Feed additive containing keratinase mutant and bile acid and application thereof

Abstract

The present invention provides a feed additive containing a keratinase mutant and bile acid and its application. The present invention uses a saturation mutation method to Bacillus licheniformis The keratinase gene of the source is mutated to obtain keratinase mutants KS01, KS02, KS03, and KS04. Compared with the original keratinase, the optimal reaction temperature of the mutants is reduced from 55°C to 38°C, 45°C, 46°C, and 50°C, respectively, and the residual enzyme activity of the mutant KS01 is above 65% under the reaction conditions of 25°C to 35°C. The present invention also uses the enzyme preparation prepared by fermentation, filtration and drying of the engineered bacteria containing the mutants and compounding with bile acid, which not only has a good effect of enzymolysis of soybean meal antigen protein, but also can be used in poultry and livestock breeding, can obviously play an anti-diarrhea role, and protect the gastrointestinal tract of animals, and has good industrial value and market application prospects.

Description

Technical Field

[0001] The invention belongs to the field of feed additives, and in particular relates to a feed additive containing a keratinase mutant and bile acid and application thereof. Background Art

[0002] Keratinase is a specific keratinase that can degrade keratin substrates (such as keratin, dander, feathers, etc.), and is produced by fungi, actinomycetes, bacteria and other microorganisms when they grow with keratin as a single carbon source. As a protease with broad substrate specificity and strong hydrolysis catalytic ability, keratinase is widely used in the daily chemical industry, animal husbandry industry, feed industry, leather industry, and pharmaceutical industry, and has great research and application value. The crude protein content in keratin is more than 80%, the total amount of various amino acids is more than 70%, and the types of essential amino acids for animals are complete. It also contains a large number of macroelements, trace elements and unknown growth factors. It is a good feed protein and fertilizer source that can replace or partially replace fish meal, and its development and utilization has important application prospects. At present, most wild keratinase belongs to high-temperature alkaline protease, and its optimal reaction temperature is generally around 60°C, and the enzyme activity or catalytic activity under 20°C-40°C is generally not high.

[0003] Error-prone PCR technology uses DNA polymerase to amplify the target fragment during PCR reaction, and adjusts the reaction conditions to increase the frequency of gene mutation, thereby randomly introducing mutations into the target gene at a certain frequency, constructing a mutant library, and then screening the required positive mutants in a high-throughput manner. Error-prone PCR technology is an important means in protein molecule modification. Summary of the invention

[0004] The present invention provides a feed additive containing a keratinase mutant and bile acid and its application. The present invention obtains several mutants with improved enzyme activity under low temperature conditions through random mutation screening: KS01, KS02, KS03, KS04, and mixes them with bile acid to prepare a feed additive, which effectively reduces diarrhea in poultry and livestock and improves their intestinal function.

[0005] In order to achieve the above-mentioned purpose, the present invention adopts the following technical solutions:

[0006] The present invention provides a keratinase mutant, wherein the amino acid sequence of the keratinase mutant has one of the following amino acid sequences:

[0007] (1) the amino acid sequence shown in SEQ ID NO: 3;

[0008] (2) the amino acid sequence shown in SEQ ID NO: 5;

[0009] (3) the amino acid sequence shown in SEQ ID NO: 7;

[0010] (4) The amino acid sequence shown in SEQ ID NO: 9.

[0011] Furthermore, the keratinase mutant is specifically a keratinase mutant KS01 obtained by changing the serine at position 340 of the keratinase with an amino acid sequence of SEQ ID NO: 1 to valine; a keratinase mutant KS02 obtained by changing the serine at position 340 of the keratinase with an amino acid sequence of SEQ ID NO: 1 to glutamic acid; a keratinase mutant KS03 obtained by changing the serine at position 340 of the keratinase with an amino acid sequence of SEQ ID NO: 1 to leucine; and a keratinase mutant KS04 obtained by changing the serine at position 340 of the keratinase with an amino acid sequence of SEQ ID NO: 1 to phenylalanine.

[0012] The present invention also provides a gene encoding the keratinase mutant, wherein the gene encoding the keratinase mutant has a nucleotide sequence as described in one of the following:

[0013] (1) the nucleotide sequence shown in SEQ ID NO: 4;

[0014] (2) the nucleotide sequence shown in SEQ ID NO: 6;

[0015] (3) the nucleotide sequence shown in SEQ ID NO: 8;

[0016] (4) The nucleotide sequence shown in SEQ ID NO: 10.

[0017] The invention also provides a recombinant expression vector comprising the coding gene of the keratinase mutant.

[0018] The present invention also provides a recombinant engineering bacterium comprising the coding gene of the keratinase mutant.

[0019] Furthermore, the recombinant engineered bacteria are Bacillus subtilis, Bacillus amyloliquefaciens, Bacillus pumilus, and Bacillus licheniformis.

[0020] The present invention also provides a feed additive, which contains both keratinase mutant and bile acid.

[0021] Furthermore, the feed additive is prepared by mixing an enzyme preparation obtained by fermenting, filtering and drying a recombinant engineered bacterium containing a keratinase mutant with bile acid in a mass volume ratio of 1:1 to 5.

[0022] The present invention also provides the use of the keratinase mutant or the feed additive in preparing feed for promoting animal growth and reducing animal diarrhea.

[0023] Furthermore, the amount of the keratinase mutant or feed additive is 100 g / t to 500 g / t of animal feed.

[0024] Compared with the prior art, the advantages and technical effects of the present invention are:

[0025] The present invention Bacillus licheniformis Based on the keratinase gene from the original source, mutants KS01, KS02, KS03 and KS04 containing S340V, S340E, S340L and S340F were screened. Compared with the original keratinase, the optimal reaction temperature of the mutants was reduced from 55°C to 38°C, 45°C, 46°C and 50°C, respectively, and the residual enzyme activity of the mutant KS01 was above 65% under the reaction conditions of 25°C to 35°C, which makes it have good market application potential in the fields of washing, leather making, feed, etc.

[0026] The present invention also uses an enzyme preparation prepared by fermentation, filtration and drying of engineered bacteria containing mutants and compounded with bile acid, which not only has a good effect of enzymatically hydrolyzing soybean meal antigen protein, but also can be used in poultry and livestock breeding to significantly prevent diarrhea and protect the gastrointestinal tract of animals. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 It is the electrophoresis result diagram of the keratinase gene amplification.

