Chimeric VSV Recombinant Virus Expressing Nipah Virus Envelope Glycoprotein and Its Application
By constructing chimeric viruses rVSV△G/NiVMYGF and rVSV△G/NiVBDGF that lack the VSV G protein, the safety and efficacy issues of Nipah virus F and G protein expression were resolved, enabling efficient vaccine and diagnostic testing applications and improving biosafety and production efficiency.
Patent Information
- Application Number
- CN202410143819.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-02-01
- Publication Date
- 2026-06-30
- Estimated Expiration
- 2044-02-01
Smart Images

Figure BDA0004693465940000081 
Figure BDA0004693465940000091 
Figure HDA0004693465950000011
Abstract
Description
Technical Field
[0001] This invention belongs to the field of virology, specifically relating to a chimeric VSV recombinant virus expressing Nipah virus envelope glycoprotein and its applications. Background Technology
[0002] Nipah disease is a serious and highly virulent zoonotic disease caused by Nipah virus (NiV). Its natural host is the fruit bat, and it can infect livestock such as pigs, horses, cattle, and sheep, as well as pets such as dogs and cats. Pigs are the intermediate amplification host for NiV. NiV is classified as a Biosafety Level IV pathogen and a key pathogen for bioterrorism prevention. The WHO has listed it as a priority pathogen in its blueprint for responding to potential pandemic risks, and my country has classified it as a Category I animal disease for focused prevention. The mortality rate of Nipah disease is 40%-100%, causing severe respiratory failure and neurological symptoms. Pigs are extremely susceptible, with mild symptoms, but can shed large amounts of the virus, making them one of the key risk factors for the spread of the disease. The disease is not pathogenic to its natural host, the fruit bat, but it can shed the virus and transmit it to humans through contaminated food in bodily fluids and excrement, which is the main mode of NiV transmission in the South Asian subcontinent in recent years. Human-to-human transmission can also occur through close contact. Since its discovery, Nipah disease has broken out almost every year in neighboring countries such as India and Bangladesh. my country is the world's largest pig-producing country and is located on the migration route of fruit bats. Therefore, my country faces a serious threat from Nipah disease: First, there is a high risk of imported cases, mainly due to bat migration carrying the virus or smuggling goods across borders; second, there is a risk of primary transmission, with studies reporting that bat sera in multiple provinces of my country are serologically positive for Nipah (like) virus; two novel Hennipa viruses (MjoV and LayV) have been discovered in Yunnan and Shandong provinces of my country. The above evidence indicates the presence of Hennipa virus in the natural environment of my country, which may cause potential disease outbreaks and epidemics.
[0003] NiV belongs to the genus Henipavirus in the family Paramyxoviridae. NiV is a member of the subfamily Paramyxovirinae within the family Paramyxoviridae, and together with Hendra virus (HeV), forms the genus Henipavirus. Nipavirus contains a single-stranded RNA of approximately 18,000 nucleotides, which binds to viral proteins of the replication complex (nucleoprotein (N), phosphoprotein (P), and polymerase (L)). The single-stranded RNA is surrounded by a lipid bilayer membrane containing attachment protein (G) and fusion protein (F) (Chua, 2000, Science. 288: 1432-5; Wang, et al. 2001, Microbes and Infection 3, 279-287; Chan, et al. 2001, J GenVirol. 82: 2151-5).
