A molecular marker associated with feed conversion in sheep and its use in breeding
By detecting polymorphic sites in the sheep APOD gene, especially the T/C mutation at 233bp, molecular markers were developed, solving the problem of low feed conversion rate in sheep breeding and improving the scientific and economic benefits of sheep breeding.
Patent Information
- Application Number
- CN202410965544.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-18
- Publication Date
- 2026-05-12
- Estimated Expiration
- 2044-07-18
AI Technical Summary
The lack of effective gene-level analysis methods in existing technologies to improve sheep feed conversion rate has affected the scientific and economic benefits of sheep breeding.
By detecting polymorphic sites in the sheep APOD gene, especially the T/C mutation at position 233bp, related molecular markers were developed and detection methods were established to screen sheep breeds with low feed conversion rates and to breed feed-saving sheep.
It significantly improved the feed conversion rate of sheep, and by screening sheep with the TT genotype, it reduced feed consumption and improved the scientific nature and economic benefits of breeding.
Smart Images

Figure CN118745471B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular marker screening and application technology, specifically involving APOD gene fragments as molecular markers affecting sheep feed conversion rate and their application in breeding. Background Technology
[0002] Lamb is one of the main meat products in society today, and improving its economic efficiency has become one of the most important tasks. In sheep production, feed costs account for a large proportion, so improving feed conversion ratio is of significant research importance. This research focuses on indicators designed through genetic improvement to reduce feed input without affecting normal animal growth, as well as feed utilization rates in livestock and poultry. Animal feed utilization rate refers to the efficiency with which it utilizes the feed it consumes, mainly affected by both feed and animal factors. Feed efficiency (FE) is short for feed conversion ratio (FCR), also known as feed return. Generally, feed conversion ratio refers to the amount of feed consumed to gain 1 kg of body weight, i.e., feed intake / gain (F / G), and has long been an important economic indicator used to measure the level of feed utilization. In addition, the gain / feed intake (G / F) ratio is an indicator of the relationship between weight gain and daily feed intake in livestock and poultry (Lancaster PA, Carstens GE, Jr CD, et al. Phenotypic and genetic relations of residual feed intake with performance and ultrasound carcasstraits in Brangus heifers. Journal of Animal Science, 2009, 87(12):3887-3896). Feed conversion ratio is widely used at home and abroad. In meat production, the feed-to-meat ratio is used, while in poultry egg production, the feed-to-egg ratio is used. To improve feed conversion ratio, we need to focus on two aspects: increasing the weight gain or meat and egg production of livestock and poultry and reducing feed consumption (Aggrey S E, Karnuah AB, Sebastian B, et al. Genetic properties of feed efficiency parameters in meat-type chickens. Genetics Selection Evolution, 2010, 42(1):1-5. Aggrey S E, Rekaya R. Dissection of Koch's residual feed intake: implications for selection. Poultry Science, 2013, 92(92):2600-2605).Studies have shown that the heritability of feed conversion ratio is 0.26–0.41, which is a moderately heritable trait. It is genetically controlled and can be improved through selection (Willems OW, Miller SP, Wood B J. Assessment of residual body weight gain and residual intake and body weight gain as feed efficiency traits in the turkey (Meleagrisgallopavo). Genetics Selection Evolution, 2013, 45(1):1-8). Based on scientific data, selective breeding and genetic improvement of sheep flocks (Mo Futao. Study on production performance, body composition and digestive metabolism of fattening lambs with different RFI. Gansu Agricultural University, 2016) is one of the feasible methods. How to determine the scientific basis is one of the problems we need to solve. At present, most indicators are analyzed based on animal phenotypes, and there are very few systematic analyses of sheep feed conversion ratio at the genetic level.
