Cryptosporidium parvum cgd6_660 oocyst wall outer wall protein and uses thereof

Antibodies were prepared by using Cryptosporidium cgd6_660 oocyst wall protein and its specific peptides, which solved the problem of insufficient sensitivity and specificity in the detection of Cryptosporidium oocysts in the existing technology, and realized an efficient and economical detection method that is suitable for the detection of environmental and clinical samples.

CN116555291BActive Publication Date: 2026-03-03JILIN UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202210815180.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-07-09
Publication Date
2026-03-03
Estimated Expiration
2042-07-09

AI Technical Summary

Technical Problem

Existing technologies are difficult to detect and enrich Cryptosporidium oocysts efficiently and economically, especially in environmental samples where sensitivity and specificity are insufficient. Furthermore, existing diagnostic kits are expensive and unsuitable for large-scale applications.

Method used

We provide Cryptosporidium microsporidium cgd6_660 oocyst wall protein and its specific polypeptide, prepare corresponding antibodies for immunological detection, and achieve labeling and enrichment of oocysts by indirect immunofluorescence.

Benefits of technology

It achieves high sensitivity and specificity in the detection of Cryptosporidium microsporidium oocysts, reduces detection costs, and is suitable for the detection of environmental and clinical samples, showing broad application potential.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 220705141935
    Figure 220705141935
  • Figure 220705141940
    Figure 220705141940
  • Figure 220705141944
    Figure 220705141944
Patent Text Reader

Abstract

The application discloses application of a micro cryptosporidium cgd6_660 protein as an oocyst outer wall marker protein, and discloses that the inventors find that the cryptosporidium cgd6_660 protein is an oocyst outer wall protein, and the protein is located on the outer surface of the cryptosporidium oocyst wall. The inventors confirm the feasibility of the protein as a detection antigen. The antibody of the protein recombinant protein (as shown in a sequence table SEQ ID N0.2) can be used for immunological detection of unbroken cryptosporidium oocysts (live cryptosporidium oocysts), and the application further provides a specific polypeptide of the protein.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biological detection technology, specifically relating to the detection of the outer wall protein of Cryptosporidium microsporidium cgd6_660 oocyst wall and its application. Background Technology

[0002] Cryptosporidia is a genus of parasitic protozoa belonging to the phylum Apicomplexa, encompassing several species that infect humans or animals. Among them is Cryptosporidia microsporum, a zoonotic species. Cryptosporidium parvum ) and the human-specific "Cryptospora humanis" ( Cryptosporidium hominis Cryptosporidium and Cryptosporidium moniliforme are two major pathogens causing severe, even fatal, diarrhea worldwide; Cryptosporidium parvum can also infect many economically important animals, including cattle, goats, and sheep, causing severe diarrhea and death in their offspring. Cryptosporidium is a gastrointestinal parasite, mainly transmitted through the fecal-oral route, and hosts become infected after ingesting water or food contaminated with Cryptosporidium. It mainly parasitizes the epithelial cells of the small intestine, causing varying degrees of symptoms, primarily moderate to severe diarrhea. In immunocompetent humans and animals, cryptosporidiosis is generally self-limiting; however, in immunocompromised hosts (such as AIDS patients), it is a leading cause of death. Cryptosporidium oocysts are round or oval, with a microscopic size (e.g., Cryptosporidium parvum oocysts are about 5 micrometers in diameter), and their main structure includes the oocyst wall and the four sporozoites it encloses. They can survive in the environment for extended periods. Figure 1Cryptosporidium parvum has a unique oocyst wall structure that resists conventional sodium hypochlorite disinfection, making it a major challenge for controlling Cryptosporidium parvum contamination in food (such as vegetables and berries) and water samples (such as drinking water and recreational water). To date, there are no specific drugs or vaccines for Cryptosporidium parvum, further increasing the need for its control. Currently, methods for detecting Cryptosporidium parvum in human or animal clinical samples in the environment mainly include pathogen detection, molecular biological detection, and immunological detection of oocyst or parasite antigens. Pathogen detection allows direct microscopic observation of unstained or labeled oocysts, but this method is time-consuming, labor-intensive, and has extremely low sensitivity, requiring skilled technicians. Existing molecular biological diagnostics have high sensitivity and specificity, but require sophisticated testing equipment. Immunological detection methods have a certain degree of sensitivity and specificity, suitable for clinical examinations and environmental sample monitoring, but require antibodies that can specifically label the oocyst wall. In addition, the content of oocysts in the environment is usually highly diluted, and the content of oocysts in some clinical samples is low. For the detection of such samples, the oocysts need to be enriched and concentrated before using the above diagnostic methods (non-specific physical methods: centrifugation precipitation only; high-density liquid flotation combined with centrifugation precipitation; specific immunological methods: using small particles or magnetic beads with antibodies that can label the outer wall of Cryptosporidium oocysts to capture oocysts, and then collecting the particles or magnetic beads by centrifugation precipitation or precipitation with magnetic objects).

