Proteases capable of catalyzing the formation of salutidine from s-erythroidine and uses thereof

Abstract

The application discloses a protease capable of catalyzing S-oxoacanthoic alkaloid to generate salutidine and application thereof, belongs to the field of biological catalysis pharmacy, and particularly relates to a protease capable of catalyzing S-oxoacanthoic alkaloid to generate salutidine and application thereof. In the field of biological catalysis technology, the protease is SinSyn1 enzyme, SinSyn2 enzyme, SinSyn3 enzyme or SinSyn21 enzyme. In the application, S-oxoacanthoic alkaloid is used as a reaction raw material, and SinSyn1 enzyme, SinSyn2 enzyme, SinSyn3 enzyme or SinSyn21 enzyme is used as a catalytic enzyme, so that S-oxoacanthoic alkaloid can be directly catalyzed to generate sinactine and salutidine through oxidation and reduction, and the catalytic efficiency is greatly improved.

Description

Technical Field

[0001] This invention belongs to the field of biocatalysis pharmaceutical technology, specifically a protease that can catalyze the production of salutidine from S-caryophylline and its uses. Background Technology

[0002] In the field of biocatalysis, synthesizing complex organic molecules with biological activity has always been a challenge. This is especially true for compounds with significant medicinal value like salutaridine, where traditional chemical synthesis methods suffer from numerous limitations, such as cumbersome steps, low yields, numerous byproducts, and the need to use harmful chemical reagents. In recent years, with the development of enzyme catalysis technology, researchers have begun to explore the use of enzymes as catalysts in the synthesis of salutaridine, aiming for a more efficient and environmentally friendly production process.

[0003] Current research suggests that S-caryophylline is converted to R-caryophylline via a recombinant epimerase (REPI), then cyclized by the sarutidine synthase SalSyn to form sarutidine, which is subsequently catalyzed by various enzymes to generate morphine alkaloids. It is known that the oxidation yield of R-caryophylline to sarutidine in this step is only 0.02%, indicating very low conversion efficiency. However, the inventors have discovered a synthase that can directly convert S-caryophylline to sarutidine, significantly improving catalytic efficiency. Summary of the Invention

[0004] To address the above problems, this invention provides a protease capable of catalyzing the production of sarutadine from S-sinococcal alkaloids and its applications. Using S-sinococcal alkaloids as the reaction raw material and SinSyn1, SinSyn2, SinSyn3, and SinSyn21 enzymes as catalytic enzymes, the reaction raw material can be directly catalyzed to oxidize and reduce to produce Sinoacutine and sarutadine, resulting in a significant improvement in catalytic efficiency.

[0005] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0006] A protease that can catalyze the production of sarutadine from S-salicylic acid, wherein the protease is SinSyn1, SinSyn2, SinSyn3, or SinSyn21.

[0007] The SinSyn1, SinSyn2, SinSyn3, and SinSyn21 enzymes are proteases synthesized by the alkaloid ketone, numbered 1, 2, 3, and 21, respectively.

[0008] Furthermore, the amino acid sequence of the SinSyn1 enzyme is as follows: amino acid sequence shown in SEQ ID NO:1; the amino acid sequence of the SinSyn2 enzyme is as follows: amino acid sequence shown in SEQ ID NO:2; the amino acid sequence of the SinSyn3 enzyme is as follows: amino acid sequence shown in SEQ ID NO:3; and the amino acid sequence of the SinSyn21 enzyme is as follows: amino acid sequence shown in SEQ ID NO:4.

[0009] Furthermore, the amino acid sequences shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 or SEQ ID NO:4 are homologous amino acid sequences with more than 89% homology.

[0010] On the other hand, the present invention discloses four polynucleotide sequences that encode the protease described in claim 1.

[0011] Furthermore, the polynucleotide sequences are shown in SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, and SEQ ID NO:8.

[0012] In another aspect, the present invention discloses an expression vector comprising the polynucleotide sequence described in claim 4 or 5.

[0013] Furthermore, the expression vector is the pESC-His expression vector.

[0014] In another aspect, the present invention discloses a host cell comprising the expression vector according to any one of claims 6-7.