[0003] In 1963, apolipoprotein D (ApoD) was first discovered in human plasma (Jarrier et al., 1963). Initially identified as a component of high-density lipoprotein (HDL), it was first isolated from human plasma in 1973 (Mcconathy et al., 1973). Subsequently, it was shown to be a member of the lipid transporter family. ApoD can bind cholesterol, progesterone, pregnenolone, bilirubin, and arachidonic acid (Rassart et al., 2000). Moreover, unlike other apolipoproteins that are mainly synthesized in the liver and intestines, apolipoprotein D is widely expressed in various tissues, including the pancreas, kidneys, placenta, spleen, and brain (Drayna et al., 1986; Ganfornina et al., 1986; Séguin et al., 2008; 1995). In recent years, an increasing number of experimental studies have indicated that APOD plays an important role in embryonic and adult growth, development and differentiation, tumor cell occurrence, development and apoptosis, resistance to external environmental stress, maintenance of lipid homeostasis, and in the occurrence, repair, disorder and disease of some nervous systems. Apolipoproteins participate in the transport and metabolism of lipids in animals and maintain lipid balance; therefore, apolipoproteins are related to various lipid-related cardiovascular diseases. The APOD gene has been identified as being related to lipoprotein metabolism in both vertebrate and human studies (Cong Yi, 2008). Studies have shown that high APOD levels in the round ligament fat deposits of obese women are associated with improved systemic metabolic factors, including insulin sensitivity and inflammation (Desmarais et al., 2018). APOD can induce non-inflammatory cirrhosis in transgenic mice by regulating hepatic prostaglandin production and ω-fatty acid accumulation (Desmarais et al., 2019). However, the relationship between the APOD gene and sheep feed efficiency, and if so, remains unclear.
[0004] There is relatively little research on the APOD gene in terms of feed efficiency traits. Sheep feed conversion rate is influenced by multiple genes with minor effects. This invention explores the correlation between different genotypes of the APOD gene and sheep feed conversion rate by sequencing and analyzing the APOD gene. The aim is to provide a reference for the selection and breeding of superior sheep breeds and to provide genetic engineering methods for the cultivation of excellent sheep breeds. Summary of the Invention
[0005] To address the aforementioned technical problems, this invention provides a molecular marker related to sheep feed conversion rate and its application.
[0006] The molecular marker of this invention is amplified from the sheep APOD gene, and its specific nucleotide sequence is shown in SEQ ID NO. 1. By amplifying and sequencing the DNA sequence of the sheep APOD gene, polymorphic sites of the APOD gene are identified, the correlation between different genotypes and sheep feed conversion ratio is analyzed, and a detection method for molecular markers containing polymorphic sites is established. This molecular marker can be applied to the breeding of new feed-saving, high-quality meat sheep breeds.
[0007] To achieve the above objectives, the present invention adopts the following technical solution:
[0008] The application of a molecular marker related to sheep feed conversion ratio in breeding, wherein the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein the Y at position 233bp represents T or C. Due to a T / C mutation at position 233 of the above sequence, the sheep APOD gene has a T / C polymorphism at this site.
[0009] The application of the primer pairs for detecting the above molecular markers in breeding includes upstream primer MF and downstream primer MR. The nucleotide sequence of upstream primer MF is shown in SEQ ID NO.2, and the nucleotide sequence of downstream primer MR is shown in SEQ ID NO.3.
[0010] The application of AQP SNP primer pairs for detecting the above molecular markers in breeding includes forward primers for detecting AlleleT, forward primers for detecting AlleleC, and universal reverse primers. The nucleotide sequence of the forward primer for detecting AlleleT is shown in SEQ ID NO.4, the nucleotide sequence of the forward primer for detecting AlleleC is shown in SEQ ID NO.5, and the nucleotide sequence of the universal reverse primer is shown in SEQ ID NO.6.
[0011] The application of a kit for detecting the above-mentioned molecular markers in breeding, wherein the kit contains PCR primer pairs or AQP primer pairs for detecting the above-mentioned molecular markers.
