.

[0329] In one embodiment, the incubation may include an amplification reaction and may include, for example, a signal amplification reaction and / or a nucleic acid amplification reaction.

[0330] In one embodiment, the amplification reaction includes a plurality of cycles. Petition 870250073538, dated 08 / 20 / 2025, page 81 / 185 74 / 136

[0331] In one embodiment, incubation is performed under conditions that allow for target amplification and a signal change by a composition to detect a target nucleic acid. Such conditions include temperature, salt concentration, and pH for the reaction.

[0332] In one embodiment, incubation is carried out in a signal amplification process without nucleic acid amplification.

[0333] In one embodiment, the signal can be amplified simultaneously with the amplification of the target. Alternatively, the signal can be amplified without the amplification of the target.

[0334] In one embodiment, the signal change occurs during a process that includes signal amplification and target amplification.

[0335] In one embodiment, amplification of the target nucleic acid can be performed by a polymerase chain reaction (PCR). PCR is widely used in the technique to amplify target nucleic acids, including cycles of denaturation of the target nucleic acids, annealing (hybridization) between the target nucleic acids and the primers, and primer extension (Mullis et al., U.S. Patents Nos. 4,683,195, 4,683,202 and 4,800,159; Saiki et al., (1985) Science 230, 1350-1354).

[0336] Several DNA polymerases can be used in the amplification reaction, including the “Klenow” fragment of E. coli DNA polymerase I, thermostable DNA polymerase, and bacteriophage T7 DNA polymerase. In particular, polymerase is a thermostable DNA polymerase that can be obtained from several bacteria, including Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis, Thermus flavus, Thermococcus litoralis, and Pyrococcus furiosus (Pfu). Most polymerases can be isolated from bacteria or are commercially available.

[0337] The amplification method described above can amplify nucleic acids and / or target signals by repeating a series of reactions with or without Petition 870250073538, dated 08 / 20 / 2025, p. 82 / 185 75 / 136 temperature change. The unit of amplification, including the repetition of such a series of reactions, refers to a “cycle”. The cycle can be expressed as the number of repetitions or a duration, depending on the amplification method used.

[0338] In one embodiment, the series of reactions can be performed sequentially. For example, for a PCR, after denaturation of the target nucleic acids (i.e., templates), annealing of the primers and, subsequently, extension of the primers, can be performed sequentially. In this case, the cycle can be expressed as the number of repetitions.

[0339] In one embodiment, incubation can be carried out for a plurality of cycles which allows the measurement of a signal change dependent on the presence of a target nucleic acid. For example, the plurality of cycles can include 2 to 100 cycles, 2 to 90 cycles, 2 to 80 cycles, 2 to 70 cycles, 2 to 60 cycles, 2 to 50 cycles, 2 to 40 cycles, 2 to 30 cycles, 2 to 20 cycles, 2 to 10 cycles, 5 to 100 cycles, 5 to 90 cycles, 5 to 80 cycles, 5 to 70 cycles, 5 to 60 cycles, 5 to 50 cycles, 5 to 40 cycles, 5 to 30 cycles, 5 to 20 cycles, 5 to 10 cycles, 10 to 100 cycles, 10 to 90 cycles, 10 to 80 cycles, 10 to 70 cycles, 10 to 60 cycles, 10 to 50 cycles, 10 to 40 cycles, 10 to 30 cycles, 10 to 20 cycles, 20 to 100 cycles, 20 to 90 cycles, 20 to 80 cycles, 20 to 70 cycles, 20 to 60 cycles, 20 to 50 cycles, 20 to 40 cycles or 20 to 30 cycles and, in particular, may include 10 cycles, 15 cycles, 20 cycles, 25 cycles, 30 cycles, 35 cycles, 40 cycles, 45 cycles or 50 cycles.

[0340] In one embodiment, signal detection can be performed in each cycle, in some selected cycles, or in an outcome cycle of an incubation reaction, including a plurality of cycles.

[0341] In one embodiment, the amplification reaction can be an amplification reaction for multiple target nucleic acids.

[0342] The term “multi-target nucleic acid amplification reaction”, as used in this document, refers to a reaction that amplifies two or more target nucleic acids in a single reaction vessel. The amplification reaction Petition 870250073538, dated 08 / 20 / 2025, p. 83 / 185 76 / 136 for multiple target nucleic acids refers to a reaction that amplifies two or more nucleic acids together. For example, the amplification reaction for multiple target nucleic acids can amplify, in a single reaction, 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 20 or more, 30 or more, 40 or more, or 50 or more target nucleic acids together.

[0343] In one embodiment, the method of the present invention can detect 2 to 50, 2 to 40, 2 to 30, 2 to 20, 2 to 15, 2 to 12, 2 to 10, 2 to 9, 2 to 8, 2 to 7, 2 to 6, 2 to 5, 3 to 50, 3 to 40, 3 to 30, 3 to 20, 3 to 15, 3 to 12, 3 to 10, 3 to 9, 3 to 8, 3 to 7, 3 to 6, 3 to 5, 4 to 50, 4 to 40, 4 to 30, 4 to 20, 4 to 15, 4 to 12, 4 to 10, 4 to 9, 4 to 8, 4 to 7, 4 to 6 or 4 to 5 target nucleic acids using a single type of marker in a single reaction vessel.

[0344] The method according to the present disclosure is used to determine whether at least one of the n target nucleic acids is present in a sample. For example, when n is 2, the method of the present disclosure can be used to determine whether at least one of a first target nucleic acid and a second target nucleic acid is present in a sample. In another example, when n is 3, the method of the present disclosure can be used to determine whether at least one of a first target nucleic acid, a second target nucleic acid, and a third target nucleic acid is present in a sample.

[0345] In one embodiment, n is an integer of 2 or more. For example, n can be 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, or 50, but it is not limited to these.

[0346] In the present disclosure, a combination of compositions for detecting n target nucleic acids is used to detect each of the n target nucleic acids, where n is an integer of 2 or more. In other words, a combination of compositions for detecting from the first to the nth target nucleic acid is used to detect from the first target nucleic acid to the nth target nucleic acid. Petition 870250073538, dated 08 / 20 / 2025, p. 84 / 185 77 / 136

[0347] As used in this document, the term “combination of compositions for detecting the first to the nth target nucleic acid” refers to a compilation or mixture of compositions specific to each of the target nucleic acids from the first to the nth. In this document, a composition for detecting a target nucleic acid is specific to that same target nucleic acid. The expression “a composition for detecting a target nucleic acid is specific to that same target nucleic acid” means that the composition for detecting the target nucleic acid is involved in detecting that same target nucleic acid, but is not involved in detecting other target nucleic acids. In other words, the expression means that the composition for detecting the target nucleic acid interacts with that same target nucleic acid, but does not interact with other target nucleic acids.

[0348] In this document, the composition for detecting the nth target nucleic acid is specific to the same target nucleic acid. For example, the composition for detecting the first target nucleic acid is specific to the first target nucleic acid, the composition for detecting the second target nucleic acid is specific to the second target nucleic acid, and the composition for detecting the third target nucleic acid is specific to the third target nucleic acid.

[0349] The combination of compositions for the detection of the first to the nth target nucleic acid, as used in this document, is employed in a single reaction. In other words, the compositions for the detection of the first to the nth target nucleic acid coexist in a single reaction solution or reaction vessel.

[0350] As used in this document, the term “composition for detection of a target nucleic acid” refers to a composition comprising components used to detect a target nucleic acid.

[0351] According to the method of the present disclosure, each of the compositions for the detection of the first to nth target nucleic acid comprises Petition 870250073538, dated 08 / 20 / 2025, p. 85 / 185 78 / 136 a marker that provides a signal depending on the presence of the same target nucleic acid, and the signals provided by each of the compositions for the detection of the first to the nth target nucleic acid are not distinguished from each other by a single detection channel.

[0352] The composition for detecting a target nucleic acid may comprise several oligonucleotides involved in the amplification and / or detection of the target nucleic acid.

[0353] The marker in this document may be linked to an oligonucleotide or may exist in free form. Alternatively, the marker may be incorporated into the oligonucleotide during incubation.

[0354] Although the marker and oligonucleotide are described as key elements in the compositions for the detection of target nucleic acids from the first to the nth, a person skilled in the art should understand that several other components may be included in the compositions.

[0355] Examples of components included in compositions for detection of the target nucleic acid include, but are not limited to, a set of oligonucleotides used to amplify or detect the target nucleic acid, a marker, a nucleic acid polymerase, a buffer, a polymerase cofactor, and a deoxyribonucleotide-5-triphosphate. Optionally, the compositions may also include various polynucleotide molecules, reverse transcriptase, various buffers and reagents, and antibodies that inhibit DNA polymerase activity. The compositions may also include reagents necessary for carrying out positive and negative control reactions. The ideal amounts of reagents to be used in a given reaction can be readily determined by a person skilled in the art who has the benefit of this disclosure.The constituents of the composition described above may be present in separate containers, or a plurality of constituents may be present in a single container. Petition 870250073538, dated 08 / 20 / 2025, page 86 / 185 79 / 136

[0356] Each of the n compositions for the detection of n target nucleic acids used in this disclosure is any one of the following: (i) an Under-Signal-Change (UnderSC-type) composition, (ii) an Inter-Signal-Change (InterSC-type) composition, and (iii) an Over-Signal-Change (OverSC-type) composition, provided that at least one of the n compositions for the detection of n target nucleic acids is an InterSC-type composition that manages the signal according to the L-PTOCE assay, as described above. For example, when n is 2, at least one of the compositions for detecting the first target nucleic acid and the composition for detecting the second target nucleic acid is an LPTOCE composition. In particular, when n is 2, exemplary combinations of the composition for detecting the first target nucleic acid and the composition for detecting the second target nucleic acid are shown in Table 1 below.When n is 3, exemplary combinations of the compositions for detecting the first to third target nucleic acids are shown in Table 2.

[0357] In Tables 1 and 2, “UnderSC”, “InterSC” and “OverSC” refer to compositions of the UnderSC, InterSC and OverSC type, respectively. Table 1 / 7 = 2 Composition to detect the first target nucleic acid Composition to detect the second target nucleic acid 1 SubSC L-PTOCE 2 L-PTOCE L-PTOCE 3 L-PTOCE InterSC 4 InterSC L-PTOCE 5 L-PTOCE SobreSC Table 2 / 7 = 3 Composition to detect the first target nucleic acid Composition to detect the second target nucleic acid Composition to detect the third target nucleic acid 1 L-PTOCE InterSC InterSC 2 L-PTOCE InterSC SobreSC 3 SubSC L-PTOCE InterSC 4 UnderSC L-PTOCE SobreSC 5 InterSC L-PTOCE InterSC Petition 870250073538, dated 08 / 20 / 2025, p. 87 / 185 80 / 136 6 InterSC L-PTOCE SobreSC 7 UnderSC InterSC L-PTOCE 8 InterSC InterSC L-PTOCE 9 L-PTOCE L-PTOCE InterSC 10 L-PTOCE L-PTOCE SobreSC 11 L-PTOCE InterSC L-PTOCE 12 UnderSC L-PTOCE L-PTOCE 13 InterSC L-PTOCE L-PTOCE 14 L-PTOCE L-PTOCE L-PTOCE

[0358] Details of UnderSC, InterSC and OverSC type compositions can be found in document WO2022-265463, which is incorporated herein by reference in its entirety.

[0359] In one embodiment, each of the n compositions for detecting the target nucleic acids provides a signal change at a corresponding detection temperature between the n detection temperatures, the signal change indicating the presence of a corresponding target nucleic acid.

[0360] For example, the composition for the detection of a / th target nucleic acid among the n target nucleic acids provides a signal change at a / th detection temperature among the n detection temperatures and provides a constant signal at the other detection temperatures in the presence of the / th target nucleic acid.

[0361] In an embodiment, / represents an integer from 1 to n, and the / th detection temperature is less than the ( / +1)th detection temperature. In an embodiment, when / is n, there is no detection temperature / +1 (i.e., detection temperature n+1). For example, when n is 3, / represents an integer from 1 to 3, and there is a first detection temperature, a second detection temperature, and a third detection temperature, wherein the first detection temperature is less than the second detection temperature and the second detection temperature is less than the third detection temperature.

[0362] According to the present disclosure, within the temperature range, which covers all n detection temperatures, the composition for detecting the / th Petition 870250073538, dated 08 / 20 / 2025, p. 88 / 185 81 / 136 target nucleic acid has a signal change temperature range (SChTR) in which the signal changes depending on the presence of the / th target nucleic acid, and one or two constant signal temperature ranges (SCoTRs) in which the signal is constant even in the presence of the / th target nucleic acid.

[0363] In one embodiment, the composition for the detection of the / th target nucleic acid is any of the following: (i) an Under-SignalChange (UnderSC-type) composition with a fusion feature in which the signal-change temperature range is lower than the constant-signal temperature range, (ii) an Inter-Signal-Change (InterSC-type) composition with a fusion feature in which the signal-change temperature range is higher than one of the two constant-signal temperature ranges, and lower than the other of the two constant-signal temperature ranges, and (iii) an Over-Signal-Change (OverSC-type) composition with a fusion feature in which the signal-change temperature range is higher than the constant-signal temperature range.

[0364] In one embodiment, the composition for the detection of the / th target nucleic acid, in the presence of the / th target nucleic acid, provides a signal change after amplification of the target nucleic acid at the / th detection temperature (i.e., change at a / th signal) while providing no signal change at the other detection temperatures, even when the target nucleic acid is amplified (i.e., the signal is constant). That is, the composition for the detection of the / th target nucleic acid has a signal change temperature range, in which the signal changes as the / th target nucleic acid is amplified, and a constant signal temperature range, in which the signal is constant even when the / th target nucleic acid is amplified.

[0365] The term “ / th signal”, as used in this document, refers to a signal provided at a / th detection temperature by the composition to detect Petition 870250073538, dated 08 / 20 / 2025, p. 89 / 185 82 / 136 a / th target nucleic acid, which is used interchangeably with “signal at a / th detection temperature”.

[0366] In one embodiment, when detecting n target nucleic acids, the / th signal may mean a signal provided by the n compositions for detection of target nucleic acids, including the composition for detection of the / th target nucleic acid, at the / th detection temperature.

[0367] In one embodiment, the composition for detecting the / th target nucleic acid, in the absence of the / th target nucleic acid, provides no signal change, i.e., it provides a constant signal at the / th detection temperature during an incubation reaction (e.g., an amplification reaction of the target nucleic acid).

[0368] In one embodiment, the signal-altering temperature range is a temperature range in which a difference is generated between the signal values ​​(e.g., signal intensities) in the presence of the target nucleic acid and in the absence of the target nucleic acid.

[0369] In one embodiment, the signal change temperature range is a temperature range in which the signal value changes depending on the amplification level of the target nucleic acid (e.g., the amount of target nucleic acid amplified).

[0370] In one embodiment, the constant signal temperature range is a temperature range in which the signal value does not change regardless of the presence of the target nucleic acid. In other words, the constant signal temperature range is a temperature range in which there is no difference between the signal value in the presence of the target nucleic acid and the signal value in the absence of the target nucleic acid.

[0371] In one embodiment, the / th detection temperature can be selected within the signal change temperature range of the composition for Petition 870250073538, dated 08 / 20 / 2025, p. 90 / 185 83 / 136 detect the / th target nucleic acid. In this disclosure, the composition for detecting the / th target nucleic acid refers to a / th detection temperature. Furthermore, the / th target nucleic acid corresponding to the composition for detecting the / th target nucleic acid may refer to a target nucleic acid with the / th detection temperature.