[0015] Furthermore, the host cell is *Saccharomyces cerevisiae* WAT11.

[0016] Furthermore, the present invention also discloses the use of the protease, which is to catalyze the oxidation-reduction of S-caryophylline to produce fenestrated pine alkaloid and salutidine.

[0017] Compared with the prior art, the beneficial effects of the present invention are as follows: The recombinant protein obtained by the present invention through genetic engineering can directly catalyze the production of sarutadine from S-caryophylline, significantly improving the conversion rate of the reaction. Compared with the traditional multi-step enzyme catalysis method, it reduces the generation of intermediate products, thereby improving the overall synthesis efficiency. Moreover, since the obtained protease has high substrate specificity and mainly produces styraxine and sarutadine, the generation of by-products is reduced, thereby simplifying the separation and purification steps of the product and reducing the production cost. Attached Figure Description

[0018] Figure 1 The pESC-His-SinSyn1 vector spectrum;

[0019] Figure 2 Agarose gel electrophoresis image of SinSyn1 amplification, where Line 1: Marker; Lines 2-4: SinSyn1;

[0020] Figure 3 Agarose gel electrophoresis image for detecting colony PCR, where Line 1: Marker; Lines 2-9: SinSyn1;

[0021] Figure 4 The image is an SDS-PAGE gel electrophoresis image, where M: Marker; Line 6: Crude SinSyn1 protein; Line 7: Negative control;

[0022] Figure 5 This is a Western blot gel electrophoresis image, where M: Marker; Line 6: Crude protein; Line 7: Negative control;

[0023] Figure 6 The following are liquid chromatography-mass spectra of the products of the S-reticuline reaction catalyzed by SinSyn1: (A) is the liquid chromatography-mass spectra of the product of the reaction between SinSyn1 and (S)-Reticuline, with * representing the Salutaridine peak and ▽ representing the Sinoacutine peak; (B) is the liquid chromatography-mass spectra of Salutaridine, the product of the reaction between SinSyn1 and (S)-Reticuline; and (C) is the liquid chromatography-mass spectra of Sinoacutine, the product of the reaction between SinSyn1 and (S)-Reticuline. Detailed Implementation

[0024] To enable those skilled in the art to better understand the technical solution, the present invention will be described in detail below with reference to embodiments. The description in this part is only exemplary and explanatory, and should not be used to limit the scope of protection of the present invention in any way.

[0025] Example 1: Synthesis of the SinSyn1 gene from *Sinomenium acutum*

[0026] A search of the established *Sinomenium acutum* transcriptome database yielded the SinSyn1 gene sequence (SEQ ID NO: 5), which was synthesized by Anhui General Biotechnology. Its encoded amino acid sequence is shown in SEQ ID NO: 1.

[0027] Bioinformatics analysis of the SinSyn1 gene from *Sinomenium acutum*:

[0028] The physicochemical properties of the amino acid sequence of the SinSyn1 gene-encoded protein were analyzed using the ExPASy Protparam bioinformatics tool. The results showed that the SinSyn1 gene encodes 532 amino acids, and the molecular weight of the SinSyn1 protein is 60.074 kDa. The molecular formula of the SinSyn1 protein is presumed to be C1. 2713 H 4257 N 727 O 758 S 28 The isoelectric point (PI) is 6.61; the instability coefficient is 37.44. Generally, a stability coefficient less than 40 is considered a stable protein, therefore SinSyn1 is a stable protein; the average hydrophilicity is -0.080, classifying it as a hydrophilic protein. SinSyn1 protein belongs to the cytochrome P450 family.

[0029] The signal peptide of the SinSyn1 protein was predicted using the SignalP-5.0Server online software. The C, S, and Y values ​​were all relatively flat and less than 0.5, indicating that there is no signal peptide in the amino acid sequence of the SinSyn1 protein, and that the SinSyn1 protein is a non-secretory protein.

[0030] Hydrophilicity analysis using the Prot Scale online program revealed that the overall peptide chain of the SinSyn1 protein is hydrophilic, thus it can be considered that the SinSyn1 protein of *Sinomenium acutum* is a hydrophilic protein.