[0003] Currently, clinical detection methods for Cryptosporidium in China mainly rely on acid-fast staining to detect oocysts, which suffers from low specificity and poor sensitivity. However, a diagnostic kit using fluorescent antibodies to label the oocyst wall has been developed internationally. This kit utilizes an oocyst wall protein (with unknown genetic information) as an antigen (only one protein) to fluorescently label the oocyst wall for microscopic observation. This antibody has also been used for the immunological enrichment of Cryptosporidium oocysts in samples. However, this antibody-based detection kit is expensive and not easily deployed on a large scale. Furthermore, methods for detecting Cryptosporidium in environmental water samples or clinical samples using indirect immunofluorescence (IFA) are currently lacking in China, primarily because no specific protein located on the outer wall of the Cryptosporidium oocyst has yet been discovered that can be used to develop specific antibodies for labeling the oocyst outer wall. Therefore, identifying marker proteins on the outer wall of Cryptosporidium oocysts, preparing specific antibodies against the outer wall of oocysts, and establishing relevant immunological detection and sample enrichment methods are of great significance for monitoring Cryptosporidium in water samples, detecting and diagnosing clinical cryptosporidiosis, conducting epidemiological surveys of Cryptosporidium infection in humans and animals, and researching the prevention and control of zoonotic Cryptosporidium. Summary of the Invention

[0004] The purpose of this invention is to solve the above-mentioned problems and to provide a detection method for Cryptosporidium microsporidium cgd6_660 oocyst wall protein and its application.

[0005] The oocyst wall protein of Cryptosporidium microsporidium cgd6_660, whose base sequence is shown in SEQ ID NO.1 of the sequence listing, is located on the outer surface of the outer wall of the oocyst.

[0006] The amino acid sequence of the oocyst wall protein of Cryptosporidium microsporidium cgd6_660 is shown in SEQ ID NO.2 of the sequence listing.

[0007] The specific polypeptide of Cryptosporidium microsporidium cgd6_660 oocyst wall protein has the following amino acid sequence: CPPELYLTPNEQG.

[0008] An immunomodulatory agent comprising a specific polypeptide of Cryptosporidium microsporidium cgd6_660 oocyst wall protein conjugated with KLH / BSA.

[0009] The antibody against Cryptosporidium microsporidium cgd6_660 oocyst wall protein specifically binds to the outer surface of the outer wall of the Cryptosporidium microsporidium oocyst wall. It is an antibody prepared using the Cryptosporidium microsporidium cgd6_660 oocyst wall protein or the Cryptosporidium microsporidium cgd6_660 oocyst wall protein-specific polypeptide.

[0010] The application of the anti-Cryptospora cgd6_660 oocyst wall protein antibody in the detection of Cryptosporidium oocysts.

[0011] In the aforementioned application, the Cryptosporidium microsporidium is an unbroken Cryptosporidium microsporidium oocyst.

[0012] This invention provides the application of Cryptosporidium cgd6_660 protein as a marker protein for the outer wall of the oocyst. The inventors have discovered that Cryptosporidium cgd6_660 protein is an outer wall protein of the oocyst, located on the outer surface of the Cryptosporidium oocyst wall. The inventors have confirmed the feasibility of using this protein as a detection antigen. An antibody against this recombinant protein (shown in SEQ ID NO. 2) can be used for the immunological detection of unbroken Cryptosporidium oocysts (live Cryptosporidium oocysts). Furthermore, this invention also provides a specific polypeptide segment of this protein. Attached Figure Description

[0013] Figure 1 This is an amplification diagram of the target fragment of the gene;

[0014] Figure 2 This recombinant protein was used to prove that it is a protein from the outer wall of the ovum sac.

[0015] Figure 3 This is a graph showing the titer of specific polypeptide antibodies.

[0016] Figure 4 Specific polypeptide antibodies were used to confirm, via IFA, that the protein is an outer wall protein of the ovum sac.