[0372] In one embodiment, a detection temperature, which is determined by the composition to detect a corresponding target nucleic acid, is assigned to a target nucleic acid.

[0373] In certain embodiments, when n is 2, the composition for detecting the first target nucleic acid provides a signal change at the first detection temperature and provides a constant signal at the second detection temperature in the presence of the first target nucleic acid; and the composition for detecting the second target nucleic acid provides a signal change at the second detection temperature and provides a constant signal at the first detection temperature in the presence of the second target nucleic acid.

[0374] In certain embodiments, when n is 3, the composition for detecting the first target nucleic acid provides a signal change at the first detection temperature and provides a constant signal at the second detection temperature and at the third detection temperature in the presence of the first target nucleic acid; the composition for detecting the second target nucleic acid provides a signal change at the second detection temperature and provides a constant signal at the first detection temperature and at the third detection temperature in the presence of the second target nucleic acid; and the composition for detecting the third target nucleic acid provides a signal change at the third detection temperature and provides a constant signal at the first detection temperature and at the second detection temperature in the presence of the third target nucleic acid.

[0375] In one mode, the / th detection temperature is selected Petition 870250073538, dated 08 / 20 / 2025, p. 91 / 185 84 / 136 within the signal-change temperature range of the composition for detecting the / th target nucleic acid, and the / th detection temperature is not included in the signal-change temperature ranges of the compositions for detecting the other target nucleic acids.

[0376] In one embodiment, the signal-change temperature range of any of the target nucleic acid detection compositions may overlap with the signal-change temperature range of a target nucleic acid detection composition with an adjacent detection temperature, although it does not overlap with the signal-change temperature range of a target nucleic acid detection composition with a non-adjacent detection temperature. In this case, the detection temperature of the target nucleic acid detection composition that has the signal-change temperature range overlapping with the signal-change temperature range of the other target nucleic acid detection composition is selected from within the signal-change temperature range that does not overlap with the signal-change temperature range of the other target nucleic acid detection composition.By selecting the detection temperature as such, only the signal indicative of the presence of a single specific target nucleic acid can be provided at a single detection temperature.

[0377] In one embodiment, the signal change temperature range of any of the compositions for detection of target nucleic acids may overlap with the signal change temperature range of the composition for detection of a target nucleic acid with an adjacent detection temperature, but neither of the two signal change temperature ranges is completely included in the other signal change temperature range.

[0378] The term “adjacent detection temperature” is used in this document to refer to consecutive detection temperatures between n Petition 870250073538, dated 08 / 20 / 2025, p. 92 / 185 85 / 136 detection temperatures and, for example, the detection temperature adjacent to the / th detection temperature is the ( / -1)th detection temperature or the ( / +1)th detection temperature.

[0379] In one embodiment, the signal change temperature range of the composition for detection of the / th target nucleic acid may partially overlap with the signal change temperature range of the composition for detection of a target nucleic acid with an adjacent detection temperature, without overlapping with the signal change temperature range of the composition for detection of a target nucleic acid with a non-adjacent detection temperature.

[0380] In one embodiment, the composition for the detection of the / th target nucleic acid may have a temperature range that alters the signal and a temperature range of constant signal.

[0381] In one embodiment, the composition for the detection of the target nucleic acid may have a temperature range that alters the signal and two temperature ranges that maintain the signal constant.

[0382] In one embodiment, the composition for the detection of the / th target nucleic acid comprises a marker that provides a signal dependent on the presence of the / th target nucleic acid.

[0383] In one embodiment, the marker in this document may be bound to an oligonucleotide or may exist in free form. Alternatively, the marker may be incorporated into the oligonucleotide during incubation (e.g., nucleic acid amplification). In other words, the composition for detecting the target nucleic acid may initially include a labeled oligonucleotide or may provide a labeled oligonucleotide as the marker is incorporated into a newly generated oligonucleotide (e.g., an extended strand) during an incubation reaction.

[0384] In one embodiment, the composition to detect the / th nucleic acid Petition 870250073538, dated 08 / 20 / 2025, p. 93 / 185 The 86 / 136 target includes an incorporation marker that is incorporated into an oligonucleotide during incubation and provides a signal depending on the presence of the 1 / th target nucleic acid.

[0385] In one embodiment, the composition for detecting the target / th nucleic acid provides a labeled oligonucleotide that serves to provide a signal depending on the presence of the target / th nucleic acid.

[0386] In one embodiment, the composition for detecting the target / th nucleic acid initially includes a labeled oligonucleotide that serves to provide a signal depending on the presence of the target / th nucleic acid. The CTO, as described in this document, corresponds to an example of a labeled oligonucleotide.

[0387] Alternatively, the composition for detecting the target / th nucleic acid may include an oligonucleotide and a marker that provides a signal depending on the presence of the target / th nucleic acid, and the marker is incorporated into the oligonucleotide during an incubation reaction (e.g., a nucleic acid amplification reaction), thus providing a labeled oligonucleotide that serves to provide a signal depending on the presence of the target / th nucleic acid.

[0388] As used in this document, the term “labeled oligonucleotide” refers to an oligonucleotide involved in generating a signal that is being detected.

[0389] In one embodiment, the labeled oligonucleotide may comprise an oligonucleotide that specifically hybridizes with a target nucleic acid (e.g., a probe or a primer); when the probe or primer hybridized with the target nucleic acid is cleaved to release a fragment, the labeled oligonucleotide may comprise a capture oligonucleotide that specifically hybridizes with the fragment; when the fragment hybridized with the capture oligonucleotide is extended to form an extended strand, the labeled oligonucleotide may comprise an oligonucleotide that specifically hybridizes with the extended strand, Petition 870250073538, dated 08 / 20 / 2025, page 94 / 185 87 / 136 an oligonucleotide that is produced by incorporating a marker during fragment extension, an oligonucleotide that hybridizes specifically with the capture oligonucleotide, and a combination thereof.

[0390] In one embodiment, the labeled oligonucleotide includes an oligonucleotide involved in the actual generation of the signal. For example, hybridization or non-hybridization between the labeled oligonucleotide and another oligonucleotide (e.g., an oligonucleotide comprising a nucleotide sequence complementary to the labeled oligonucleotide or to the target nucleic acid) determines the generation of the signal.

[0391] In one embodiment, the labeled oligonucleotide may be a “probe” known in the art. The term “probe,” as used in this document, refers to a single-stranded nucleic acid molecule comprising one or more moieties substantially complementary to a target nucleic acid sequence. According to one embodiment of the present disclosure, the 3’ end of the probe is “blocked” to prevent its extension. The blocking may be achieved according to conventional methods. For example, the blocking may be accomplished by adding to the 3’-hydroxyl group of the last nucleotide a chemical moiety, such as biotin, markers, phosphate groups, alkyl groups, non-nucleotide ligands, phosphorothioate residues, or alkanediol. Alternatively, the blocking may be accomplished by removing the 3’-hydroxyl group from the last nucleotide or by using a nucleotide without a 3’-hydroxyl group, such as dideoxynucleotide.

[0392] In one embodiment, the labeled oligonucleotide may be composed of at least one oligonucleotide. According to one embodiment of the present invention, when the labeled oligonucleotide is composed of a plurality of oligonucleotides, the labeled oligonucleotide may be labeled in various ways. For example, all or a portion of the plurality of oligonucleotides may have at least one marker. Petition 870250073538, dated 08 / 20 / 2025, p. 95 / 185 88 / 136

[0393] In one mode, the marker can be a single marker or interactive markers.

[0394] For example, the single marker includes a fluorescent marker, a luminescent marker, a chemiluminescent marker, an electrochemical marker, and a metallic marker. In one embodiment, the single marker provides different signals (e.g., different signal intensities) depending on its presence on a double strand or a single strand. In one embodiment, the single marker is a fluorescent marker. The preferred types and binding sites of single fluorescent markers used in the present disclosure are disclosed in U.S. Patents Nos. 7,537,886 and 7,348,141, the teachings of which are incorporated herein by reference in their entirety. For example, the single fluorescent marker includes, without limitation, JOE, FAM, TAMRA, ROX, and fluorescein-based markers. The single marker can be linked to an oligonucleotide by various methods.For example, the marker can be connected to a probe by means of a spacer containing carbon atoms (for example, a 3-carbon spacer, a 6-carbon spacer, or a 12-carbon spacer).

[0395] In one embodiment, interactive markers may include at least one reporter molecule and at least one suppressor molecule. In particular, interactive markers may include one reporter molecule and one suppressor molecule. Or, interactive markers may include one reporter molecule and two suppressor molecules.

[0396] The reporter molecule and suppressor molecule useful in this disclosure may include any molecules known in the art, details of which are found in the section describing reporter molecules and suppressor molecules in the first aspect of the descriptive report.

[0397] In one mode, when the marker is interactive, the markers Petition 870250073538, dated 08 / 20 / 2025, p. 96 / 185 89 / 136 interactive markers may include at least one reporter molecule and at least one suppressor molecule, wherein the interactive markers may all be linked to one oligonucleotide or may be linked to each of a plurality of oligonucleotides.

[0398] In one embodiment, an incorporation marker can be used in the process of incorporating a marker during a primer extension to generate a signal (e.g., Plexor technology, Sherrill CB et al., Journal of the American Chemical Society, 126: 4550-45569 (2004)). Additionally, the incorporation marker can be used in a signal generation by a duplex formed in a cleavage-dependent manner of a hybridized mediated oligonucleotide with a target nucleic acid.

[0399] In one embodiment, the incorporation marker can generally be linked to a nucleotide. In addition, a nucleotide with an unnatural base can be used.

[0400] As used in this document, the term “non-natural base” refers to derivatives of natural bases, such as adenine (A), guanine (G), thymine (T), cytosine (C), and uracil (U), that are capable of forming hydrogen-bonded base pairs. The term “non-natural base,” as used in this document, includes bases with base-pairing patterns different from natural bases as parent compounds, as described, for example, in U.S. Patents Nos. 5,432,272, 5,965,364, 6,001,983, and 6,037,120. Base pairing between non-natural bases includes two or three hydrogen bonds, as in natural bases. Base pairing between non-natural bases is also formed in a specific manner. Specific examples of unnatural bases include the following bases in base pair combinations: iso-C / iso-G, iso-dC / iso-dG, Z / P, V / J, K / X, H / J, Pa / Ds, Pa / Q, Pn / Ds, Pn / Dss, Px / Ds, NaM / 5SICS, 5FM / 5SICS and M / N (see U.S. Patents Nos. 5,432,272; 5,965,364; 6,001,983; 6,037,120; 6.140,496; 6,627,456; 6,617,106; and. Petition 870250073538, dated 08 / 20 / 2025, p. 97 / 185 90 / 136 7,422,850; and Filip Wojciechowski et al., Chem. Soc. Rev., 2011,40, 5669-5679).

[0401] Conventional methods for detecting multiple target nucleic acids have the disadvantage of requiring the use of different types of fluorescent markers for real-time detection of multiple target nucleic acids or requiring additional analysis, such as fusion curve analysis, even when using a single type of fluorescent marker. In contrast, the method according to the present disclosure can detect multiple target nucleic acids in real time using a single type of marker (e.g., a single fluorescent marker) without additional analysis, such as fusion analysis.

[0402] In one embodiment, each of the n compositions for target nucleic acid detection provides one or more duplexes.

[0403] As used in this document, the term “duplex” refers to a double-stranded nucleic acid molecule formed by the hybridization of two single-stranded nucleic acid molecules with a sequence that is partially or fully complementary to each other under hybridization conditions. The two single-stranded nucleic acid molecules that form the duplex can exist in associated form (i.e., one double-stranded molecule) or in dissociated form (i.e., two single-stranded molecules), depending on the temperature (in particular, the detection temperature). In this respect, the term “duplex,” when referring to the expression “a composition for detecting a target nucleic acid provides a duplex,” is used to encompass both a duplex in associated form and a duplex in dissociated form.

[0404] In one modality, duplex can also refer to a “hybrid”.

[0405] The expression “a composition for the detection of a target nucleic acid provides a duplex”, as used in this document, may mean that the composition provides a duplex in associated form and / or a duplex in dissociated form. Similarly, the expression “a composition for the detection of a target nucleic acid generates a duplex during incubation”, as used in this Petition 870250073538, dated 08 / 20 / 2025, p. 98 / 185 91 / 136 document, it may mean that the composition generates a duplex in the associated form and / or a duplex in the dissociated form during an incubation reaction.

[0406] In one embodiment, at least one of the duplexes provided by the composition for detection of a target nucleic acid is a duplex that provides a signal. In particular, duplex is a duplex that provides a signal change. In other words, the composition for detection of a / th target nucleic acid provides a duplex that provides a signal and, particularly, the composition for detection of the / th target nucleic acid provides a duplex that provides a signal change depending on the presence of the / th target nucleic acid.

[0407] The term “duplex that provides a signal”, as used in this document, refers to a duplex capable of providing a signal that can be distinguished depending on whether the duplex is in associated form or dissociated form. For example, this means that the duplex in associated form generates (or extinguishes) a signal, and the duplex in dissociated form extinguishes (or generates) a signal.

[0408] In one embodiment, the duplex that provides the signal may include at least one marker.

[0409] As used in this document, the term “duplex providing a sign change” refers to a duplex that provides a sign change indicative of the presence of a target nucleic acid, since the amount of duplex providing the sign change changes depending on the presence of the target nucleic acid. In particular, the extended duplex according to this disclosure corresponds to an example of a duplex providing a sign change described in this document.

[0410] In one embodiment, the duplex that provides the signal change includes a marker. In particular, at least one marker is attached to at least one of the two single-stranded nucleic acid molecules that constitute the duplex. For example, the duplex that provides the signal change includes a single marker and, in that case, Petition 870250073538, dated 08 / 20 / 2025, p. 99 / 185 92 / 136 In the first case, the single marker is attached to either of the two single-stranded nucleic acid molecules that make up the duplex. In another example, the duplex that provides the sign change includes interactive markers, and in that case, either all interactive markers are attached to one of the two single-stranded nucleic acid molecules that make up the duplex that provides the sign change, or one of the interactive markers is attached to one of the two single-stranded nucleic acid molecules and the other interactive marker is attached to the other single-stranded nucleic acid molecule.

[0411] In one embodiment, the composition for the detection of the / th target nucleic acid provides a duplex that provides a signal change.

[0412] In one embodiment, the composition for detecting the / th target nucleic acid provides a marker signal when the duplex that provides the signal change is in the associated form. In other words, the composition for detecting the / th target nucleic acid provides a signal depending on the association of the two single-stranded nucleic acid molecules that constitute the duplex.

[0413] In an alternative embodiment, the composition for detecting the / th target nucleic acid provides a marker signal when the duplex that provides the signal change is in the dissociated form. In other words, the composition for detecting the / th target nucleic acid provides a signal depending on the dissociation of the two single-stranded nucleic acid molecules that constitute the duplex.

[0414] In one embodiment, the association or dissociation of the duplex may depend on temperature.

[0415] In one embodiment, the duplex that provides the signal change may be a duplex that was initially (originally) included in the composition to detect a target nucleic acid.

