Grass carp tlr5 and grass carp hemorrhagic disease resistance-related snp sites, site combinations and applications thereof

By screening for SNP sites on grass carp chromosome 20 and developing primers, molecular marker-assisted breeding for grass carp hemorrhagic disease resistance was achieved, solving the breeding problem of grass carp hemorrhagic disease, improving the disease resistance of grass carp, and reducing the mortality rate of the disease.

CN118667973BActive Publication Date: 2026-06-26HUAZHONG AGRI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
HUAZHONG AGRI UNIV
Filing Date
2024-07-18
Publication Date
2026-06-26

AI Technical Summary

Technical Problem

Currently, there is a lack of effective treatment for grass carp hemorrhagic disease, and existing technologies have failed to effectively utilize SNP loci for disease-resistant breeding of grass carp, resulting in severe disease outbreaks during grass carp farming, especially with high mortality rates during the high-temperature season.

Method used

By screening for SNP sites at bases 30969284 and 30958638 on chromosome 20 of grass carp, corresponding primers were developed for PCR detection. Combined with molecular marker-assisted breeding, grass carp varieties resistant to grass carp hemorrhagic disease were screened out.

Benefits of technology

This study achieved molecular marker-assisted breeding for grass carp resistance to hemorrhagic disease, improved the disease resistance of grass carp, provided an economical and effective breeding method, and reduced the mortality rate of the disease.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_3
    Figure SMS_3
Patent Text Reader

Abstract

The application belongs to the field of aquatic organism breeding, and particularly relates to a SNP site of grass carp TLR5 related to grass carp hemorrhagic disease resistance, a SNP site combination and application thereof. The application successfully screens the SNP site of grass carp TLR5 related to grass carp hemorrhagic disease resistance through PCR-RFLP sequencing and correlation analysis, which is located at the 30969284th and 30958638th base of chromosome 20. In view of the two SNP sites, a SNP site combination of TLR5 related to grass carp hemorrhagic disease resistance is further developed, and the grass carp hemorrhagic disease resistance individual can be screened through detection of the SNP site combination. Therefore, the SNP molecular marker provided by the application can be used for grass carp molecular marker assisted breeding, and accelerate the breeding of disease-resistant grass carp varieties, and provide a reference basis for the disease-resistant breeding of grass carp.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of aquatic organism breeding, specifically involving the SNP sites, site combinations and their applications related to grass carp TLR5 and grass carp hemorrhagic disease resistance. Background Technology

[0002] Grass carp (Ctenopharyngodon idella) belongs to the order Cypriniformes, family Cyprinidae, subfamily Leuciscinae, genus Ctenopharyngodon, and is also known as grass carp.

[0003] Grass carp hemorrhagic disease caused by grass carp reovirus is a serious threat in grass carp farming. In the early stages, fish exhibit reduced feeding and darkened body color. As the disease progresses, hemorrhages of varying degrees appear in various parts of the body, including the mouth, upper and lower jaws, around the eyes, and gill covers. In severe cases, dissection reveals muscle hemorrhage, intestinal congestion with no contents, and petechiae in multiple organs, including the swim bladder, liver, gallbladder, spleen, kidneys, and mesentery. Pathological examination reveals damaged capillary endothelial cells with a hyaline lesion, increased vascular permeability, widespread hemorrhage in capillaries and small vessels, and thrombus formation within the vessels. Systemic hemorrhage is a key characteristic of grass carp hemorrhagic disease. Outbreaks of grass carp hemorrhagic disease are highly seasonal, with the highest morbidity and mortality rates during summer when the water temperature is between 25-30℃. When the water temperature is below 20℃, viral replication in the host is significantly reduced, and infectivity may even be lost. However, once the water temperature exceeds 24℃, viral replication in the host accelerates, leading to fish mortality. To date, grass carp hemorrhagic disease can be classified into three types: red fin and red gill cover type, enteritis type, and red muscle type.

[0004] Currently, there is no effective treatment for grass carp hemorrhagic disease. Therefore, breeding disease-resistant grass carp varieties is a more economical and effective approach.

[0005] SNPs (Single nucleotide polymorphisms) refer to variations in a single nucleotide in the genome and are one of the most common forms of genetic variation. Studying SNP loci can reveal genetic differences between individuals, providing an important foundation for the study of hereditary traits. In grass carp, researching the correlation between SNP loci and resistance to grass carp hemorrhagic disease can provide important theoretical basis for disease-resistant breeding of grass carp. Therefore, identifying SNP loci related to grass carp hemorrhagic disease resistance is of great significance for grass carp farming and disease control. Currently, researchers have identified several SNP loci associated with grass carp hemorrhagic disease resistance. Summary of the Invention

[0006] The purpose of this invention is to provide a reagent for detecting the 30969284th base of grass carp chromosome 20 and its application in the breeding of grass carp resistant to grass carp hemorrhagic disease.

[0007] Another objective of this invention is to provide a reagent for detecting bases 30969284 and 30958638 on chromosome 20 of grass carp, and its application in the breeding of grass carp resistant to grass carp hemorrhagic disease.

