A candidate gene nlr-g4 derived from timophevi wheat powdery mildew resistance gene pm6 and its application

By cloning and regulating the NLR-G4 gene of Timofevi wheat, the problem of the easy loss of the wheat powdery mildew resistance gene Pm6 during utilization was solved, achieving precise regulation of wheat powdery mildew resistance, improving breeding efficiency and the development of disease-resistant varieties.

CN118879736BActive Publication Date: 2026-06-26NANJING AGRICULTURAL UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
NANJING AGRICULTURAL UNIVERSITY
Filing Date
2024-09-18
Publication Date
2026-06-26

AI Technical Summary

Technical Problem

The wheat powdery mildew resistance gene Pm6 is easily lost during long-term use, and existing technologies are unable to effectively analyze its growth period-dependent disease resistance mechanism, resulting in the waste of disease resistance resources and serious impact of the disease on wheat yield and quality.

Method used

The candidate gene NLR-G4 from Timofevi wheat was cloned and analyzed. By constructing recombinant expression vectors and overexpression vectors, the gene was overexpressed or silenced in wheat to regulate its resistance. The tag sequence facilitated protein purification, and plant breeding was carried out by combining specific promoters and selective markers.

Benefits of technology

This method enables precise regulation of wheat powdery mildew resistance, enhancing or reducing its resistance, providing a new approach to wheat breeding, and improving the efficiency and resistance of disease-resistant varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118879736B_ABST
    Figure CN118879736B_ABST
Patent Text Reader

Abstract

The application discloses a candidate gene NLR-G4 derived from a Timopheevi wheat powdery mildew resistance gene Pm6 and application thereof.The nucleotide sequence of the candidate gene NLR-G4 derived from the Timopheevi wheat powdery mildew resistance gene is shown in SEQ ID NO.1.The application also protects the application of the candidate gene NLR-G4 of Pm6 in improving plant disease resistance.Using a transient overexpression system, the NLR-G4 can be transformed into a susceptible wheat variety Yangmai 158, so that the sinker index can be significantly reduced; using a VIGS system, the NLR-G4 can be silenced in a disease-resistant material IGV1-465, so that the plant disease susceptibility is enhanced.Therefore, the NLR-G4 positively regulates the powdery mildew resistance, and has important significance for wheat disease-resistant breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering, specifically relating to the candidate gene NLR-G4 of the wheat powdery mildew gene Pm6, its encoded protein, and its applications. Background Technology

[0002] Wheat powdery mildew is a fungal disease caused by the highly specialized parasite *Blumeria graminis* f. spritici (Bgt). It is widespread globally, severely impacting wheat yield and quality. Wheat powdery mildew exhibits rapid virulence variation and numerous physiological races, leading to intense competition between the host and the pathogen. Long-term, large-scale use of a single resistance source accelerates the variation of the pathogen's physiological races, resulting in the loss of resistance genes. Continuously discovering, researching, and utilizing effective resistance resources, and breeding new varieties with aggregated resistance genes, is the most economical and effective way to control powdery mildew.

[0003] Common wheat closely related species contain a large number of superior genes for stress resistance, high yield, and high quality, making them important resources for common wheat variety improvement. Timofeevi (T. timopheevii, 2n=4x=28, AAGG) is a secondary gene pool of common wheat, possessing multiple powdery mildew resistance genes, such as Pm6, Pm27, and Pm37. The Pm6 gene, derived from the long arm of chromosome 2G of T. timopheevii, confers growth-stage-dependent powdery mildew resistance in wheat and is widely used in breeding. Cloning the Pm6 gene and elucidating its growth-stage-dependent resistance mechanism is of great significance for the rational utilization of Pm6 and the breeding of new disease-resistant varieties. Summary of the Invention

[0004] The purpose of this invention is to provide a candidate gene NLR-G4 for wheat powdery mildew resistance gene Pm6 and its encoded protein sequence.

[0005] Another objective is to provide a recombinant expression vector containing the aforementioned genes.

[0006] Another object of the present invention is to provide the application of the gene and the overexpression vector.

[0007] The candidate gene NLR-G4 sequence of the powdery mildew resistance gene Pm6 provided by this invention is derived from the introgression line IGV1-465 of the wheat Prins-T. timopheevii 2G chromosome segment. The gene nucleic acid sequence is SEQ ID NO.1, and its amino acid sequence is SEQ ID NO.2.

