Application of lncRNA PTPRN2-AS1 as a prognostic marker for renal clear cell carcinoma

Abstract

The present invention relates to the application of lncRNA PTPRN2-AS1 as a prognostic marker for renal clear cell carcinoma. The present invention provides the application of LncRNA PTPRN2-AS1 in the preparation of a prognosis product for renal clear cell carcinoma patients, and specifically provides a kit for predicting the prognosis of renal clear cell carcinoma patients based on real-time fluorescence quantitative analysis. Studies have confirmed that the above-mentioned markers are upregulated in renal clear cell carcinoma tissues, and renal clear cell carcinoma patients with high expression of lncRNA PTPRN2-AS1 have a worse prognosis than renal clear cell carcinoma patients with low expression of lncRNA PTPRN2-AS1. Therefore, the expression of lncRNA PTPRN2-AS1 is used for the prognosis prediction of renal clear cell carcinoma patients, which can provide a strong molecular biological basis for the prognosis of renal clear cell carcinoma patients, and has far-reaching clinical significance and promotion value.

Description

Technical Field

[0001] The invention belongs to the technical field of renal clear cell carcinoma prognosis markers, and specifically relates to the application of non-coding RNA PTPRN2-AS1 as a renal clear cell carcinoma prognosis marker and a renal clear cell carcinoma prognosis detection kit. Background Art

[0002] The information disclosed in this background technology section is only intended to enhance the understanding of the overall background of the invention, and should not necessarily be regarded as an admission or any form of suggestion that the information constitutes the prior art already known to a person skilled in the art.

[0003] Renal parenchymal carcinoma is an adenocarcinoma originating from renal tubular epithelial cells, 85% of which are clear cell carcinomas. Therefore, clear cell renal cell carcinoma (ccRCC) is the most common renal cancer and is highly correlated with tumor metastasis, accounting for more than 75% of renal cancer-related deaths. Radical nephrectomy is generally used to treat ccRCC, but its metastasis rate through blood transport is very high, and about 60% of patients have the possibility of metastasis. Most deaths are due to tumor progression, migration and invasion, as well as postoperative recurrence. Although some treatment methods, including surgical treatment, radiotherapy and chemotherapy, have made great progress, there is currently no reference standard for the prognosis of renal clear cell carcinoma, nor are there specific indicators, which is far from meeting the needs of prognosis judgment for human renal clear cell carcinoma. Therefore, prognosis judgment for human renal clear cell carcinoma in order to select the best treatment plan and significantly improve patient survival has become an important issue that needs to be solved in the field of urology.

[0004] Long non-coding RNA (lncRNA) is a type of non-coding RNA with a length greater than 200 bp. It cannot be translated into proteins, but participates in the regulation of various physiological processes in the form of RNA. LncRNA can regulate gene expression at multiple levels, such as transcription, epigenetics, and variable splicing. In recent years, as a regulatory molecule, the application value of lncRNA in clinical diagnosis, chemotherapy sensitivity, and prognosis evaluation has gradually attracted the attention of researchers. Studies have shown that HULC is specifically and highly expressed in primary liver cancer tissues, and a high level of transcripts can also be detected in the serum of liver cancer patients. Therefore, it may become a serological marker for liver cancer testing. The expression level of HULC can be used as an indicator of tumor treatment prognosis. LncRNA PCA3 is highly expressed in prostate cancer and can be detected in urine, which is also convenient for clinical testing. LncRNA-LALR1 accelerates the cell cycle process and promotes hepatocyte proliferation by activating Wnt / β-catenin signaling. Drug target intervention of lncRNA-LALR1 to induce liver regeneration may be beneficial for the treatment of liver failure and liver transplantation. It can be seen that lncRNA has great potential as a molecular marker for diagnosis, prognosis and treatment. Summary of the invention