[0028] Figure 2 This is a diagram of the keratinase mutant screening process.

[0029] Figure 3 The invention relates to an analysis of the enzyme activity and optimal reaction temperature of the keratinase mutant.

[0030] Figure 4 The fermentation data of the keratinase mutant KL01 in a 15 L fermenter.

[0031] Figure 5 The invention relates to the degradation effect of the fermentation liquid of the keratinase mutant on feather protein.

[0032] Figure 6 This is a gel image of the in vitro enzymatic hydrolysis of soybean meal antigen protein by keratinase, where No. 1 is the untreated soybean meal, and No. 2-5 are the soybean meal treated with 200U / mL keratinase for 2h, 4h, 8h, and 16h respectively. DETAILED DESCRIPTION

[0033] In order to facilitate the understanding of the present invention, the present invention will be described in more comprehensive and detailed manner with reference to the accompanying drawings and embodiments below, but the protection scope of the present invention is not limited to the following specific embodiments.

[0034] The molecular biology experimental methods not specifically described in the following examples can be performed by referring to the specific methods listed in the book Molecular Cloning Laboratory Manual (3rd Edition) by J. Sambrook, or according to the kits and product instructions. The reagents and biological materials used in the specific examples can be obtained from commercial channels unless otherwise specified.

[0035] 1. Strains and vectors

[0036] Bacillus subtilis WB600, plasmid pWB980, Escherichia coli BL21, and plasmid pET-21a(+) were purchased from Invitrogen.

[0037] 2. Reagents and culture media

[0038] Plasmid extraction kit, fragment purification and recovery kit, restriction endonuclease, protein marker: Blue PlusII Protein Marker (14-120 kDa), etc. were purchased from Nanjing Novozymes Co., Ltd.; ampicillin was purchased from Sangon Biotech (Shanghai) Co., Ltd.; GeneMorph II random mutation PCR kit was purchased from Stratagene.

[0039] LB medium formula: 1% tryptone, 0.5% yeast extract, 1% NaCl.

[0040] Fermentation medium formula: soybean meal 3.5-10%, cottonseed meal 5-10%, corn flour 2-6%, PPG-20000 0.5-1.0%, protease 0.5-1.0%, amylase 0.5-1.0%, disodium hydrogen phosphate 0.2-0.5%, calculated by mass ratio.

[0041] 3. Enzyme activity determination: refer to the protease determination method in "GBT 23527-2009 Protease Preparations"

[0042] Example 1: Construction of recombinant bacteria carrying keratinase gene and construction of its mutant library

[0043] refer to Bacillus licheniformis Primers were designed based on the amino acid sequence (SEQ ID NO: 1) and DNA sequence (SEQ ID NO: 2) of the keratinase from the source, a Kpn I restriction enzyme site was designed at the 5' end, and a BamH I restriction enzyme site was designed at the 3' end. PCR amplification of the target band was performed using the following primers:

[0044] KF: CGGGGTACCATGATGAGGAAAAAGGTTT (SEQ ID NO: 11);

[0045] KR: CGCCCATCCTTATTGAGCGGCAGCTTCGA (SEQ ID NO: 12).

[0046] The reaction system is as follows:

[0047] PCR upstream primer (25pmol / µL) 1µL PCR downstream primers (25pmol / µL) 1µL dNTP Mix 4µL PCR Buffer 5µL Template DNA 1µL DNA polymerase 0.5µL Add double distilled water to the total volume 50µL

[0048] The reaction conditions were as follows: pre-denaturation at 95°C for 3 min, denaturation at 94°C for 10 sec, annealing at 58°C for 30 sec, extension at 72°C for 1 min, 30 cycles, post-extension at 72°C for 10 min, and storage at 15°C.

[0049] The PCR product was subjected to electrophoresis. Figure 1 As shown, the single-band PCR product was purified, double-digested, connected to the pWB980 vector (according to the steps in the kit instructions), and transformed into Bacillus subtilis WB600, coated on a plate containing antibiotics, and recombinant bacteria were screened.

[0050] The mutant library was constructed by site-directed saturation mutagenesis, using the gene of SEQ ID NO: 2 as a template, and the primer sequences used were as follows:

[0051] KF: CGGGGTACCATGATGAGGAAAAAGGTTT (SEQ ID NO: 11);

[0052] KR: CGCCCATCCTTATTGAGCGGCAGCTTCGA (SEQ ID NO: 12);

[0053] 340F: CAGCAGCTTTGATCTTGNNKAAACATCCGAACCTTTCAGC (SEQ ID NO: 13)

[0054] 340R: CAAGATCAAAGCTGCTGCTC (SEQ ID NO: 14).

[0055] The amplified PCR product was double-digested with Kpn I and BamH I, ligated to the pWB980 vector, transformed into Bacillus subtilis WB600, and positive clones were screened on kanamycin-resistant LB plates.

[0056] The selected transformant colonies were inoculated into 96-well deep-well plates. Three single colonies K0 expressing original keratinase were inoculated into each plate as controls. 500uL of LB liquid culture medium containing kanamycin resistance was placed into each well. After culturing at 37°C and 200rpm for 24 hours, the fermentation liquid was centrifuged to obtain the supernatant, and then the enzyme activity of keratinase was detected. The results are shown in Figure 2. Figure 2 As shown, the mutant genes whose enzyme activities under low temperature conditions (20℃-40℃) were significantly higher than those of the control K0 were repeatedly verified and sequenced.

[0057] The mutants with improved enzymatic activity under low temperature conditions using the original keratinase as the starting template were screened out:

[0058] The mutation pattern of KS01 is S340V, the amino acid sequence is shown in SEQ ID No: 3, and the gene sequence is shown in SEQ ID No: 4;

[0059] The mutation pattern of KS02 is S340E, the amino acid sequence is shown in SEQ ID No: 5, and the gene sequence is shown in SEQ ID No: 6;

[0060] The mutation pattern of KS03 is S340L, the amino acid sequence is shown in SEQ ID No: 7, and the gene sequence is shown in SEQ ID No: 8;

[0061] The mutation pattern of KS04 is S340F, the amino acid sequence is shown in SEQ ID No: 9, and the gene sequence is shown in SEQ ID No: 10.