[0008] To facilitate the purification of protein NLR-G4, a tag as shown in Table 1 can be attached to the amino or carboxyl terminus of the protein, which consists of the amino acid sequence shown in SEQ ID NO.2.

[0009] The specific tag sequences are shown in Table 1.

[0010] Table 1 Label Sequence

[0011] Label residues amino acid sequence FLAG 8 DYKDDDDK HA 9 YPYDVPDYA c-myc 10 EQKLISEEDL Poly-Arg 5-6 (usually 5) RRRRR PoN-His 2-10 (usually 6) HHHHHH Strep-tagII 8 WSHPQFEK

[0012] The NLR-G4 protein of this invention can be synthesized artificially, or its encoding gene can be synthesized first and then expressed biologically.

[0013] Expression cassettes containing the NLR-G4 gene, recombinant expression vectors, recombinant bacteria, etc., are all within the scope of protection of this invention.

[0014] Primer pairs that amplify the full length or any fragment of the gene sequence are also within the scope of protection of this invention.

[0015] When constructing recombinant expression vectors using the aforementioned nucleic acid molecules, any type of enhancing, constitutive, tissue-specific, or inducible promoter can be added before its transcription initiation nucleotide. These promoters can be used alone or in combination with other plant promoters, such as the cauliflower mosaic virus (CAMV) 35S promoter and the maize ubiquitin promoter. Furthermore, when constructing plant expression vectors using the genes of this invention, enhancers, including translational enhancers or transcriptional enhancers, can also be used. These enhancer regions can be ATG start codons or adjacent region start codons, but they must be identical to the reading frame of the coding sequence to ensure correct translation of the entire sequence. The sources of the translation control signals and start codons are wide-ranging; they can be natural or synthetic. The translation initiation region can originate from the transcription initiation region or structural genes.

[0016] To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be processed, such as by adding genes that can be expressed in plants, encoding enzymes or luminescent compounds that produce color changes (GUS genes, luciferase genes, etc.), antibiotic resistance markers (gentamicin markers, kanamycin markers, etc.), or chemical reagent resistance marker genes (such as herbicide resistance genes). From a safety perspective, transgenic plants can be screened directly under stress without adding any selective marker genes.

[0017] The recombinant vector may specifically be a recombinant expression vector. Specifically, the recombinant expression vector may be a recombinant plasmid obtained by inserting the nucleic acid molecule into an existing plant expression vector. Existing plant expression vectors may specifically be pBI220 vector, pWMB220-GUS, or BSMV-γ vector.

[0018] This invention also protects the application of the NLR-G4 protein, such as regulating powdery mildew resistance; enhancing or reducing plant resistance to powdery mildew.

[0019] The present invention also protects the application of the nucleic acid molecule encoding the NLR-G4 protein, such as breeding plants with altered resistance to powdery mildew; breeding plants with enhanced or reduced resistance to powdery mildew.

[0020] This invention also protects a plant breeding method: increasing the activity and / or content of NLR-G4 protein in a target plant, thereby enhancing the target plant's resistance to powdery mildew.

[0021] This invention also protects a plant breeding method: reducing the content and / or activity of NLR-G4 protein in a target plant, thereby reducing the target plant's resistance to powdery mildew.

[0022] The powdery mildew described above can be caused by powdery mildew pathogens. The powdery mildew pathogen described above can be *Brucea blisterii* wheat-specific strain. Specifically, the powdery mildew pathogen is *Brucea blisterii* strain E26.

[0023] The candidate gene NLR-G4 obtained in this invention, derived from the powdery mildew resistance gene Pm6 in Timofewi wheat, is a growth-stage-dependent resistance gene. This discovery helps elucidate the mechanism of action of growth-stage-dependent powdery mildew resistance in wheat. Overexpression of this gene in susceptible materials enhances powdery mildew resistance, while silencing the gene in resistant materials enhances susceptibility, indicating that this gene positively regulates powdery mildew resistance. This invention is of great significance for wheat powdery mildew resistance breeding. Attached Figure Description

[0024] Figure 1 The results of resistance identification of IGV1-465 and Prins to powdery mildew race E26 at different stages. A: Resistance phenotype of IGV1-465 and Prins 7 days after inoculation at the two-leaf and four-leaf stages; B: Mycelial development of IGV1-465 and Prins 0h and 72h after infection with powdery mildew race E26.