[0004] NiV virus particles are pleomorphic, enveloped, and most are irregularly spherical, with a diameter of approximately 150-200 nm. A few virus particles are filamentous, reaching lengths of up to 10,000 nm. NiV has two main genetic lineages: NiV Malaysia (NiV-MY) and NiV Bangladesh (NiV-BD). The NiV-MY genome has 18,246 nucleotides, while the NiV-BD genome has 18,252 nucleotides. The currently circulating strain is the Malaysian strain, which has 12 more bases than HeV and encodes at least six proteins: N (nucleoprotein), P (phosphoprotein), M (matrix protein), F (fusion protein), G (receptor-binding protein), and L (polymerase). Among these, the N protein, P protein, and L polymerase together form the replication complex, which binds to the viral RNA and is involved in viral genome transcription and replication; the M protein is involved in maintaining the viral envelope morphology; and the F and G proteins are involved in protein fusion and adsorption, and are related to viral invasion. Nipah virus (NiV) contains two membrane-anchoring glycoproteins within its envelope: the G protein and the F protein. The G protein, a type II transmembrane glycoprotein, consists of 602 amino acids. Its N-terminus is located inside the membrane, with a very short intramembrane portion. A hydrophobic transmembrane domain is located near the N-terminus, while the C-terminus is located outside the membrane. It consists of a "spherical" head region and a relatively long "outer stem" region. The G protein can bind to host cell membrane proteins ephrin-B2 and ephrin-B3. The F protein is a type I transmembrane glycoprotein located on the surface of the viral particle. Its main function is to mediate the fusion of the viral envelope with the host cell membrane, thereby allowing the viral genome to enter the cell. Like the G protein, the F protein is also a major immunoprotective antigen of Nipah virus, causing immunized animals to produce neutralizing antibodies. Neutralizing antibodies against the G and F proteins are the most important immune mechanisms for protection against Nipah disease. During its invasion of host cells, NiV binds to receptors ephrin-B2 / B3 via its surface glycoprotein G. This triggers a conformational change in the fusion protein F within the receptor-binding region and stem region, thereby activating F to fuse with the cell membrane, ultimately allowing the virus to invade the cell. These two proteins are highly conserved on the host cell surface, making F and G the primary targets for antiviral and vaccine research.
[0005] Guillaume et al. immunized hamsters with recombinant poxvirus expressing Nipah virus G or F proteins and prepared hyperimmune serum. Passive immunization of hamsters with hyperimmune serum could protect them against lethal doses of Nipah virus (Guillaume V, Contamin H, Loth P, Georges-Courbot MC, Lefeuvre A, Marianneau P, Chua KB, Lam SK, Buckland R, Deubel V et al: Nipah virus: vaccination and passive protection studies in a hamster model. J Virol 2004, 78(2): 834-840.), indicating that neutralizing antibodies play an important role in the body's defense against and clearance of Nipah virus. Kaku et al.'s study compared serum dilution titers obtained from neutralization tests using Nipah virus G and F protein envelope-chimeric vesicular stomatitis pseudovirus particles and live Nipah virus, finding a positive correlation between the serum neutralization titers obtained by the two methods (Kaku Y, Noguchi A, Marsh GA, McEachern JA, Okutani A, Hotta K, Bazartseren B, Fukushi S, Broder CC, Yamada A et al: A neutralization test for specific detection of Nipah virus antibodies using pseudotypedvesicular stomatitis virus expressing green fluorescent protein. J VirolMethods 2009, 160(1-2): 7-13.). Patent CN113372454B discloses a study using Nipah virus receptor-binding glycoprotein (G) as the research object. The study utilizes mammalian cells for soluble expression, purification, and the preparation of specific serum through immunization of mice. Results show that the Nipah virus G protein is solublely expressed in Expi293F cells, and the purified target protein is of the correct size with a purity greater than 99%. The prepared antiserum specifically binds to the target protein. Patent HK1096431A confirms that the Nipah virus G glycoprotein causes attachment to the cell receptor, while the F glycoprotein induces fusion between the virus and the cell membrane. G and F work synergistically to induce fusion; that is, vaccines expressing Nipah virus proteins only induce fusion during co-infection (i.e., G+F).Patent CN102533675A discloses a recombinant Newcastle disease virus LaSota vaccine strain expressing Nipah encephalitis virus F protein, its preparation method, and its application. The Nipah virus F gene was inserted into the LaSota genome as an independent transcription unit, and a recombinant Newcastle disease virus rLa-NiVF expressing Nipah virus F protein was successfully constructed and rescued. The experimental results show that rLa-NiVF can correctly express Nipah virus F protein, and the recombinant virus maintains the same high chicken embryo growth titer and high safety for mammals as the LaSota vaccine strain. Patent CN102559612B discloses a recombinant Newcastle disease virus LaSota vaccine strain expressing Nipah encephalitis virus G protein, its preparation method, and its application. Specifically, it discloses the successful construction of a recombinant Newcastle disease virus live vector vaccine rLa-NiVG expressing Nipah virus G protein using a reverse genetics technique with a LaSota attenuated Newcastle disease virus strain as a vector. This demonstrates that rLa-NiVG can correctly express the Nipah virus G protein, and the recombinant virus maintains the same high chicken embryo growth titer and high safety for mammals as LaSota.