[0062] Example 2: Shake flask fermentation expression verification of recombinant bacteria of keratinase mutants with improved enzymatic activity under low temperature conditions

[0063] The above-mentioned recombinant bacteria containing mutants were inoculated into fermentation medium respectively. After shake flask fermentation for 78 hours, the culture solution was centrifuged to obtain the supernatant. The average enzyme activity of the supernatant of each mutant fermentation solution was determined at 40°C, and the optimal temperature of the mutant was determined at the same time.

[0064] The results are as follows Figure 3 The enzyme activities of the mutant keratinase KS01, KS02, KS03 and KS04 at 40°C were comparable to those of the original keratinase K0; the optimal reaction temperatures of the mutants KS01, KS02, KS03 and KS04 decreased from 55°C to 38°C, 45°C, 46°C and 50°C, respectively, and the residual enzyme activity of the mutant KS01 was above 65% under the reaction conditions of 25°C to 35°C.

[0065] Example 3: Fermentation and preparation of keratinase mutants in a 15 L fermenter

[0066] The genetically engineered bacteria expressing the keratinase mutant KS02 were streaked onto LB plates containing kanamycin resistance (final concentration of 20 μg / mL), cultured at 37°C until single colonies grew, and single colonies with good growth were selected for fermentation. Fermentation production process:

[0067] (1) The recombinant cells were inoculated into LB liquid medium and cultured overnight at 37°C and 200 rpm with shaking;

[0068] (2) Inoculate the overnight cultured seed solution into a 15L fermenter with a liquid volume of 8L;

[0069] (3) Control conditions: 37°C, 300-600rpm; dissolved oxygen 20%-60%; tank pressure 0.05Mpa; ventilation volume 0-8h 0.6m 3 / h; 8h to tank stop 0.8-0.9 m 3 / h.

[0070] (4) Ferment until the spore formation rate is above 90% as detected by microscopic examination.

[0071] (5) Stop the tank and centrifuge the fermentation broth at 5000 rpm for 5 min to obtain the supernatant enzyme solution.

[0072] (6) The pH value of the fermentation process is natural. The enzyme activity is measured 24 hours after fermentation. After the fermentation is completed (usually 48 hours), the fermentation liquid is processed through a plate and frame filter to obtain a crude enzyme solution, which is then spray-dried through a spray tower to become an enzyme preparation for application testing.

[0073] The fermentation process curve is as follows Figure 4 As shown: samples were taken every 4 hours to measure the enzyme production level, and the antibacterial activity reached the highest point after 48 hours of fermentation.

[0074] Example 4: Experiment on degradation of feather powder by keratinase mutants

[0075] Collect white feathers, cut the feathers into pieces, take 0.02 g of feather pieces, add 20 mL of buffer (pH 8.0 0.02 M Tris-HCl buffer) to prepare a suspension;

[0076] Experimental group: The fermentation broth of the genetically engineered bacteria of the keratinase mutant KS02 was centrifuged to obtain the fermentation broth supernatant, which was added to the feather suspension;

[0077] Control group: no enzyme was added, and the treatment process was the same as that of the experimental group;

[0078] Reaction conditions: After the enzyme solution and substrate are evenly mixed, the enzymatic reaction is carried out on a water bath shaker at 37°C and 120 rpm / min for 2 h.

[0079] After the reaction is completed, the result is Figure 5As shown in the figure, compared with the control group, the feathers in the experimental group on the left were significantly degraded and appeared milky white, while the feathers in the control group on the right were not degraded, and appeared transparent with feathers suspended. This experiment shows that the keratinase mutant maintains the original high efficiency of keratin degradation, while its optimal reaction temperature is reduced. Therefore, the keratinase mutant has great application potential in fields such as washing and leather making that require enzymatic reactions at lower temperatures.

[0080] Example 5: In vitro enzymatic hydrolysis of soybean meal antigen protein by keratinase

[0081] Soybean meal is the most commonly used feed raw material and an important source of protein nutrition for livestock and poultry. It has accounted for more than 70% of my country's protein feed raw materials for many years. Keratinase can effectively eliminate the effects of trypsin inhibitors, degrade plant keratin and antigenic proteins (allergens), improve the utilization efficiency of protein raw materials, significantly reduce nitrogen excretion in feces and urine, prevent food-borne diarrhea and promote growth. There are 32 confirmed soybean antigenic proteins, among which soybean globulin and β-conglycinin are the most immunogenic soybean antigenic proteins, accounting for 65% to 80% of the total protein in soybean seeds, and are the main antigenic proteins in soybeans.

[0082] In this embodiment, the soybean meal was ground into fine powder and then prepared into a 0.1 g / mL soybean meal suspension with a phosphate buffer solution (pH 7.5-9.0). The fermented enzyme solution of the keratinase mutant was sterilized by filtering through a 0.22 μm sterile filter membrane and diluted to 200 U / mL for standby use. The control group took 5 mL of the above suspension and added 1 mL of sterile water; the experimental group took 5 mL of the above suspension and added 1 mL of enzyme solution containing 200 U / mL keratinase. The experimental group and the control group were placed in a water bath shaker at 40°C and 100 rpm for enzymatic digestion, and the enzymatic digestion samples were removed for 2h, 4h, 8h and 16h, respectively. The enzymatic digestion and antigen protein removal were analyzed by SDS-PAGE.

[0083] from Figure 6 It can be seen that after 8 hours of enzymatic hydrolysis, the keratinase mutant can remove most of the antigenic proteins and significantly reduce allergens. At the same time, it can hydrolyze the difficult-to-digest large molecular proteins into small peptides, which can play a good growth-promoting role for livestock and poultry and other animals.

[0084] Example 6: Preparation of feed additives and animal breeding experiments

[0085] The keratinase preparation prepared in Example 4 was uniformly mixed with bile acid at a mass volume ratio of 1:1 to prepare a composite preparation. The effective components of bile acid include hyocholic acid, hyodeoxycholic acid and chenodeoxycholic acid, the weight percentage of the sum of hyocholic acid and hyodeoxycholic acid is 78.0%, the weight percentage of chenodeoxycholic acid is 20.0%, and the rest is water and ash (the total weight percentage is calculated as 100%).

[0086] Weaned piglets from a farm were selected, with a body weight of 11.3±1.84 kg / head. 30 piglets were selected for the control group, with 3 replicates and 10 piglets for each replicate; 30 piglets were selected for the experimental group, with 3 replicates and 10 piglets for each replicate. Both the control group and the experimental group were fed a low-protein diet with a crude protein content of 20%, but the experimental group also added 200 g / t of the compound preparation to the feed; they were fed separately, and the experimental period was 30 days. The feed intake of weaned piglets was regularly counted and weighed, and the feed-to-weight ratio and diarrhea index were calculated.