[0025] Figure 2 This is a mapping of Pm6. A: Chromosome 2B diagram of IGV1-465; B: Location of molecular markers; C: IGV1-465, CS ph1b, and different recombinant strains; D: Genes and locations within the candidate regions of Pm6 using the 10+ LongReach Lancer-2G genome as a reference; E: Powdery mildew identification phenotypes of IGV1-465, CS ph1b, and different recombinant strains. P1: Prins; P2: IGV1-465; 1-17: 17 recombinant types.

[0026] Figure 3Gene annotation and transcriptome expression data for candidate regions corresponding to the 10+ LongReach Lancer-2G genome as a reference genome. A: Candidate gene IDs and functional annotations, expression levels of candidate genes IGV1-465 and Prins at four-leaf stage after 0h and 24h of powdery mildew infection. B: NLR-G4 expression was induced by powdery mildew at both two-leaf and four-leaf stages.

[0027] Figure 4 The EMS mutant and its corresponding powdery mildew resistance phenotype are shown. i: point mutations in the candidate gene NLRG4 and its promoter region; ii: resistance identification phenotype of the mutant against powdery mildew E26.

[0028] Figure 5 To verify the function of NLRG4 in a transient system. A: Construction process of pBI220-NLR-G4 vector; B: Changes in haustorium index and presence / absence of haustorium formation after overexpression of pBI220-NLR-G4 and pWMB220-GUS mixed vector in young leaves of Yangmai 158; C: Construction process of BSMV:γ-NLRG4 vector; D: Silencing efficiency of IGV1-465 after application to BSMV-NLRG4; E: Powdery mildew phenotype after application of IGV1-465 to BSMV-NLRG4. Detailed Implementation

[0029] The following examples are provided to better understand the present invention, but are not intended to limit the invention. Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0030] The powdery mildew fungus used in this study was wheat powdery mildew race E26.

[0031] The IGV1-465 and Prins mentioned in this study are described in the literature “Tao Wenjing, Liu Jinyuan, Liu Dajun, et al. Accurate identification of introgression fragments in common wheat-Timofiev wheat powdery mildew resistant introgression lines [J]. Acta Botanica Sinica, 1999(09):941-946.”

[0032] The CS ph1b mutant described in this study is described in the literature “Wan W, Xiao J, Li M, et al. Fine mapping of wheat powdery mildew resistance gene Pm6 using 2B / 2G homoeologous recombineants induced by the ph1b mutant[J]. Theoretical and Applied Genetics, 2020, 133(2): 1265-1275.”

[0033] The single-cell transient expression technique and haustorium index are described in the literature “Patrick S, Jana P, Olaf A, et al. A Transient Assay System for the Functional Assessment of Defense-Related Genes in Wheat[J]. Molecular Plant-Microbe Interactions, 1999, 12(8): 647-654”.

[0034] The gene silencing technique induced by barley stripe mosaic virus is described in the literature “Yuan C,Li C,Yan L,etal.A high throughput barley stripe mosaic virus vector for virus induced genesilencing in monocots and dicots[J].PLoS One,2011,10(6):e26468”.

[0035] Example 1: Identification of resistance during the growth period of IGV1-465 and Prins to powdery mildew E26

[0036] In a study comparing the resistant IGV1-465 and the susceptible Prins material, powdery mildew E26 was inoculated at the two-leaf and four-leaf stages. Mycelial staining of leaves at the four-leaf stage (0 h, representing pre-inoculation) and 72 h post-inoculation revealed that Prins was susceptible at both stages; IGV1-465 showed susceptibility at the two-leaf stage but exhibited high resistance or immunity at the four-leaf stage; and at the four-leaf stage, powdery mildew spores on IGV1-465 ceased development 72 h after infection, while those on Prins developed normally. Figure 1 This demonstrates that Pm6-mediated powdery mildew resistance is age-dependent.