[0031] The amino acid sequence of the SinSyn1 protein from *Synonyms chinensis* was analyzed using SWISS-MODEL. Homology modeling was used to predict the tertiary structure of the SinSyn1 protein. The tertiary structure of the SinSyn1 protein was most similar to that of the CYP76AH1 protein from *Salvia miltiorrhiza*, with a similarity of 29.55%.

[0032] Multiple sequence alignment of amino acid sequences of known P450 family enzymes with the SinSyn1 protein from *Syngonium sibiricum* was performed using DNAMAN. The results showed that SinSyn1 protein and P450 family enzymes have similar conserved regions and high sequence conservation. A phylogenetic tree constructed using MEGA.X showed that SinSyn1 is closely related to the sarutadine synthase (PsSAS) from *Papaver somniferum*.

[0033] Example 2: Expression and functional verification of SinSyn1 protein:

[0034] 1. Expression vehicle

[0035] The expression vector is pESC-His from Shanghai Yubo Biotechnology Co., Ltd. The plasmid map of the expression vector inserted into the target gene SinSyn1 can be found here. Figure 1 .

[0036] 2. Test reagents and instruments

[0037] See Table 1 for details of reagents and instruments used.

[0038] Table 1. Main Reagents and Instruments

[0039]

[0040]

[0041]

[0042] 3. Main solution preparation methods

[0043] The preparation method of the main solution used in this embodiment:

[0044] LB liquid resistance medium (Amp): Prepare in the same way as LB medium. When the medium temperature drops below 55℃, add 1mL of filtered and sterilized ampicillin solution (100mg / mL) and mix well.

[0045] LB resistance plate (Amp): The preparation is basically the same as LB medium, but 15g of agar powder needs to be added. After the medium temperature drops to 55℃, add 1mL of filtered sterilized ampicillin solution (100mg / mL), mix well, and then pour into plates.

[0046] 2% glucose SC-His liquid culture medium: Weigh 20g glucose, 8g SC-His, add 1000mL deionized water, and steam sterilize at 115℃ for 20min.

[0047] SC-His plates with 2% glucose: Weigh 15g agar powder, 20g glucose, and 8g SC-His, add 1000mL deionized water, and sterilize by steaming at 115℃ for 20min.

[0048] 2% galactose SC-His liquid culture medium: Weigh 20g galactose, 8g SC-His, add 1000mL deionized water, and steam sterilize at 115℃ for 20min.

[0049] YPD liquid culture medium: Weigh 20g tryptone, 10g yeast extract, and 20g glucose, add 1000mL deionized water, and sterilize by steaming at 115℃ for 20min.

[0050] YPD plates: The preparation is basically the same as YPD medium. Add 20g of agar powder and wait for the medium temperature to drop to 60℃ before pouring the plates.

[0051] 3M Sodium Acetate: Weigh 246g of sodium acetate and dissolve it in 1000mL of deionized water.

[0052] Coomassie Brilliant Blue Staining Solution: Weigh 1g of Coomassie Brilliant Blue R-250, add 250mL of isopropanol, 100mL of glacial acetic acid, and 650mL of deionized water in sequence, and mix thoroughly.

[0053] Coomassie Brilliant Blue Decolorizing Solution: Measure 100 mL of glacial acetic acid, 50 mL of ethanol, and 850 mL of deionized water, and mix thoroughly.

[0054] Example 3: Eukaryotic expression of the SinSyn1 gene:

[0055] 1. Cloning of the SinSyn1 gene:

[0056] Based on the multiple cloning site of pESC-His and the SinSyn1 nucleic acid sequence, SinSyn1 gene primers SinSyn1-F and SinSyn1-R were designed using Primer Premier 5. A single underline indicates the restriction enzyme sites (EcoRI and NotI), and double underlines indicate the 6×His tag.