[0017] Figure 5 The specific polypeptide antibody was used to confirm that the protein was an outer wall protein of the ovum sac.

[0018] Figure 6 Sensitivity curves for detecting different titers of peptide antibodies;

[0019] Figure 7 Specificity detection charts for different samples. Detailed Implementation

[0020] Example 1: Recombinant protein expression of the protein with gene cgd6_660 from Cryptosporidium microsporum.

[0021] I. Screening of recombinant proteins from Cryptosporidium microsporidium cgd6_660 protein

[0022] (1) Search for gene number cgd6_660 on the Cryptosporidium professional website (http: / / cryptodb.org / cryptodb / ) and download its nucleotide sequence and amino acid sequence;

[0023] (2) Construction of prokaryotic expression vectors

[0024] Primers were designed targeting the cgd6_660 base sequence. DNAMAN was used to select suitable restriction enzyme sites. The selected sites were: upstream: BamH I (GGATCC) Xho I (CTCGAA), and the specificity of the primers was compared using BLAST. The designed primers are shown in the table below:

[0025] F- CGC GGATCCGAAAAATTAACTTTAATAAATTCCTCCAATAAAA

[0026] R- CCG CTCGAATTAAAAGAATAAATTACCTAAAATTGGAG

[0027] Underlined bases are protective bases; the amplified fragment is 1833 bp in size. Its nucleotide sequence is shown in SEQ ID NO. 1. Primers were synthesized by Jilin Kumei Biotechnology Co., Ltd. The recombinant protein cgd6_660 was expressed; its amino acid sequence is shown in SEQ ID NO. 2.

[0028] Cryptosporidium microsporidium DNA was extracted and used as a template. The primers described above were added, and PCR was performed using a high-fidelity enzyme (Novizan P515-01). The reaction system consisted of: 25 µL of 2×Phanta Max Master Mix premix, 2 µL each of forward and reverse primers, 1 µL of DNA template, and 20 µL of water, for a total volume of 50 µL. The reaction program was as follows: pre-denaturation: 95℃ for 3 min; denaturation: 95℃ for 15 s; annealing: 60℃ for 30 s; extension: 72℃ for 60 s; 72℃ for 5 min, for 35 cycles. After identification by nucleic acid electrophoresis, the gene fragment was recovered using a gel extraction kit, and its concentration was measured for enzyme digestion. Simultaneously, the empty vector pET-28a was prepared.

[0029] The target fragment and the empty vector pET-28a were double-digested with enzymes. According to the enzyme instructions, the digestion system was 1 μg of plasmid. BamH I, Xho I 1 µL each; 2 µL of 10×Buffer; water to 20 µL. Enzyme digestion conditions: 37℃ water bath for 1 h, then check the digestion effect, recover the target fragment by gel, and determine its concentration. Ligate the vector and fragment according to the Solution I (Takara) instructions (fraction to vector molar ratio 5:1) in a 16℃ water bath for 30 min, then transfer to BL21 (condonplus) competent cells, plate and culture on solid medium containing kanamycin resistance, PCR identification and sequencing, and inoculate the correctly identified expression strain into K+-containing medium. + Cultured in liquid culture medium.

[0030] II. Expression and purification of recombinant proteins

[0031] (1) Screening and optimization of expression conditions

[0032] Strains successfully ligated to the pET-28a vector (His tag) were streaked, and single colonies were cultured in 5 mL of liquid medium for 8-10 h. The bacterial culture was then expanded at a 1:100 ratio for approximately 2 h. When the OD value at 600 nm reached approximately 0.6, expression was induced. IPTG was added to a final concentration of 0.1 mmol / L for induction. Three different induction temperatures and durations were set: 16℃, 12 h; 25℃, 6 h; and 37℃, 3 h. A control group without IPTG was also established to determine the optimal expression conditions.

[0033] (2) Purification of His-tagged recombinant proteins

[0034] 1) After selecting appropriate induction conditions to induce protein expression, collect the bacterial culture, centrifuge at 3500 r / min for 10 min at 4℃, and discard the supernatant.

[0035] 2) Add an appropriate amount of PBS buffer to fully suspend the precipitate.

[0036] 3) Vortex the precipitate with 20 mL of 10 mM imidazole solution, add PMSF (0.5 mmol / L) and Triton X-100 (1%) and mix well. Place the centrifuge tube in an ice-water mixture and use an ultrasonic disruptor to disrupt the bacterial cells. Set the ultrasonic parameters as follows: working time 15 min, ultrasonic 3 s, stop 3 s, power 160 W.