[0037] Example 2: Locating the powdery mildew resistance gene

[0038] Based on Example 1: Due to recombination inhibition between the introgression fragment of chromosome 2G in IGV1-465 and the homologous segment of chromosome 2B in wheat, it was impossible to find more recombinant plants of the target segment in the secondary segregating population of IGV1-465 / Prins, increasing the difficulty of Pm6 localization. To further localize Pm6, this study introduced the mutant gene ph1b from the partial homologous pairing gene (Ph1b) of the common wheat variety Chinese Spring to overcome the recombination inhibition between partial homologous chromosomes of 2B / 2G, thereby screening for new recombinants in the target region. Using the 2G sorting sequence and the 10+ LongReach Lancer-2G sequence obtained in our laboratory in the previous period, 37 linkage markers with Pm6 were developed ( Figure 2 ) and in the 5679 segregators of F2 constructed from IGV1-465 and CS ph1b, markers were added to increase density. Combined with in vitro and in vivo identification of powdery mildew at the four-leaf stage, Pm6 was ultimately located between markers 504300 and 507700, corresponding to a physical location of 1.2 Mb in LongReach Lancer-2G. Figure 2 (This refers to a study involving 24 candidate genes. The molecular markers used for localization are shown in Table 2.)

[0039] Table 2. Molecular markers for Pm6 localization

[0040]

[0041]

[0042]

[0043] The analysis method for the above positioning markers is as follows:

[0044] 1. Extraction of wheat genomic DNA using the CTAB method

[0045] (1) Take 0.1g of wheat tissue sample and place it in a 2.0mL tube with glass beads. After freezing with liquid nitrogen, grind it at 1500rpm for 1min on a grinder. (2) Add 500μL of CTAB extraction solution (2% CTAB, 2% PVP, 0.1M Tris (pH 8.0), 25mM EDTA (pH 8.0), 2M NaCl), and place it in a constant temperature incubator at 65℃ for 45min. Invert the tube every 15min to mix. (3) Add an equal volume of chloroform, shake vigorously until completely turbid, let stand for 1min, and centrifuge at 12000rpm for 10min. (4) Take the supernatant and add an equal volume of pre-cooled isopropanol to a new centrifuge tube. Mix gently, place on ice for 10min, and centrifuge at 12000rpm for 3min. (5) Discard the supernatant, wash twice with 1ml of 70% alcohol, and air dry at room temperature. (6) Dissolve and dilute with ddH2O to 100-200 ng / μL and store in a refrigerator at -20℃.

[0046] 2. Development of molecular markers

[0047] (1) SNP markers: Within the Pm6 candidate region, SNPs were designed by comparing them with those present in the 2G reference genome and the 2A, 2B, and 2D reference genomes such as the Chinese Spring, Fielder, and 10+ genomes, using the online primer design tool Primer 3.0.

[0048] (2) SSR markers: Repeated sequences were extracted from the candidate region of Pm6, the differences in repeated sequences between resistant and susceptible parents were analyzed, and primers were designed using the online primer design software SSR Hunter.

[0049] (3) IT (Intron Target) marker: By analyzing the 2G and 2B sequences, homologous sequences with insertions or deletions of more than 10bp in the 2G and 2B sequences within the Pm6 candidate interval were extracted. At the same time, the differences between 2A and 2D were compared and designed on PrimerPremier.

[0050] Polymorphism of all the above markers was verified in IGV1-465 and Prins and its F2 population, and polymorphic molecular markers were selected for localization.

[0051] 3. Polymerase chain reaction (PCR) for sequence amplification and PCR product detection.

[0052] (1) PCR reaction system (10μL): DNA (100-200ng / μL) 1.5μL, forward and reverse primers (10μmol / μL) 0.2μL each, ddH2O 3.1μL, 2×Green Taq Mix Buffer 5μL, total 10μL.

[0053] (2) PCR reaction program: denaturation at 95.0℃ for 5 min; denaturation at 95.0℃ for 20 s, annealing at 56-60℃ for 30 s, extension at 72℃ for 1 min, for a total of 32 cycles; extension at 72℃ for 5 min; storage at 10℃. The PCR reaction was performed in an MJ Research PTC-225 thermal cycler. The PCR products were analyzed and identified by agarose gel electrophoresis or polyacrylamide gel electrophoresis.