[0416] In one embodiment, when the duplex that provides the signal change has been included in the composition for detection of the target nucleic acid, the duplex can Petition 870250073538, dated 08 / 20 / 2025, pp. 100 / 185 93 / 136 is generated by hybridization between a labeled oligonucleotide and an oligonucleotide hybridizable with the labeled oligonucleotide. The CTO / LPHO hybrid of the present disclosure or a double-stranded nucleic acid hybridization probe (U.S. Patent No. 7,799,522), also known as a Yin-Yang probe, is an exemplary duplex that provides a signal change depending on the presence of a target nucleic acid, which was initially included in the composition to detect the target nucleic acid.

[0417] In one embodiment, when the duplex that provides the signal change was initially included in the composition to detect the target nucleic acid, the amount of the duplex that provides the signal change varies, in particular, decreases, in a manner dependent on the presence of the target nucleic acid, thus providing the signal change. For example, the amount of the CTO / LPHO hybrid decreases as extended duplexes are generated, depending on the presence of the target nucleic acid, thus providing a signal change depending on the presence of the target nucleic acid.

[0418] In one embodiment, the duplex that provides the signal change may be a duplex recently provided by the composition to detect a target nucleic acid during an incubation reaction.

[0419] In one embodiment, the duplex that provides the signal change, generated during the incubation reaction, can be provided by hybridization between a labeled oligonucleotide and the target nucleic acid.

[0420] Signals from the formation of a duplex between the labeled oligonucleotide and the target nucleic acid can be generated by several methods, including the Scorpion method (Whitcombe et al., Nature Biotechnology 17: 804-807 (1999)), the Sunrise (or Amplifluor) method (Nazarenko et al., Nucleic Acids Research, 25(12): 2516-2521 (1997) and US Patent No. 6,117,635), the LUX method (US Patent No. 7,537,886), and the Plexor method (Sherrill CB, et al., Journal of the American Chemical Society). Petition 870250073538, dated 08 / 20 / 2025, p. 101 / 185 94 / 136 Society, 126: 4550-4556 (2004)), molecular signaling method (Tyagi et al., Nature Biotechnology v.14 MARCH 1996), Hybeacon method (French DJ et al., Mol. Cell Probes, 15(6): 363-374 (2001)), adjacent hybridization probe method (Bernard PS et al., Anal. Biochem., 273: 221 (1999)) and LNA method (US Patent No. 6,977,295).

[0421] In one embodiment, the duplex that provides the signal change, which is generated during the incubation reaction, may be a duplex generated by a cleavage reaction dependent on the presence of the target nucleic acid. The extended duplex according to the present disclosure is an example of a duplex generated by a cleavage reaction dependent on the presence of the target nucleic acid.

[0422] In one embodiment, the signal change is generated by a duplex generated in a cleavage-dependent manner of a mediated oligonucleotide specifically hybridized with the target nucleic acid.

[0423] As used in this document, the term “mediating oligonucleotide” refers to an oligonucleotide that mediates the generation of a duplex, not including a target nucleic acid.

[0424] In one embodiment, the cleavage of the mediating oligonucleotide by itself does not generate a signal, but after hybridization and cleavage of the mediating oligonucleotide, a fragment (a cleavage product) produced by the cleavage is involved in a series of reactions for signal generation.

[0425] In one embodiment, hybridization or cleavage of the mediated oligonucleotide does not by itself generate a signal.

[0426] In one embodiment, the mediating oligonucleotide includes an oligonucleotide that hybridizes with a target nucleic acid and is cleaved to release a fragment, thereby mediating the generation of a duplex.

[0427] In one embodiment, the fragment mediates the generation of a duplex by extending the fragment into a capture oligonucleotide. Petition 870250073538, dated 08 / 20 / 2025, page 102 / 185 95 / 136

[0428] According to one embodiment, the mediating oligonucleotide comprises (i) a targeting portion comprising a nucleotide sequence that hybridizes with a target nucleic acid and (ii) a labeling portion comprising a nucleotide sequence that does not hybridize with the target nucleic acid.

[0429] In one embodiment, the composition for detecting a target nucleic acid may include a labeling oligonucleotide that hybridizes with the target nucleic acid, and the cleavage reaction dependent on the presence of the target nucleic acid may involve cleavage of the labeling oligonucleotide. The labeling oligonucleotide corresponds to an example of the mediating oligonucleotide described above, and the PTO of the present disclosure corresponds to an example of the labeling oligonucleotide.

[0430] According to one embodiment, cleavage of the mediating oligonucleotide releases a fragment, and the fragment is specifically hybridized to a capture oligonucleotide and extended into the capture oligonucleotide. When the capture oligonucleotide comprises a marker, the capture oligonucleotide corresponds to an instance of the labeled oligonucleotide described in this document.

[0431] According to one embodiment, the mediating oligonucleotide hybridized with a target nucleic acid is cleaved and releases a fragment, the fragment is specifically hybridized to a capture oligonucleotide and the fragment is extended to generate an extended strand, which induces the formation of an extended duplex between the extended strand and the capture oligonucleotide, thus providing an indicative signal of the presence of the target nucleic acid.

[0432] According to one embodiment, a third oligonucleotide comprising a hybridization nucleotide sequence with the extended strand may be used. When the third oligonucleotide is used, the hybridization of the extended strand and the third oligonucleotide form another type of duplex, thus providing Petition 870250073538, dated 08 / 20 / 2025, page 103 / 185 96 / 136 is a signal that indicates the presence of the target nucleic acid (e.g., PCE-SH). In this case, another type of duplex is a duplex that provides the signal change.

[0433] Signals from a duplex generated in a cleavage-dependent manner on the mediating oligonucleotide can be generated by several methods, including the PTOCE (cleavage and extension of PTO) method (WO 2012 / 096523), the PCESH (cleavage and extension of PTO-dependent signaling oligonucleotide hybridization) method (WO 2013 / 115442) and the PCE-NH (non-hybridization of cleavage and extension of PTO) method (WO 2014 / 104818).

[0434] With regard to the terms disclosed in the references above, the corresponding examples of oligonucleotides are as follows: the mediating oligonucleotide corresponds to a PTO (Probing and Labeling Oligonucleotide), the capture oligonucleotide corresponds to a CTO (Capture and Shaping Oligonucleotide), and the third oligonucleotide corresponds to an SO (Signaling Oligonucleotide) or an HO (Hybridization Oligonucleotide). The SO, HO, CTO, extended strand, or a combination thereof may play the role of a labeled oligonucleotide.

[0435] In one embodiment, the duplex that provides the signal change can be a single-type duplex or multiple-type duplexes. Specifically, when the duplex that provides the signal change is a single-type duplex, the number of duplexes can be 1, and when the duplex that provides the signal change is a multiple-type duplex, the number of duplexes can be 2, 3, 4, 5, 6, 7, 8, 9, 10, 15 or 20, specifically, 2, 3 or 4 and, more specifically, 2 or 3.

[0436] In one embodiment, the single-type duplex or any of the multiple-type duplexes includes a marker.

[0437] In one embodiment, when the duplex that provides the signal change is a single-type duplex, the amount of single-type duplex changes depending on the presence of a target nucleic acid, thus altering the signal. Petition 870250073538, dated 08 / 20 / 2025, pp. 104 / 185 97 / 136

[0438] In one embodiment, when the duplex is a multi-type duplex, the quantity ratios between the multi-type duplexes change depending on the presence of a target nucleic acid, thus altering the signal.

[0439] In one embodiment, the Tm values ​​of the duplexes of multiple types are different from each other. For example, the Tm values ​​of the duplexes differ from each other by at least 2 °C, at least 3 °C, at least 4 °C, at least 5 °C, at least 7 °C, at least 8 °C, at least 9 °C, at least 10 °C, at least 11 °C, at least 12 °C, at least 13 °C, at least 14 °C, at least 15 °C or at least 20 °C.

[0440] In one embodiment, the quantity of a duplex refers to the sum of the quantity of a duplex in dissociated form and the quantity of a duplex in associated form.

[0441] In one embodiment, at least two of the multi-type duplexes include the same single-stranded nucleic acid molecule. When the multi-type duplexes include the same single-stranded nucleic acid molecule, the same single-stranded nucleic acid molecule is included in a first duplex initially included in the composition to detect the target nucleic acid, and during an incubation reaction, a new second duplex including the same single-stranded nucleic acid molecule may be generated. In this case, the same single-stranded nucleic acid molecule, included in the first duplex, may be considered consumed when participating in the generation of the second duplex during the incubation reaction, resulting in a decrease in the amount of the first duplex and an increase in the amount of the second duplex.

[0442] In one embodiment, the signal change temperature range of the composition to detect the target / th nucleic acid can be determined based on the length and / or sequence of the duplex that provides a signal change. Petition 870250073538, dated 08 / 20 / 2025, pp. 105 / 185 98 / 136

[0443] In one embodiment, the composition for the detection of the / th target nucleic acid provides a single-type duplex; the composition for the detection of the / th target nucleic acid may have a signal-change temperature range and a constant-signal temperature range. The signal-change temperature range and the constant-signal temperature range may be determined based on the length and / or sequence of the single-type duplex.

[0444] In one embodiment, when the composition for detection of the / th target nucleic acid provides duplexes of multiple types, in particular, two different types of duplexes, the composition for detection of the / th target nucleic acid may have one signal-change temperature range and two constant-signal temperature ranges. The signal-change temperature range and the constant-signal temperature ranges may be determined based on the lengths and / or sequences of the two different types of duplexes.

[0445] In one embodiment, any of the n compositions for detection of the target nucleic acids may include an amplification oligonucleotide that serves to amplify a corresponding target nucleic acid. In one embodiment, the amplification oligonucleotide may be the same as the labeled oligonucleotide.

[0446] As used in this document, the term “amplifying oligonucleotide” refers to any oligonucleotides that serve to amplify target nucleic acids.

[0447] In one embodiment, the amplification oligonucleotide may be a “primer” known in the art. As used in this document, the term “primer” refers to an oligonucleotide capable of acting as a starting point for synthesis when placed under conditions in which the synthesis of the primer extension product that is complementary to a target (template) nucleic acid strand is induced, i.e., in the presence of nucleotides and a polymerization agent, such as DNA polymerase, and at a suitable temperature and pH. The primer must be long Petition 870250073538, dated 08 / 20 / 2025, pp. 106 / 185 99 / 136 is sufficient to initiate the synthesis of extension products in the presence of the polymerization agent. The appropriate initiator length is determined by several factors, including temperature, application field, and initiator source.

[0448] The primer may include a forward primer (also refers to an upstream primer or an upstream oligonucleotide), a reverse primer (also refers to a downstream primer or a downstream oligonucleotide), or both. The amplification oligonucleotide may be an oligonucleotide with a structure known in the art or may be synthesized by a method known in the art.

[0449] The fact that the amplifying oligonucleotide and the labeled oligonucleotide are the same means that a single oligonucleotide acts simultaneously as an amplifying oligonucleotide that amplifies a target nucleic acid and as a labeled oligonucleotide that generates a signal in the presence of the target nucleic acid. In one example, the labeled oligonucleotide can be hybridized with the target nucleic acid and extended, thus generating a signal.

[0450] Note that the composition for detecting a target nucleic acid used in this disclosure does not necessarily provide a signal at any temperature in the presence of the target nucleic acid.

[0451] In one embodiment, even when the signal generation mechanisms of the target nucleic acid detection compositions are the same, the target nucleic acid detection compositions, including oligonucleotides of different sequences, can be considered different from each other. The different nucleic acid detection compositions have different detection temperatures from each other.

[0452] In one embodiment, the detection temperatures according to the present disclosure can be predetermined in light of the signal change temperature range of each of the n compositions for nucleic acid detection. Petition 870250073538, dated 08 / 20 / 2025, p. 107 / 185 100 / 136 target.

[0453] In one embodiment, the signal change temperature range of any of the n compositions for target nucleic acid detection can be determined based on the length and / or sequence of the duplex. In other words, by adjusting the Tm value of the duplex, the signal change temperature range can be predetermined.

[0454] In one embodiment, when the signal change is generated by a labeled oligonucleotide (e.g., a molecular signal) that hybridizes specifically with the target nucleic acid, signal detection can be successfully achieved at a predetermined detection temperature by adjusting the Tm value of the labeled oligonucleotide.

[0455] In one embodiment, when the signal is provided by a duplex generated in the presence of the target nucleic acid, signal detection is successfully achieved at a predetermined temperature by adjusting the Tm value of the duplex.

[0456] As described above, the detection temperature is determined in view of the signal change temperature range which varies depending on the duplex provided by the composition for detection of a target nucleic acid.

[0457] In one embodiment, the detection temperature of any of the n compositions for the detection of n target nucleic acids can be predetermined within a signal change temperature range that does not overlap with the signal change temperature ranges of the other compositions.

[0458] In one embodiment, the detection temperatures assigned to the compositions for detecting the target nucleic acids differ from each other by at least 2 °C, at least 3 °C, at least 4 °C, at least 5 °C, at least 7 °C, at least 8 °C, at least 9 °C, at least 10 °C, at least 11 °C, at least 12 °C, at least 15 °C, at least 20 °C or more.

[0459] In one embodiment, the n detection temperatures can be Petition 870250073538, dated 08 / 20 / 2025, pp. 108 / 185 101 / 136 selected within a temperature range of 45 °C to 97 °C, 45 °C to 96 °C, 45 °C to 95 °C, 45 °C to 94 °C, 45 °C to 93 °C, 45 °C to 92 °C, 45 °C to 91 °C, 45 °C to 90 °C, 46 °C to 97 °C, 46 °C to 96 °C, 46 °C to 95 °C, 46 °C to 94 °C, 46 °C to 93 °C, 46 °C to 92 °C, 46 °C to 91 °C, 46 °C to 90 °C, 47 °C to 97 °C, 47 °C to 96 °C, 47 °C to 95 °C, 47°C to 94°C, 47°C to 93°C, 47°C to 92°C, 47°C to 91°C, 47°C to 90°C, 48°C to 97°C, 48°C to 96°C, 48°C to 95°C, 48°C to 94°C, 48°C to 93°C °C, 48 °C to 92 °C, 48 °C to 91 °C, 48 °C to 90 °C, 49 °C to 97 °C, 49 °C to 96 °C, 49 °C to 95 °C, 49 °C to 94 °C, 49 °C to 93 °C, 49 °C to 92 °C, 49 °C to 91°C, 49°C to 90°C, 50°C to 97°C, 50°C to 96°C, 50°C to 95°C, 50°C to 94°C, 50°C to 93°C, 50°C to 92°C, 50°C to 91°C or 50°C to 90°C.

[0460] For example, the highest detection temperature (i.e., the nth detection temperature) among the n detection temperatures can be selected within a temperature range of 70 °C to 97 °C, 70 °C to 95 °C, 70 °C to 93 °C, 70 °C to 90 °C, 73 °C to 97 °C, 73 °C to 95 °C, 73 °C to 93 °C, 73 °C to 90 °C, 75 °C to 97 °C, 75 °C to 95 °C, 75 °C to 93 °C, 75 °C to 90 °C, 78 °C to 97 °C, 78 °C to 95 °C, 78 °C to 93 °C, 78 °C to 90 °C, 80 °C to 97 °C °C, 80 °C to 95 °C, 80 °C to 93 °C, 80 °C to 90 °C, 83 °C to 97 °C, 83 °C to 95 °C, 83 °C to 93 °C, 83 °C to 90 °C, 85 °C to 97 °C, 85 °C to 95 °C, 85 °C to 93°C or 85°C to 90°C.