[0005] In the previous research work, the applicant discovered lncRNA PTPRN2-AS1 through transcriptome sequencing. The applicant extracted RNA from renal clear cell carcinoma tissues, and analyzed the expression of lncRNA PTPRN2-AS1 by real-time fluorescence quantitative PCR after reverse transcription. The results showed that lncRNA PTPRN2-AS1 was upregulated in renal clear cell carcinoma tissues, and the expression difference was statistically significant compared with that in adjacent tissues (P<0.001)( Figure 1 ). Moreover, there was a significant difference in the prognosis of patients with renal clear cell carcinoma with different expression levels of lncRNA PTPRN2-AS1. Kaplan-Meier survival analysis found that the survival rate of patients with renal clear cell carcinoma with high expression of lncRNA PTPRN2-AS1 was significantly lower than that of patients with low expression (p=0.033)( Figure 2 ). The prognostic analysis of the multivariate Cox proportional hazard model found that the relative risk of lncRNA PTPRN2-AS1 was >1, indicating that patients with high expression of lncRNA PTPRN2-AS1 had a worse prognosis than those with low expression, and high expression of lncRNA PTPRN2-AS1 was an independent risk factor for the prognostic risk prediction of patients with renal clear cell carcinoma. lncRNA PTPRN2-AS1 can be used as a specific molecular marker for the prognosis of patients with renal clear cell carcinoma.

[0006] Based on the above research results, the present invention provides the following technical solutions:

[0007] In a first aspect, the present invention provides use of lncRNA PTPRN2-AS1 as a prognostic marker for renal clear cell carcinoma.

[0008] The lncRNA PTPRN2-AS1 described in the first aspect above is located on chromosome 7p36.3, has a GeneBank accession number of NR-038966, and has a sequence as shown in SEQ ID NO:1.

[0009] Preferably, the application of the above non-coding RNA as a prognostic marker for renal clear cell carcinoma mainly includes:

[0010] (1) To evaluate the prognosis of patients with renal clear cell carcinoma based on the expression level of lncRNA PTPRN2-AS1 in clinical samples of the patients;

[0011] (2) Use the detection reagent of lncRNA PTPRN2-AS1 to develop a prognostic detection product for renal clear cell carcinoma;

[0012] (3) Screening of therapeutic active ingredients for renal clear cell carcinoma based on the changes in the expression level of lncRNA PTPRN2-AS1 in the disease model.

[0013] In the application of aspect (1) above, the clinical sample includes but is not limited to one or more of cancer lesion tissue, serum, plasma, whole blood, secretions, and body fluids; in one embodiment verified by the present invention, the clinical sample is the lesion tissue of a patient with renal clear cell carcinoma.

[0014] In the application of aspect (3) above, the disease model includes but is not limited to animal models, tissue models or cell models.

[0015] In the application of the above (2), the prognosis detection product includes but is not limited to a detection kit, a detection chip and a prognosis detection platform; in addition, the detection reagent of the lncRNA PTPRN2-AS1 includes reagents involved in various methods capable of realizing the detection of the above markers, such as transcriptome sequencing, Northern blot, real-time fluorescence quantitative PCR technology, fluorescence in situ hybridization, RNA interference and RNA binding protein immunoprecipitation. Among the above detection methods, fluorescence quantitative PCR detection is usually used as the gold standard method for non-coding RNA detection. Therefore, in an embodiment of the present invention with better effect, a detection kit for evaluating the prognosis of patients with renal clear cell carcinoma based on the fluorescence PCR method is provided.

[0016] In a third aspect, the present invention provides a renal clear cell carcinoma prognosis detection kit, wherein the kit comprises a reagent for detecting the expression level of lncRNA PTPRN2-AS1 in a patient's body based on a fluorescent PCR method.

[0017] Preferably, the detection reagents include RNA extraction reagents, reverse transcription reagents, and reagents used for cDNA quantitative PCR.

[0018] Furthermore, the RNA extraction reagent includes Trizol reagent, chloroform, isopropanol, anhydrous ethanol and RNase-Free ddH2O.

[0019] Furthermore, the reverse transcription reagent includes a reverse transcription buffer solution, FQ-RT Primer mix, Enzyme mix, and random primers used for lncRNA PTPRN2-AS1.

[0020] Furthermore, the reagents used for the cDNA quantitative PCR include lncRNA PTPRN2-AS1 real-time fluorescence quantitative PCR specific primers, U6snRNA internal reference PCR specific primers, real-time fluorescence quantitative SYBR dye, premix, RNase-FreeddH2O; In a specific embodiment of the present invention, the lncRNA PTPRN2-AS1 real-time fluorescence quantitative PCR specific primers are:

[0021] Forward primer 5′-AAACGCTCTCTGCATGTGTG-3′ (SEQ ID NO: 2),

[0022] Reverse primer 5′-TGTGTGTGAACAGTCGCTTG-3′ (SEQ ID NO: 3),

[0023] The U6snRNA internal reference PCR specific primers are as follows:

[0024] The forward primer was 5′-ATTGGAACGATACAGAGAAGATT-3′ (SEQ ID NO: 4),

[0025] The reverse primer was 5'-GGAACGCTTCACGAATTTG-3' (SEQ ID NO: 5).