[0008] To achieve the above objectives, the present invention adopts the following technical measures:

[0009] The applicant collected 47 grass carp individuals from ponds at a grass carp farming base in Chongqing that had been artificially infected with grass carp reovirus and were in the process of developing hemorrhagic disease. These were designated as the susceptible group. After the disease outbreak, 52 individuals that had stabilized and survived were collected as the resistant group, totaling 99 grass carp samples. After TLR5a / b amplification, these samples were sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. DNAstar software was used for sequencing assembly, and snapgene was used to analyze the sequencing results. Different phenotypes were recorded, and combined with the sequencing results, GraphPad software was used to combine SNP genotype and phenotype data for genome-wide association analysis. Two SNPs associated with grass carp hemorrhagic disease resistance were finally screened out. SNP site Chr20-30969284 is located at position 149 in the sequence shown in Table 1, where the Y base at position 149 is C (cytosine) or T (thymine); SNP site Chr20-30958638 is located at position 386 in the sequence shown in Table 1, where the M base at position 386 is A (adenine) or C (cytosine).

[0010] The scope of protection of this invention includes:

[0011] Application of reagents for detecting base position 30969284 on chromosome 20 of grass carp in breeding grass carp resistant to grass carp hemorrhagic disease.

[0012] Application of reagents for detecting base 30958638 on chromosome 20 of grass carp in the breeding of grass carp resistant to grass carp hemorrhagic disease.

[0013] In the above-described applications, the preferred reagent is a primer. This application can detect the SNP using conventional PCR primers. Therefore, those skilled in the art can detect this SNP site by designing conventional primers.

[0014] The preferred primers are:

[0015] Chr20-30969284: Upstream primer F: 5'TCAGCACTCAAATTGTGAAATGC 3', Downstream primer R: 5'CTCATTCATGTCTTGCAGTGTCACT 3';

[0016] Chr20-30958638: Upstream primer F: 5'ACGCTGTAATTTTTTGTAAACAAATT 3', Downstream primer R: 5'GTTTATCTTTCTCATTGTTTGCTCAA 3'.

[0017] Compared with the prior art, the beneficial results of the present invention are as follows:

[0018] This invention screened out two SNP molecular markers that are significantly associated with resistance to hemorrhagic disease in grass carp. These SNP molecular markers can be used for marker-assisted breeding of grass carp to accelerate the selection of disease-resistant grass carp varieties and provide a reference for disease-resistant breeding of grass carp or other farmed fish. Detailed Implementation

[0019] To enable those skilled in the art to better understand the technical content of this invention, the invention will be further described below with reference to specific embodiments. Unless otherwise specified, the technical solutions described in this invention are conventional solutions in the art; the reagents or materials described, unless otherwise specified, are all from commercial sources. The grass carp reference genome used in this invention is the publicly available version from NCBI (https: / / ftp.ncbi.nlm.nih.gov / genomes / all / GCF / 019 / 924 / 925 / GCF_019924925.1_HZGC01 / GCF_019924925.1_HZGC01_genomic.fna.gz).

[0020] Example 1:

[0021] Mining of SNPs related to resistance to grass carp hemorrhagic disease

[0022] 1) The applicant collected 47 grass carp individuals that were artificially infected with grass carp reovirus and broke out of grass carp hemorrhagic disease from ponds in a grass carp breeding base in Chongqing as the susceptible group. After the disease period, 52 individuals that had stabilized and survived were collected as the disease-resistant group, for a total of 99 grass carp samples. After TLR5a / b amplification, the samples were sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. The sequencing splicing was performed using the software DNAstar, and the sequencing results were analyzed using snapgene.

[0023] 2) Record different phenotypes, combine them with sequencing results, and use GraphPad software to combine SNP genotype and phenotype data for genome-wide association analysis.

[0024] The results showed that two SNPs associated with grass carp hemorrhagic disease resistance were finally screened out. The SNP site Chr20-30969284 is located at position 149 in the sequence shown in Table 1, where the Y base at position 149 is C (cytosine) or T (thymine); the SNP site Chr20-30958638 is located at position 386 in the sequence shown in Table 1, where the M base at position 386 is A (adenine) or C (cytosine).

[0025] These loci are associated with grass carp hemorrhagic disease resistance and can be used for the breeding of disease-resistant traits in grass carp. The results of the analysis of these loci are shown in Table 2.

[0026] Table 1. SNP information related to resistance to grass carp hemorrhagic disease.

[0027]

[0028] Table 2. Statistical analysis of SNP loci in susceptible and resistant populations.

[0029]

[0030] Table 2 shows that the genotypes of the two SNP loci differed significantly between the resistant and susceptible groups (P < 0.05). The genotypes significantly associated with disease resistance at these two SNP loci were Chr20-30969284:TT and Chr20-30958638:AA. The genotypes significantly associated with susceptibility were Chr20-30969284:CC and Chr20-30958638:CC. Therefore, the SNP markers of this invention can be used for breeding grass carp resistant to hemorrhagic disease.