[0037] 4) Centrifuge the sonicated liquid at 16400 rpm / min and 4℃ for 30 min, and collect the supernatant.

[0038] 5) Use His GraviTrap TM Recombinant proteins were purified using a column. After the 20% ethanol in the nickel column had completely eluented, 20 mL of 5 mM imidazole solution was added to equilibrate the column. After the 10 mM imidazole eluent had completely eluented, the supernatant from the lysed bacterial cells was slowly added, and the column was incubated for approximately 2 hours. The eluent was then slowly passed through the nickel column. Subsequently, 20 mM, 40 mM, 60 mM, 80 mM, and 100 mM imidazole were added sequentially for washing. Finally, 1 mL of 500 mM imidazole was added, and the column was incubated for 10 minutes. The eluent was collected, and this process was repeated three times. The entire procedure was performed at 4°C.

[0039] 6) Pre-cool PBS, dialyze the protein with deimidazole, and dialyze for at least 1 hour to obtain the cgd6_660 recombinant protein. Determine the protein concentration after dialysis, and identify the recombinant protein using SDS-PAGE and Western blot.

[0040] Example 2: Animal Immunization of Recombinant Protein and Preparation of Antibodies and Indirect Immunofluorescence Detection

[0041] I. Immunization Procedures for Laboratory Animals

[0042] New Zealand white rabbits were immunized with recombinant protein. For the first immunization, 300 μg / rabbit (recombinant protein) was emulsified with an equal volume of Freund's complete adjuvant and injected intradermally at multiple sites. Two weeks after the first immunization, 150 μg / rabbit (recombinant protein) was emulsified with an equal volume of Freund's incomplete adjuvant and given as a booster immunization. A total of four immunizations were administered. Serum was collected from the marginal ear vein before the first immunization and 14 days after the fourth immunization. The serum was separated for subsequent testing.

[0043] II. Indirect Immunofluorescence Detection

[0044] For environmental or clinical samples, use saturated saline or sucrose flotation to remove most bacteria and impurities before conducting subsequent tests, and then proceed with the following steps.

[0045] (1) Treatment of coverslips: Treat coverslips with 0.1 mg / mL polylysine for 30 min, rinse once with ddH2O, and air dry at room temperature for 2 h.

[0046] (2) Sample fixation: intact Cryptosporidium oocysts were fixed with 4% paraformaldehyde at room temperature for 30 min, and excess formaldehyde was washed away with PBS.

[0047] (3) Drawing a circle and smearing the sample: Use a histological pen to draw a small circle in the center of the treated coverslip, take 30 μL of sporozoites and drop them into the small circle, and let it stand at room temperature for 1 h;

[0048] (4) Cleaning: Absorb the liquid on the coverslip and wash with PBS 3-4 times, 5 min / time;

[0049] (5) Primary antibody: Dilute the antiserum 1:50 with PBS containing 3% BSA, add 50 μL to a coverslip, and incubate at room temperature for 1 h or at 4°C overnight. (Note: For verification of the outer wall protein of the oocyst: If the antibody is incubated for 15 min and the sample is not permeabilized, and it stains with green fluorescence (the prepared antibody recognizes this protein), then it proves that the protein is the outer wall protein of the oocyst.) Figure 1 ).

[0050] (6) Secondary antibody: After washing with PBS, add Alexa Fluor® 488 goat anti-rabbit IgG (1:1000) to each well and incubate at 37 ℃ in the dark for 1 h.

[0051] (7) Nucleus staining: Wash with PBS, add DAPI (4',6-diamidinyl-2-phenylindole) to each well to a final concentration of 1 µg / mL, stain the nucleus at room temperature in the dark for 5 min, and wash with PBS 3-4 times.

[0052] (8) Mounting: Add one drop of anti-fluorescence quenching mounting solution (Beyotime, P0126-5 mL), and observe the slide under a fluorescence microscope after mounting with the mounting solution.

[0053] The results are as follows Figure 1 As shown, the recombinant protein antibodies all confirmed that the protein is an outer wall protein of the Cryptosporidium oocyst wall, and the fluorescence signal was strong, indicating that the protein has potential value in establishing detection methods. To more accurately confirm that it is an outer wall protein of the oocyst wall and to maximize the sensitivity and specificity of detection, we designed a polypeptide sequence with good specificity for further evidence.