[0012] A method for detecting molecular markers associated with sheep feed conversion ratio, wherein the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and the Y at position 233 bp represents T or C, the method comprising detecting sheep genomic DNA using the primer pairs or kits described above, and the specific detection method comprising the following steps:
[0013] S1. Amplify sheep genomic DNA using the PCR primer pairs, AQP primer pairs, or kits containing the primer pairs described above.
[0014] S2. Identify the polymorphic sites in the amplification products obtained in step S1.
[0015] In step S2, the above-mentioned typing and identification methods include, but are not limited to, direct sequencing, fluorescent probe, gene chip, and high-resolution melting curve methods.
[0016] The method for detecting molecular markers related to sheep feed conversion ratio using the above primer pairs includes the following steps:
[0017] a) Genomic DNA was extracted from sheep blood samples and AQP typing was performed using primer pairs with nucleotide sequences as shown in SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6;
[0018] b) After amplification, fluorescence signals were detected and genotyping results were viewed using a C1000 Touch Thermal Cycler instrument.
[0019] The above-described detection method is applied to the detection of sheep feed conversion rate. By detecting the molecular markers of the present invention in the genomic DNA of the sheep to be tested and analyzing the types of polymorphic sites, the feed conversion rate of the sheep can be determined, and sheep breeds with low feed conversion rates can be screened out. The feed conversion rate of sheep carrying the TT genotype is significantly lower than that of sheep carrying the TC genotype.
[0020] The above-described detection method is applied to sheep breeding, where the breeding aims to select feed-saving sheep breeds. If the genotype of the sample to be tested is TT, then sheep with this genotype are feed-saving. The feed conversion ratio of sheep carrying the TT genotype is significantly lower than that of sheep carrying the TC genotype, and lower than that of sheep carrying the CC genotype.
[0021] This invention, through PCR amplification and sequencing of the APOD gene of the representative sheep breed, Hu sheep, discovered a T / C polymorphism site at position 233 of the amplified fragment. By detecting polymorphisms in 897 Hu sheep and establishing a least-squares model, a molecular marker related to sheep feed conversion ratio was identified. This molecular marker can be used for the breeding of feed-saving sheep, providing an effective genetic engineering method for the genetic improvement of sheep feed conversion ratio, and has significant practical application value.
[0022] The beneficial effects of this invention are as follows:
[0023] This invention provides the application of molecular markers related to sheep feed conversion ratio in breeding. Sheep with the TT genotype at the polymorphic locus of this molecular marker have a significantly lower feed conversion ratio than those with the TC genotype. Therefore, the TT genotype should be selected for breeding. Detecting the genotype at this polymorphic locus can effectively identify whether a sheep is a feed-saving breed, providing an effective detection method for breeding feed-saving sheep.
[0024] This invention also establishes a method for detecting molecular markers related to sheep feed conversion rate and sites leading to polymorphism. This method can determine the genotype of polymorphic sites in sheep to be tested, and can be used to select sheep with TT homozygous genes as breeding sheep for breeding purposes, in order to cultivate feed-saving sheep and improve the quality of sheep, which helps to improve the economic benefits of the breeding industry. Attached Figure Description
[0025] Figure 1 This is an agarose gel electrophoresis image of the sheep APOD gene fragment used as a molecular marker in this invention, wherein lane M: DL 2000 Marker, lanes 1-12: APOD gene amplification results.
[0026] Figure 2 The sequencing results are for the sheep APOD gene mutation site in Example 1 of this invention.
[0027] Figure 3 The image shows the AQP typing results of the amplified APOD gene fragment of sheep in this invention. The blue dot near the left represents the TT genotype, the green dot near the middle represents the CT genotype, and the orange dot near the right represents the CC genotype. Detailed Implementation
[0028] The following embodiments are used to further illustrate the present invention, but should not be construed as limiting the present invention. Any modifications or substitutions made to the present invention without departing from its spirit and essence are within the scope of the present invention.