[0461] For example, the lowest detection temperature (i.e., the first detection temperature) among the n detection temperatures can be selected within a temperature range of 45°C to 70°C, 45°C to 68°C, 45°C to 65°C, 45°C to 63°C, 45°C to 60°C, 45°C to 58°C, 45°C to 55°C, 48°C to 70°C, 48°C to 68°C, 48°C to 65°C, 48°C to 63°C, 48°C to 60°C, 48°C to 58°C, 48°C to 55°C, 50°C to 70°C °C, 50 °C to 68 °C, 50 °C to 65 °C, 50 °C to 63 °C, 50 °C to 60 °C, 50 °C to 58 °C or 50 °C to 55 °C.

[0462] For example, intermediate detection temperatures (by Petition 870250073538, dated 08 / 20 / 2025, p. 109 / 185 102 / 136 example, from a second detection temperature up to the (n-1)th detection temperature) among the n detection temperatures can be selected within a temperature range of 55 °C to 85 °C, 55 °C to 83 °C, 55 °C to 80 °C, 55 °C to 78 °C, 55 °C to 7.5 °C, 55 °C to 73 °C, 55 °C to 70 °C, 55 °C to 68 °C, 55 °C to 65 °C, 55 °C to 63 °C, 55 °C to 60 °C, 58 °C to 85 °C, 58 °C to 83 °C, 58 °C to 80 °C, 58 °C to 78 °C, 58 °C to 75 °C, 58 °C to 73 °C, 58 °C to 70 °C, 58 °C to 68 °C, 58 °C to 65 °C, 58 °C to 63 °C, 58 °C to 60 °C, 60 °C to 85 °C, 60 °C to 83 °C, 60 °C to 80 °C, 60 °C to 78 °C, 60°C to 75°C, 60°C to 73°C, 60°C to 70°C, 60°C to 68°C, 60°C to 65°C, 60°C to 63°C, 63°C to 85°C, 63°C to 83°C, 63°C to 80°C, 63°C to 78°C °C, 63 °C to 75 °C, 63 °C to 73 °C, 63 °C to 70 °C, 63 °C to 68 °C, 63 °C to 65 °C, 65 °C to 85 °C, 65 °C to 83 °C, 65 °C to 80 °C, 65 °C to 78 °C, 65 °C to 75 °C, 65 °C to 73°C, 65°C to 70°C, 65°C to 68°C, 68°C to 85°C, 68°C to 83°C, 68°C to 80°C, 68°C to 78°C,68°C to 75°C, 68°C to 73°C, 68°C to 70°C, 70°C to 85°C, 70°C to 83°C, 70°C to 80°C, 70°C to 78°C, 70°C to 75°C or 70°C to 73°C.

[0463] In one embodiment, each of the n target nucleic acids is assigned an detection temperatures, n compositions for detection of the n target nucleic acids appropriate for the n detection temperatures are prepared, and then step (a) can be performed.

[0464] In one embodiment, when n is 3, the first detection temperature can be selected within a temperature range of 50 °C to 60 °C, the second detection temperature can be selected within a temperature range of 65 °C to 75 °C, and the third detection temperature can be selected within a temperature range of 80 °C to 95 °C.

[0465] In step (a), signals are detected at the n detection temperatures during incubation.

[0466] In one embodiment, signal detection can be performed in each cycle or in selected cycles, or in a reaction termination cycle. Petition 870250073538, dated 08 / 20 / 2025, pp. 110 / 185 103 / 136

[0467] In one embodiment, signal detection can be performed in at least one cycle. For example, signals can be detected at n detection temperatures in a selected cycle or at n detection temperatures in each of two selected cycles. For example, when n is 3 and signals are detected in cycle 1 and cycle 30, the signals (i.e., a first signal, a second signal, and a third signal) are detected at a first detection temperature, a second detection temperature, and a third detection temperature in cycle 1, and the signals are detected at a first detection temperature, a second detection temperature, and a third detection temperature in cycle 30.

[0468] In one embodiment, the detection of the signals can be carried out in at least two cycles.

[0469] In one embodiment, the change in signal can be measured using signals detected in at least two cycles. For example, nucleic acid amplification can be performed in 30, 40, 45, or 50 cycles of PCR, and in each cycle, signals can be measured at n detection temperatures. Then, the values ​​of the signals detected at each detection temperature in a plurality of cycles can be represented as an amplification curve (a collection of cycle data points and RFUs in cycles) at each detection temperature. As a specific example, when n is 3, an amplification curve at the first detection temperature, an amplification curve at the second detection temperature, and an amplification curve at the third detection temperature can be obtained, and then the change in signal can be obtained from each of the amplification curves.

[0470] The term “amplification curve”, as used in this document, refers to a curve resulting from a signal generation reaction, in particular an amplification reaction of a target nucleic acid. The amplification curve includes a curve resulting from a reaction in the presence of the target nucleic acid in the sample or Petition 870250073538, dated 08 / 20 / 2025, page 111 / 185 104 / 136 a curve or line resulting from a reaction in the absence of the target nucleic acid in the sample.

[0471] In one embodiment, a change in signal and / or a constant signal can be measured from an amplification indicator of a target nucleic acid.

[0472] As used in this document, the term “amplification indicator” refers to any indicator that is closely related to the occurrence of amplification of a target nucleic acid and that can be obtained from the signal provided in step (a). The amplification indicator may refer to a value that is generated depending on the amplification of a target nucleic acid. The amplification indicator may be an indicator with higher values ​​as the target nucleic acid is amplified (i.e., as the amount of the target nucleic acid increases), or it may be an indicator with lower values ​​as the target nucleic acid is amplified. The amplification indicator may be any indicator, provided it indicates amplification of the target nucleic acid.

[0473] In one embodiment, the amplification indicator may include an indicator obtained from an amplification curve or a fusion curve. In particular, the amplification indicator may include a signal value (e.g., RFU) in a specific cycle, a signal value in each cycle, a difference in signal values ​​between specific cycles, or a difference between a reference signal value and a signal value in a specific cycle on an amplification curve, or the height, width, or area of ​​the maximum fusion peak in a fusion curve. In one embodiment, examples of the amplification indicator include, without limitation, the Ct value (cycle threshold), ΔRFU (e.g., difference in RFUs in two cycles, difference between a reference RFU and an RFU in a specific cycle, etc.), RFU ratio (e.g., ratio of RFUs in two cycles or ratio of RFUs between a reference RFU and an RFU in a specific cycle, etc.).) and height / area / width of the maximum melting peak in a melting curve. Petition 870250073538, dated 08 / 20 / 2025, p. 112 / 185 105 / 136

[0474] In one embodiment, the amplification indicator is the Ct value or the Cq value. The concept of the Ct value and the Cq value is well known in the art.

[0475] In one embodiment, the amplification indicator is the ΔRFU or RFU ratio between the RFU values ​​obtained in an amplification reaction. For example, the amplification indicator is the difference (subtraction) or ratio between RFUs in two cycles, or the difference (subtraction) or ratio between an RFU in a specific cycle and a reference RFU.

[0476] The method according to the present disclosure exploits the fact that the composition for detection of a target nucleic acid provides a signal change depending on the presence of the target nucleic acid, only at a corresponding detection temperature. In one embodiment, the method according to the present disclosure can measure a signal change using signal values ​​detected at detection temperatures in at least two cycles. In another embodiment, the method according to the present disclosure can measure a signal change using a signal value detected at a detection temperature in one cycle (i.e., a signal value detected in step (a)) and a reference signal value.

[0477] In one embodiment, when signals are detected in a plurality of cycles in step (a), the first cycle and the final cycle in which signals are detected can be selected to be separated from each other by at least 1 cycle to at least 20 cycles. In particular, the first cycle and the final cycle in which signals are detected can be selected to be separated from each other by 1 cycle, 2 cycles, 3 cycles, 4 cycles, 5 cycles, 6 cycles, 7 cycles, 8 cycles, 9 cycles, 10 cycles, 11 cycles, 12 cycles, 13 cycles, 14 cycles, 15 cycles, 16 cycles, 17 cycles, 18 cycles, 19 cycles, 20 cycles or more and, more specifically, by 5 cycles, 10 cycles, 15 cycles, 20 cycles, 30 cycles or more.

[0478] In one embodiment, signal detection can be performed in any of the intermediate cycles, including an exponential phase region, or Petition 870250073538, dated 08 / 20 / 2025, pp. 113 / 185 106 / 136 in any of the late cycles, including a plateau region. For example, signals can be detected in two cycles, one cycle being any of the early cycles, including a baseline region, and the other cycle being any of the intermediate or late cycles, or one cycle being any of the intermediate cycles and the other cycle being any of the intermediate or late cycles.

[0479] In one embodiment, the initial cycles include cycles from cycle 1 to any cycle close to the value obtained by dividing the final cycle by 3. For example, when the final cycle is 45, 45 divided by 3 equals 15, and therefore the initial cycles can be determined as being from cycle 1 to cycle 20, from cycle 1 to cycle 15, from cycle 1 to cycle 10, or from cycle 1 to cycle 5. The intermediate cycles can be cycles close to a value obtained by dividing the final cycle by 2. For example, when the final cycle is cycle 45, 45 divided by 2 equals 22.5, and therefore the intermediate cycles can be from cycle 16 to cycle 30, from cycle 18 to cycle 30, from cycle 20 to cycle 30, from cycle 16 to cycle 27, from cycle 18 to cycle 27, from cycle 20 to cycle 27, from cycle Cycles 16 to 25, cycle 18 to 25, or cycle 20 to 25. Late cycles may be the final cycle or cycles close to the final cycle of an amplification reaction.For example, when the final cycle is cycle 45, the late cycles can be from cycle 31 to cycle 45, from cycle 35 to cycle 45, from cycle 38 to cycle 45, from cycle 40 to cycle 45, or from cycle 43 to cycle 45. The initial, intermediate, and late cycles can vary depending on the final cycle of the amplification reaction.

[0480] In one embodiment, the signal change can be measured using a signal value detected in at least one cycle and a “reference signal value”. The reference signal value may refer to a value that can be used to confirm a signal change dependent on the presence of the target nucleic acid by means of a separate reaction.

[0481] In one embodiment, the value of the reference signal can be obtained from a reaction in the absence of a corresponding target nucleic acid in a Petition 870250073538, dated 08 / 20 / 2025, pp. 114 / 185 107 / 136 corresponding detection temperature. For example, the reference signal value may be a “signal value at a detection temperature” in the absence of the target nucleic acid.

[0482] In one embodiment, there are n reference signal values ​​for n detection temperatures.

[0483] In one embodiment, the “signal value at a detection temperature (e.g., a / th detection temperature)” detected in the absence of the target nucleic acid (e.g., a / th target nucleic acid) can be obtained by means of a separate negative control reaction.

[0484] In one embodiment, the reference signal value can be obtained by performing a negative control reaction at the same time as, or separately from, the method according to this disclosure.

[0485] In one embodiment, the reference signal value can be obtained by means of a negative control reaction. According to certain embodiments, the reference signal value at the nth detection temperature can be obtained by mixing a free sample of the nth target nucleic acid (e.g., distilled water) with n compositions to detect n target nucleic acids and detecting the signals at the nth detection temperature while amplifying the target nucleic acids. In this document, signal detection can be performed in any cycle. Specifically, a signal value detected in any of the initial or final cycles of the negative control reaction can be used as the reference signal value. More specifically, a signal value detected in the same cycle as the cycle in which the signal is detected in step (a) can be used as the reference signal value.

[0486] In one embodiment, the reference signal value can be obtained by means of a positive control reaction. According to certain embodiments, the reference signal value can be obtained by mixing a sample containing one / th Petition 870250073538, dated 08 / 20 / 2025, pp. 115 / 185 108 / 136 target nucleic acid with the composition to detect a / th target nucleic acid (in particular, n compositions to detect n target nucleic acids) and detect a signal at a / th detection temperature while amplifying the / th target nucleic acids.

[0487] When the reference signal value is obtained via the positive control reaction, the cycle in which a signal value is detected may be in a baseline region of the reaction. The baseline region refers to a region in which a signal (e.g., a fluorescent signal) remains substantially constant during the initial cycles of an amplification reaction (e.g., PCR). In this region, since the level of amplification products is not sufficient to be detectable, most fluorescent signals in this region are attributed to the fluorescent signal inherent in the reaction sample and the background signal, including fluorescent signals from the measurement system itself. In other words, a signal value detected in a cycle in the baseline region of the positive control reaction is substantially identical to the reference signal value obtained from a reaction in the absence of the target nucleic acid (e.g., the negative control reaction).

[0488] In one embodiment, a signal change can be measured by a difference between the reference signal value and the signal value detected in step (a).

[0489] In one embodiment, the reference signal value may be a predetermined threshold value from a negative control reaction, taking into account the background signal and the sensitivity of the detector or the characteristics of the markers used. Using the threshold value, the significance of a signal change can be determined. The threshold value can be determined by any threshold setting method known in the art. For example, the threshold value can be determined considering the background signal, the sensitivity, the marker characteristics, the signal variation of a detector, the margin of error, and the like. Petition 870250073538, dated 08 / 20 / 2025, pp. 116 / 185 109 / 136

[0490] In one embodiment, when the value of the signal detected in step (a) is equal to or greater than the threshold value as the reference signal value, it can be determined that the signal has changed.

[0491] In one embodiment, signal detection, at each of the n detection temperatures, can be performed using a single type of detector.

[0492] In one embodiment, the single detector type is a detector. In one embodiment, the marker signals in each of the labeled oligonucleotides included in the n compositions for detection of target nucleic acids are not differentiated from each other by a single detector type with respect to each target nucleic acid.

[0493] As used in this document, a single type of fluorescent marker refers to a fluorescent marker that has identical or substantially identical signal characteristics (e.g., optical characteristics, emission wavelength, and electrical signals). For example, FAM and CAL Fluor 610 provide different signal types.

[0494] As used in this document, a single type of fluorescent marker means that the fluorescent marker signals are not differentiated from each other using a detection channel. This single type of fluorescent marker is not based on the chemical structure of the fluorescent marker, and even when two fluorescent markers with different chemical structures are not differentiated using a detection channel, they are considered as a single type.

[0495] According to the present disclosure, the signals generated from the n compositions for detection of target nucleic acids that include a common type of fluorescent marker are not differentiated by a detection channel.

[0496] The term “detection channel”, as used in this document, refers to a means of detecting a signal from a single type of fluorescent marker. The thermocyclers used in the technique, for example, ABI 7500 (Applied Biosystems), Petition 870250073538, dated 08 / 20 / 2025, pp. 117 / 185 110 / 136 QuantStudio (Applied Biosystems), CFX96 (Bio-Rad Laboratories), Cobas z 480 (Roche), LightCycler (Roche), etc., include various channels (e.g., optical diodes) to detect the signals of some different types of fluorescent markers, and these channels correspond to the detection channel as used in this document.

[0497] The detection channel, as used in this document, includes a means of signal detection. For example, the detection channel could be an optical diode capable of detecting a fluorescent signal at a given wavelength.

[0498] In one embodiment, the signals detected at the n detection temperatures are not differentiated from each other by the single type of detector. Step (b): Determination of the Presence of the Target Nucleic Acid

[0499] After the signals are detected, the presence of n target nucleic acids is determined from the signals detected in step (a).