[0054] Example 3: Prediction of Pm6 candidate genes

[0055] Collinearity analysis of the Pm6 candidate regions corresponding to the genomes of LongReach Lancer-2G, Fielder-2B, and CS-2B revealed that each region contains a disease resistance gene cluster consisting of five CNL-type and one ABC transporter-type resistance gene. To further predict candidate genes, transcriptome sequencing was performed on leaves of IGV1-465 and Prins at 0h and 24h post-inoculation, with three replicates per sample. Expression analysis of 24 candidate genes within the candidate regions, combined with gene annotation, revealed that NLRG4, encoding a CNL-type resistance protein, was upregulated in IGV1-465 but almost unexpressed in Prins, making it the most likely candidate gene. Figure 3 (As shown). Using the gDNA and cDNA of NLRG4-F / R in IGV1-465 as templates, the full-length NLRG4 was cloned. It was found that the gDNA and cDNA of NLRG4 were identical, without introns, and the full length was 4731 bp. Its nucleotide sequence is shown in SEQ ID NO.1, encoding 1576aa, and the amino acid sequence is shown in SEQ ID NO.2.

[0056] The above transcriptome analysis and gene cloning can be performed using the following methods.

[0057] 1. Preparation, sequencing, and expression analysis of transcriptome samples

[0058] RNA sample preparation is as follows: Place 0.1g of leaf tissue into a 2.0mL RNase-free centrifuge tube and grind at 1500rpm for 30-60s. Add 1mL of TRIPURE and mix by inverting. Vortex at 1000rpm for 15 seconds and incubate at room temperature for 3 minutes to allow complete ribosome dissociation. Centrifuge at 12000rpm for 10 minutes at 4℃ and collect the supernatant to remove high molecular weight DNA and outer membrane. Add 0.2mL of chloroform to the centrifuge tube and vortex vigorously for 15 seconds to mix. Incubate at room temperature for 2-3 minutes. Centrifuge at 12000rpm for 10-15 minutes at 4℃. At this point, the solution and precipitate should be clearly separated into three layers. Transfer the supernatant to a 1.5mL RNase-free centrifuge tube. Add an equal volume of pre-chilled isopropanol, mix by inverting, and incubate at room temperature for 10 minutes. Centrifuge at 12000rpm for 10 minutes at 4℃. Discard the supernatant; at this point, RNA will form a gel-like precipitate at the bottom of the centrifuge tube. Add 1 mL of 75% ethanol prepared with RNase-free H2O and wash the precipitate. Centrifuge at 12000 rpm for 3 min at 4°C and carefully discard the supernatant. Place in a fume hood for 2-3 min to evaporate excess ethanol, then add 30-100 μl of RNase-free H2O to fully dissolve the RNA. After dissolution, store at -70°C. Take 1 μL of total RNA and add 4 μL of 10× loading buffer for electrophoresis on a 1% agarose gel (220V, 15 min). Three clear 5S, 18S, and 28S bands should be visible, with no dragging in the wells. Simultaneously, measure the absorbance at 260 nm and 280 nm on a NanoDrop. For high-purity RNA samples, the A260 / A280 ratio should be close to 2.0.

[0059] 2. Obtaining the NLRG4 gene sequence

[0060] (1) Synthesis of first-strand cDNA: The synthesis was performed using the Novozymes reverse transcription kit (HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper)).

[0061] Template denaturation: Mix 1 μg RNA template with 6 μl RNase-free ddH2O and incubate at 65℃ for 5 min; then incubate on ice for 2 min.

[0062] Genomic DNA removal: Add 2 μl of 5×gDNA Wiper Mix to the previous mixture and mix well. Then 42℃ for 2-3 min.

[0063] Long fragment reverse cDNA: Add 2 μl 5×gDNA Wiper Mix, 2 μl 10×RT Mix, 2 μl HiScript III enzyme Mix, 1 μl Oligo(dT), and 5 μl RNase-free ddH2O to the mixture from the previous step. Mix well and incubate at 37°C for 45 min followed by 85°C for 5 sec. After completion, store at -80°C.

[0064] Cloning of the NLRG4 gene sequence: NLRG4 was cloned using primers P1: TCAAAACCAACGAGATGGAGAC and P2: AAGGGAAGGAACTGTGTGAGT.

[0065] (1) PCR reaction system (50μL): cDNA: 5μL, upstream and downstream primers (10μmol / μL) 2μL each, ddH2O 18μL, 2×Phata Max Mix Buffer 25μL, total 50μL.