[0087] The results are shown in Table 1. The daily weight gain of the test group is slightly higher than that of the control group, and the feed-to-weight ratio is basically not much different. From the perspective of diarrhea index, the diarrhea index of the test group is significantly reduced, indicating that the feed additive of the present invention can reduce the crude protein in the piglet feed to a certain extent, promote protein utilization, and at the same time can play a significant role in preventing diarrhea and protecting the stomach and intestines of the piglet.

[0088] Table 1 Animal breeding test data

[0089] Daily weight gain / g Material weight ratio Diarrhea Index Control group 418±4.86 1.34±0.15 2.37±0.21 Experimental Group 426±1.74 1.33±0.059 1.42±1.12

[0090] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, it is still possible for a person skilled in the art to modify the technical solutions described in the aforementioned embodiments, or to replace some of the technical features therein by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions claimed to be protected by the present invention. Sequence Listing <110> Shandong Longchang Animal Health Products Co., Ltd. <120> Feed additive containing keratinase mutant and bile acid and application thereof <160> 14 <170> SIPOSequenceListing 1.0 <210> 1 <211> 379 <212> PRT <213> Artificial Sequence <400> 1 Met Met Arg Lys Lys Ser Phe Trp Leu Gly Met Leu Thr Ala Leu Met 1 5 10 15 Leu Val Phe Thr Met Ala Phe Ser Asp Ser Ala Ser Ala Ala Gln Pro 20 25 30 Ala Lys Asn Val Glu Lys Asp Tyr Ile Val Gly Phe Lys Ser Gly Val 35 40 45 Lys Thr Ala Ser Val Lys Lys Asp Ile Ile Lys Glu Ser Gly Gly Lys 50 55 60 Val Asp Lys Gln Phe Arg Ile Ile Asn Ala Ala Ile Ala Lys Leu Asp 65 70 75 80 Lys Glu Ala Leu Glu Glu Val Lys Asn Asp Pro Asp Val Ala Tyr Val 85 90 95 Glu Glu Asp His Val Ala His Ala Leu Ala Gln Thr Val Pro Tyr Gly 100 105 110 Ile Pro Leu Ile Lys Ala Asp Lys Val Gln Ala Gln Gly Tyr Lys Gly 115 120 125 Ala Asn Val Lys Val Ala Val Leu Asp Thr Gly Ile Gln Ala Ser His 130 135 140 Pro Asp Leu Asn Val Val Gly Gly Ala Ser Phe Val Ala Gly Glu Ala 145 150 155 160 Tyr Asn Thr Asp Gly Asn Gly His Gly Thr His Val Ala Gly Thr Val 165 170 175 Ala Ala Leu Asp Asn Thr Thr Gly Val Leu Gly Val Ala Pro Asn Val 180 185 190 Ser Leu Tyr Ala Val Lys Val Leu Asn Ser Ser Gly Ser Gly Ser Tyr 195 200 205 Ser Gly Ile Val Ser Gly Ile Glu Trp Ala Thr Thr Asn Gly Met Asp 210 215 220 Val Ile Asn Met Ser Leu Gly Gly Pro Ser Gly Ser Thr Ala Met Lys 225 230 235 240 Gln Ala Val Asp Asn Ala Tyr Ala Arg Gly Val Val Val Val Ala Ala 245 250 255 Ala Gly Asn Ser Gly Ser Ser Gly Asn Thr Asn Thr Ile Gly Tyr Pro 260 265 270 Ala Lys Tyr Asp Ser Val Ile Ala Val Gly Ala Val Asp Ser Asn Ser 275 280 285 Asn Arg Ala Ser Phe Ser Ser Val Gly Ala Glu Leu Glu Val Met Ala 290 295 300 Pro Gly Ala Gly Val Tyr Ser Thr Tyr Pro Thr Ser Thr Tyr Ala Thr 305 310 315 320 Leu Asn Gly Thr Ser Met Ala Ser Pro His Val Ala Gly Ala Ala Ala 325 330 335 Leu Ile Leu Ser Lys His Pro Asn Leu Ser Ala Ser Gln Val Arg Asn 340 345 350 Arg Leu Ser Ser Thr Ala Thr Tyr Leu Gly Ser Ser Phe Tyr Tyr Gly 355 360 365 Lys Gly Leu Ile Asn Val Glu Ala Ala Ala Gln 370 375 <210> 2 <211> 1140 <212> DNA <213> Artificial Sequence <400> 2 atgatgagga aaaagagttt ttggcttggg atgctgacgg ccttaatgct cgtgttcacg 60 atggccttca gcgattccgc gtctgctgct cagccggcga aaaatgttga aaaggattat 120 attgtcggat ttaagtcggg agtgaaaacc gcatccgtca aaaaggacat catcaaagag 180 agcggcggaa aagtggacaa gcagtttaga atcatcaacg cggcaatagc gaagctagac 240 aaagaagcgc ttgaggaagt caaaaatgat ccggatgtcg cttatgtgga agaggatcac 300 gtagctcatg ctttggcgca aaccgttcct tacggcattc ctctcattaa agcggacaaa 360 gtgcaggctc aaggctacaa gggagcgaac gtaaaagtcg ccgtcctgga tacaggaatc 420 caagcttctc atccggactt gaacgtagtc ggcggagcaa gcttcgtagc tggcgaagct 480 tataacaccg acggcaacgg acacggcacg catgttgccg gtacagtagc tgcgcttgac 540 aatacaacgg gtgtattagg cgttgcgccg aacgtatcct tgtacgcggt taaagtgctg 600 aattcaagcg gaagcggatc ttacagcggc attgtaagcg gaatcgagtg ggcgacgaca 660 aacggcatgg atgttatcaa catgagcctt ggaggaccat caggctcaac agcgatgaaa 720 caggcggttg acaatgcata tgcaagaggg gttgtcgttg tggcggctgc tgggaacagc 780 ggatcttcag gaaacacgaa tacaatcggc tatcctgcga aatacgactc tgtcatcgca 840 gttggcgcgg tagactctaa cagcaacaga gcttcatttt ccagcgtcgg agcagagctt 900 gaagtcatgg ctcctggcgc aggcgtgtac agcacttacc caaccagcac ttatgcaaca 960 ttgaacggaa cgtcaatggc ttctcctcat gtagcgggag cagcagcttt gatcttgtca 1020 aaacatccga acctttcagc ttcacaagtc cgcaaccgtc