[0500] In one embodiment, the presence of the / th target nucleic acid is determined by the signal change detected at the / th detection temperature. For example, a signal change is measured from the signals detected at the / th detection temperature, to determine the presence of the / th target nucleic acid.

[0501] In one embodiment, when a change in the signal is detected at the / th detection temperature, it can be determined that the / th target nucleic acid is present.

[0502] In one embodiment, when no change in the signal is detected at the / th detection temperature, i.e., the signal is constant at the / th detection temperature, it can be determined that the / th target nucleic acid is absent.

[0503] In one embodiment, the change in signal can be measured using signals detected in at least two cycles or a signal value detected in at least one cycle and a reference signal value.

[0504] Determining the presence of the target nucleic acid from the signals Petition 870250073538, dated 08 / 20 / 2025, pp. 118 / 185 111 / 136 detected at each detection temperature can be performed by the process described in step (a) to measure a signal change, for example, a method that uses an amplification indicator or any other method known in the art.

[0505] In certain embodiments, when né 3 and signal detection is performed in cycle 10, cycle 20 and cycle 30, the presence of the first target nucleic acid can be determined from signals detected at a first detection temperature (a first signal in cycle 10, a first signal in cycle 20 and a first signal in cycle 30), the presence of the second target nucleic acid can be determined from signals detected at a second detection temperature (a second signal in cycle 10, a second signal in cycle 20 and a second signal in cycle 30) and the presence of the third target nucleic acid can be determined from signals detected at a third detection temperature (a third signal in cycle 10, a third signal in cycle 20 and a third signal in cycle 30).

[0506] In certain embodiments, when né 4 and signal detection is performed in cycle 30, the presence of the first target nucleic acid is determined from a signal detected at a first detection temperature (i.e., a first signal in cycle 30) and a reference signal value, the presence of the second target nucleic acid is determined from a signal detected at a second detection temperature (i.e., a second signal in cycle 30) and a reference signal value, and the presence of the third target nucleic acid is determined from a signal detected at a third detection temperature (i.e., a third signal in cycle 30) and a reference signal value.

[0507] In one embodiment, the value of the reference signal can be obtained by means of a separate negative control reaction or a separate positive control reaction.

[0508] In one embodiment, the method according to the present disclosure can be carried out together with a negative control reaction. A signal value Petition 870250073538, dated 08 / 20 / 2025, pp. 119 / 185 112 / 136 detected in the negative control reaction can be used as a reference signal value. For example, a signal detected at a / th detection temperature in a cycle (e.g., the final cycle) of a reaction comprising composition to detect a / th target nucleic acid can be compared with a signal detected at the same detection temperature (i.e., the / th detection temperature) in the same cycle (e.g., the final cycle) of the negative control reaction to determine whether the signal has changed or not.

[0509] In certain embodiments, when n is 3 and a signal is detected at cycle 30, the presence of the first target nucleic acid can be determined from a signal detected at the first detection temperature (i.e., a first signal at cycle 30) and a first reference signal value (e.g., a signal detected at the first detection temperature at cycle 30 of a negative control reaction), the presence of the second target nucleic acid can be determined from a signal detected at the second detection temperature (i.e., a second signal at cycle 30) and a second reference signal value (e.g., a signal detected at the second detection temperature at cycle 30 of a negative control reaction), and the presence of the third target nucleic acid can be determined from a signal detected at the third detection temperature (i.e., a third signal at cycle 30) and a third reference signal value (e.g.,a signal detected at the third detection temperature in cycle 30 of a negative control reaction.

[0510] In one embodiment, the method according to the present disclosure can be carried out together with a positive control reaction. A signal value detected in the positive control reaction can be used as a reference signal value. For example, a first signal detected at a / th detection temperature in a cycle, for example, cycle 30, can be compared with a signal detected at the / th detection temperature in a cycle, for example, cycle 1 before cycle 30 of a positive control reaction to determine if the signal has changed. Petition 870250073538, dated 08 / 20 / 2025, pp. 120 / 185 113 / 136

[0511] In one embodiment, when signal detection is performed in a cycle in step (a) and a signal change is measured using a reference signal value obtained by means of a positive control reaction, signal detection in the positive control reaction to obtain the reference signal value may be performed in a cycle at least 30 cycles, at least 20 cycles, at least 10 cycles, or at least 5 cycles before the cycle in which signal detection is performed in step (a).

[0512] In certain embodiments, when n is 3 and signal detection is performed in cycle 30, the presence of the first target nucleic acid can be determined from a signal detected at the first detection temperature (i.e., a first signal in cycle 30) and a first reference signal value (e.g., a signal detected at the first detection temperature in cycle 1 of a positive control reaction for the first target nucleic acid), the presence of the second target nucleic acid can be determined from a signal detected at the second detection temperature (i.e., a second signal in cycle 30) and a second reference signal value (e.g., a signal detected at the second detection temperature in cycle 1 of a positive control reaction for the second target nucleic acid), and the presence of the third target nucleic acid can be determined from a signal detected at the third detection temperature (i.e.,a third signal in cycle 30) and a third reference signal value (e.g., a signal detected at the third detection temperature in cycle 1 of a positive control reaction for the third target nucleic acid). IV. Target Nucleic Acid Detection Method Using LPHO

[0513] In a fourth aspect of the present disclosure, a method is provided for detecting a target nucleic acid in a sample using a Labeled Portion Hybridization Oligonucleotide (LPHO), (a) providing a fragment produced by an enzymatic cleavage reaction Petition 870250073538, dated 08 / 20 / 2025, pp. 121 / 185 114 / 136 of an oligonucleotide, depending on the presence of the target nucleic acid in the sample; (b) hybridize the fragment with a Capture and Modeling Oligonucleotide (CTO); wherein the CTO comprises, in a 3' to 5' direction: (i) a capture portion comprising a nucleotide sequence that hybridizes with the fragment and (ii) a template portion comprising a nucleotide sequence that does not hybridize with the fragment, wherein the CTO has a reporter molecule and a suppressor molecule that define a labeled portion, wherein the fragment is hybridized with the capture portion of the CTO; (c) perform an extension reaction using the resultant of step (b) and DNA polymerase with 5' nuclease activity in the presence of a Labeled Portion Hybridization Oligonucleotide (LPHO); wherein the LPHO comprises a hybridization nucleotide sequence with the labeled portion of the CTO, wherein, when the target nucleic acid is present in the sample, the fragment hybridized with the capture portion of the CTO is extended to generate an extended strand complementary to the CTO, thus generating an extended duplex between the extended strand and the CTO, wherein the generation of the extended duplex prevents the formation of a CTO / LPHO hybrid between the labeled portion of the CTO and the LPHO, wherein, when the target nucleic acid is not present in the sample, the extended strand is not generated and instead the CTO / LPHO hybrid is formed, in which the extended duplex has a melting temperature (Tm) different from the Tm of the CTO / LPHO hybrid; and (d) detect the presence of the extended duplex; where the extended duplex is detected by measuring a signal provided by the extended duplex, Petition 870250073538, dated 08 / 20 / 2025, pp. 122 / 185 115 / 136 where the measurement is performed at a temperature in which the signal intensity of the extended duplex differs from the signal intensity of the CTO / LPHO hybrid, and where the presence of the extended duplex indicates the presence of the target nucleic acid.

[0514] As the fourth aspect of this disclosure relates to a method for detecting extended duplexes using LPHO described in the first and second aspects of this disclosure, descriptions common to them are omitted to avoid undue redundancy that would lead to complexity in this descriptive report.

[0515] First, in step (a), a fragment produced by enzymatic cleavage of an oligonucleotide is provided, depending on the presence of the target nucleic acid in the sample.

[0516] The fragment may include any fragment produced by the enzymatic cleavage of an oligonucleotide, depending on the presence of the target nucleic acid, such as a PTO fragment, as described above.

[0517] The fragment provided in step (a) can be obtained by any of the various oligonucleotide cleavage reactions known in the art.

[0518] For example, as disclosed in Patent No. 7,482,121, two oligonucleotides are hybridized with the same strand of the target nucleic acid in a non-overlapping manner to form a cleavage structure. The cleavage structure is then cleaved using an enzyme, such as the thermostable nuclease FEN-1, to provide a fragment. The cleavage structure includes a double-stranded hybrid comprising a pseudo-Y structure, a gap, or a cut. As another example, the fragment can be provided by a cleavage reaction of the mediating oligonucleotide, as described above. For example, the Invader assay (U.S. Patent No. 5,691,142) provides a fragment by cleavage of the mediating oligonucleotide. As another example, a primer comprising a restriction enzyme recognition sequence is hybridized with an acid Petition 870250073538, dated 08 / 20 / 2025, pp. 123 / 185 116 / 136 target nucleic acid to generate an amplification product including the restriction enzyme recognition sequence, and the restriction enzyme recognition sequence in the amplification product is then cleaved to provide a fragment.

[0519] As described above, endonuclease or exonuclease can be used to cleave oligonucleotides. Examples of endonucleases include restriction enzymes, RNA endonucleases, and DNA endonucleases; and examples of exonucleases include, but are not limited to, 5'-exonuclease and 3'-exonuclease.

[0520] In one embodiment, the oligonucleotide cleaved by the enzymatic cleavage reaction may be the target nucleic acid itself.

[0521] Steps (b) to (d) of the fourth aspect of this disclosure can be described in detail by referring to steps (c) to (e) of the first aspect of this disclosure, respectively.

[0522] The present invention will now be described in more detail by means of embodiments. The following embodiments are provided to describe the present invention in more detail, and it will be evident to a person skilled in the art in the technical field to which the present invention pertains that the scope of the present invention, as suggested in the appended claims, is not limited by the following embodiments. Invention Modality EXAMPLES Example 1: Detection of a single target nucleic acid

[0523] In this example, it was investigated whether the L-PTOCE assay can be used to detect a target nucleic acid in real time.

[0524] For this purpose, two types of CTOs with the same sequence were prepared, with the reporter molecule and the suppressor molecule labeled at different positions, and four types of LPHOs of different lengths for the two types of CTOs. Subsequently, four combinations of the two types of CTOs and four types of Petition 870250073538, dated 08 / 20 / 2025, pp. 124 / 185 117 / 136 LPHOs were tested for detection of the target nucleic acid. 1-1 Preparation of target nucleic acid and oligonucleotides

[0525] As a target nucleic acid, genomic DNA from Mycoplasma genitalium (MG) (accession number: ATCC 33530) was used. For detection of MG target nucleic acids, a forward primer (i.e., upstream primer), a reverse primer (i.e., downstream primer), and a PTO were prepared, as shown in Table 3. Table 3 SE Q ID NO. Oligo Type Tm (°C) Sequence (5'-3') 1 Initiator r Direct MG 62 TGATATCCATCCTAAGACTAATCGTII11IAGTTGAAAC 2 Initiator r Reverse MG 62 CCAATTACCI II CCTCCATCGIIIIIGCTGAGAAA 3 MG- PTO 74 CTTCGATCGCGTCACGGTGTTGGTGTGCATCAGTTGTTA ATGJEspacer C3]

[0526] The underlined character indicates the 5' marking portion of the PTO.

[0527] Subsequently, two types of CTOs and four types of LPHOs were prepared, as shown in Table 4. Table 4 SEQ ID NO. Oligo Type Tm (°C) Sequence (5'-3') 4 CTO-1 78 [BHQ-1 ]GGCTCGCATAGATTCATGGC[T(CAL Fluor Orange 560)]GGGTGACGCGATCGAAG[Spacer C3] 5 LPHO1A 72 GTCACCCAGCCATGAATCTATGCGAGCC [Spacer C3] 6 LPHO1B 72 CTTIGATCGCGTIACCCAGCCATGAATCTATGCGAGCC [Spacer C3] 7 CTO-2 78 GGCTCGCATAGATTCATGGGC[T(CAL Fluor Orange 560)]GGGTGACGCGATCGAAG[BHQ-1 ] 8 LPHO2A 72 CTTCGATCGCGTCACCCAGCCATGAATC [Spacer C3] 9 LPHO- 72 CTTCGATCGCGTCACCCAGCCATGAITCTATGIGAGCC Petition 870250073538, dated 08 / 20 / 2025, pp. 125 / 185 118 / 136 2B [C3 Spacer]

[0528] As shown in Table 4, the first CTO (hereinafter referred to as CTO-1) has a suppressor molecule (BHQ-1) attached to the 5' end of the targeting portion and a reporter molecule (CAL Fluor Orange 560) attached to the 3' end of the targeting portion; the second CTO (hereinafter referred to as CTO-2) has a suppressor molecule (BHQ-1) attached to the 3' end of the capture portion and a reporter molecule (CAL Fluor Orange 560) attached to the shaping portion.

[0529] In addition, two types of LPHOs (hereinafter referred to as LPHO-1A and LPHO-1B) of different lengths comprising a hybridization nucleotide sequence with the labeled portion of CTO-1 were prepared, and two types of LPHOs (hereinafter referred to as LPHO-2A and LPHO-2B) of different lengths comprising a hybridization nucleotide sequence with the labeled portion of CTO-2 were prepared. LPHO-1A and LPHO-2A are shorter than LPHO-1B and LPHO-2B, respectively.

[0530] The 3' ends of PTO, CTO and LPHO were blocked by the C3 spacer to prohibit their extension by DNA polymerase. 1-2 Real-time PCR

[0531] Real-time PCR was performed for four combinations of one of the two types of CTOs and one of the four types of LPHOs as follows.

[0532] Combination 1: CTO-1 and LPHO-1A

[0533] Combination 2: CTO-1 and LPHO-1B

[0534] Combination 3: CTO-2 and LPHO-2A

[0535] Combination 4: CTO-2 and LPHO-2B<Combinação 1>

[0536] The target nucleic acid (Tube 1: 1 pg of MG genomic DNA) and distilled water (Tube 2, negative control) were mixed with: 5 pmol of MG Direct Primer (SEQ ID NO: 1), 5 pmol of MG Reverse Primer (SEQ ID NO: 2), 3 pmol of MGPTO (SEQ ID NO: 3), 1 pmol of CTO-1 (SEQ ID NO: 4) and 3 pmol of LPHO-1A (SEQ Petition 870250073538, dated 08 / 20 / 2025, pp. 126 / 185 119 / 136 ID NO: 5) and then combined with 5 μL of Mixed Enzyme 4X (20 U Taq DNA polymerase) (Nanohelix, Korea) and 5 μL of Mixed Buffer 4X (final, 0.8 mM dNTPs, 50 mM KCl, 3.5 mM MgCl2) (Nanohelix, Korea) to prepare a reaction mixture in a final volume of 20 μL.

[0537] Tube 1 and Tube 2 containing the reaction mixture were placed in a real-time thermocycler (CFX96 Real-time Cycler, Bio-Rad) and subjected to real-time PCR, which consists of denaturation at 95 °C for 15 minutes and then 50 cycles of 10 seconds at 95 °C, 15 seconds at 60 °C, 10 seconds at 72 °C and 5 seconds at 75 °C.

[0538] Signal detection was performed at three temperatures in each cycle as follows: (i) 60 °C, where both the extended duplex and the hybrid CTO / LPHO remain in their double-strip state (i.e., the temperature within the first constant signal temperature range); (ii) 75 °C, where the extended duplex remains in its double-strand state and the CTO / LPHO hybrid dissociates into a single-strand state (i.e., the temperature within the signal-change temperature range); and (iii) 95 °C, where both the extended duplex and the CTO / LPHO hybrid dissociate into a single-strand state (i.e., the temperature within the second constant-signal temperature range).