[0006] This application constructs a chimeric viral strain co-expressing G and F proteins using vesicular stomatitis virus (VSV) as a vector, providing a new approach for the effective prevention and control, diagnosis and detection, vaccine preparation, and preparation of antiviral therapeutic products for Nipah disease. Summary of the Invention
[0007] This study used vesicular stomatitis virus (VSV) lacking the VSV G protein as a vector to construct chimeric viral strains co-expressing the G and F proteins of NiV Malaysian strain (NiV-Malaysia, NiVMY) and Bangladeshi strain (NiV-Bangladesh, NiVBD), respectively. The constructed strains were rVSV△G / NiVMYGF and rVSV△G / NiVBDGF. This virus can fully express the F and G proteins of Nipah virus on the surface of vesicular stomatitis virus (VSV) particles lacking the VSV G protein, ensuring the integrity of the virus and making it replicable. At the same time, this virus has better biosafety and can be used for routine detection and preparation of products.
[0008] Based on this, the present invention was completed.
[0009] In a first aspect, the present invention provides a chimeric recombinant VSV virus strain co-expressing NiV G and F proteins, wherein the chimeric recombinant VSV virus strain is rVSV△G / NiVMYGF and rVSV△G / NiVBDGF; vesicular stomatitis virus rVSV△G / NiVMYGF, accession number: CCTCC NO: V2023110, accession date: 2023.12.18, depositary institution: China Center for Type Culture Collection; vesicular stomatitis virus rVSV△G / NiVBDGF, accession number: CCTCC NO: V2023111, accession date: 2023.12.18, depositary institution: China Center for Type Culture Collection.
[0010] In a second aspect, the present invention provides a composition comprising chimeric VSV recombinant virus strains rVSV△G / NiVMYGF and rVSV△G / NiVBDGF.
[0011] Furthermore, the chimeric VSV recombinant virus strain may also be its nucleotide or its protein.
[0012] Furthermore, the protein also includes its protein fusions and derivatives.
[0013] Furthermore, the compositions include, but are not limited to, pharmaceutical compositions and immunomodulatory agents.
[0014] Thirdly, the present invention provides the use of chimeric VSV recombinant virus strains rVSV△G / NiVMYGF and rVSV△G / NiVBDGF in the preparation of formulations for the prevention or treatment of diseases caused by Nipah virus infection.
[0015] Furthermore, the preparation may also be a vaccine or a vaccine composition thereof.
[0016] Furthermore, the vaccine composition also contains an adjuvant.
[0017] Furthermore, the adjuvant is selected from oil-in-water adjuvants, polymer and water adjuvants, water-in-oil adjuvants, aluminum hydroxide adjuvants, vitamin E adjuvants, and combinations thereof.
[0018] Furthermore, the vaccine composition further comprises at least one additional antigen.
[0019] Furthermore, the route of administration of the formulation is selected from: oral administration, sublingual administration, gastric or intestinal administration, local administration, injection administration, intravenous injection, subcutaneous injection, intramuscular injection, transdermal administration, and / or inhalation administration.