[0054] Example 3: Screening of Cryptosporidium microsporidium cgd6_660-specific peptides

[0055] (1) Search for gene number cgd6_660 on the Cryptosporidium professional website (http: / / cryptodb.org / cryptodb / ) and download its amino acid sequence;

[0056] (2) Design of specific peptides

[0057] Screening for specific peptides:

[0058] The downloaded amino acid sequence of the gene was input into swissmodel.expasy.org to predict its spatial structure and identify polypeptide fragments of 10-14 amino acids located in the loop region. Then, using iedb.org, its B-cell epitopes were analyzed, and fragments with high prediction values ​​were selected. Finally, specificity alignment analysis was performed using NCBI, and fragments with high specificity were selected for synthesis.

[0059] (3) In order to enhance the coupling efficiency of the peptide with KLH and BSA, peptides containing cysteine ​​were selectively avoided during peptide design, and a cysteine ​​residue was artificially added to the end of peptides that did not have a cysteine ​​residue at the N-terminus or C-terminus. The designed peptide sequence is: CPCELYLTPNEQG, which was synthesized by Shanghai Qiangyao Biotechnology Co., Ltd.

[0060] (4) Coupling of peptide with KLH / BSA: First, dissolve 1 mg of KLH / BSA in 200 µL of ddH2O. Dissolve 200 µg of MBS (m-maleimide benzoyl-N-hydroxysuccinimide) in 0.04 mL of DMF (dimethylformamide) solution and add it to the carrier protein solution. Mix well at RT for 2 h and dialyze overnight with PBS. Dissolve 2 mg of peptide in 0.4 mL of PBS, and add the overnight dialyzed mixture to two peptide solutions respectively. React at RT for 4 h, dialyze for 12 h, aliquot into 20 µL and store at -20℃. Identify the above-conjugated BSA-peptide using SDS-PAGE.

[0061] Example 4: Animal Immunization and Preparation and Titer Determination of Polyclonal Antibodies

[0062] I. Immunization Procedures for Laboratory Animals

[0063] New Zealand white rabbits were immunized with successfully conjugated peptide (CPPELYLTPNEQG)-KLH. For the first immunization, the conjugated peptide (300 μg / rabbit) was emulsified with an equal volume of Freund's complete adjuvant and injected intradermally at multiple sites. Two weeks later, peptide-KLH (150 μg / rabbit) was emulsified with an equal volume of Freund's incomplete adjuvant as a booster immunization, for a total of four immunizations. Serum samples were collected from the marginal ear vein before the first immunization and 14 days after the fourth immunization; serum was separated and used for antibody titer determination.

[0064] II. Detection of serum antibody titers using indirect ELISA method

[0065] Using conjugated BSA peptides as the coating antigen, pre-immunization serum served as a negative control, serum after four immunizations served as the primary antibody, and alkaline phosphatase (AP)-labeled goat anti-rabbit IgG (H+L) served as the secondary antibody, indirect ELISA was performed. The final concentration of the coating antigen was 5 μg / mL. Serum was serially diluted starting at 1:500, and the secondary antibody was diluted 1:20000. After adding the chromogenic buffer, the A405 value was measured using an ELISA reader.

[0066] (1) Coating antigen: Dilute the successfully conjugated peptide-BSA 5 µg / mL with Coating Buffer (0.05 M carbonate buffer at pH 9.6), 50 µL / well, 37°C for 1 h, then overnight at 4°C; or proceed to the next step after 2 h at 37°C.

[0067] (2) Washing the plate: Wash the plate with Washing Buffer (0.05% Tween-20, 8g NaCl / L) and use an ELISA plate washer to wash the plate 3-4 times, with an interval of 4 min each time.

[0068] (3) Blocking: Add 100µL of Blocking Buffer (3% BSA in 0.05 M carbonate buffer at pH 9.6) per well and incubate at 37°C for 1 h.

[0069] (4) Washing the plate: Same as step (2).

[0070] (5) Incubation of primary antibody: Dilute the antibody with Tween Buffer (PBS solution containing 0.5% BSA and 0.05% Tween-20). Use serum before the first immunization as negative control, serum after the last immunization as positive antibody, and serum before immunization as negative control. Dilute the antibody at dilution ratios of 1:500, 1:1000, 1:2000, 1:4000, 1:8000, 1:16000, and 1:32000. Use 50 µL per well and incubate at 37°C for 1 h.

