Detection of SNP marker of CASP14 gene related to horn size of sheep and its application
By using SNP markers of the CASP14 gene to detect sheep horn size, the problem of the lack of relevant markers in existing technologies has been solved, enabling precise selection of horn size in sheep breeding and improving the convenience of sheep management and production performance.
Patent Information
- Application Number
- CN202410914915.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-09
- Publication Date
- 2026-04-21
- Estimated Expiration
- 2044-07-09
AI Technical Summary
The lack of SNP markers related to sheep horn size in existing technologies makes it difficult to efficiently select sheep with ideal horn sizes in breeding, affecting their safety, ease of management, and production performance.
The CASP14 gene SNP marker, located at position 7944295 on chromosome 5 with a polymorphism of G/A, was used to analyze sheep genotypes through PCR amplification and sequencing, identifying large-horned and small-horned sheep, and providing specific primers for gene selection.
This enables precise selection of sheep horn size during breeding, improving management efficiency and safety, optimizing production performance and environmental adaptability, and reducing injury risks and stress responses.
Smart Images

Figure BDA0004934809780000031 
Figure BDA0004934809780000041 
Figure HDA0004934809790000011
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic biology, specifically relating to the detection and application of SNP markers of the CASP14 gene related to sheep horn size. Background Technology
[0002] In animal morphology research, the size of animal horns is not discussed as extensively as other physiological characteristics, and there are relatively few related reports both domestically and internationally. In sheep flocks, horn size is often related to an individual's social status. Sheep with larger horns typically occupy a higher rank within the flock, possessing greater influence and resource acquisition advantages. Male sheep often fight for territory and mating rights through horn combat, and individuals with larger horns have an advantage in these competitions and are more likely to obtain reproductive opportunities.
[0003] Within the specific group of sheep, variations in horn size are also a result of adaptive evolution. In the current intensive farming environment, large-horned sheep are prone to injuring each other in densely populated areas, especially when competing for food or space. Furthermore, during handling and transportation, large-horned sheep are more likely to cause harm to humans and other animals. In addition, large-horned sheep are more prone to stress in dense environments, affecting their health and productivity. Small-horned sheep, on the other hand, are easier to raise and manage, reducing the difficulty and danger for farmers during treatment and cleaning. In intensive farming, where stocking densities are higher, small-horned sheep require less space, helping to optimize farm space utilization. In conclusion, small-horned sheep have significant advantages in modern intensive farming, not only in terms of safety and ease of management, but also in reducing costs, increasing production, and improving animal welfare.
[0004] With the development of molecular biology and genomics, animal breeding using molecular markers has become feasible. Research on sheep horn size can not only reveal the genetic basis of horn size variation but also be applied in breeding to select sheep with ideal horn sizes to adapt to specific environmental and management requirements. Therefore, research in this field has practical and potential value for enhancing the environmental adaptability and welfare of sheep flocks. To date, detailed genetic studies on sheep horn size are still relatively rare. Summary of the Invention
[0005] The main objective of this invention is to provide a detection method for a CASP14 gene SNP marker related to sheep horn size and its application. Using this SNP marker, gene selection can be performed precisely, thereby efficiently breeding sheep with ideal horn size, thus overcoming the technical deficiency of the prior art in lacking SNP markers directly related to sheep horn traits.
[0006] The present invention employs the following technical solutions to achieve the above objectives:
[0007] A CASP14 gene SNP marker associated with sheep horn size, characterized in that the SNP marker is located at position 7944295 on chromosome 5, and the polymorphism of the SNP marker is G / A.
[0008] Furthermore, the SNP marker sites indicate that the horns of sheep with the GA genotype are significantly smaller than those of sheep with the AA and GG genotypes.
[0009] This invention provides the application of the SNP marker in identifying sheep horn traits.
[0010] This invention provides the application of the SNP marker in sheep breeding.