[0020] Furthermore, the formulation may be: tablets, capsules, powders, injections, syrups, solutions, sustained-release agents, immediate-release agents, controlled-release agents, emulsions, microemulsions, nanoformulations, targeted formulations, suppositories, ointments, gels, solid dispersions, inclusion complexes, and / or patches.
[0021] Fourthly, the present invention provides an antibody against Nipah virus, which is prepared from chimeric VSV recombinant virus strains rVSV△G / NiVMYGF and rVSV△G / NiVBDGF.
[0022] Furthermore, the chimeric VSV recombinant viruses are rVSV△G / NiVMYGF and rVSV△G / NiVBDGF; vesicular stomatitis virus rVSV△G / NiVMYGF, accession number: CCTCC NO: V2023110, accession date: 2023.12.18, depositary institution: China Center for Type Culture Collection; vesicular stomatitis virus rVSV△G / NiVBDGF, accession number: CCTCC NO: V2023111, accession date: 2023.12.18, depositary institution: China Center for Type Culture Collection.
[0023] Furthermore, the antibody also includes its primers: the primers are as follows:
[0024] NiVMY-FF:
[0025] GGACGAGCTGTACAAGTAAGCTAGCTATGAAAAAAACTAACAGATATCACGACGC GTACAACCATGGTAGTTATACTTGACAAGAGATG; (SEQ ID NO. 1)
[0026] NiVMY-FR:
[0027] AGAGGCTGGAATTAGGAGACTGAGTAAACCGGGGATTGTTCAGAAGCTAGAAGTT AGGGGATTGTTCAGAAGCTAGAAGTTAGACAGCCTATGTCCCAATGTAGTAGAGATCC CC; (SEQ ID NO. 2)
[0028] NiVMY-GF:
[0029] GTCTCCTAATTCCAGCCTCTCGAACAACTAATATCCTGTCTTTTCTATCCCTATGAA AAAAACTAACAGAGATCGATCTGTTTACGCGTACAACCATGCCGGCAGAAAACAAGA AAGTTAG;(SEQ ID NO.3)
[0030] NiVMY-G-R:
[0031] GTCCAAACATGAAGAATCTGGCTAGCTTATGTACATTGCTCTGGTATCTTAACC;(SEQ ID NO.4)
[0032] NiVBD-F-F:
[0033] TGGACGAGCTGTACAAGTAAGCTAGCTATGAAAAAAACTAACAGATATCACGACG CGTACAACCATGGCAGTTATACTTAACAAGAGATA;(SEQ ID NO.5)
[0034] NiVBD-F-R:
[0035] AGAGGCTGGAATTAGGAGACTGAGTAAACCGGGGATTGTTCAGAAGCTAGAAGTT AGGGGATTGTTCAGAAGCTAGAAGTTAGACTAGCCTATGTCCCAATGTAATAGAGATCC CC;(SEQ ID NO.6)
[0036] NiVBD-G-F:
[0037] GTCTCCTAATTCCAGCCTCTCGAACAACTAATATCCTGTCTTTTCTATCCCTATGAA AAAAACTAACAGAGATCGATCTGTTTACGCGTACAACCATGCCGACAGAAAGCAAGA AAGTTAG;(SEQ ID NO.7)
[0038] NIVBD-G-R:
[0039] GTCCAAACATGAAGAATCTGGCTAGCTTATGTACATTGCTCTGGTATCTTAAC;(SEQ ID NO.8)
[0040] Fifthly, the present invention provides a preparation for diagnosing diseases caused by Nipah virus infection; said preparation contains an anti-Nipah virus antibody as described in the fourth aspect.
[0041] Furthermore, the preparation may be a reagent or kit for diagnostic testing.
[0042] In a sixth aspect, the present invention provides a chimeric VSV recombinant virus, a composition thereof, and the use of the composition thereof in the preparation of an antibody against Nipah virus.