[0029] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise specified, all reagents used in this embodiment are of analytical grade or higher.
[0030] Example 1: Amplification of the APOD gene
[0031] Using sheep APOD gene DNA (GenBank accession number: NC_056054.1) as a template, a pair of primers, MF and MR, were designed using Oligo 7.0 software. The primer sequences are as follows:
[0032] MF(SEQ ID NO.2):5'-GCGAGCCCAGACATGTTCCT-3'
[0033] MR(SEQ ID NO.3):5'-TACCTACCCCAAGGCTTGCT-3'
[0034] (2) Amplification and sequencing of the APOD gene
[0035] The total PCR amplification reaction volume was 35 μL, including 17.5 μL of 2×PCR Master Mix, 1.1 μL of 10 μmol / L upstream primer MF (SEQ ID NO. 2), 1.1 μL of 10 μmol / L downstream primer MR (SEQ ID NO. 3), 1.3 μL of DNA template, and 14 μL of ddH2O. The DNA template was genomic DNA extracted from sheep blood.
[0036] PCR amplification program: 94℃ pre-denaturation for 3 min, 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 60 s, 35 cycles, and a final extension at 72℃ for 10 min.
[0037] The PCR amplification products were detected by 1.5% agarose gel electrophoresis, and the results are as follows: Figure 1 As shown, lane M represents a 2000 molecular weight marker, and lanes 1-12 represent the APOD gene amplification results. The amplified PCR fragment was sequenced, yielding a 352 bp amplified fragment with the nucleotide sequence shown in SEQ ID NO.1. This fragment contains a polymorphic site, specifically at position 233 bp where Y is either T or C. This indicates that the amplified APOD gene fragment (SEQ ID NO.1) exhibits a T / C polymorphism at position 233 bp (see [link to SEQ ID NO.1]). Figure 2 ).
[0038] Among them, SEQ ID NO.1: GCGAGCCCAGACATGTTCCTCCAAGGACTCC GTGCCCTCAGAGGCTCCGAACGCCTCCAGCTGCTTTGTTCTCCCCACTCCAGGTCCGTCTCCAGCCTCCCAGCCCAAAGATGGTGCCAGCGCTGCTGCTGCTGCTCCCTGCCCTGGCTGGCCTCTTCGGAGCAGCTGAGGGACAAGCTTTCCATCTCGGGA AATGCCCCAATCCTCCGGTGCAGGAGAATTTTGACGTGAAYAAGGTGCAGTAAATGGATAAATCCCTGCTTGTTTTGCTGTCCTGTTTGAATAAGCATCCTACCAGGTTTGGTTTTATTTTCCTGCTCTAATGACCACAGCAAGCCTTGGGGTAGGTA.
[0039] DNA sequence homology retrieval and identification:
[0040] The DNA sequence obtained after sequencing was compared with known physiologically functional genes published in the GenBank database using the BLAST (Basic Local Alignment Search Tool) software on the website of the National Center for Biotechnology Information (NCBI, http: / / www.ncbi.nlm.nih.gov) to identify and obtain functional information of the DNA sequence. The search results showed that the sequence obtained had 98% homology with a partial sequence of the sheep APOD gene DNA (GenBank accession number: NC_056054.1).
[0041] Example 2: Establishment of a genotyping detection method
[0042] 1. Primer sequence design
[0043] AQP primer pairs were designed targeting the T / C polymorphism site of the amplified fragment in Example 1 for the specific detection of this polymorphism site. The nucleotide sequence of the optimized AQP primer pairs is as follows:
[0044] Forward primer A1 (SEQ ID NO.4) used to detect AlleleT: GAAGGTGACCAA GTTCATGCTTGCAGGAGAATTTTGACGTGAAT;
[0045] Forward primer A2 (SEQ ID NO.5) for detecting AlleleC: GAAGGTCGGAGTCAACGGATTTGCAGGAGAATTTTGACGTGAAC;
[0046] Universal reverse primer C (SEQ ID NO.6): TCAAACAGGAGACAGCAAAACAA GC.