[0066] (2) PCR reaction program: denaturation at 95.0℃ for 5 min; denaturation at 95.0℃ for 20 s, annealing at 56-60℃ for 30 s, extension at 72℃ for 2 min, for a total of 35 cycles; extension at 72℃ for 5 min; storage at 10℃. The PCR reaction was performed in an MJ Research PTC-225 thermal cycler. The PCR products were analyzed by agarose gel electrophoresis.

[0067] Example 4: Analysis of EMS-susceptible mutants of the powdery mildew gene

[0068] Two hundred and fifty IGV1-465 seeds were mutagenized using 0.75% ethylmethane sulfonate (EMS). The mutants were identified by powdery mildew E26 at the four-leaf stage in the M1 and M2 generations, yielding five independent susceptible mutants (Mution1-Mution5). The full-length NLRG4 sequence and promoter sequence of the mutants were cloned using primers P1: TCAAAACCAACGAGATGGAGAC, P2: AAGGGAAGGAACTGTGTGAGT, P3: GTTGGCTAGTGATCGGTTGG, and P4: AGGCCTGAGAGGCATCTTTTC. Point mutations were found in all five mutants. One mutant (Mut1) had a point mutation that caused premature termination of its encoded protein. Three mutants (Mut2, Mut3, and Mut4) had missense mutations, and one mutant (Mut4) had a mutation upstream of the start codon ATG. Figure 4 As shown in the figure, this further illustrates that NLRG4 is a candidate gene for Pm6.

[0069] The above gene cloning can be performed using the following methods.

[0070] Cloning of the full-length sequence of NLRG4

[0071] PCR amplification of the full-length sequence of NLRG4: The full-length sequence of NLRG4 was amplified by PCR using primers P1 and P2 in gDNA and reversed cDNA; the method was the same as in Example 2, PCR amplification.

[0072] Purification and recovery of the target product: Using the Qingke Biotechnology Agarose Gel Extraction Kit, the target band was cut out under UV light and placed in a 2.0 mL tube. 400-500 μL of Buffer GL was added, and the tube was heated at 65℃ and 300 rpm for 5 min until the colloid was completely melted. 250 μL of Buffer BL was added to the EC adsorption column to activate the silica membrane. The completely melted gel product was transferred to the adsorption column, centrifuged at 12000 rpm for 1 min, and the waste liquid at the bottom of the tube was discarded. 700 μL of Buffer W2 was added to the adsorption column, centrifuged at 12000 rpm for 1 min, and the supernatant was discarded. This process was repeated twice. The adsorption column was placed back into the tube and centrifuged at 12000 rpm for 2 min, and the excess waste liquid was discarded. The tube was incubated at room temperature for 2 min, and the adsorption column was placed in a new tube with 30-50 μL of Eluent elution buffer added. After standing for 2 min, the tube was centrifuged at 12000 rpm for 2 min. This process was repeated twice. The concentration of the recovered sample was measured on a Nano Drop and stored at -20℃.

[0073] Cloning of the target product: Following the novizan blunt-end cloning vector construction kit, 1 μL of 5×TA / Blunt-Zero Cloning Mix, 1 μL of DNA recovery product, and 3 μL of ddH2O were mixed thoroughly and recombinated at room temperature for 5-10 min; 50 μL of DH5α E. coli competent cells were added; after incubating on ice for 15 min, heat shock was performed at 42℃ for 40-60 sec; after incubating on ice for 2 min, 800 μL of LBO medium was added; after activation at 37℃ and 220 rpm for 1 h, the culture was incubated with ampicillin (A... + The resistant LBA plates were coated and incubated upside down for 12 hours. Single clones were picked with sterile toothpicks and identified by bacterial PCR. Positive single strains were sent to Qingke Biotechnology for sequencing. The full-length sequence of NLRG4 obtained is shown in SEQ ID NO.1.

[0074] Example 5: Verification of NLRG4 function using single-cell transient expression technology

[0075] To verify the function of NLRG4, the full-length NLRG4 was amplified using recombinant primers P5: AGGACCGGTCCCGGGGGATCCATGGAGACAGCCGGG and P6: GCCCTTGCTCACCATGGATCCGGTTCTGACAATCGG and then inserted between the BamHI and KpnI restriction sites of pBI220 to obtain the overexpression vector pBI220-NLR-G4. Figure 5 A).