[0026] Preferably, the prognosis detection kit is used as follows: (1) collecting renal clear cell carcinoma tissue and adjacent tissue removed after surgery from the individual to be tested, and extracting total RNA; (2) using total RNA as a template to reverse transcribe PTPRN2-AS1 into cDNA; (3) using PTPRN2-AS1 specific primers to perform real-time fluorescence quantitative PCR amplification to obtain the relative expression level 2-ΔΔCT , when 2 -ΔΔCT >4.09 indicates that PTPRN2-AS1 is highly expressed.

[0027] The beneficial effects of one or more of the above technical solutions are:

[0028] The detection preparation of the present invention can be used to detect the expression level of lncRNA PTPRN2-AS1 in patients with renal clear cell carcinoma, providing a strong molecular biological basis for the prognosis prediction of patients with renal clear cell carcinoma, and has far-reaching clinical significance and promotion. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] The accompanying drawings in the specification, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0030] Figure 1 Real-time fluorescence quantitative PCR was used to analyze the differential expression of lncRNA PTPRN2-AS1 in renal clear cell carcinoma tissues and adjacent tissues;

[0031] Figure 2 To investigate the relationship between lncRNA PTPRN2-AS1 and the prognosis of 35 patients with renal clear cell carcinoma. DETAILED DESCRIPTION

[0032] It should be noted that the following detailed descriptions are all illustrative and intended to provide further explanation of the present invention. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present invention belongs.

[0033] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit exemplary embodiments according to the present invention. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should be understood that when the terms "comprising" and / or "including" are used in this specification, it indicates the presence of features, steps, operations, devices, components and / or combinations thereof.

[0034] In order to enable those skilled in the art to more clearly understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below in conjunction with specific embodiments.

[0035] Example 1 Detection of lncRNA PTPRN2-AS1 in renal clear cell carcinoma tissue

[0036] 1. Preservation of renal clear cell carcinoma tissue:

[0037] The renal clear cell carcinoma tissue and adjacent tissue to be tested were collected and stored in cryovials containing RNA stabilizing solution and stored in a -80°C refrigerator.

[0038] 2. Extraction of RNA from tissues

[0039] Take about 150mg of the sample and add 1.2ml Trizol. After grinding and ultrasonic treatment, add 240μl of chloroform, mix well and centrifuge at 4℃12000g for 20min; carefully transfer the upper aqueous phase to a new 1.5ml EP tube, add an equal volume of isopropanol and gently mix, let stand at room temperature for 15min, centrifuge at 4℃12000g for 15min; discard the supernatant, add 750μl of 75% ethanol and mix well, resuspend the precipitate, centrifuge at 4℃7500g for 8min, discard the supernatant, repeat 2 times, dry at room temperature for 5min, add 40-60μl of DEPC water to dissolve RNA. Use Nanodrop to measure the concentration of RNA, the OD260 / 280 ratio is between 1.8-2.0, and store at -80℃.

[0040] 3. Reverse transcription

[0041] Use Tiangen's reverse transcription kit. The system for 20 μL reverse transcription reaction is as follows:

[0042]

[0043] Reverse transcription step 1: 42°C for 6 min

[0044]

[0045] Reverse transcription second step procedure: 42℃1h.

[0046] 4. Real-time fluorescence quantitative PCR using PTPRN2-AS1 specific primers

[0047] The PTPRN2-AS1 specific primer sequence was synthesized by Genewise Biotechnology Co., Ltd.

[0048] First, dilute the reverse transcription product cDNA by 2 times and mix well. The 20μL reaction system is as follows:

[0049]

[0050] Real-time fluorescence quantitative PCR reaction program: 94°C for 5 min, 40 cycles, 95°C for 15 s, and 60°C for 1 min.

[0051] The specific primer sequences for LncRNA PTPRN2-AS1 are:

[0052] F: 5'-AAACGCTTCTCTGCATGTGTG-3'

[0053] R: 5'-TGTGTGTGAACAGTCGCTTG-3'

[0054] 5.2 -ΔΔCT Determination of indicators

[0055] The experimental data were analyzed by relative quantitative analysis, U6 was used as the internal reference gene, and the data were analyzed by SPSS software. The analysis found that compared with adjacent tissues, the expression of lncRNA PTPRN2-AS1 in 52 cases of renal clear cell carcinoma tissues was significantly upregulated, and the difference was statistically significant (P<0.001).