[0057] SinSyn1-F:ATTTTTGAAAATTCGAATTCATGGAATTTCACTTGCTGTTGCAGGC

[0058]

[0059] Using pPICZA-SinSyn1 as a template and SinSyn1-F and SinSyn1-R as primers, the reaction system for amplifying the SinSyn1 gene with EcoRI and NotI restriction sites is shown in Table 2. The PCR amplification program was as follows: pre-denaturation 98℃-2min, denaturation 98℃-10s, annealing 68℃-10s, extension 72℃-40s, final denaturation 72℃-5min, with a cycle number of 35.

[0060] Table 2 PCR reaction system

[0061] Components Volume (μL) Gold Mix (Green) 45μL pPICZA-SinSyn1 (100 ng / μL) 1μL SinSyn1-F 2μL SinSyn1-R 2μL Total volume 50μL

[0062] After PCR, 10 μL of the PCR product was subjected to electrophoresis on a 1% agarose gel for 30 min at 120 V. The electrophoresis results were observed using a gel imaging system.

[0063] 2. Vector digestion and purification of the target gene

[0064] The purified target gene and vector pESC-His were double-digested with EcoRI and NotI enzymes, as shown in Table 3. After mixing, the mixture was incubated at 37°C for 4 hours. 5 μL of the digestion product was then subjected to electrophoresis on a 1% agarose gel for 30 minutes at 120V. The electrophoresis results were observed using a gel imaging system.

[0065] Table 3 Enzyme digestion reaction system

[0066]

[0067] After enzyme digestion, the target gene and pESC-His vector were recovered using a full-gold assay kit. For detailed purification steps, please refer to [link to purification procedure]. PCR Purification Kit.

[0068] 3. Construction of pESC-His-SinSyn1 vector

[0069] The purified and recovered pESC-His with sticky ends was ligated to SinSyn1, and the reaction system is shown in Table 4. In a 10 μL reaction system, the amounts of pESC-His vector and SinSyn1 added were both 0.01–0.25 pmols, with a molar ratio approximately 1:2. The mixture was gently stirred and reacted at 50 °C for 30 min. After the reaction, the centrifuge tubes were placed on ice to cool for a few seconds. Subsequently, the mixture was transformed into *E. coli* Top10 competent cells, and 100 μL was plated on Amp-resistant LB agar plates and incubated overnight at 37 °C.

[0070] Table 4 Cloning reaction system

[0071] Component Volume 2×BasicAssemblyMix 5μL pESC-His xμL Inserts yμL <![CDATA[ddH2O]]> to 10μL

[0072] 4. Identification of positive cloning vectors and plasmid extraction

[0073] Positive clones were identified by colony PCR using GAL10 primers. The PCR procedure was as follows: pre-denaturation 94℃-2 min, denaturation 94℃-25 s, annealing 55℃-25 s, extension 72℃-40 s, final denaturation 72℃-5 min, cycle number 35, cycle number 30. After PCR, 10 μL of the PCR product was electrophoresed on a 1% agarose gel for 30 min at 120 V. The electrophoresis results were observed using a gel imaging system. Positive clones identified by PCR were inoculated into LB liquid (Amp) antibiotic medium and incubated at 37℃ for 12 h in a constant temperature shaker at 200 rpm. The bacterial culture was then sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing.

[0074] 5. Extraction of recombinant plasmids

[0075] The bacterial culture, which had been sequenced and whose Blast and SinSyn1 genes were correctly matched by NCBI, was added to LB liquid (Amp) resistant medium and incubated at 37°C for 12 hours using a constant-temperature shaker at 200 rpm. The specific steps for plasmid extraction are as follows:

[0076] (1) Take 2 mL of overnight culture, centrifuge at 10000 rpm for 1 min, and aspirate the supernatant.

[0077] (2) Add 250 μL RB (containing RNase A), shake, and suspend the bacterial pellet;

[0078] (3) Add 250 μL LB, and mix by turning the container upside down 4-6 times to ensure complete lysis of the bacterial cells;

[0079] (4) Add 350 μL NB, mix gently 5-6 times until a firm yellow agglomerate is formed, and let stand at room temperature for 2 minutes.