tctccagtac ggcgacttat 1080 ttgggaagct ccttctacta tggaaaaggt ctgatcaatg tcgaagctgc cgctcaataa 1140 <210> 3 <211> 379 <212> PRT <213> Artificial Sequence <400> 3 Met Met Arg Lys Lys Ser Phe Trp Leu Gly Met Leu Thr Ala Leu Met 1 5 10 15 Leu Val Phe Thr Met Ala Phe Ser Asp Ser Ala Ser Ala Ala Gln Pro 20 25 30 Ala Lys Asn Val Glu Lys Asp Tyr Ile Val Gly Phe Lys Ser Gly Val 35 40 45 Lys Thr Ala Ser Val Lys Lys Asp Ile Ile Lys Glu Ser Gly Gly Lys 50 55 60 Val Asp Lys Gln Phe Arg Ile Ile Asn Ala Ala Ile Ala Lys Leu Asp 65 70 75 80 Lys Glu Ala Leu Glu Glu Val Lys Asn Asp Pro Asp Val Ala Tyr Val 85 90 95 Glu Glu Asp His Val Ala His Ala Leu Ala Gln Thr Val Pro Tyr Gly 100 105 110 Ile Pro Leu Ile Lys Ala Asp Lys Val Gln Ala Gln Gly Tyr Lys Gly 115 120 125 Ala Asn Val Lys Val Ala Val Leu Asp Thr Gly Ile Gln Ala Ser His 130 135 140 Pro Asp Leu Asn Val Val Gly Gly Ala Ser Phe Val Ala Gly Glu Ala 145 150 155 160 Tyr Asn Thr Asp Gly Asn Gly His Gly Thr His Val Ala Gly Thr Val 165 170 175 Ala Ala Leu Asp Asn Thr Thr Gly Val Leu Gly Val Ala Pro Asn Val 180 185 190 Ser Leu Tyr Ala Val Lys Val Leu Asn Ser Ser Gly Ser Gly Ser Tyr 195 200 205 Ser Gly Ile Val Ser Gly Ile Glu Trp Ala Thr Thr Asn Gly Met Asp 210 215 220 Val Ile Asn Met Ser Leu Gly Gly Pro Ser Gly Ser Thr Ala Met Lys 225 230 235 240 Gln Ala Val Asp Asn Ala Tyr Ala Arg Gly Val Val Val Val Ala Ala 245 250 255 Ala Gly Asn Ser Gly Ser Ser Gly Asn Thr Asn Thr Ile Gly Tyr Pro 260 265 270 Ala Lys Tyr Asp Ser Val Ile Ala Val Gly Ala Val Asp Ser Asn Ser 275 280 285 Asn Arg Ala Ser Phe Ser Ser Val Gly Ala Glu Leu Glu Val Met Ala 290 295 300 Pro Gly Ala Gly Val Tyr Ser Thr Tyr Pro Thr Ser Thr Tyr Ala Thr 305 310 315 320 Leu Asn Gly Thr Ser Met Ala Ser Pro His Val Ala Gly Ala Ala Ala 325 330 335 Leu Ile Leu Val Lys His Pro Asn Leu Ser Ala Ser Gln Val Arg Asn 340 345 350 Arg Leu Ser Ser Thr Ala Thr Tyr Leu Gly Ser Ser Phe Tyr Tyr Gly 355 360 365 Lys Gly Leu Ile Asn Val Glu Ala Ala Ala Gln 370 375 <210> 4 <211> 1140 <212> DNA <213> Artificial Sequence <400> 4 atgatgagga aaaagagttt ttggcttggg atgctgacgg ccttaatgct cgtgttcacg 60 atggccttca gcgattccgc gtctgctgct cagccggcga aaaatgttga aaaggattat 120 attgtcggat ttaagtcggg agtgaaaacc gcatccgtca aaaaggacat catcaaagag 180 agcggcggaa aagtggacaa gcagtttaga atcatcaacg cggcaatagc gaagctagac 240 aaagaagcgc ttgaggaagt caaaaatgat ccggatgtcg cttatgtgga agaggatcac 300 gtagctcatg ctttggcgca aaccgttcct tacggcattc ctctcattaa agcggacaaa 360 gtgcaggctc aaggctacaa gggagcgaac gtaaaagtcg ccgtcctgga tacaggaatc 420 caagcttctc atccggactt gaacgtagtc ggcggagcaa gcttcgtagc tggcgaagct 480 tataacaccg acggcaacgg acacggcacg catgttgccg gtacagtagc tgcgcttgac 540 aatacaacgg gtgtattagg cgttgcgccg aacgtatcct tgtacgcggt taaagtgctg 600 aattcaagcg gaagcggatc ttacagcggc attgtaagcg gaatcgagtg ggcgacgaca 660 aacggcatgg atgttatcaa catgagcctt ggaggaccat caggctcaac agcgatgaaa 720 caggcggttg acaatgcata tgcaagaggg gttgtcgttg tggcggctgc tgggaacagc 780 ggatcttcag gaaacacgaa tacaatcggc tatcctgcga aatacgactc tgtcatcgca 840 gttggcgcgg tagactctaa cagcaacaga gcttcatttt ccagcgtcgg agcagagctt 900 gaagtcatgg ctcctggcgc aggcgtgtac agcacttacc caaccagcac ttatgcaaca 960 ttgaacggaa cgtcaatggc ttctcctcat gtagcgggag cagcagcttt gatcttggta 1020 aaacatccga acctttcagc ttcacaagtc cgcaaccgtc tctccagtac ggcgacttat 1080 ttgggaagct ccttctacta tggaaaaggt ctgatcaatg tcgaagctgc cgctcaataa 1140 <210> 5 <211> 379 <212> PRT <213> Artificial Sequence <400> 5 Met Met Arg Lys Lys Ser Phe Trp Leu Gly Met Leu Thr Ala Leu Met 1 5 10 15 Leu Val Phe Thr Met Ala Phe Ser Asp Ser Ala Ser Ala Ala Gln Pro 20 25 30 Ala Lys Asn Val Glu Lys Asp Tyr Ile Val Gly Phe Lys Ser Gly Val 35 40 45 Lys Thr Ala Ser Val Lys Lys Asp Ile Ile Lys Glu Ser Gly Gly Lys 50 55 60 Val Asp Lys Gln Phe Arg Ile Ile Asn Ala Ala Ile Ala Lys Leu Asp 65 70 75 80 Lys Glu Ala Leu Glu Glu Val Lys Asn Asp Pro Asp Val Ala Tyr Val 85 90 95 Glu Glu Asp His Val Ala His Ala Leu Ala Gln Thr Val Pro Tyr Gly 100 105 110 Ile Pro Leu Ile Lys Ala Asp Lys Val Gln Ala Gln Gly Tyr Lys Gly 115 120 125 Ala Asn Val Lys Val Ala Val Leu Asp Thr Gly Ile Gln Ala Ser His 130 135 140 Pro Asp Leu Asn Val Val Gly Gly Ala Ser Phe Val Ala Gly Glu Ala 145 150 155 160 Tyr Asn Thr Asp Gly Asn Gly His Gly Thr His Val Ala Gly Thr Val 165 170 175 Ala Ala Leu Asp Asn Thr Thr Gly Val Leu Gly Val Ala Pro Asn Val 180 185 190 Ser Leu Tyr Ala Val Lys Val Leu Asn Ser Ser Gly Ser Gly Ser Tyr 195 200 205 Ser Gly Ile Val Ser Gly Ile Glu Trp Ala Thr Thr Asn Gly Met Asp 210 215 220 Val Ile Asn Met Ser Leu Gly Gly Pro