[0043] Furthermore, the antibodies include, but are not limited to, monoclonal antibodies, genetically engineered antibodies, multifunctional antibodies, and antibodies prepared using phage technology.
[0044] Furthermore, the antibodies include, but are not limited to, diagnostic reagents and antibody therapeutic agents.
[0045] Furthermore, the antibody also includes its primers: the primers are shown in SEQ ID NO.1-SEQ ID NO.8.
[0046] Beneficial effects
[0047] 1. This application uses VSV as a live viral vector, which has several advantages: ① It efficiently and stably expresses the Nipah virus F and G proteins on the viral envelope surface, which is helpful for research on pathogens with high biosafety requirements; ② Viral genome replication and assembly are completed in the cytoplasm, without the risk of host gene recombination, and as a vaccine vector, there is no risk of reverse transcription activity or integration into the host genome, resulting in high safety; ③ The genome is simple and easy to modify, and can simultaneously express the Nipah virus G and F proteins; ④ Human pre-existing immunity is low, and there is no pre-existing immunity problem against the viral vector, exhibiting a certain degree of self-limitation; ⑤ It induces strong humoral and cellular immune responses; ⑥ VSV can achieve high viral titers by proliferating in most mammalian cells.
[0048] 2. The chimeric VSV recombinant virus strains rVSV△G / NiVMYGF and rVSV△G / NiVBDGF constructed in this application have good immunogenicity and biological activity; they can be detected under routine experimental conditions, especially the Nipah virus in samples, without the need for special experimental conditions, and have high safety with no risk of infection.
[0049] 3. The chimeric viruses rVSV△G / NiVMYGF and rVSV△G / NiVBDGF constructed in this application, lacking the VSV G protein, exhibit good immunogenicity and biological activity. Immunoelectron microscopy shows that they can embed into the surface of viral particles. Immunization of mice with inactivated chimeric viruses induced high levels of neutralizing antibodies, with neutralizing antibody titers reaching 640-fold and 512-fold, respectively. Therefore, both viruses have high growth titers, good immunogenicity, and good safety, which can improve the efficiency of large-scale production and facilitate safe production management, making them ideal strains for NiV inactivated vaccines.
[0050] 4. The chimeric viruses rVSV△G / NiVMYGF and rVSV△G / NiVBDGF constructed in this application, lacking the VSV G protein, can serve as important viral resources for the effective prevention, diagnosis, testing, vaccine preparation, and antiviral treatment of Nipah disease in the future, based on their complete viral structure, higher immunogenicity, and better safety. Attached Figure Description
[0051] Figure 1 Immunofluorescence results of rVSV△G / NiVMYGF and rVSV△G / NiVBDGF.
[0052] Figure 2 Transmission electron microscopy and immunoelectron microscopy results of rVSV△G / NiVMYGF and rVSV△G / NiVBDGF.
[0053] Figure 3 Virus growth curve.
[0054] Figure 4 Virus safety assessment
[0055] Figure 5 The results of neutralizing antibody detection were obtained using rVSV△G / NiVMYGF and rVSV△G / GFP / NiVMYGF, respectively.
[0056] Figure 6 The results of neutralizing antibody detection were obtained using rVSV△G / NiVBDGF and rVSV△G / GFP / NiVMYGF, respectively. Detailed Implementation
[0057] The specific embodiments of the present invention will be further described below. It should be noted that these descriptions are for the purpose of aiding understanding the present invention, but do not constitute a limitation thereof. Furthermore, the technical features involved in the embodiments described below can be combined with each other as long as they do not conflict with each other.
[0058] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, and the experimental materials used in the following embodiments are all available through conventional commercial channels.