[0080] (5) Centrifuge at 12000 rpm for 5 min, collect the supernatant and add it to the centrifuge column, centrifuge at 12000 rpm for 1 min, and discard the effluent;

[0081] (6) Add 650 μL WB, centrifuge at 12000 rpm for 1 min, and discard the effluent;

[0082] (7) Centrifuge at 12000 rpm for 2 min to completely remove residual WB;

[0083] (8) Place the centrifuge column in a new centrifuge tube, add 50 μL of preheated deionized water at 60℃ to the center of the centrifuge column, and let it stand at room temperature for 1 min.

[0084] (9) Centrifuge at 10000 rpm for 1 min to elute the DNA. Store the eluted DNA at -20℃ for later use.

[0085] 6. Recombinant plasmid pESC-His-SinSyn1 was transformed into Saccharomyces cerevisiae.

[0086] Transform pESC-His-SinSyn1 into WAT11 competent cells. Thaw 100 μL of WAT11 competent cells on ice, then add 5 μg of pre-chilled target plasmid, 10 μL of carrier DNA (100℃, 5 min, rapid ice bath, repeated once), and 500 μL of PEG / LiAc. Mix well by pipetting several times, then incubate at 30℃ for 30 min (twisting 6-8 times at 15 min for better mixing). Place centrifuge tubes in a 42℃ water bath for 15 min (twisting 6-8 times at 7.5 min for better mixing). Centrifuge at 5000 rpm for 40 s, discard the supernatant, resuspend in 400 μL of ddH2O, centrifuge for 30 s, discard the supernatant again. Resuspend in 500 μL of SC liquid medium, plate, and incubate at 30℃ for 48-96 h. Use SC series products from Beijing Coollab Technology Co., Ltd. for selection media.

[0087] 7. Screening for positive strains of *Saccharomyces cerevisiae* by transfection with pESC-His-SinSyn1.

[0088] Transformed single clones were picked and inoculated into 1 mL of SC liquid medium and cultured at 30°C for 36 h at 200 rpm. 200 μL of the overnight culture was transferred to a 1.5 mL EP tube and centrifuged at 10000 rpm for 1 min to collect the precipitate. 30 μL of LightyPrep reagent for DNA was added to the precipitate, and the mixture was heated at 100°C for 10 min. After centrifugation at 10000 rpm for 2 min, the supernatant was used as the template for the PCR reaction. The PCR reaction procedure and reaction system were the same as those in Table 2 above.

[0089] 8. SinSyn1 protein induction expression and SDS-PAGE

[0090] 200 μL of the culture of WAT11 single clones successfully transformed into pESC-His-SinSyn1 plasmid was inoculated into 20 mL of liquid SC medium and cultured at 30℃ and 200 rpm for 24 h. Then it was transferred to 200 mL of SC liquid medium (with 2% galactose added) with an initial inoculation OD600 of 0.4 and cultured at 30℃ and 200 rpm for 72 h.

[0091] Take 1 mL of bacterial culture as the induction sample, centrifuge at 10000 rpm for 1 min to collect the precipitate. Resuspend the 1 mL precipitate in 40 μL PBS, and add an equal volume of 2×SDS loading buffer. Heat in boiling water for 5 min, incubate at -20℃ for 5 min, then heat in boiling water for 5 min. Take 20 μL of the sample for SDS-PAGE. After electrophoresis, stain the gel with Coomassie Brilliant Blue overnight and destain. Observe using a gel imaging system.

[0092] 9. Western blot

[0093] (1) Sample preparation: The experimental steps are the same as those described above for 8-SinSyn1 protein induction expression and SDS-PAGE;

[0094] (2) After electrophoresis, cut the gel to the appropriate size using a gel cutter and place it in an incubation box. Add an appropriate amount of transfer buffer and shake slowly on a horizontal shaker. Cut 6 pieces of filter paper slightly larger than the gel strip and 1 PVDF membrane the same size as the gel strip. Soak the membrane in methanol for 10 seconds. Place the filter paper on top of the gel and the PVDF membrane on top of the filter paper. During this time, the membrane and the gel should not come into contact. Add transfer buffer so that the membrane can be covered by the buffer when shaking. Shake slowly for 20 minutes.