[0071] (6) Washing the plate: Same as (2)

[0072] (7) Incubation with enzyme-labeled secondary antibody: Use Tween Buffer, dilute alkaline phosphatase-labeled goat anti-rabbit IgG (H+L) 1:20000 as secondary antibody, 50 µL / well, incubate at 37℃ for 1 h.

[0073] (8) Washing the board: Same as (2)

[0074] (9) Color development: Prepare a 1 mg / mL color development solution (PNPP substrate color development) using color development buffer, 50 µL / well, and develop the color at 37℃ in the dark for 10-20 min. Then, use an ELISA reader to detect the A405 reading. Use the BSA-conjugated peptide as the detection coating antigen and use the ELISA method to detect the antibody titer of rabbit serum immunized with KLH-peptide.

[0075] The results are as follows Figure 2 As shown, after four immunizations of rabbits, the effective serum titer reached 1:32,000, which was sufficient for subsequent experiments.

[0076] Example 5 Immunoelectron microscopy labeling

[0077] Immunoelectron microscopy was used to label the specific peptides, which further confirmed that they were proteins of the outer wall of the ovum sac.

[0078] I. Preparation of Electron Microscopy Samples

[0079] (1) Decapsulation: Cryptosporidium microsporidium oocysts were incubated in decapsulation solution (incomplete culture medium containing 0.75% sodium taurocholate) at 37°C for 1 h.

[0080] (2) Fixation: Fix with 4% paraformaldehyde-0.1% glutaraldehyde at room temperature for 2 h, and wash three times with maleate buffer (containing 0.5 mM maleate) for 30 min each time.

[0081] (3) Block staining: Incubate the sample with maleate buffer containing 0.5% uranium acetate at 20°C for 30 min, and wash three times with maleate buffer for 15 min each time.

[0082] (4) Agglutination: In a 50 ℃ water bath, the fixed parasites were blown evenly with completely dissolved 2% low melting point agarose. After being left at room temperature for 30 min to fully solidify, they were cut into pieces of ~0.5 mm. 3 Small pieces.

[0083] II. Dehydration and Soaking of Samples

[0084] (1) Gradient dehydration of ethanol: 30% alcohol at 4 ℃ for 30 min; 50% alcohol at 4 ℃ for 1 h; 70%, 80%, and 90% alcohol at -20 ℃ for 1 h each; 100% alcohol twice for 1 h each.

[0085] (2) Pre-soaking: Anhydrous ethanol: LR-White (2:1) - 20℃ for 1 h; Anhydrous ethanol: LR-White (1:1) - 20℃ for 1 h; Anhydrous ethanol: LR-White (1:2) - 20℃ for 1 h.

[0086] (3) Soaking: The sample was soaked in LR-White at -20℃ overnight; the sample was soaked in LR-White at -20℃ for 24 h; the sample was soaked in LR-White at -20℃ for 12 h.

[0087] (4) Polymerization: The sample was embedded in LR-White. The sample was placed in a gelatin capsule, filled with LR-White, and polymerized under UV light at -15℃ for 24 h.

[0088] III. Immunomarking

[0089] (1) Positioning and ultrathin sectioning: The semi-thin section is 1.5 µm thick. The ultrathin section is selected from the parasite-rich area. The ultrathin section is 80 nm thick. The section is retrieved with a copper mesh coated with an aromatic film. After passing the electron microscopy inspection, the section is retrieved with a nickel mesh coated with an aromatic film for subsequent gold labeling.

[0090] (2) Sealing: Invert the nickel mesh onto PBS containing 5% skim milk and 0.01% TWEEN 20 (PBS-MT) and incubate at room temperature for 1 h.

[0091] (3) Primary antibody: Dilute the antibody in PBS-MT, incubate overnight at 4°C, and wash with PBS for 2 min × 8 times.

[0092] (4) Secondary antibody: Dilute Goat anti-Rabbit IgG (10 nm Gold) 1:50 in PBS-MT, incubate at 37 ℃ for 1 h, wash with PBS for 1 min × 4 times, and wash with deionized water for 1 min × 4 times.

[0093] (5) Post-fixation: Fix with 2% glutaraldehyde for 10 min, then wash with deionized water for 1 min × 4 times.

[0094] (6) Staining: Insert the nickel mesh into 2% uranium acetate for staining for 15 min, and wash with deionized water for 2 min × 8 times.