[0059] Vesicular stomatitis virus (VSV) is a representative type virus of the Rhabdoviridae family. It has a simple structure, strong replication capacity, and can rapidly induce disease, making it widely used as a research model for the mechanisms of RNA enveloped virus invasion, replication, and assembly. VSV can efficiently insert foreign genes and stably express foreign target proteins, and can be used as a viral vector in research on other viral families. Vesicular stomatitis virus belongs to the genus Rhabdoviridae, family Rhabdoviridae, and is a non-segmented, single-stranded negative-sense RNA virus, including the New Jersey type and the Indiana type. The virus is bullet-shaped or cylindrical, enveloped, and has a genome length of approximately 11 kb, encoding five structural proteins: nucleoprotein N, phosphoprotein P, matrix protein M, glycoprotein G, and RNA polymerase protein L. The G protein mediates viral binding to host cells and activates the immune response. In this application, a Nipah virus chimeric strain co-expressing both G and F proteins was constructed by deleting its own glycoprotein G. The constructed strains rVSV△G / NiVMYGF and rVSV△G / NiVBDGF exhibit good immunogenicity and biological activity. The complete expression of Nipah virus F and G proteins on the surface of VSV particles lacking the G protein was clearly detected, ensuring the integrity of the Nipah virus and achieving viral replication. The vesicular stomatitis virus rVSV△G / NiVMYGF strain has the accession number CCTCC. NO:V2023110, Deposit date: 2023.12.18, Depository institution: China Center for Type Culture Collection; Vesicular stomatitis virus rVSV△G / NiVBDGF, Deposit number: CCTCC NO:V2023111, Deposit date: 2023.12.18, Depository institution: China Center for Type Culture Collection.
[0060] Example 1
[0061] 1.1 Synthesis of chimeric VSV virus expressing NiV G and F proteins
[0062] The G and F proteins of NiV Malaysian strain (NiV-Malaysia, NiVMY) and Bangladeshi strain (NiV-Bangladesh, NiVBD) were synthesized artificially. Primers were designed to introduce the VSV gene initiation, termination, and Kozak sequences before the ATG start codon of the upstream primer, respectively.
[0063] Table 1 Primers for constructing recombinant full-length VSV cDNA expressing NiVF or G proteins
[0064]
[0065] The target fragment was amplified using PCR. The PCR product was recovered by 1% agarose gel electrophoresis, and the concentration of the recovered product was measured and stored at -20℃. Homologous recombination was performed between the PCR product and the enzyme digestion product (Nhe I) of the vector pCI-Rz-VSVΔG-eGFP-FL to obtain recombinant plasmids pCI-RzVSVΔG-NiVMYGF and pCI-RzVSVΔG-NiVBDGF expressing NiVMY G and F proteins, respectively. These recombinant plasmids were co-transfected into BHK-21 cells using calcium phosphate transfection with helper plasmids pBS-VSV-N, pBS-VSV-P, and pBS-VSV-L expressing the N, P, and L genes of VSV, respectively. The transfection system is as follows:
[0066] Table 2 Transfection System
[0067]
[0068] Mix the reaction components in tube A, add them to tube B, mix well, let stand for 20 minutes, and then add them dropwise to the culture medium of BHK-21 cells. Place the tube in an incubator at 37°C and 5% CO2.
[0069] 72 hours after transfection, the cell supernatant was harvested and continuously passaged in Vero-E6 cells until obvious cytopathic effects (CPE) were formed. The chimeric viruses were collected and named rVSV△G / NiVMYGF and rVSV△G / NiVBDGF, respectively.
[0070] 1.2 Identification of Recombinant Chimeric VSV Virus
[0071] Chimeric viruses rVSV△G / NiVMYGF and rVSV△G / NiVBDGF, as well as wild-type VSV, were infected with Vero-E6 cells at MOI=0.01. Cells were collected 36 h after infection, and after cell lysis, they were identified by immunofluorescence using mouse anti-NiV-G and NiV-F serum (1:100) as primary antibodies.