[0095] (3) Protein membrane transfer: A semi-dry transfer tank was used for protein membrane transfer. The transfer apparatus was arranged from bottom to top in the following order: 3 layers of filter paper, PVDF membrane, gel, and 3 layers of filter paper, forming a "sandwich" structure. The gel and PVDF membrane were precisely aligned, air bubbles were removed, and excess liquid on the apparatus was absorbed. The electrodes and apparatus were then covered. The power was turned on, the current was set to 100mA, and the transfer time was 13min. After the transfer was complete, TBST buffer was added, and the apparatus was shaken slowly for 5min to remove any residual transfer buffer.

[0096] (4) Weigh 1.0g of skim milk powder, add 20mL of TBST buffer to dissolve, stir and mix well, add this milk to an incubator containing PVDF membrane and shake slowly on a shaker, incubate at room temperature for more than 2 hours.

[0097] (5) Immunohistochemistry: Discard the skim milk, wash the membrane with TBST buffer, 5 min × 3 times. Discard the buffer, add 10 mL of primary antibody (the primary antibody is mouse His-tag monoclonal antibody, diluted 1:2000 with antibody dilution buffer), the liquid must cover the entire membrane, shake slowly on a shaker at room temperature, and incubate for 1 h;

[0098] (6) Recover the primary antibody and wash the membrane with an appropriate volume of TBST buffer, 5 min × 4 times;

[0099] (7) Add horseradish peroxidase-conjugated secondary antibody (diluted with antibody dilution buffer at a ratio of 1:2000), shake gently, and incubate at room temperature for 1 hour. Recover the secondary antibody, wash the membrane with an appropriate volume of TBST buffer, 5 min × 4 times;

[0100] (8) Color development was performed using the DAB colorimetric kit.

[0101] Example 4: In vitro catalytic function verification of SinSyn1:

[0102] 1. In vitro enzyme activity experiment

[0103] The experimental steps are as follows:

[0104] (1) Take 100uL of the positive yeast strain and inoculate it into 50mL of SC-His liquid medium containing 2% glucose, and culture at 30℃ with shaking at 220rpm for 24h.

[0105] (2) Collect yeast cells by centrifugation at 4000 rpm for 5 min, discard the supernatant, and resuspend the precipitated cells in SC-His liquid medium containing 2% galactose.

[0106] (3) Repeat step (2) 3 times. The cell pellet is resuspended in 10 mL of SC-His liquid medium containing 2% galactose and the OD600 is adjusted to 1.0.

[0107] (4) After the above suspension was cultured at 30°C and shaken at 220 rpm for 13 h, substrate was added for feeding until the final concentration was 0.1 mM;

[0108] (5) Continue to culture at 30℃ and shake at 220 rpm for 5 h. Take 1 mL of bacterial culture into a 5 mL centrifuge tube, extract it 3 times with 1 mL of ethyl acetate, combine the extracts and blow them dry with nitrogen, dissolve them with 0.6 mL of methanol, filter them through a 0.22 μm filter membrane, and finally analyze the liquid chromatography-mass spectrometry results. All experiments were independently repeated 3 times.

[0109] (6) Using empty positive bacteria as a control, culture and treat under the same conditions as above.

[0110] 2. Detection of catalytic products

[0111] The catalytic product using S-caryophylline as a substrate was detected by LC-MS / MS. Chromatographic conditions: Column: Agilent Poroshell 120EC-C18 3.0×100mm, 2.7μm; Mobile phase A: 0.1% formic acid in water; Mobile phase B: methanol; Detector DAD parameter: 210nm; Column temperature: 30℃; Injection volume: 10μL; Elution program: 8min A: 95%; 8-15min A: 70%-45%; 15-20min A: 45%-30%. Mass spectrometry conditions: Electrospray ionization (ESI); Capillary voltage: 3.5kV; Drying gas temperature: 300℃; Drying gas flow rate: 11L / min; Fragmentation voltage: 500V; Positive ion mode detection; Primary mass spectrometry scan range: m / z 100-1000.