[0539] The real-time PCR results were shown in Figure 6.

[0540] For the amplification curve at 60 °C within the first constant signal temperature range and the amplification curve at 95 °C within the second constant signal temperature range, the signal remained constant without any change, although the target nucleic acid was amplified. On the other hand, for the amplification curve at 75 °C within the signal change temperature range, the signal changed when the target nucleic acid was amplified. Petition 870250073538, dated 08 / 20 / 2025, pp. 127 / 185 120 / 136

[0541] Meanwhile, the negative control provided a constant signal at 60 °C, 75 °C and 95 °C. That is, no signal change was detected.

[0542] As described above, the L-PTOCE assay according to this disclosure has been found to measure a signal (i.e., a change in signal) indicating the presence of the target nucleic acid using a reference signal value obtained from a negative control reaction. The signal was considered to have changed if the signal values ​​at 60 °C, 75 °C, and 95 °C were greater than RFU 100, a threshold based on the signal value of the negative control reaction (i.e., RFU: 0). As a result, as shown in Table 5, a change in signal was identified from a Ct value of 28.58 only at 75 °C, and no change in signal was identified at 60 °C and 95 °C. Table 5 Tube Ct (Cycle Limit) 60 °C 75 °C 95 °C 1 N / A 28.58 N / A 2 N / AN / AN / A Tube 1: 1 pg of genomic DNA from MG; Tube 2: Negative control; N / A: Not applicable<Combinação 2>

[0543] The target nucleic acid (Tube 1: 50 pg of MG genomic DNA) and distilled water (Tube 2, negative control) were mixed with: 5 pmol of MG Direct Primer (SEQ ID NO: 1), 5 pmol of MG Reverse Primer (SEQ ID NO: 2), 3 pmol of MGPTO (SEQ ID NO: 3), 1 pmol of CTO-1 (SEQ ID NO: 4), and 3 pmol of LPHO-1B (SEQ ID NO: 6), and then combined with 5 μL of Mixed Enzyme 4X (20 U of Taq DNA polymerase) (Nanohelix, Korea) and 5 μL of Mixed Buffer 4X (final, 0.8 mM dNTPs, 50 mM KCl, 3.5 mM MgCl2) (Nanohelix, Korea), to prepare a reaction mixture with a final volume of 20 μE

[0544] Tube 1 and Tube 2 containing the reaction mixture were placed in a real-time thermocycler (CFX96 Real-time Cycler, Bio-Rad) and subjected to Petition 870250073538, dated 08 / 20 / 2025, pp. 128 / 185 121 / 136 Real-time PCR, which consists of denaturation at 95 °C for 15 minutes, followed by 50 cycles of 10 seconds at 95 °C, 15 seconds at 60 °C, 10 seconds at 72 °C, and 5 seconds at 75 °C.

[0545] Signal detection was performed at three temperatures in each cycle, as follows: (i) 60 °C at which both the extended duplex and the hybrid CTO / LPHO remain in their double-strip state (i.e., the temperature within the first constant signal temperature range); (ii) 75 °C, at which the extended duplex remains in its double-strand state and the CTO / LPHO hybrid dissociates into a single-strand state (i.e., the temperature within the signal-change temperature range); and (iii) 95 °C at which both the extended duplex and the CTO / LPHO hybrid dissociate into a single-strand state (i.e., the temperature within the second constant-signal temperature range).

[0546] The real-time PCR results were shown in Figure 7.

[0547] For the amplification curve at 60 °C within the first constant signal temperature range and the amplification curve at 95 °C within the second constant signal temperature range, the signal remained constant without any change, although the target nucleic acid was amplified. On the other hand, for the amplification curve at 75 °C within the signal change temperature range, the signal changed when the target nucleic acid was amplified.

[0548] Meanwhile, the negative control provided a constant signal at 60 °C, 75 °C and 95 °C. That is, no signal change was detected.

[0549] As described above, the L-PTOCE assay according to this disclosure has been found to measure a signal (i.e., a change in signal) indicating the presence of the target nucleic acid using a reference signal value obtained from a negative control reaction. The signal was considered to have changed if the Petition 870250073538, dated 08 / 20 / 2025, pp. 129 / 185 122 / 136 signal values ​​at 60 °C, 75 °C, and 95 °C were greater than RFU 100, a limit based on the signal value of the negative control reaction (i.e., RFU: 0). As a result, as shown in Table 6, a change in signal was identified from a Ct value of 28.58 only at 75 °C, and no change in signal was identified at 60 °C and 95 °C. Table 6 Tube Ct (Cycle Limit) 60 °C 75 °C 95 °C 1 N / A 23.33 N / A 2 N / AN / AN / A Tube 1: 50 pg of genomic DNA from MG; Tube 2: Negative control; N / A: Not applicable<Combinação 3>

[0550] The target nucleic acid (Tube 1: 5 pg of MG genomic DNA) and distilled water (Tube 2, negative control) were mixed with: 5 pmol of MG Direct Primer (SEQ ID NO: 1), 5 pmol of MG Reverse Primer (SEQ ID NO: 2), 3 pmol of MGPTO (SEQ ID NO: 3), 1 pmol of CTO-2 (SEQ ID NO: 7), and 3 pmol of LPHO-2A (SEQ ID NO: 8), and then combined with 5 μL of Mixed Enzyme 4X (20 U of Taq DNA polymerase) (Nanohelix, Korea) and 5 μL of Mixed Buffer 4X (final, 0.8 mM dNTPs, 50 mM KCl, 3.5 mM MgCl2) (Nanohelix, Korea), to prepare a reaction mixture with a final volume of 20 μE

[0551] Tube 1 and Tube 2 containing the reaction mixture were placed in a real-time thermocycler (CFX96 Real-time Cycler, Bio-Rad) and subjected to real-time PCR, which consists of denaturation at 95 °C for 15 minutes and then 50 cycles of 10 seconds at 95 °C, 15 seconds at 60 °C, 10 seconds at 72 °C and 5 seconds at 75 °C.

[0552] Signal detection was performed at three temperatures in each cycle, as follows: (i) 60 °C, in which both the extended duplex and the hybrid CTO / LPHO Petition 870250073538, dated 08 / 20 / 2025, pp. 130 / 185 123 / 136 remain in their double-tape state (i.e., the temperature within the first constant signal temperature range); (ii) 75 °C, where the extended duplex remains in its double-strand state and the CTO / LPHO hybrid dissociates into a single-strand state (i.e., the temperature within the signal-change temperature range); and (iii) 95 °C, where both the extended duplex and the CTO / LPHO hybrid dissociate into a single-strand state (i.e., the temperature within the second constant-signal temperature range).

[0553] The real-time PCR results were shown in Figure 8.

[0554] For the amplification curve at 60 °C within the first constant signal temperature range and the amplification curve at 95 °C within the second constant signal temperature range, the signal remained constant, without any change, although the target nucleic acid was amplified. On the other hand, for the amplification curve at 75 °C within the signal change temperature range, the signal changed as the target nucleic acid was amplified.

[0555] Meanwhile, the negative control provided a constant signal at 60 °C, 75 °C and 95 °C. That is, no signal change was detected.

[0556] As described above, the L-PTOCE assay according to this disclosure has been found to measure a signal (i.e., a change in signal) indicating the presence of the target nucleic acid using a reference signal value obtained from a negative control reaction. The signal was considered to have changed if the signal values ​​at 60 °C, 75 °C, and 95 °C were greater than RFU 100, a threshold based on the signal value of the negative control reaction (i.e., RFU: 0). As a result, as shown in Table 7, a change in signal was identified from a Ct value of 28.58 only at 75 °C, and no change in signal was measured at 60 °C and 95 °C. Table 7 Ct tube (Cycle limit) Petition 870250073538, dated 08 / 20 / 2025, pp. 131 / 185 124 / 136 60 °C 75 °C 95 °C 1 N / A 27.25 N / A 2 N / AN / AN / A Tube 1: 5 pg of genomic DNA from MG; Tube 2: Negative control; N / A: Not applicable<Combinação 4>

[0557] The target nucleic acid (Tube 1: 5 pg of MG genomic DNA) and distilled water (Tube 2, negative control) were mixed with: 5 pmol of MG Direct Primer (SEQ ID NO: 1), 5 pmol of MG Reverse Primer (SEQ ID NO: 2), 3 pmol of MGPTO (SEQ ID NO: 3), 1 pmol of CTO-2 (SEQ ID NO: 7), and 3 pmol of LPHO-2B (SEQ ID NO: 9), and then combined with 5 μL of 4X Mixed Enzyme (20 U of Taq DNA polymerase) (Nanohelix, Korea) and 5 μL of 4X Mixed Buffer (final, 0.8 mM dNTPs, 50 mM KCl, 3.5 mM MgCl2) (Nanohelix, Korea), to prepare a reaction mixture with a final volume of 20 μE

[0558] Tube 1 and Tube 2 containing the reaction mixture were placed in a real-time thermocycler (CFX96 Real-time Cycler, Bio-Rad) and subjected to real-time PCR, which consists of denaturation at 95 °C for 15 minutes and then 50 cycles of 10 seconds at 95 °C, 15 seconds at 60 °C, 10 seconds at 72 °C and 5 seconds at 75 °C.

[0559] Signal detection was performed at three temperatures in each cycle, as follows: (i) 60 °C, where both the extended duplex and the hybrid CTO / LPHO remain in their double-strip state (i.e., the temperature within the first constant signal temperature range); (ii) 75 °C, where the extended duplex remains in its double-strand state and the CTO / LPHO hybrid dissociates into a single-strand state (i.e., the temperature within the signal-change temperature range); and (iii) 95 °C, where both the extended duplex and the CTO / LPHO hybrid dissociate into a single-strand state (i.e., the temperature within the second Petition 870250073538, dated 08 / 20 / 2025, pp. 132 / 185 125 / 136 constant signal temperature range).

[0560] The real-time PCR results were shown in Figure 9.

[0561] For the amplification curve at 60 °C within the first constant signal temperature range and the amplification curve at 95 °C within the second constant signal temperature range, the signal remained constant without any change, although the target nucleic acid was amplified. On the other hand, for the amplification curve at 75 °C within the signal change temperature range, the signal changed as the target nucleic acid was amplified.

[0562] Meanwhile, the negative control provided a constant signal at 60 °C, 75 °C and 95 °C. That is, no signal change was detected.

[0563] As described above, the L-PTOCE assay according to this disclosure was found to measure a signal (i.e., a change in signal) indicating the presence of the target nucleic acid using a reference signal value obtained from a negative control reaction. The signal was considered to have changed if the signal values ​​at 60 °C, 75 °C, and 95 °C were greater than RFU 100, a limit based on the signal value of the negative control reaction (i.e., RFU: 0). As a result, as shown in Table 8, a change in signal was identified from a Ct value of 26.28 only at 75 °C, and no change in signal was measured at 60 °C and 95 °C. Table 8 Tube Ct (Cycle Limit) 60 °C 75 °C 95 °C 1 N / A 26.28 N / A 2 N / AN / AN / A Tube 1: 5 pg of genomic DNA from MG; Tube 2: Negative control; N / A: Not applicable

[0564] Through the results of Combination 1 to Combination 4, it was confirmed that the L-PTOCE assay and the composition according to this disclosure can be used for the detection of the target nucleic acid. Furthermore, Petition 870250073538, dated 08 / 20 / 2025, pp. 133 / 185 126 / 136 it was found that the L-PTOCE assay and the composition according to this disclosure are applicable as a method and a composition for generating InterSC-type signals. Example 2: Detection of single nucleotide polymorphism

[0565] In this example, it was investigated whether the L-PTOCE assay can be used to detect a single nucleotide polymorphism of the target nucleic acid. 2-1. Preparation of the target nucleic acid and oligonucleotides

[0566] As a target nucleic acid, a synthetic RNA of the SARS-CoV-2 N501Y variant was used, which incorporates the nucleotide sequence that encodes the N501Y amino acid variation. The nucleotide sequence that encodes the N501Y amino acid variation has a single nucleotide polymorphism - a substitution of the nucleotide T for A at position 1501 in the reference sequence of the SARS-CoV-2 S gene (RefSeq: NC_045512.2.).

[0567] The target nucleic acid was prepared as follows:

[0568] The pBluescriptn SK+ plasmid with the 447 bp DNA sequence (SEQ ID NO: 10) with the single nucleotide polymorphism, as shown in Table 9, was acquired from Bionics. Subsequently, the plasmid was used to prepare synthetic RNA of the SARS-CoV-2 N501Y variant using the MEGAscript™ T7 Transcription Kit (Thermofisher, AM1334). Table 9 Target nucleic acid SEQ ID NO. Sequence (5'-3') Variant SARS-CoV-2 N501Y 10 CTGCGTTATAGCTTGG AATTCTAACAATCTTGA TTCTAAGGTTGGTGGTA ATTATAATTACCTGTAT AGATTG111AGGAAGTC TAATCTCAAACCIIIIG AGAGAGATA TTT CAGTACGACTGATCGATCCAGTCCATCGATTGATTGATTG111AGGAAGTC GGTGTTAAAGGT MTAA TTGTTACIIICCIIIAC AATCATATGG TTT CCAA Petition 870250073538, of 20 / 08 / 2025, p. 134 / 185 127 / 136 CCCACTTATGGTGTTG GTTACCAACCATACAGA GTAGTAGTACIIICIII TGAACTTCTACATGCAC CAGCAACIG III GIGG ACCIAAAAAGICIACIA AIIIGGIIAAAAACAAA IGIGICAAI I ICAACII CAAIGGI I IAACAGGC ACAGGTGTTCTTACTGA IICAAACAACIACIA IGCAACI GGCAGAGACAIIGCIG ACACIACIGAIGCIGIC CGIGAICCACA

[0569] The bold character indicates the single nucleotide polymorphism.

[0570] To detect the SARS-CoV-2 N501Y variant, a direct primer, a reverse primer, a PTO, a CTO and an LPHO were prepared, as shown in Table 10 . Table 10 Nucleic acid CO target SE Q ID NO Oligo type Tm (°C) Sequence (5'-3') Variant SARS-CoV2 N501 Y 11 Initiator r 64 AAACC IIII GAGAGAGA IAIII CAAC 12 Reverse initiator r 61.5 AC Al I IGI III IAACCAAAHAGIAG 13 PTO 72.5 CCTCAGGTGGCAATATGGTGTTGGTTACCAACCA TACAGAGIAGIA [C3 spacer] 14 CTO 77.5 [BHQ-1JCCI II CGCCCACATCGT[T(CAL Fluor Red 61O)]GCTGCCATTGCCACCIGAGG[C3 spacer] 15 LPHO 69 AAIGGCAGCAACGAIGIG GGCGAAAGG [C3 spacer]

[0571] The underlined character indicates the 5' tag portion of the PTO; the bold character indicates a single nucleotide polymorphism. 2-2. Reverse transcription-Real-time PCR

[0572] Real-time RT-PCR was performed with the above oligonucleotides. Petition 870250073538, dated 08 / 20 / 2025, pp. 135 / 185 128 / 136

[0573] Target nucleic acid (Tube 1: 5 x 103 copies of synthetic RNA of the SARS-CoV-2 N501Y variant), non-target nucleic acid (Tube 2: 103 copies of wild-type SARS-CoV-2 genomic DNA (ATCC, VR-1991D)) and distilled water (Tube 3, negative control) were mixed with: 5 pmol of forward primer (SEQ ID NO: 11), 5 pmol of reverse primer (SEQ ID NO: 12), 3 pmol of PTO (SEQ ID NO: 13), 1 pmol of CTO (SEQ ID NO: 14) and 3 pmol of LPHO (SEQ ID NO: 15) and then combined with 5 μL of Mixed Enzyme 4X (20 U of Taq DNA polymerase, 30 U of M-MLV reverse transcriptase) (Nanohelix, Korea) and 5 μL of 4X Mixed Buffer (final, 0.8 mM dNTPs, 200 mM KCl, 14 mM MgCl2) (Nanohelix, Korea), to prepare a reaction mixture in a final volume of 20 μL.