[0011] A method for identifying sheep horn traits using the above-mentioned SNP markers includes the following steps:
[0012] (1) Extract DNA from the sheep to be tested;
[0013] (2) Using the sheep genomic DNA to be tested as a template, PCR amplification was performed using SNP-labeled specific primers to obtain PCR products;
[0014] (3) Sequencing the PCR products and analyzing their genotypes;
[0015] (4) Result judgment: Based on different genotypes, sheep with horn type traits are judged to be either large-horned or small-horned; sheep with genotype AA or GG at locus 7944295 on chromosome 5 have large-horned horns with a horn length >30cm; sheep with genotype GA at locus 7944295 on chromosome 5 have small-horned horns with a horn length <20cm;
[0016] The specific primers include:
[0017] Forward primer 1 (F1): GAAGGTCGGAGTCAACGGATTCATACCCCTTTGATAATTTCTGTC,
[0018] Specifically, as shown in SEQ No. 1;
[0019] Forward primer 2 (F2): GAAGGTGACCAAGTTCATGCTCATACCCCTTTGATAATTTCTGTT,
[0020] Specifically, as shown in SEQ No. 2;
[0021] Reverse primer (R): GTATGTCTCCTGGGCCAAGA, as shown in SEQ No. 3.
[0022] Furthermore, the PCR amplification program in the above method is as follows: 94℃ pre-denaturation for 10 min; 94℃ denaturation for 20 s, annealing at 61-55℃ for 45 s, for a total of 10 cycles, with the annealing temperature decreasing by 0.6℃ after each cycle, and the annealing temperature decreasing from 61℃ to 55℃ within 10 cycles; 94℃ denaturation for 20 s, annealing at 55℃ for 45 s, for a total of 37 cycles.
[0023] This invention also provides the application of the above-mentioned SNP marker identification method for sheep horn traits in sheep breeding.
[0024] The present invention has the following beneficial effects:
[0025] The size of sheep horns affects their safety and ease of management, especially in intensive farming environments. Small-horned or hornless sheep are easier to manage, reducing the risk of injury to each other. Horn size also relates to sheep stress response and health, playing a crucial role in adapting to different farming environments. The SNP markers provided by this invention allow for the selection of individuals with suitable horn sizes in breeding, improving flock management efficiency and safety, as well as optimizing their production performance and environmental adaptability. Attached Figure Description
[0026] Figure 1 DNA quality control diagram in Example 1;
[0027] Figure 2 : Genotyping diagram in Example 1;
[0028] Figure 3 Example 1: A diagram showing the size of sheep horns, with the larger horns on the left and the smaller horns on the right.
[0029] Figure 4 Box plot of the correlation analysis between SNP and sheep horn size in Example 1. Detailed Implementation
[0030] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. After reading the present invention, any modifications of the present invention in various equivalent forms by those skilled in the art will fall within the scope of protection of the claims of this application.
[0031] Example 1: Identification of sheep horn size using the CASP14 gene SNP marker chr5:7944295
[0032] The experimental subjects were 36 small-tailed Han sheep, one month old.
[0033] The specific primers for SNP markers are:
[0034] Forward primer 1 (F1): GAAGGTCGGAGTCAACGGATTCATACCCCTTTGATAATTTCTGTC;
[0035] Forward primer 2 (F2): GAAGGTGACCAAGTTCATGCTCATACCCCTTTGATAATTTCTGTT;
[0036] Reverse primer (R):
[0037] GTATGTCTCCTGGGCCAAGA;
[0038] The method is as follows:
[0039] (1) Collect 5 mL of sheep venous blood, extract DNA using the traditional CTAB method, and dilute the DNA to 20 ng / μl; dilute the primers to 100 μl / ml; dilute the forward and reverse primer sequences according to the ratio of F1:F2:R:water = 24:24:48:100.
[0040] (2) Using the sheep genomic DNA to be tested as a template, PCR amplification was performed using SNP-labeled specific primers. The amplification system is shown in Table 1, and the amplification program is shown in Table 2. PCR primers were obtained. PCR products from different sheep were electrophoresed on 1% agarose gel, as shown below. Figure 1 As shown:
[0041] Table 1 Amplification System
[0042] name 384-well plate (4μL system) 2xTaqDNAPolymeraseMix 2μL SNPPrimerMix(4x) 1μL DNA sample 2ul
[0043] Table 2 Amplification Procedure
[0044]
[0045]
[0046] (3) After the PCR amplification cycle, the fluorescence value was read using a real-time PCR instrument at a temperature below 40°C. The PCR products were then sequenced, and the sequencing results were analyzed using LGC_OMEGA's genotype reading software (Kluster Caller). Based on the sample clusters and fluorescence types, the genotypes were classified into three types: GG, GA, and AA. Figure 2 As shown.