[0072] Analysis results showed that both the chimeric viruses rVSV△G / NiVMYGF and rVSV△G / NiVBDGF correctly expressed NiVF and G proteins (e.g., ...). Figure 1 (As shown).
[0073] 1.3 Observation of chimeric virus morphology
[0074] Supernatant from virus-infected cells was collected, cell debris was removed, and samples were prepared using phosphotungstic acid negative staining. Viral morphology was observed under an electron microscope. To observe the chimeric viral envelope spikes, viral samples were labeled with G and F protein-specific antibodies, respectively.
[0075] Electron microscopy revealed that the two chimeric viruses were bullet-shaped, and viral particles and their surface glycoproteins were observable. Immunoelectron microscopy with negative staining showed that specific gold particles (e.g., gold adsorbed onto the surface of the viral particles) could be attached to the surface. Figure 2 (As shown).
[0076] 1.4 Growth kinetics of chimeric viruses
[0077] Two chimeric viruses were inoculated into Vero-E6 cells at an MOI of 0.01. Cell supernatants were collected at 12h, 24h, 36h, 48h, 60h, and 72h post-infection, and TCID was measured. 50 .
[0078] Chimeric VSV viruses rVSV△G / NiVMYG and rVSV△G / NiVMYF, expressing only NiVMY G or NiVMY F proteins, were constructed. Simultaneously, chimeric VSV viruses rVSV△G / NiVBDG and rVSV△G / NiVBDF, expressing only NiVBD G or NiVBD F proteins, were also constructed. rVSV△G / NiVMYG and rVSV△G / NiVMYF were mixed in equal proportions, and rVSV△G / NiVBDG and rVSV△G / NiVBDF were mixed in equal proportions. These mixtures were then seeded into Vero-E6 cells at an MOI of 0.01. Cell supernatants were collected at 12h, 24h, 36h, 48h, 60h, and 72h post-infection, and TCID was measured. 50 .
[0079] like Figure 3 As shown, the growth trends of the two chimeric viruses were basically consistent with those of wild-type VSV, reaching their peak values between 36 and 48 hours. The titers of rVSV△G / NiVMYGF and rVSV△G / NiVBDGF were 10, ... 8.28 TCID 50 / mL and 10 8.58 TCID 50 / mL. The viral titers were higher than those after mixed infection with both rVSV△G / NiVMYG+rVSV△G / NiVMYF and rVSV△G / NiVBDG+rVSV△G / NiVBDF viruses.
[0080] Example 2: Safety test of chimeric virus in mice
[0081] Chimeric virus rVSV△G / NiVMYGF and rVSV△G / NiVBDGF viral fluid 5×10 5TCID 50 Ten 6-week-old female BALB / c mice were injected intramuscularly with 0.1 ml of PBS, while ten mice were injected with the same volume of PBS as a control. The health status of the mice and changes in body weight were observed daily for two consecutive weeks.
[0082] like Figure 4 As shown, all mice inoculated with the chimeric virus survived without any clinical symptoms. The weight gain curve of the experimental group mice was consistent with that of the PBS group, indicating that the chimeric virus is not pathogenic to mice.
[0083] Example 3: Chimeric Virus Mouse Immunization Test
[0084] Chimeric viruses rVSV△G / NiVMYGF and rVSV△G / NiVBDGF were inactivated and administered intramuscularly to six 6-week-old female BALB / c mice. A booster immunization was given three weeks later at a dose of 1×10⁻⁶. 6 TCID 50 / 0.1ml. Blood samples were collected at 2, 3, 4, 5 and 6 weeks after the first immunization to prepare serum.