[0574] Tubes 1 to 3 containing the reaction mixture were placed in a real-time thermocycler (CFX96 Real-time Cycler, Bio-Rad) and subjected to real-time RTPCR, which consists of reverse transcription at 50 °C for 20 minutes, denaturation at 95 °C for 15 minutes, and then 50 cycles of 10 seconds at 95 °C, 15 seconds at 60 °C, 5 seconds at 70 °C and 10 seconds at 72 °C.

[0575] Signal detection was performed at three temperatures in each cycle, as follows: (i) 60 °C, where both the extended duplex and the hybrid CTO / LPHO remain in their double-strip state (i.e., the temperature within the first constant signal temperature range); (ii) 70 °C, where the extended duplex remains in its double-strand state and the CTO / LPHO hybrid dissociates into a single-strand state (i.e., the temperature within the signal-altering temperature range); and (iii) 95 °C, where both the extended duplex and the CTO / LPHO hybrid dissociate into a single-strand state (i.e., the temperature within the second constant-signal temperature range). [057 6] The real-time RT-PCR results were shown in Figure Petition 870250073538, dated 08 / 20 / 2025, pp. 136 / 185 129 / 136 10.

[0577] The signal was considered altered if the signal values ​​at 60 °C, 75 °C, and 95 °C were greater than RFU 100, a threshold based on the signal value of the negative control reaction (i.e., RFU: 0). As a result, as shown in Figure 10 and Table 8, a signal alteration in Tube 1 comprising the synthetic RNA of the SARS-CoV-2 N501Y variant was identified from a Ct value of 25.97 only at 75 °C, and no signal alteration was identified at 60 °C and 95 °C.

[0578] Meanwhile, for tube 2 containing wild-type SARS-CoV-2 genomic RNA and tube 3 as a negative control, the amplification curves at 60 °C and 75 °C provided a constant signal. That is, no signal change was detected. Table 1 1 Tube Ct (Cycle Limit) 60 °C 70 °C 95 °C 1 N / A 25.97 N / A 2 N / AN / AN / A 3 N / AN / AN / A Tube 1: 5 x 103copies of synthetic RNA of the N501Y variant of SARS-CoV-2; Tube 2: 103 copies of wild-type SARS-CoV-2 genomic RNA; Tube 3: Negative control; N / A: Not applicable

[0579] These results demonstrate that the L-PTOCE assay and the composition according to the present disclosure can be used to distinguish and detect a single nucleotide polymorphism. Example 3: Detection of multiple target nucleic acids

[0580] In this example, it was investigated whether the combination of the LPTOCE composition and another composition that adopts a different signal generation mechanism (i.e., UnderSC, InterSC, and / or OverSC type compositions) can detect multiple target nucleic acids in real time using a single type of marker in a single Petition 870250073538, dated 08 / 20 / 2025, pp. 137 / 185 130 / 136 reaction vessel.

[0581] First, two target nucleic acids were prepared: Mycoplasma hominis (MH) genomic DNA and Mycoplasma genitalium (MG) genomic DNA. The PTOCE assay (WO 2012 / 096523) using CTO with interactive double markers, adopting the UnderSC type signal generation mechanism, was used to detect the first target nucleic acid. The L-PTOCE assay according to this disclosure, adopting the InterSC type signal generation mechanism, was used to detect the second target nucleic acid.

[0582] Figure 11 schematically shows the signal generation principle of the composition to detect the first target nucleic acid (MH) and the composition to detect the second target nucleic acid (MG), depending on the presence or absence of the target nucleic acid. According to the present disclosure, by adjusting the respective signal change temperature ranges of the PTOCE assay and the L-PTOCE assay, a plurality of target nucleic acids can be detected in real time using a single type of marker in a reaction vessel.

[0583] Specifically, as shown in Figure 11, the first composition for detecting the first target nucleic acid, MH, and the second composition for detecting the second target nucleic acid, MG, generate an extended duplex in the presence of the corresponding target nucleic acid, respectively. The sequence and length of the oligonucleotides in the composition for detecting the first target nucleic acid were adjusted so that the extended duplex generated depending on the first target nucleic acid remains in its double-stranded form at the first detection temperature and dissociates into a single-stranded state at the second detection temperature. The sequence and length of the oligonucleotides in the composition for detecting the second target nucleic acid were adjusted so that the extended duplex generated as a function of the second target nucleic acid remains in its double-stranded form at both the first and second detection temperatures. Petition 870250073538, dated 08 / 20 / 2025, pp. 138 / 185 131 / 136 detection, while the CTO / LPHO hybrid remains in its double-strand form at the first detection temperature and dissociates into a single-strand state at the second detection temperature.

[0584] As a result, the composition for detection of the first target nucleic acid provides a signal change at the first detection temperature in the presence of the first target nucleic acid, and the signal is constant at the second detection temperature. The composition for detection of the second target nucleic acid provides a constant signal at the first detection temperature in the presence of the second target nucleic acid and provides a signal change at the second detection temperature.

[0585] Both the PTOCE assay for detecting the first target nucleic acid and the L-PTOCE assay for detecting the second target nucleic acid are similar in that they generate extended duplexes depending on the presence of a corresponding target nucleic acid. However, the composition for detecting the first target nucleic acid provides a signal shift at the first detection temperature due to the difference between a suppressed signal when the first target nucleic acid is absent and an unsuppressed signal when the first target nucleic acid is present at the first detection temperature, and the composition for detecting the second target nucleic acid provides a signal shift at the second detection temperature due to the difference between a suppressed signal when the second target nucleic acid is absent and an unsuppressed signal when the second target nucleic acid is present at the second detection temperature.Furthermore, the composition for detecting the first target nucleic acid provides a constant signal at the second temperature because there is no difference between the suppressed signal when the first target nucleic acid is absent and the suppressed signal when the first target nucleic acid is present at the second temperature, and the composition for detecting the second target nucleic acid provides a constant signal at the first temperature. Petition 870250073538, dated 08 / 20 / 2025, pp. 139 / 185 132 / 136 temperature because there is no difference between the unsuppressed signal when the second target nucleic acid is absent and the unsuppressed signal when the second target nucleic acid is present at the first detection temperature. 3-1. Preparation of target nucleic acids and oligonucleotides

[0586] Genomic DNA from Mycoplasma hominis (MH) (accession number: ATCC 15488) was used as the first target nucleic acid and genomic DNA from Mycoplasma genitalium (MG) (accession number: ATCC 33530) as the second target nucleic acid.

[0587] A first detection temperature to detect a signal change indicative of the presence of the first target nucleic acid, MH, was set at 60 °C, and a second detection temperature to detect a signal change indicative of the presence of a second target nucleic acid, MG, was set at 75 °C. Then, the oligonucleotides for the composition for detection of the target nucleic acid MH and the composition for detection of the target nucleic acid MG were prepared as below.

[0588] To detect the target nucleic acid MH, a forward primer, a reverse primer, an MH-PTO, and an MH-CTO were prepared, as shown in Table 12. The MH-PTO comprises, in a 5' to 3' direction: (i) a 5' labeling portion comprising a non-hybridizing nucleotide sequence for the target nucleic acid MH and (ii) a 3' targeting portion comprising a nucleotide sequence hybridizing with the target nucleic acid MH. The MH-CTO comprises, in a 3' to 5' direction: (i) a capture portion comprising a nucleotide sequence hybridizing with the 5' labeling portion of MH-PTO and (ii) a shaping portion comprising a non-hybridizing nucleotide sequence with the 5' labeling portion and the 3' targeting portion of MHPTO. MH-CTO has a suppressor molecule (BHQ-1) attached to the 5' end and a reporter molecule (CAL Fluor Orange 560) attached to the 3' targeting portion. Petition 870250073538, dated 08 / 20 / 2025, pp. 140 / 185 133 / 136 The 3' ends of PTO and CTO were blocked by the C3 spacer to prevent their extension by DNA polymerase.

[0589] The oligonucleotides for the detection of the second target nucleic acid, MG, were the same as those used in Example 1 for the detection of the target nucleic acid MG, including the forward primer (SEQ ID NO: 1), the reverse primer (SEQ ID NO: 2), PTO (SEQ ID NO: 3), CTO-1 (SEQ ID NO: 4) and LPHO-1A (SEQ ID NO: 5). T able 12 Target CO nucleic acid SE Q ID NO Oligo Type Tm (°C ) Sequence (5'-3') MH 16 MHInitiate or forward 65 GCTTCATGTACTACTAACTG II TAGCIIIIITTGCCAA CGT 17 MHInitiate or reverse 0 63 TCCAATAGCTATTGCAGCACCI111ITTGTTGGAAC 18 MH- PTO 71 ATATCGCGCGTCTGCTCCACACAAAGA TTT AAGA AGAGCAAG [C3 Spacer] 19 MHCTO 66 [BHQ-1]TT TAT T TAT T TAT T TAT[T(CAL Fluor Orange 560)]TTACTGCAGACGCGCGATAT[C3 Spacer]

[0590] The underlined character indicates the 5' marking portion of the PTO. 3-2. Multiplex real-time PCR

[0591] Multiplex real-time PCR was performed in a reaction vessel using the above oligonucleotides.

[0592] The target nucleic acids (Tube 1: 500 fg of MH genomic DNA; Tube 2: 1 pg of MG genomic DNA; Tube 3: 500 fg of MH genomic DNA and 1 pg of MG genomic DNA) and distilled water (Tube 4, Negative Control) were mixed with: 5 pmol of MH direct primer (SEQ ID NO: 16), 5 pmol of MH reverse primer (SEQ ID NO: 17), 3 pmol of MH-PTO (SEQ ID NO: 18), 1 pmol of MHCT (SEQ ID NO: 19), 5 pmol of MG Direct Primer (SEQ ID NO: 1), 5 pmol of Petition 870250073538, dated 08 / 20 / 2025, pp. 141 / 185 134 / 136 Reverse Primer MG (SEQ ID NO: 2), 3 pmol of MG-PTO (SEQ ID NO: 3), 1 pmol of CTO-1 (SEQ ID NO: 4) and 3 pmol of LPHO-1A (SEQ ID NO: 5) and then combined with 5 μL of Mixed Enzyme 4X (20 U of Taq DNA polymerase) (Nanohelix, Korea) and 5 μL of Mixed Buffer 4X (final, 0.8 mM dNTPs, 50 mM KCl, 3.5 mM MgCl2) (Nanohelix, Korea), to prepare a reaction mixture in a final volume of 20 pL.

[0593] Tubes 1 to 4 containing the reaction mixture were placed in a real-time thermocycler (CFX96 Real-time Cycler, Bio-Rad) and subjected to real-time PCR, which consists of denaturation at 95 °C for 15 minutes and then 50 cycles of 10 seconds at 95 °C, 15 seconds at 60 °C, 10 seconds at 72 °C and 5 seconds at 75 °C. Signal detection was performed at 60 °C for detection of the target nucleic acid MH and at 75 °C for detection of the target nucleic acid MG in each cycle.

[0594] The real-time PCR results were shown in Figure 12.

[0595] For Tube 1 containing only the target nucleic acid MH, the amplification curve at 75 °C exhibited a constant signal, although the target nucleic acid MH was amplified. In contrast, the amplification curve at 60 °C showed a change in sign as the target nucleic acid MH was amplified. For Tube 2 containing only the target nucleic acid MG, the amplification curve at 60 °C exhibited a constant signal, although the target nucleic acid MG was amplified. In contrast, the amplification curve at 75 °C showed a change in sign as the target nucleic acid MG was amplified. For Tube 3 containing the target nucleic acids MH and MG, the amplification curves at 60 °C and 75 °C showed a change in sign, respectively.

[0596] Meanwhile, for Tube 4 as a negative control, the amplification curves at 60 °C and 75 °C provided a constant signal. That is, no signal change was detected.

[0597] These results demonstrate that the combination of composition L Petition 870250073538, dated 08 / 20 / 2025, pp. 142 / 185 135 / 136 PTOCE and another composition for target nucleic acid detection adopting a different signal generation mechanism (i.e., UnderSC, InterSC, and / or OverSC type compositions) can be used to detect multiple target nucleic acids in real time using a single type of marker in a single reaction vessel. Furthermore, it would be interesting to know that a combination of several LPTOCE compositions, each of which is an InterSC type composition, can be used to detect multiple target nucleic acids in real time.

[0598] In an alternative method, the change in signal was measured using the reference signal value obtained from the negative control reaction. The signal was considered altered if the signal values ​​at 60 °C and 75 °C were greater than RFU 100, a threshold based on the signal value of the negative control reaction (i.e., RFU: 0). As a result, as shown in Table 13, a signal change in Tube 1 was identified from a Ct value of 29.37 only at 60 °C, a signal change in Tube 2 was identified from a Ct value of 28.49 only at 75 °C, and signal changes in Tube 3 were identified from a Ct value of 29.61 and a Ct value of 28.39 at 60 °C and 75 °C, respectively. On the other hand, for Tube 4 as the negative control, no signal change was identified at either detection temperature. Table 1.3 Tube Ct (Cycle Limit) First detection temperature (60 °C) Second detection temperature (75 °C) 1 29.37 N / A 2 N / A 28.49 3 29.61 28.39 4 N / A Tube 1: 500 fg of MH genomic DNA; Tube 2: 1 pg of genomic DNA MG; Tube 3: 500 fg of genomic DNA from MH and 1 pg of genomic DNA from MG; Tube 4: Negative control; Petition 870250073538, dated 08 / 20 / 2025, pp. 143 / 185 136 / 136 N / A: Not applicable

[0599] In summary, the L-PTOCE assay according to the present disclosure can detect one or more target nucleic acids using the same type of marker in a reaction vessel.