[0047] (4) Result determination: Based on different genotypes, sheep with large horns or small horns are determined; sheep with the gene at chromosome 5, locus 7944295, which is GG or AA, are large-horned sheep; sheep with the gene at chromosome 5, locus 7749295, which is GA, are small-horned sheep.
[0048] Correlation analysis of sheep SNPs, such as Figure 3 As shown, sheep with the gene at chromosome 5, locus 7944295, being either GG or AA, are large-horned sheep with an average length of 31.7 cm, while sheep with the gene at chromosome 5, locus 7944295, being GA, are small-horned sheep with an average length of 16.9 cm.
Claims
1. The application of a specific primer labeled with SNP in identifying the horn size trait in sheep, characterized in that, The SNP marker is located at locus 7944295 on chromosome 5, and the polymorphism of this SNP marker is G / A; sheep with the genotype GA at this locus have small horns, and sheep with the genotypes AA and GG at this locus have large horns; the sheep is a small-tailed Han sheep. The specific primers are: Forward primer 1: GAAGGTCGGAGTCAACGGATTCATACCCCTTTGATAATTTCTGTC; Forward primer 2: GAAGGTGACCAAGTTCATGCTCATACCCCTTTGATAATTTCTGTT; Reverse primer: GTATGTCTCCTGGGCCAAGA.
2. The application of a specific primer for an SNP marker in sheep horn-size breeding, characterized in that, The SNP marker is located at locus 7944295 on chromosome 5, and the polymorphism of this SNP marker is G / A; sheep with the genotype GA at this locus have small horns, and sheep with the genotypes AA and GG at this locus have large horns; the sheep is a small-tailed Han sheep. The specific primers are: Forward primer 1: GAAGGTCGGAGTCAACGGATTCATACCCCTTTGATAATTTCTGTC; Forward primer 2: GAAGGTGACCAAGTTCATGCTCATACCCCTTTGATAATTTCTGTT; Reverse primer: GTATGTCTCCTGGGCCAAGA.
3. A method for identifying the horn size trait of small-tailed Han sheep using SNP-labeled specific primers, characterized in that, Includes the following steps: Step 1: Extract DNA from the small-tailed Han sheep to be tested; Step 2: Using the genomic DNA of the small-tailed Han sheep to be tested as a template, PCR amplification was performed using SNP-labeled specific primers to obtain PCR products; Step 3: Sequencing the PCR products to analyze their genotypes; Step 4, Result Interpretation: Based on different genotypes, determine whether the horn size trait of the Small-tailed Han Sheep belongs to the large-horn type or the small-horn type; the Small-tailed Han Sheep with the AA or GG genotype at locus 7944295 on chromosome 5 have large-horn type horns; the Small-tailed Han Sheep with the GA genotype at locus 7944295 on chromosome 5 have small-horn type horns. The specific primers are: Forward primer 1: GAAGGTCGGAGTCAACGGATTCATACCCCTTTGATAATTTCTGTC; Forward primer 2: GAAGGTGACCAAGTTCATGCTCATACCCCTTTGATAATTTCTGTT; Reverse primer: GTATGTCTCCTGGGCCAAGA.
4. The method as described in claim 3, characterized in that, The PCR amplification program in step 2 is as follows: 94℃ pre-denaturation for 10 min; 94℃ denaturation for 20 s, 61-55℃ annealing for 45 s, for a total of 10 cycles; 94℃ denaturation for 20 s, 55℃ annealing for 45 s, for a total of 37 cycles.
5. The application of the method as described in claim 3 or 4 in the breeding of Small-tailed Han sheep.
Citation Information
Patent Citations
RXDP2 gene SNP marking composition related to sheep horn phenotype and application thereof
CN105483125A
SNP (Single Nucleotide Polymorphism) molecular marker, amplification primer and kit related to lake and horn type, application of SNP molecular marker, amplification primer and kit and method for judging lake and horn type
CN115747347A