[0031] Example 2:

[0032] Development of primers for detecting SNP sites associated with grass carp hemorrhagic disease resistance:

[0033] Based on the two single nucleotide polymorphism sites located in Example 1 of this invention, corresponding primers were developed for molecular marker-assisted selection breeding of disease-resistant grass carp to obtain grass carp varieties resistant to grass carp hemorrhagic disease. Primer information is shown in Table 3.

[0034] Table 3. Primer nucleotide sequences for amplifying grass carp hemorrhagic disease resistance-related SNPs.

[0035]

[0036] Example 3:

[0037] Application of SNP loci related to grass carp hemorrhagic disease resistance in grass carp breeding

[0038] In March-April 2024, grass carp fry artificially infected with grass carp reovirus and induced an outbreak of grass carp hemorrhagic disease were collected from ponds at a grass carp farming base in Chongqing. One hundred diseased and deceased individuals and one hundred resistant surviving individuals were collected. The genotypes of the two SNP loci located in Example 1 were analyzed to verify the correlation between genotype and grass carp hemorrhagic disease resistance. The specific steps included:

[0039] 1) DNA extraction and PCR amplification

[0040] DNA was extracted from 200 tail fin strips of the validation population using the isopropanol / ammonium acetate method and diluted to 100 ng / μL for later use. Grass carp genomic DNA was used as a template, and PCR amplification was performed using the primers shown in Table 3.

[0041] PCR reaction conditions: 94℃ pre-denaturation for 4 min; 94℃ denaturation for 30 s, T m Anneal for 30 seconds, extend at 72°C for 40 seconds, 34 cycles; extend at 72°C for 10 minutes, store at 4°C.

[0042] The PCR system is as follows: 0.25 μL each of upstream and downstream primers, 0.5 μL of DNA template, 5 μL of SuperLong Taq Master Mix (Mei5bio, Beijing, China), and ddH2O to a final volume of 10 μL.

[0043] 2) Genotype statistics

[0044] After PCR was completed, the corresponding sample sequences were obtained using Sanger sequencing. The genotypes of the SNP sites described in this invention were read based on the sequencing peak diagram of each sample, and their survival and mortality rates were calculated. The statistical results are shown in Table 4.

[0045] Table 4. Detection of two disease-resistant SNP genotypes in 100 diseased and deceased individuals.

[0046] name genotype Number of dead individuals detected Detection rate of deceased individuals Chr20-30969284 TT 7 7% Chr20-30958638 AA 9 9%

[0047] Table 5. Detection of disease-resistant SNP genotypes in 100 surviving disease-resistant individuals.

[0048] name genotype Number of surviving individuals detected Detection rate of surviving individuals Chr20-30969284 TT 73 73% Chr20-30958638 AA 34 34%

[0049] As shown in Tables 4 and 5, the molecular marker Chr20-30969284 has a higher accuracy. Both can be used simultaneously; that is, when an individual's SNP genotype at Chr20-30969284 is TT and its genotype at Chr20-30958638 is AA, the survival rate is significantly higher than the mortality rate, indicating that the individual is a grass carp resistant to hemorrhagic disease.

[0050] The above embodiments are only used to illustrate the present invention, and the scope of protection of the present invention is not limited to the above embodiments. Those skilled in the art can achieve the purpose of the present invention based on the above disclosure. Any improvements and modifications made based on the concept of the present invention fall within the scope of protection of the present invention, and the specific scope of protection is determined by the claims.

Claims

1. Application of a reagent for detecting the SNP at position 30969284 of chromosome 20 of grass carp in the breeding of grass carp resistant to grass carp hemorrhagic disease. The reagent is a primer, and the reference genome of grass carp is GCF_019924925.1_HZGC01 in the NCBI public version. The grass carp hemorrhagic disease is caused by grass carp reovirus infection.

2. The application of reagents for detecting SNPs at positions 30969284 and 30958638 on chromosome 20 of grass carp in the breeding of grass carp resistant to grass carp hemorrhagic disease. The reagents are primers, and the reference genome of grass carp is GCF_019924925.1_HZGC01 in the NCBI public version. The grass carp hemorrhagic disease is caused by grass carp reovirus infection.

3. The application according to claim 1, wherein the reagent is a primer, and is: Chr20-30969284: Upstream primer F: 5'TCAGCACTCAAATTGTGAAATGC 3', Downstream primer R: 5'CTCATTCATGTCTTGCAGTGTCACT 3'.

4. The application according to claim 2, wherein the reagent is a primer, and is: Chr20-30969284: Upstream primer F: 5'TCAGCACTCAAATTGTGAAATGC 3', downstream primer R: 5'CTCATTCATGTCTTGCAGTGTCACT 3' and Chr20-30958638: Upstream primer F: 5'ACGCTGTAATTTTTTGTAAACAAATT 3', downstream primer R: 5'GTTTATCTTTCTCATTGTTTGCTCAA 3'.

Citation Information

Patent Citations

  • Molecular marker for hemorrhagic disease resistance trait of grass carp and application of molecular marker

    CN105132444A

  • Genetic marker-related with immunity traits of hemorragic disease of grass carp

    CN106256904A