[0047] The above primers were synthesized by Beijing Sangon Biotech Co., Ltd.
[0048] 2. Quality control of extracted genomic DNA.
[0049] Genomic DNA can be extracted from sheep blood using a DNA extraction kit. The extracted genomic DNA is then tested for quality using 1% agarose gel electrophoresis and Nanodrop 2100. Acceptable DNA requires: (1) Agarose gel electrophoresis showing a single DNA band without significant diffusion; (2) Nanodrop 2100 detection showing A260 / 280 between 1.8 and 2.0; A260 / 230 between 1.8 and 2.0; and no significant light absorption at 270 nm. Unacceptable DNA needs to be extracted and tested again. This is based on the AQP of Beijing Jiacheng Biotechnology Co., Ltd. TM The detection technology and genome size calculations determined the DNA usage to be 2–50 ng / sample. The extracted genomic DNA was then diluted to a concentration of 2–50 ng / μL to serve as a DNA template.
[0050] 3. Genotyping
[0051] First, prepare a 100 μmol / L solution of each of the AQP primer pairs: forward primer A1 for detecting AlleleT, forward primer A2 for detecting AlleleC, and universal reverse primer C. Then, mix these primers with sterile water in a volume ratio of 12:12:30:46 (forward primer A1:forward primer A2:reverse primer C:sterile water) to prepare a primer mixture for later use.
[0052] Then, using a pipette, add 0.07 μL of primer mixture, 0.5 μL of sterile water, 2.5 μL of HiGeno 2xProbe Mix, and 2 μL of diluted DNA template (2–50 ng / μL) to each well of a 384-well plate. After adding the components, seal the plate, centrifuge with vortexing, and transfer to a C1000 Touch plate. TM PCR amplification was performed on a Thermal Cycler instrument.
[0053] The specific procedure is as follows:
[0054] Pre-denaturation at 95℃ for 10 minutes;
[0055] 95℃, 20 seconds (denaturation) — 61℃-55℃, 40 seconds (annealing & extension), amplification for 10 cycles, with a decrease of 0.6℃ per cycle;
[0056] 95℃, 20 seconds (denaturation) — 55℃, 40 seconds, continue amplification for 34 cycles.
[0057] After amplification, use C1000 Touch TM The Thermal Cycler instrument was used to detect fluorescence signals and examine genotyping at 37°C. Results for some samples are shown below. Figure 3As shown in the figure. HEX is the horizontal axis and FAM is the vertical axis. Each graph in the figure represents a sample of the test material. The blue square near the left indicates that the locus is homozygous genotype "TT"; the green triangle near the middle indicates that the locus is heterozygous genotype "TC"; and the orange dot near the right indicates that the locus is homozygous genotype "CC".
[0058] 4. Application of the molecular markers of this invention in the association analysis of marker traits of sheep feed conversion rate
[0059] The experiment examined the polymorphism of 897 Hu sheep, determined their genotypes, and established the least squares model as described below to conduct association analysis between genotype and feed conversion ratio.
[0060] Y ijkl =μ+Genotype i +P j +F k +M l +ε ijkl
[0061] Among them, Y ijkl Here are the observed trait values, μ is the population mean, and Genotype. i For genotype effect, P j Due to the batch effect, F k Due to the paternal effect, M l Maternal effect, ε ijkl Assuming random error, let ε ijlmk They are mutually independent and follow N(0, σ). 2 )distributed.
[0062] Genotyping results showed that among 897 individuals, there were 124 individuals with the TT genotype, 523 individuals with the TC genotype, and 250 individuals with the CC genotype. The association analysis results between genotype and traits in sheep during the 120-180 day stage are shown in Table 1.