Ser Gly Ser Thr Ala Met Lys 225 230 235 240 Gln Ala Val Asp Asn Ala Tyr Ala Arg Gly Val Val Val Val Ala Ala 245 250 255 Ala Gly Asn Ser Gly Ser Ser Gly Asn Thr Asn Thr Ile Gly Tyr Pro 260 265 270 Ala Lys Tyr Asp Ser Val Ile Ala Val Gly Ala Val Asp Ser Asn Ser 275 280 285 Asn Arg Ala Ser Phe Ser Ser Val Gly Ala Glu Leu Glu Val Met Ala 290 295 300 Pro Gly Ala Gly Val Tyr Ser Thr Tyr Pro Thr Ser Thr Tyr Ala Thr 305 310 315 320 Leu Asn Gly Thr Ser Met Ala Ser Pro His Val Ala Gly Ala Ala Ala 325 330 335 Leu Ile Leu Glu Lys His Pro Asn Leu Ser Ala Ser Gln Val Arg Asn 340 345 350 Arg Leu Ser Ser Thr Ala Thr Tyr Leu Gly Ser Ser Phe Tyr Tyr Gly 355 360 365 Lys Gly Leu Ile Asn Val Glu Ala Ala Ala Gln 370 375 <210> 6 <211> 1140 <212> DNA <213> Artificial Sequence <400> 6 atgatgagga aaaagagttt ttggcttggg atgctgacgg ccttaatgct cgtgttcacg 60 atggccttca gcgattccgc gtctgctgct cagccggcga aaaatgttga aaaggattat 120 attgtcggat ttaagtcggg agtgaaaacc gcatccgtca aaaaggacat catcaaagag 180 agcggcggaa aagtggacaa gcagtttaga atcatcaacg cggcaatagc gaagctagac 240 aaagaagcgc ttgaggaagt caaaaatgat ccggatgtcg cttatgtgga agaggatcac 300 gtagctcatg ctttggcgca aaccgttcct tacggcattc ctctcattaa agcggacaaa 360 gtgcaggctc aaggctacaa gggagcgaac gtaaaagtcg ccgtcctgga tacaggaatc 420 caagcttctc atccggactt gaacgtagtc ggcggagcaa gcttcgtagc tggcgaagct 480 tataacaccg acggcaacgg acacggcacg catgttgccg gtacagtagc tgcgcttgac 540 aatacaacgg gtgtattagg cgttgcgccg aacgtatcct tgtacgcggt taaagtgctg 600 aattcaagcg gaagcggatc ttacagcggc attgtaagcg gaatcgagtg ggcgacgaca 660 aacggcatgg atgttatcaa catgagcctt ggaggaccat caggctcaac agcgatgaaa 720 caggcggttg acaatgcata tgcaagaggg gttgtcgttg tggcggctgc tgggaacagc 780 ggatcttcag gaaacacgaa tacaatcggc tatcctgcga aatacgactc tgtcatcgca 840 gttggcgcgg tagactctaa cagcaacaga gcttcatttt ccagcgtcgg agcagagctt 900 gaagtcatgg ctcctggcgc aggcgtgtac agcacttacc caaccagcac ttatgcaaca 960 ttgaacggaa cgtcaatggc ttctcctcat gtagcgggag cagcagcttt gatcttggaa 1020 aaacatccga acctttcagc ttcacaagtc cgcaaccgtc tctccagtac ggcgacttat 1080 ttgggaagct ccttctacta tggaaaaggt ctgatcaatg tcgaagctgc cgctcaataa 1140 <210> 7 <211> 379 <212> PRT <213> Artificial Sequence <400> 7 Met Met Arg Lys Lys Ser Phe Trp Leu Gly Met Leu Thr Ala Leu Met 1 5 10 15 Leu Val Phe Thr Met Ala Phe Ser Asp Ser Ala Ser Ala Ala Gln Pro 20 25 30 Ala Lys Asn Val Glu Lys Asp Tyr Ile Val Gly Phe Lys Ser Gly Val 35 40 45 Lys Thr Ala Ser Val Lys Lys Asp Ile Ile Lys Glu Ser Gly Gly Lys 50 55 60 Val Asp Lys Gln Phe Arg Ile Ile Asn Ala Ala Ile Ala Lys Leu Asp 65 70 75 80 Lys Glu Ala Leu Glu Glu Val Lys Asn Asp Pro Asp Val Ala Tyr Val 85 90 95 Glu Glu Asp His Val Ala His Ala Leu Ala Gln Thr Val Pro Tyr Gly 100 105 110 Ile Pro Leu Ile Lys Ala Asp Lys Val Gln Ala Gln Gly Tyr Lys Gly 115 120 125 Ala Asn Val Lys Val Ala Val Leu Asp Thr Gly Ile Gln Ala Ser His 130 135 140 Pro Asp Leu Asn Val Val Gly Gly Ala Ser Phe Val Ala Gly Glu Ala 145 150 155 160 Tyr Asn Thr Asp Gly Asn Gly His Gly Thr His Val Ala Gly Thr Val 165 170 175 Ala Ala Leu Asp Asn Thr Thr Gly Val Leu Gly Val Ala Pro Asn Val 180 185 190 Ser Leu Tyr Ala Val Lys Val Leu Asn Ser Ser Gly Ser Gly Ser Tyr 195 200 205 Ser Gly Ile Val Ser Gly Ile Glu Trp Ala Thr Thr Asn Gly Met Asp 210 215 220 Val Ile Asn Met Ser Leu Gly Gly Pro Ser Gly Ser Thr Ala Met Lys 225 230 235 240 Gln Ala Val Asp Asn Ala Tyr Ala Arg Gly Val Val Val Val Ala Ala 245 250 255 Ala Gly Asn Ser Gly Ser Ser Gly Asn Thr Asn Thr Ile Gly Tyr Pro 260 265 270 Ala Lys Tyr Asp Ser Val Ile Ala Val Gly Ala Val Asp Ser Asn Ser 275 280 285 Asn Arg Ala Ser Phe Ser Ser Val Gly Ala Glu Leu Glu Val Met Ala 290 295 300 Pro Gly Ala Gly Val Tyr Ser Thr Tyr Pro Thr Ser Thr Tyr Ala Thr 305 310 315 320 Leu Asn Gly Thr Ser Met Ala Ser Pro His Val Ala Gly Ala Ala Ala 325 330 335 Leu Ile Leu Leu Lys His Pro Asn Leu Ser Ala Ser Gln Val Arg Asn 340 345 350 Arg Leu Ser Ser Thr Ala Thr Tyr Leu Gly Ser Ser Phe Tyr Tyr Gly 355 360 365 Lys Gly Leu Ile Asn Val Glu Ala Ala Ala Gln 370 375 <210> 8 <211> 1140 <212> DNA <213> Artificial Sequence <400> 8 atgatgagga aaaagagttt ttggcttggg atgctgacgg ccttaatgct cgtgttcacg 60 atggccttca gcgattccgc gtctgctgct cagccggcga aaaatgttga aaaggattat 120 attgtcggat ttaagtcggg agtgaaaacc gcatccgtca aaaaggacat catcaaagag 180 agcggcggaa aagtggacaa gcagtttaga atcatcaacg cggcaatagc gaagctagac 240 aaagaagcgc ttgaggaagt caaaaatgat ccggatgtcg cttatgtgga agaggatcac 300 gtagctcatg ctttggcgca aaccgttcct tacggcattc ctctcattaa agcggacaaa 360 gtgcaggctc aaggctacaa gggagcgaac gtaaaagtcg ccgtcctgga