[0076] The formation of powdery mildew haustoria is fundamental for plant cells to absorb nutrients for growth and reproduction, and is often used as an important indicator of powdery mildew resistance. This study used single-cell transient expression technology to overexpress a 35S promoter-driven overexpression hybrid vector (pBI220-NLR-G4:pWMB220-GUS = 1:1) in the young leaves of the susceptible material Yangmai 158, using a mixed empty vector (pBI220:pWMB220-GUS = 1:1) as a negative control. The results showed that, compared with the negative control, pBI220-NLR-G4 expression significantly reduced the powdery mildew haustoria index, demonstrating that NLRG4 positively regulates powdery mildew resistance. Figure 5 As shown in B.

[0077] The above technologies can be achieved through the following methods:

[0078] 1. Construction of the overexpression vector pBI220-NLR-G4

[0079] Using a full-length cloning plasmid containing NLRG4 as a template, PCR amplification was performed using recombinant primers P5 and P6. The pBI220 empty vector was digested with BamHI and KpnI restriction enzymes. The linearized vector and the amplified target fragment were purified and recovered. Using the Novavirenz ClonExpress II One Step Cloning Kit, the following mixture was prepared: X μL linearized vector, Y μL insert fragment, 2 μL 5×CE II Buffer, 1 μL Exnase II, and ddH2O added to a final volume of 10 μL (X = [0.02 × vector base pairs] ng, Y = [0.04 × fragment base pairs] ng). The mixture was incubated at 37°C for 30 min. Transformation and sequencing were performed according to Example 4, gene cloning method.

[0080] 2. Overexpression of NLR-G4 in young leaves of Yangmai 158 using single-cell transient expression technology.

[0081] Single-cell transient expression technology: The mixed expression vector was thoroughly mixed with gold powder and then bombarded with epidermal cells of fresh leaves at the two-leaf stage of Yangmai 158 using a PDS1000 / He gene gun transformation system. The bombardment conditions were as follows: a 1.0 cm diameter, 900 psi ruptureable membrane was used, and the vacuum level during bombardment was 27 inches. The steps are as follows:

[0082] (1) Preparation of gold powder: Weigh 30 mg of gold powder into a 1.5 mL Eppendorf tube; add 70% alcohol, vortex for 5 min, and let stand for 15 min to allow the gold powder to precipitate completely; centrifuge for 5 sec and discard the supernatant; repeat the above step 3 times. Add 1 mL of water, vortex for 1 min, let stand for 1 min, centrifuge for 2 sec and discard the supernatant; add 50% glycerol and vortex thoroughly until homogeneous, and store at -20℃.

[0083] (2) Bullet preparation: After removing the gold powder from -20℃, vortex for 5 min; pipette 2 μL of gold powder into a 1.5 mL Eppendorf tube; add plasmid at a rate of 1 μg / 1 gun; while vortexing, add 50 μL of 2.5 M CaCl2 to the Eppendorf tube, then add 20 μL of 0.1 M spermine, vortex for 3 min; let stand for 1 min, centrifuge for 2 sec, and discard the supernatant; add 140 μL of 70% ethanol, vortex thoroughly, centrifuge for 2 sec, and discard the supernatant; add 140 μL of 100% ethanol, vortex thoroughly, centrifuge for 2 sec, and discard the supernatant; add 15 μL of 100% ethanol, vortex thoroughly, and prepare for use;

[0084] (3) Bombardment: After fully vortexing the wrapped bullets again, evenly coat them onto the macrocarriers and let them air dry; install the rupture membrane, and wet the rupture membrane with anhydrous ethanol before installation; place the macrocarriers on the first layer, place the culture medium with Yangmai 158 leaves on the second layer, and then vacuum to 28 inches; turn on the switch to bombard.

[0085] 3. Staining of powdery mildew haustoria and statistical analysis of haustoria index

[0086] A lower haustorium index indicates stronger resistance to powdery mildew. The haustorium index is the proportion of cells forming haustoria to the total interacting cells. The staining of haustoria and the statistical analysis of the haustorium index in this study can be performed following these steps:

[0087] Leaves bombarded with gene guns were cultured in the dark for 4-6 hours and then inoculated with wheat powdery mildew. About 42 hours after inoculation, the leaves were immersed in staining solution and then placed in a 37°C incubator for 12-24 hours for GUS staining. The presence or absence of haustoria was observed in cells infected with powdery mildew spores and expressing the GUS reporter gene under a microscope, and the haustoria index was counted.