[0056] 6. Prognostic analysis

[0057] Through the follow-up statistics of 52 patients with renal clear cell carcinoma used in the experiment, it was found that 15 patients could not be contacted during the follow-up due to mobile phone shutdown, number change or other reasons. Finally, 35 patients or family members of renal clear cell carcinoma who could be contacted received follow-up analysis. We asked these patients or family members in detail about the time of first onset, treatment, recurrence and death, etc. The follow-up time was 1-55 months. Among the selected patients with renal clear cell carcinoma, the expression value of fluorescence quantitative PCR analysis was selected as the reference standard. After the results were arranged in descending order, those with higher than the median were high expression of lncRNA PTPRN2-AS1, totaling 25 cases, and the others were low expression of lncRNA PTPRN2-AS1, totaling 10 cases. According to Kaplan-Meier survival analysis, patients with high expression of lncRNA PTPRN2-AS1 had a shorter survival time and poorer prognosis than those with low expression of lncRNA PTPRN2-AS1. The difference was statistically significant (P=0.033). The prognostic analysis of the multivariate Cox proportional hazard model found that the relative risk of lncRNA PTPRN2-AS1 was >1, indicating that patients with high expression of lncRNA PTPRN2-AS1 had a worse prognosis than those with low expression. Therefore, high expression of lncRNA PTPRN2-AS1 is an independent risk factor for predicting the prognostic risk of patients with renal clear cell carcinoma.

[0058] The above studies show that lncRNA PTPRN2-AS1 can be used as a specific molecular marker for the prognosis of patients with renal clear cell carcinoma.

[0059] Example 2

[0060] In this embodiment, a kit for detecting the prognosis of patients with renal clear cell carcinoma based on the marker lncRNA PTPRN2-AS1 is provided, and the kit includes the following reagents:

[0061] 1. Isopropyl alcohol 100ml

[0062] 2. Chloroform 100ml

[0063] 3.Trizol 50ml

[0064] 4.RNase-Free ddH2O 5ml

[0065] 5. 1μM random reverse transcription primer 50ul

[0066] 6. 10× reverse transcription buffer 100ml

[0067] 7. 10mM FQ-RT Primer mix 100ul

[0068] 8. 200U / μl Enzyme mix 50ul

[0069] 9. 2×Sample Premix 50ul

[0070] 10. 100μM lncRNA PTPRN2-AS1 specific primer 50ul

[0071] Forward primer 5′-AAACGCTCTCTGCATGTGTG-3′

[0072] Reverse primer 5′-TGTGTGTGAACAGTCGCTTG-3′

[0073] 11.100μM U6snRNA specific primer 50ul

[0074] The forward primer is 5′-ATTGGAACGATACAGAGAAGATT-3′

[0075] The reverse primer was 5′-GGAACGCTTCACGAATTTG-3′.

[0076] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. Use of primers for detecting lncRNA PTPRN2-AS1 in preparing a product for predicting the prognosis of renal clear cell carcinoma, wherein the sequence of the lncRNA PTPRN2-AS1 is shown in SEQ ID NO:

1.

2. The use according to claim 1, characterized in that: The primers are as follows: Forward primer 5′- AAACGCTCTCTGCATGTGTG -3′, Reverse primer 5′- TGTGTGTGAACAGTCGCTTG -3′.

3. The use according to claim 1, characterized in that The prognosis products include detection kits and detection chips.

4. The use according to claim 3, characterized in that The detection kit includes reagents for detecting the expression content of lncRNA PTPRN2-AS1 in a patient's body based on a fluorescent PCR method, including RNA extraction reagents, reverse transcription reagents, and reagents used for cDNA quantitative PCR.

5. The use according to claim 4, characterized in that The RNA extraction reagents include Trizol reagent, chloroform, isopropanol, anhydrous ethanol and RNase-Free ddH2O; Or, the reverse transcription reagents include reverse transcription buffer solution, FQ-RT Primer mix, and Enzyme mix; Alternatively, the reagents used for the cDNA quantitative PCR include U6snRNA internal reference PCR specific primers, real-time fluorescence quantitative SYBR dye, premix, and RNase-Free ddH2O.

6. The use according to claim 5, characterized in that The U6snRNA internal reference PCR specific primers are as follows: The forward primer was 5′-ATTGGAACGATACAGAGAAGATT-3′, The reverse primer was 5′-GGAACGCTTCACGAATTTG-3′.

Images