tacaggaatc 420 caagcttctc atccggactt gaacgtagtc ggcggagcaa gcttcgtagc tggcgaagct 480 tataacaccg acggcaacgg acacggcacg catgttgccg gtacagtagc tgcgcttgac 540 aatacaacgg gtgtattagg cgttgcgccg aacgtatcct tgtacgcggt taaagtgctg 600 aattcaagcg gaagcggatc ttacagcggc attgtaagcg gaatcgagtg ggcgacgaca 660 aacggcatgg atgttatcaa catgagcctt ggaggaccat caggctcaac agcgatgaaa 720 caggcggttg acaatgcata tgcaagaggg gttgtcgttg tggcggctgc tgggaacagc 780 ggatcttcag gaaacacgaa tacaatcggc tatcctgcga aatacgactc tgtcatcgca 840 gttggcgcgg tagactctaa cagcaacaga gcttcatttt ccagcgtcgg agcagagctt 900 gaagtcatgg ctcctggcgc aggcgtgtac agcacttacc caaccagcac ttatgcaaca 960 ttgaacggaa cgtcaatggc ttctcctcat gtagcgggag cagcagcttt gatcttgtta 1020 aaacatccga acctttcagc ttcacaagtc cgcaaccgtc tctccagtac ggcgacttat 1080 ttgggaagct ccttctacta tggaaaaggt ctgatcaatg tcgaagctgc cgctcaataa 1140 <210> 9 <211> 379 <212> PRT <213> Artificial Sequence <400> 9 Met Met Arg Lys Lys Ser Phe Trp Leu Gly Met Leu Thr Ala Leu Met 1 5 10 15 Leu Val Phe Thr Met Ala Phe Ser Asp Ser Ala Ser Ala Ala Gln Pro 20 25 30 Ala Lys Asn Val Glu Lys Asp Tyr Ile Val Gly Phe Lys Ser Gly Val 35 40 45 Lys Thr Ala Ser Val Lys Lys Asp Ile Ile Lys Glu Ser Gly Gly Lys 50 55 60 Val Asp Lys Gln Phe Arg Ile Ile Asn Ala Ala Ile Ala Lys Leu Asp 65 70 75 80 Lys Glu Ala Leu Glu Glu Val Lys Asn Asp Pro Asp Val Ala Tyr Val 85 90 95 Glu Glu Asp His Val Ala His Ala Leu Ala Gln Thr Val Pro Tyr Gly 100 105 110 Ile Pro Leu Ile Lys Ala Asp Lys Val Gln Ala Gln Gly Tyr Lys Gly 115 120 125 Ala Asn Val Lys Val Ala Val Leu Asp Thr Gly Ile Gln Ala Ser His 130 135 140 Pro Asp Leu Asn Val Val Gly Gly Ala Ser Phe Val Ala Gly Glu Ala 145 150 155 160 Tyr Asn Thr Asp Gly Asn Gly His Gly Thr His Val Ala Gly Thr Val 165 170 175 Ala Ala Leu Asp Asn Thr Thr Gly Val Leu Gly Val Ala Pro Asn Val 180 185 190 Ser Leu Tyr Ala Val Lys Val Leu Asn Ser Ser Gly Ser Gly Ser Tyr 195 200 205 Ser Gly Ile Val Ser Gly Ile Glu Trp Ala Thr Thr Asn Gly Met Asp 210 215 220 Val Ile Asn Met Ser Leu Gly Gly Pro Ser Gly Ser Thr Ala Met Lys 225 230 235 240 Gln Ala Val Asp Asn Ala Tyr Ala Arg Gly Val Val Val Val Ala Ala 245 250 255 Ala Gly Asn Ser Gly Ser Ser Gly Asn Thr Asn Thr Ile Gly Tyr Pro 260 265 270 Ala Lys Tyr Asp Ser Val Ile Ala Val Gly Ala Val Asp Ser Asn Ser 275 280 285 Asn Arg Ala Ser Phe Ser Ser Val Gly Ala Glu Leu Glu Val Met Ala 290 295 300 Pro Gly Ala Gly Val Tyr Ser Thr Tyr Pro Thr Ser Thr Tyr Ala Thr 305 310 315 320 Leu Asn Gly Thr Ser Met Ala Ser Pro His Val Ala Gly Ala Ala Ala 325 330 335 Leu Ile Leu Phe Lys His Pro Asn Leu Ser Ala Ser Gln Val Arg Asn 340 345 350 Arg Leu Ser Ser Thr Ala Thr Tyr Leu Gly Ser Ser Phe Tyr Tyr Gly 355 360 365 Lys Gly Leu Ile Asn Val Glu Ala Ala Ala Gln 370 375 <210> 10 <211> 1140 <212> DNA <213> Artificial Sequence <400> 10 atgatgagga aaaagagttt ttggcttggg atgctgacgg ccttaatgct cgtgttcacg 60 atggccttca gcgattccgc gtctgctgct cagccggcga aaaatgttga aaaggattat 120 attgtcggat ttaagtcggg agtgaaaacc gcatccgtca aaaaggacat catcaaagag 180 agcggcggaa aagtggacaa gcagtttaga atcatcaacg cggcaatagc gaagctagac 240 aaagaagcgc ttgaggaagt caaaaatgat ccggatgtcg cttatgtgga agaggatcac 300 gtagctcatg ctttggcgca aaccgttcct tacggcattc ctctcattaa agcggacaaa 360 gtgcaggctc aaggctacaa gggagcgaac gtaaaagtcg ccgtcctgga tacaggaatc 420 caagcttctc atccggactt gaacgtagtc ggcggagcaa gcttcgtagc tggcgaagct 480 tataacaccg acggcaacgg acacggcacg catgttgccg gtacagtagc tgcgcttgac 540 aatacaacgg gtgtattagg cgttgcgccg aacgtatcct tgtacgcggt taaagtgctg 600 aattcaagcg gaagcggatc ttacagcggc attgtaagcg gaatcgagtg ggcgacgaca 660 aacggcatgg atgttatcaa catgagcctt ggaggaccat caggctcaac agcgatgaaa 720 caggcggttg acaatgcata tgcaagaggg gttgtcgttg tggcggctgc tgggaacagc 780 ggatcttcag gaaacacgaa tacaatcggc tatcctgcga aatacgactc tgtcatcgca 840 gttggcgcgg tagactctaa cagcaacaga gcttcatttt ccagcgtcgg agcagagctt 900 gaagtcatgg ctcctggcgc aggcgtgtac agcacttacc caaccagcac ttatgcaaca 960 ttgaacggaa cgtcaatggc ttctcctcat gtagcgggag cagcagcttt gatcttgttc 1020 aaacatccga acctttcagc ttcacaagtc cgcaaccgtc tctccagtac ggcgacttat 1080 ttgggaagct ccttctacta tggaaaaggt ctgatcaatg tcgaagctgc cgctcaataa 1140 <210> 11 <211> 29 <212> DNA <213> Artificial Sequence <400> 11 cggggtacca tgatgaggaa aaagagttt 29 <210> 12 <211> 29 <212> DNA <213> Artificial Sequence <400> 12 cgcccatccttattgagcgg cagcttcga 29 <210> 13 <211> 40 <212> DNA <213> Artificial Sequence <400> 13 cagcagcttt gatcttgnnk aaacatccga acctttcagc 40 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <400> 14 caagatcaaa gctgctgctc 20