[0063] Table 1. Association analysis between APOD gene polymorphism and feed conversion ratio in sheep.
[0064]
[0065]
[0066] Note: All data in the table are mean ± standard error. Different superscript letters in the same column indicate significant differences (P<0.05), while the same superscript letter indicates no significant differences (P>0.05).
[0067] The results showed that the T>C mutation site at 233 bp of the APOD gene sequence shown in SEQ ID NO.1 was significantly correlated with feed conversion ratio (FCR) in sheep (P<0.05). The FCR120-180 of the TT genotype was 7.032±1.107, significantly lower than that of the TC genotype (7.377±1.759) (P<0.05) and lower than that of the CC genotype (7.313±1.54). The TT genotype consumed 0.345 kg less feed per kg of weight gain compared to the TC and CC genotypes, respectively. Therefore, sheep carrying the TT genotype had a significantly higher feed conversion ratio than those carrying the TC genotype (P<0.05). This indicates that the T allele is the dominant allele, and sheep with the TT genotype should be selected for breeding.
Claims
1. The application of a primer pair for detecting molecular markers related to feed conversion ratio in Hu sheep breeding, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, where Y at 233bp represents T or C, and this mutation leads to T / C polymorphism of the molecular marker; the feed conversion rate of sheep carrying the TT genotype is significantly lower than that of sheep carrying the TC genotype, and the breeding is to select feed-saving Hu sheep.
2. The application of primer pairs for detecting molecular markers related to feed conversion ratio in Hu sheep breeding, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, where Y at 233bp represents T or C, and this mutation leads to T / C polymorphism of the molecular marker; the feed conversion rate of sheep carrying the TT genotype is significantly lower than that of sheep carrying the TC genotype, and the breeding is to select feed-saving Hu sheep; the nucleotide sequences of the primer pair are shown in SEQ ID NO.2 and SEQ ID NO.
3.
3. The application of AQP SNP primer pairs for detecting molecular markers related to feed conversion ratio in Hu sheep breeding, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, where Y at 233bp represents T or C, and this mutation leads to T / C polymorphism of the molecular marker; the feed conversion rate of sheep carrying the TT genotype is significantly lower than that of sheep carrying the TC genotype, and the breeding is for selecting feed-saving Hu sheep; the AQP SNP primer pair includes a forward primer for detecting AlleleT, a forward primer for detecting AlleleC, and a universal reverse primer, wherein the nucleotide sequence of the forward primer for detecting AlleleT is shown in SEQ ID NO.4, the nucleotide sequence of the forward primer for detecting AlleleC is shown in SEQ ID NO.5, and the nucleotide sequence of the universal reverse primer is shown in SEQ ID NO.
6.
4. The application of a detection kit for molecular markers related to feed conversion ratio in Hu sheep breeding, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, where Y at 233bp represents T or C, and this mutation leads to T / C polymorphism of the molecular marker; the feed conversion rate of sheep carrying the TT genotype is significantly lower than that of sheep carrying the TC genotype, and the breeding is for selecting feed-saving Hu sheep; the detection kit contains primer pairs or AQP primer pairs, wherein the nucleotide sequences of the primer pairs are shown in SEQ ID NO.2 and SEQ ID NO.3; The nucleotide sequences of the AQP primer pairs are shown in SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.
6.
5. The application of a method for detecting molecular markers related to feed conversion ratio in Hu sheep feed conversion ratio detection, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, where Y at position 233bp represents T or C. The detection method includes the following steps: S1. Amplify the genomic DNA of Hu sheep using primer pairs as shown in SEQ ID NO.2 and SEQ ID NO.3 or AQP primer pairs as shown in SEQ ID NO.4-6; S2. Genotyping the molecular marker at position 233 bp of the amplified product obtained in step S1. Used to screen for feed-saving Hu sheep, the feed conversion rate of sheep carrying the TT genotype was significantly lower than that of sheep carrying the TC genotype.