[0600] After describing a preferred embodiment of the present invention, it should be understood that variants and modifications that fit within the spirit of the invention may become apparent to a person skilled in the art. Therefore, the scope of the present invention shall be determined by the appended claims and their equivalents. Petition 870250073538, dated 08 / 20 / 2025, pages 144 / 185

Claims

1 / 11 CLAIMS 1. Method for detecting a target nucleic acid in a sample by probe-and-label oligonucleotide extension cleavage assay (PTO) assisted by portion-labeled oligonucleotide hybridization (LPHO) (L-PTOCE) CHARACTERIZED in that it comprises: (a) hybridizing a primer and a PTO with the target nucleic acid; wherein the primer comprises a nucleotide sequence hybridizing with a first region of the target nucleic acid, wherein the PTO comprises in a 5' to 3' direction: (i) a 5' labeling portion and (ii) a 3' targeting portion, wherein the 3' targeting portion comprises a nucleotide sequence hybridizing with a second region of the target nucleic acid, and the 5' labeling portion comprises a nucleotide sequence not hybridized with the target nucleic acid when the 3' targeting portion is hybridized with the second region of the target nucleic acid, wherein the primer is located upstream of the PTO;(b) contacting the result of step (a) with a DNA polymerase having 5' nuclease activity under PTO cleavage conditions; wherein the primer is extended to induce cleavage of the PTO by the DNA polymerase having 5' nuclease activity, such that cleavage releases a fragment comprising the 5' tag portion of the PTO; (c) hybridizing the released PTO fragment with a capture and template oligonucleotide (CTO); wherein the CTO comprises, in a 3' to 5' direction: (i) a capture portion comprising a sequence of nucleotides hybridized with the 5' tag portion of the PTO and (ii) a template portion comprising a sequence of nucleotides not hybridized with the 5' tag portion and the Petition 870250073538, dated 20 / 08 / 2025, page. 174 / 185 2 / 11 3' targeting of the PTO, where the CTO has a reporter molecule and a suppressor molecule that define a labeled portion, where the fragment is hybridized with the capture portion of the CTO;(d) perform an extension reaction using the resultant of step (c) and DNA polymerase with 5' nuclease activity in the presence of a Labeled Portion Hybridization Oligonucleotide (LPHO); wherein the LPHO comprises a hybridization nucleotide sequence with the labeled portion of the CTO, wherein, when the target nucleic acid is present in the sample, the fragment hybridized with the capture portion of the CTO is extended to generate an extended strand complementary to the CTO, thus generating an extended duplex between the extended strand and the CTO, wherein the generation of the extended duplex prevents the formation of a CTO / LPHO hybrid between the labeled portion of the CTO and the LPHO, wherein, when the target nucleic acid is not present in the sample, the extended strand is not generated and instead the CTO / LPHO hybrid is formed, wherein the extended duplex has a melting temperature (Tm) different from the Tm of the CTO / LPHO hybrid; and (e) detect the presence of extended duplex;where the extended duplex is detected by measuring a signal provided by the extended duplex, where the measurement is performed at a temperature at which the intensity of the signal provided by the extended duplex is different from the intensity of the signal provided by the CTO / LPHO hybrid, and where the presence of the extended duplex indicates the presence of the target nucleic acid.

2. Method according to claim 1, CHARACTERIZED in that Petition 870250073538, dated 20 / 08 / 2025, pp. 175 / 185 3 / 11 that the extended duplex is generated by (i) extending the hybridized fragment to the capture portion of the CTO before hybridization of the labeled portion of the CTO and the LPHO, (ii) extending the hybridized fragment to the capture portion of the CTO after hybridization between the labeled portion of the CTO and the LPHO, thereby cleaving the LPHO, or (iii) both (i) and (ii).

3. Method according to claim 2, CHARACTERIZED in that the generation of the extended duplex prevents the formation of the CTO / LPHO hybrid, by preferentially hybridizing between the extended strip and the CTO over hybridizing between the labeled portion of the CTO and the LPHO or the generation of the extended duplex prevents the formation of the CTO / LPHO hybrid, by cleaving the LPHO during the extension of step (d).

4. Method according to claim 1, CHARACTERIZED in that, when the CTO is not hybridized with the extended strand or with the LPHO, the reporter molecule and the suppressor molecule in the CTO are very close to each other, causing the suppressor molecule to suppress a signal from the reporter molecule, and when the CTO is hybridized with the extended strand or with the LPHO, the reporter molecule and the suppressor molecule in the CTO are separated, causing the suppressor molecule not to suppress a signal from the reporter molecule.

5. Method according to claim 1, CHARACTERIZED in that (i) both the reporter molecule and the suppressor molecule are attached to the capture portion of the CTO, (ii) both the reporter molecule and the suppressor molecule are attached to the shaping portion of the CTO or (iii) one of the reporter and suppressor molecules is attached to the capture portion of the CTO and the other is attached to the shaping portion of the CTO.

6. Method according to claim 1, CHARACTERIZED in that the LPHO is hybridized with a complete or partial sequence of the labeled portion of the CTO, and the reporter molecule and the suppressor molecule in the CTO are separated, Petition 870250073538, dated 20 / 08 / 2025, p. 176 / 185 4 / 11, causing the suppressor molecule not to suppress a signal from the reporter molecule.

7. Method, according to claim 6, CHARACTERIZED in that the Tm of the extended duplex is at least 3 °C higher than the Tm of the CTO / LPHO hybrid.

8. Method according to claim 1, CHARACTERIZED in that the LPHO comprises a nucleotide sequence that competes with the fragment for hybridization with the CTO.

9. Method according to claim 8, CHARACTERIZED in that the LPHO is not cleaved by the fragment or by the extension product thereof.

10. Method according to claim 1, CHARACTERIZED in that the LPHO comprises a nucleotide sequence that does not compete with the fragment for hybridization with the CTO.

11. Method according to claim 10, CHARACTERIZED in that the LPHO is cleaved by the fragment or by the extension product thereof.

12. Method, according to claim 1, CHARACTERIZED in that the temperature for measurement depends on the Tm of the extended duplex and the Tm of the CTO / LPHO hybrid.

13. Method according to claim 1, CHARACTERIZED in that the method is performed in the presence of a plurality of PTOs, a plurality of CTOs and a plurality of LPHOs, and steps (a) to (e) are repeated with denaturation between repetition cycles.

14. Method according to claim 13, CHARACTERIZED in that the temperature for measurement allows (i) at least one of the extended duplexes to remain in the double-tape state and (ii) at least one of the CTO / LPHO hybrids to dissociate into a single-tape state.

15. Composition for detecting a target nucleic acid in a sample CHARACTERIZED in that it comprises: Petition 870250073538, dated 08 / 20 / 2025, page 177 / 185 5 / 11 (a) a primer; wherein the primer comprises a hybridization nucleotide sequence with a first region of the target nucleic acid, (b) a probing and labeling oligonucleotide (PTO);wherein the PTO comprises in a 5' to 3' direction: (i) a 5' labeling portion and (ii) a 3' targeting portion, wherein the 3' targeting portion comprises a nucleotide sequence hybridizing with a second region of the target nucleic acid, and the 5' labeling portion comprises a nucleotide sequence not hybridized with the target nucleic acid when the 3' targeting portion is hybridized with the second region of the target nucleic acid, wherein the primer is located upstream of the PTO, wherein the primer is extended to induce cleavage of the PTO by a DNA polymerase having 5' nuclease activity, such that cleavage releases a fragment comprising the 5' labeling portion of the PTO; (c) a capture and template oligonucleotide (CTO);wherein the CTO comprises, in a 3' to 5' direction: (i) a capture portion comprising a nucleotide sequence hybridized with the 5' tag portion of the PTO and (ii) a template portion comprising a nucleotide sequence not hybridized with the 5' tag portion and the 3' targeting portion of the PTO, wherein the CTO has a reporter molecule and a suppressor molecule that define a tagged portion, wherein the fragment is hybridized with the capture portion of the CTO; and (d) a tagged portion hybridization oligonucleotide (LPHO);wherein the LPHO comprises a hybridization nucleotide sequence with the labeled portion of the CTO, Petition 870250073538, dated 08 / 20 / 2025, p. 178 / 185 6 / 11 wherein, when the target nucleic acid is present in the sample, the fragment hybridized with the capture portion of the CTO is extended to generate an extended strand complementary to the CTO, thus generating an extended duplex between the extended strand and the CTO, wherein the generation of the extended duplex prevents the formation of a CTO / LPHO hybrid between the labeled portion of the CTO and the LPHO, wherein, when the target nucleic acid is not present in the sample, the extended strand is not generated and instead the CTO / LPHO hybrid is formed, in which the extended duplex has a melting temperature (Tm) different from the Tm of the CTO / LPHO hybrid.

16. Composition according to claim 15, CHARACTERIZED in that (i) both the reporter molecule and the suppressor molecule are linked to the capture portion of the CTO, (ii) both the reporter molecule and the suppressor molecule are linked to the shaping portion of the CTO or (iii) one of the reporter and suppressor molecules is linked to the capture portion of the CTO and the other is linked to the shaping portion of the CTO.

17. Composition according to claim 15, CHARACTERIZED in that it provides a signal dependent on the presence of the target nucleic acid.

18. Composition according to claim 17, CHARACTERIZED in that the signal dependent on the presence of the target nucleic acid is a signal provided by the extended duplex.

19. Composition, according to claim 15, CHARACTERIZED in that it has a signal-change temperature range (SChTR) in which the signal changes depending on the presence of the target nucleic acid, and two constant-signal temperature ranges (SCoTRs) in which the signal is constant even in the presence of the target nucleic acid.

20. Composition, according to claim 19, CHARACTERIZED in that the signal change temperature range is larger than the first constant signal temperature range of the two constant signal temperature ranges and smaller than the second constant signal temperature range of the two constant signal temperature ranges.

21. Composition according to claim 18, CHARACTERIZED in that the extended duplex remains in the double-stranded state and the CTO / LPHO hybrid dissociates into a single-stranded state at temperatures within the signal-switching temperature range in the presence of the target nucleic acid.

22. Method for detecting n target nucleic acids in a sample, CHARACTERIZED in that it comprises: (a) detecting signals at n detection temperatures while incubating n compositions for detecting the n target nucleic acids with a sample suspected of containing at least one of the n target nucleic acids in a reaction vessel; wherein n is an integer of 2 or more, wherein the incubation comprises a plurality of reaction cycles and the signal detection is performed in at least one of the plurality of reaction cycles, wherein each of the n compositions for detecting the n target nucleic acids provides a signal change at a corresponding detection temperature among the n detection temperatures in the presence of a corresponding target nucleic acid, wherein the signal change indicates the presence of a corresponding target nucleic acid,wherein a composition for detecting a / th target nucleic acid among the n compositions for detecting the n target nucleic acids provides a signal change at a / th detection temperature among the n detection temperatures and provides a constant signal at the other detection temperatures in the presence of the / th target nucleic acid, wherein the signal change indicates the presence of the / th target nucleic acid, wherein / represents an integer from 1 to n, and the / th detection temperature is lower than the ( / +1)th detection temperature, wherein, within the temperature range encompassing all n detection temperatures, the composition for detecting the / th target nucleic acid has a signal change temperature range (SChTR) in which the signal changes depending on the presence of the / th target nucleic acid,and one or two constant signal temperature ranges (SCoTRs) in which the signal is constant even in the presence of the / th target nucleic acid, wherein the composition for detecting the / th target nucleic acid is any of the following: (i) an Under-Signal-Change (UnderSC) type composition having a melting feature in which the signal-change temperature range is smaller than the constant signal temperature range, (ii) an Inter-Signal-Change (InterSC-type) type composition having a melting feature in which the signal-change temperature range is larger than one of the two constant signal temperature ranges and smaller than the other of the two constant signal temperature ranges, and (iii) an Over-Signal-Change (OverSC) type composition having a melting feature in which the signal-change temperature range is larger than the constant signal temperature range,and wherein at least one of the n compositions for detecting n target nucleic acids is (ii) an InterSC type composition that generates the signal according to the method as defined in any one of claims 1 to 14, and (b) determining the presence of the n target nucleic acids from the signals detected in step (a), wherein the presence of the nth target nucleic acid is determined by the signal change detected at the nth detection temperature.

23. Method, according to claim 22, CHARACTERIZED in that the / th detection temperature is selected within the signal change temperature range of the composition to detect the / th target nucleic acid, wherein the / th detection temperature is not included in the signal change temperature ranges of the compositions to detect the other target nucleic acids.

24. Method according to claim 22, CHARACTERIZED in that when n is 2, the composition for detecting the first target nucleic acid is an UnderSC or InterSC type composition, and the composition for detecting the second target nucleic acid is an InterSC or OverSC type composition, or (ii) when n is 3 or more, the composition for detecting the first target nucleic acid is an UnderSC or InterSC type composition, the composition for detecting the nth target nucleic acid is an InterSC or OverSC type composition, and each of the compositions for detecting target nucleic acids other than the first target nucleic acid and the nth target nucleic acid is an InterSC type composition.

25. Method, according to claim 22, CHARACTERIZED in that the composition for detecting the / th target nucleic acid provides a duplex that provides a signal change.

26. Method according to claim 25, CHARACTERIZED in that the duplex providing the signal change comprises a marker.

27. Method according to claim 22, CHARACTERIZED in that signal detection is performed in at least two of the plurality of reaction cycles.

28. Method according to claim 27, CHARACTERIZED in that the signal change is measured using signals detected in at least two of the plurality of reaction cycles.

29. Method according to claim 22, CHARACTERIZED in that the signal change at the i-th detection temperature is measured using a signal detected in at least one of the plurality of reaction cycles and a reference signal value. Petition 870250073538, dated 20 / 08 / 2025, pp. 182 / 185 10 / 11 30. Method according to claim 29, CHARACTERIZED in that the reference signal value is obtained from a reaction in the absence of the / th target nucleic acid.

31. Method according to claim 22, CHARACTERIZED in that the detection of a signal at each of the n detection temperatures is performed using a unique type of detector.

32. Method according to claim 31, CHARACTERIZED in that the signals detected at the n detection temperatures are not differentiated from each other by the single type of detector.

33. Method for detecting a target nucleic acid in a sample using a labeled moiety (LPHO) hybridization oligonucleotide CHARACTERIZED in that it comprises: (a) providing a fragment produced by an enzymatic cleavage reaction of an oligonucleotide, depending on the presence of the target nucleic acid in the sample; (b) hybridizing the fragment with a capture and template oligonucleotide (CTO); wherein the CTO comprises, in a 3' to 5' direction: (i) a capture moiety comprising a fragment-hybridizing nucleotide sequence and (ii) a template moiety comprising a non-hybridizing nucleotide sequence with the fragment, wherein the CTO has a reporter molecule and a suppressor molecule that define a labeled moiety, wherein the fragment is hybridized with the capture moiety of the CTO; (c) perform an extension reaction using the resultant of step (b) and a DNA polymerase having 5' nuclease activity in the presence of LPHO;wherein the LPHO comprises a hybridization nucleotide sequence with the labeled portion of the CTO, Petition 870250073538, 20 / 08 / 2025, p. 183 / 185 11 / 11 wherein, when the target nucleic acid is present in the sample, the fragment hybridized with the capture portion of the CTO is extended to generate an extended strand complementary to the CTO, thus generating an extended duplex between the extended strand and the CTO, wherein the generation of the extended duplex prevents the formation of a CTO / LPHO hybrid between the labeled portion of the CTO and the LPHO, wherein, when the target nucleic acid is not present in the sample, the extended strand is not generated and instead the CTO / LPHO hybrid is formed, in which the extended duplex has a melting temperature (Tm) different from the Tm of the CTO / LPHO hybrid; and (d) detect the presence of the extended duplex;wherein the extended duplex is detected by measuring a signal provided by the extended duplex, wherein the measurement is performed at a temperature at which the signal intensity of the extended duplex is different from the signal intensity of the CTO / LPHO hybrid, and wherein the presence of the extended duplex indicates the presence of the target nucleic acid. Petition 870250073538, dated 20 / 08 / 2025, pp. 184 / 185;