Claims

1. A keratinase mutant, characterized in that: The amino acid sequence of the keratinase mutant has one of the following amino acid sequences: (1) the amino acid sequence shown in SEQ ID NO: 3; (2) the amino acid sequence shown in SEQ ID NO: 5; (3) the amino acid sequence shown in SEQ ID NO: 7; (4) The amino acid sequence shown in SEQ ID NO:

9.

2. The keratinase mutant according to claim 1, characterized in that The keratinase mutants are specifically keratinase mutant KS01 obtained by changing the serine at position 340 of the keratinase with an amino acid sequence of SEQ ID NO: 1 to valine; keratinase mutant KS02 obtained by changing the serine at position 340 of the keratinase with an amino acid sequence of SEQ ID NO: 1 to glutamic acid; keratinase mutant KS03 obtained by changing the serine at position 340 of the keratinase with an amino acid sequence of SEQ ID NO: 1 to leucine; and keratinase mutant KS04 obtained by changing the serine at position 340 of the keratinase with an amino acid sequence of SEQ ID NO: 1 to phenylalanine.

3. The gene encoding the keratinase mutant according to claim 1, characterized in that The coding gene has a nucleotide sequence as described in one of the following: (1) the nucleotide sequence shown in SEQ ID NO: 4; (2) the nucleotide sequence shown in SEQ ID NO: 6; (3) the nucleotide sequence shown in SEQ ID NO: 8; (4) The nucleotide sequence shown in SEQ ID NO:

10.

4. A recombinant expression vector comprising a gene encoding the keratinase mutant according to claim 3.

5. A recombinant engineered bacterium comprising a gene encoding the keratinase mutant according to claim 3, characterized in that: The recombinant engineering bacteria are Bacillus subtilis, Bacillus amyloliquefaciens, Bacillus pumilus and Bacillus licheniformis.

6. A feed additive, characterized in that: The feed additive contains the keratinase mutant according to claim 1 and bile acid at the same time.

7. The feed additive according to claim 6, characterized in that The feed additive is prepared by mixing an enzyme preparation obtained by fermenting, filtering and drying a recombinant engineering bacterium containing a keratinase mutant with bile acid in a mass volume ratio of 1:1-5.

8. Use of the keratinase mutant according to claim 1 or the feed additive according to claim 6 in preparing feed for promoting animal growth and reducing animal diarrhea, characterized in that: The animals are suckling piglets.

9. The use according to claim 8, characterized in that: The amount of the keratinase mutant or feed additive is 100 g / t to 500 g / t of animal feed.

Images