[0095] Example 6: Indirect immunofluorescence detection of samples

[0096] For environmental or clinical samples, use saturated saline or sucrose flotation to remove most bacteria and impurities before conducting subsequent tests, and then proceed with the following steps.

[0097] (1) Treatment of coverslips: Treat coverslips with 0.1 mg / mL polylysine for 30 min, rinse once with ddH2O, and air dry at room temperature for 2 h.

[0098] (2) Sample fixation: Intact oocysts were fixed with 4% paraformaldehyde at room temperature for 30 min, and excess formaldehyde was washed away with PBS.

[0099] (3) Drawing a circle and smearing the sample: Use a histological pen to draw a small circle in the center of the treated coverslip, take 30 μL of sporozoites and drop them into the small circle, and let it stand at room temperature for 1 h;

[0100] (4) Cleaning: Absorb the liquid on the coverslip and wash with PBS 3-4 times, 5 min / time;

[0101] (5) Primary antibody: Dilute 1 μL of anti-peptide serum 1:50 with PBS containing 3% BSA (bovine serum albumin), then add 50 μL to a coverslip and incubate at room temperature for 1 hour or at 4°C overnight. (Note: For verification of oocyst wall outer wall proteins: If the antibody is incubated for 15 minutes and the sample is not permeabilized, and fluorescence is observed, then the protein is an oocyst wall outer wall protein.) Figure 1 ).

[0102] (6) Secondary antibody: After washing with PBS, add Alexa Fluor® 488 goat anti-rabbit IgG (1:1000) to each well and incubate at 37 ℃ in the dark for 1 h.

[0103] (7) Nucleus staining: Wash with PBS, add DAPI (4',6-diamidinyl-2-phenylindole) to each well to a final concentration of 1 µg / mL, stain the nucleus at room temperature in the dark for 5 min, and wash with PBS 3-4 times.

[0104] (8) Mounting: Add one drop of anti-fluorescence quencher, mount the slide with mounting solution, and observe it under a fluorescence microscope.

[0105] like Figure 4-5 As shown, the specific polypeptide antibody can sensitively and specifically recognize the oocyst wall of Cryptosporidium, and the rabbit serum antibody against this polypeptide has good sensitivity, such as... Figure 6 As shown, the fluorescence intensity was very bright when the serum was diluted 1:50. As the antibody was continuously diluted, the fluorescence intensity gradually weakened. When the serum was diluted to 1:800, there was still a weak fluorescence. This experiment shows that the serum antibody sensitivity is very good.

[0106] (Note: For verification of proteins on the outer wall of the oocyst: antibody incubation for 15 min, without permeabilization of the sample (using reagents such as Tritol or SDS), means the antibody can only recognize proteins on the outer wall of the oocyst. If the fluorescence intensity of the antibody corresponding to that protein is relatively obvious, it indicates that the antibody recognizes the protein on the outer wall of the oocyst.) Figure 1 (As shown).

[0107] In the detection of samples in the environment, such as Figure 7 As shown, the polypeptide antibody only recognizes Cryptosporidium oocysts (Cryptospora microsporidium and Cryptosporidium taizer in the above image) and does not cross-react with other species (Escherichia coli, coccidia, Giardia lamblia), indicating that the antibody has good specificity.

[0108] Therefore, selecting this outer wall protein of the oocyst as a candidate antigen has great potential as a diagnostic reagent for detecting Cryptosporidium in environmental water samples or clinical samples.

Claims

1. A Cryptosporidium parvum cgd6_660 oocyst wall protein specific polypeptide characterized by: The amino acid sequence of the polypeptide is: CPPELYLTPNEQG.

2. An immunological preparation, characterized by: The polypeptide specific to the microsporidium cgd6_660 oocyst wall protein of claim 1 is coupled with KLH / BSA.

3. A polyclonal antibody against a Cryptosporidium parvum cgd6_660 oocyst wall protein specific polypeptide characterized by: The polyclonal antibody prepared by using the immunological preparation of claim 2 can specifically bind to the outer surface of the outer wall of the Cryptosporidium oocyst wall.

4. The polyclonal antibody of the anti-microsporidium cgd6_660 oocyst wall protein specific polypeptide of claim 3 in the preparation of a Cryptosporidium oocyst detection kit.

5. Use according to claim 4, characterized in that: The microsporidium is unbroken Cryptosporidium oocyst.