[0088] Example 6 uses barley stripe mosaic virus-induced gene silence (BSMV-induced gene silence, VIGS) experiment to verify the function of NLRG4.

[0089] The wheat VIGS system utilizes the replication and transcription of barley stripe mosaic virus (BSMV) carrying a target fragment within wheat to induce gene silencing through the degradation or epigenetic modification of homologous gene mRNA. Using DNAMAN to compare the differences between NLR-G4 and its homologous genes, primers P7:TCTAAGGAAGTTT AACTGTCTGGCGGCGTG and P8:AACCACCACCACCGTGTAGTCAAGCTCATC were designed to specifically amplify a 200bp fragment specific to NLRG4. The target fragment was then inserted into the ApaI restriction site of BSMV-γ to construct the BSMV-γ-NLR-G4 vector. Figure 5 C).

[0090] BSMV-α, BSMV-β, BSMV-γ, BSMV-PDS, and BSMV-γ-NLR-G4 were transformed into Agrobacterium tumefaciens EHA105 and recombined in Tobacco Benzoinii leaves after 3-4 weeks. After recombination, these compounds were rubbed onto two-leaf stage resistant material IGV1-465. When plants coated with BSMV-PDS showed photobleaching, the silencing efficiency of four-leaf stage plants coated with BSMV-γ-NLR-G4 was tested using NLRG4-specific qRT-PCR primers P9: CTCCTTGTTGTTGCCATCTTT and P10: CGGGCTACACAAGCTTATCA. Powdery mildew was then inoculated, with BSMV-Mock as a negative control. The experiment was repeated three times. The results showed that compared with the negative control BSMV-γ, all silenced plants were susceptible to the disease, further verifying that NLRG4 is Pm6 and positively regulates powdery mildew resistance. Figure 5 E).

[0091] The steps for determining the efficiency of silence are as follows:

[0092] (1) RNA was reverse transcribed into short cDNA fragments using the Novozymes short fragment reverse transcription HiScript RT SuperMix for qPCR kit.

[0093] The reverse transcription system consisted of 1 μl template RNA, 4 μl 4×gDNA wiper Mix, and 11 μl RNase-free ddH2O. After mixing thoroughly, the mixture was incubated at 42℃ for 2 min and then on ice for 2 min. 5×Hiscript qRT SuperMix was added, and the mixture was incubated at 37℃ for 15 min and then at 85℃ for 5 sec. After the reverse transcription was completed, the mixture was stored at -20℃.

[0094] (2) Identification of NLRG4 expression levels in treated samples was performed using the AceQ qPCR SYBR Green Master Mix (without ROX) kit from Novizan.

[0095] The qRT-PCR system is as follows: GreenMaster Mix, 0.2 μl Primer-F / R (10 μM), 1 μl cDNA, and ddH2O were added to a final volume of 10 μl. After preparation, the mixture was used on a Roche 480 real-time quantitative PCR instrument, with three replicates per experiment. The program was as follows: pre-denaturation: 95℃ for 5 min; amplification program, 40 cycles: 95℃ for 10 s, 60℃ for 30 s; extension: 72℃ for 5 min; 10℃ for 3 min. Data processing: Based on the CT values ​​obtained from qRT-PCR, the internal reference gene TaActin was amplified using primers P11: TTGCACCAAGCAGCATGAA and P12: AACCACCGATCCAGACACTGTA. The expression levels of different samples relative to the control were calculated. -△△CT Where △△CT=(CT) Target -CT Actin ).

Claims

1. A powdery mildew resistance gene derived from chromosome 2GL of Timofewi wheat. Pm6 The encoded protein is characterized by The amino acid sequence is SEQ ID NO.

2.

2. The application of the protein of claim 1 in positively regulating wheat resistance to powdery mildew.

3. A wheat breeding method, characterized in that, Increasing the content of the protein described in claim 2 in wheat enhances its resistance to powdery mildew.

Citation Information

Patent Citations

  • Wheat powdery mildew resistance related protein TaGLP-7A as well as coding gene and application thereof

    CN114835789A

  • Wheat powdery mildew resistance negative regulation protein TaPAP and coding gene and application thereof

    CN118496332A