[0112] 3. Results and Analysis

[0113] SinSyn1 gene PCR amplification:

[0114] Using the pPICZA-SinSyn1 gene cloning vector plasmid as a template, PCR amplification was performed using SinSyn1-F and SinSyn1-R amplification primers. The agarose gel electrophoresis image is shown below. Figure 2 As shown, the length of the target fragment after sequencing identification is 1654bp.

[0115] Expression vector construction and identification:

[0116] After the SinSyn1 gene was ligated into the expression vector pESC-His, the recombinant vector was transformed into E. coli Top10 competent cells, and selection was performed using LB (Amp) antibiotic plates. Single clones were picked for colony PCR detection, and the colony PCR results were detected by 1% agarose gel electrophoresis. Figure 3 As shown in the figure. The correctly identified recombinant plasmid was sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results showed that the SinSyn1 gene was successfully inserted into the pESC-His expression vector.

[0117] SDS-PAGE and Western blot analysis of SinSyn1 protein:

[0118] The fragmented proteins induced in SC-His liquid medium with 2% galactose were analyzed by SDS-PAGE. The SDS-PAGE results are shown below. Figure 4 As shown, the recombinant SinSyn1 protein was successfully expressed, with a molecular weight of approximately 60.00 kDa. The protein was obtained from the fragmented supernatant; SinSyn1 is a soluble protein. Western blot analysis of the recombinant protein yielded the following results: Figure 5 .

[0119] SinSyn1 protease catalysis experiment and detection:

[0120] To verify that the SinSyn1 recombinant protein can catalyze S-reticuline, S-reticuline was used as the substrate, and the reaction was carried out at 30°C for 5 h. The enzyme catalytic product was detected by LC-MS / MS, and the results are as follows. Figure 6 As shown in the liquid chromatography-mass spectrometry (LC-MS) chromatogram of the catalytic products, a characteristic peak of salutaridine appears at 6.967 min, and a characteristic peak of sinoacutine appears at 7.017 min. The mass spectra of sinoacutine and salutaridine in the catalytic products show that the corresponding characteristic ion (m / z) for hydrogenation is 328.1560. The results indicate that the SinSyn1 recombinant protein can catalyze the redox reaction of S-sinoacutine to sinoacutine and salutaridine.

[0121] The recombination process for the other three enzymes, SinSyn2, SinSyn3, and SinSyn21, is the same as in the above examples.

[0122] It should be noted that, in this document, the terms "comprising," "including," and any other variations are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such a process, method, article, or apparatus. Specific examples have been used in this document to illustrate the principles and implementation methods of the present invention. These examples are merely for the purpose of helping to understand the method and core ideas of the present invention. The above descriptions are only preferred embodiments of the present invention. It should be pointed out that, due to the limitations of written expression and the objective existence of infinite specific structures, those skilled in the art can make several improvements, modifications, or variations without departing from the principles of the present invention, and can also combine the above technical features in an appropriate manner. These improvements, modifications, variations, or combinations, or the direct application of the concept and technical solution of the present invention to other situations without modification, should all be considered within the scope of protection of the present invention.

Claims

1. A method for preparing salutidine, characterized in that, In the presence of a protease, S-caryophylline is catalyzed to undergo a redox reaction to generate a reaction product containing salutidine; the protease is SinSyn1 enzyme; the SinSyn1 enzyme has the amino acid sequence shown in SEQ ID NO:

1.

2. The method according to claim 1, characterized in that, The reaction is carried out in an in vitro enzyme catalytic system.

3. The method according to claim 1, characterized in that, The reaction is carried out in a recombinant host cell expressing the protease.

4. The method according to claim 3, characterized in that, The host cell was Saccharomyces cerevisiae strain WAT11.

5. The method according to claim 3, characterized in that, The host cell contains a recombinant expression vector, which contains a polynucleotide sequence encoding the protease.

6. The method according to claim 5, characterized in that, The expression vector is the pESC-His vector.

7. The use of the protease used in the method of claim 1 in catalyzing the production of salutidine from S-caryophylline.

8. A recombinant yeast cell for producing salutidine, comprising the expression vector of the method of claim 5 or 6.

Images