[0085] The levels of NiV G and F neutralizing antibodies in serum were detected using a neutralization assay with chimeric viruses rVSV△G / GFP / NiVMYGF and rVSV△G / GFP / NiVMYGF. The serum to be tested was serially diluted 2-fold using the fixed-virus dilution method, and mixed with 1×10⁻⁶ virus-based solutions. 3 TCID 50 A chimeric virus mixture of rVSVΔG / GFP / NiVGF was used, with five parallel controls for each dilution. The serum-virus mixture was incubated at 37°C for 1 hour before being inoculated into 96-well Vero-E6 cells. Cells were observed under an inverted fluorescence microscope 24 hours after infection, and the highest dilution that inhibited fluorescence by 50% was taken as the neutralizing titer.
[0086] The results are as follows Figure 5 As shown, mouse serum two weeks after primary immunization with rVSV△G / NiVMYGF effectively blocked infection with rVSV△G / GFP / NiVMYGF and rVSV△G / GFP / NiVBDGF. After booster immunization, the neutralizing antibody titer further increased, reaching its highest level five weeks after primary immunization, with dilutions of 640-fold and 512-fold, respectively.
[0087] like Figure 6 As shown, mouse serum two weeks after primary immunization with rVSV△G / NiVBDGF effectively blocked infection with rVSV△G / GFP / NiVMYGF and rVSV△G / GFP / NiVBDGF. After booster immunization, the neutralizing antibody titer further increased, reaching its highest level five weeks after primary immunization, with dilutions reaching 512-fold.
Claims
1. A chimeric recombinant VSV virus strain co-expressing NiV G and F proteins, wherein the chimeric recombinant VSV virus strain is vesicular stomatitis virus rVSV△G / NiVMYGF and rVSV△G / NiVBDGF; wherein the vesicular stomatitis virus rVSV△G / NiVMYGF has accession number: CCTCC NO:V2023110, accession date: 2023.12.18, and depositary institution: China Center for Type Culture Collection; and the vesicular stomatitis virus rVSV△G / NiVBDGF has accession number: CCTCC NO:V2023111, accession date: 2023.12.18, and depositary institution: China Center for Type Culture Collection.
2. A composition comprising vesicular stomatitis virus rVSV△G / NiVMYGF and rVSV△G / NiVBDGF, wherein the vesicular stomatitis virus rVSV△G / NiVMYGF has accession number CCTCC NO:V2023110, accession date: 2023.12.18, and is deposited at the China Center for Type Culture Collection; and the vesicular stomatitis virus rVSV△G / NiVBDGF has accession number CCTCC NO:V2023111, accession date: 2023.12.18, and is also deposited at the China Center for Type Culture Collection.
3. The composition according to claim 2, characterized in that, The vesicular stomatitis virus rVSV△G / NiVMYGF and rVSV△G / NiVBDGF are its nucleotides or proteins.
4. The application of vesicular stomatitis virus rVSV△G / NiVMYGF and rVSV△G / NiVBDGF in the preparation of a formulation for preventing diseases caused by Nipah virus infection, wherein the vesicular stomatitis virus rVSV△G / NiVMYGF has accession number: CCTCC NO: V2023110, accession date: 2023.12.18, and is deposited at the China Center for Type Culture Collection; and the vesicular stomatitis virus rVSV△G / NiVBDGF has accession number: CCTCC NO: V2023111, accession date: 2023.12.18, and is deposited at the China Center for Type Culture Collection.
5. The application as described in claim 4, characterized in that, The preparation is a vaccine and a vaccine composition thereof.
6. The use of the chimeric VSV recombinant virus or composition as described in any one of claims 1-3 in the preparation of antibodies against Nipah virus.
Citation Information
Patent Citations
Recombinant newcastle disease virus LaSota vaccine strain for expressing nipah encephalitis virus F protein
CN102533675A
Recombinant newcastle disease virus LaSota vaccine strain for expressing Nipah virus encephalitis G-protein
CN102559612B
Nipah virus receptor-binding glycoprotein and its application
CN113372454B
A method for detecting nipah virus and method for providing immunoprotection against henipaviruses
HK1096431A
Rapid acting vaccine against nipah virus
WO2023049794A1