A genetic marker linked to a wheat grain nickel ion accumulation qtl qni.hnaas-6bs

Abstract

The application discloses a genetic marker linked with a wheat kernel nickel ion accumulation QTL qNi.hnaas-6BS, adopts a Wheat Breeders 660K microarray chip to identify genotype data of a natural population, combines phenotype data of kernel nickel ion content of the wheat natural population, carries out whole genome association analysis (GWAS), identifies that a quantitative trait locus (QTL) qNi.hnaas-6BS for controlling wheat kernel nickel ion accumulation exists on a short arm of a 6B chromosome of the wheat, the QTL is closely linked with SNP6872, is located at the 125,482,475th nucleotide of the 6B chromosome, and the SNP6872 has C / T polymorphism. Haplotype analysis results on a population level show that when the nucleotide of the site is CC, the wheat kernel has lower nickel ion content, and is a favorable allelic genotype for limiting the accumulation of the wheat kernel nickel ion.

Description

Technical Field

[0001] This invention relates to the field of wheat molecular breeding technology, and more specifically, to a QTL for nickel ion accumulation in wheat grains. qNi.hnaas-6BS Screening and application of linked genetic markers. Background Technology

[0002] Nickel pollution in soil has become a serious global environmental problem, primarily caused by human activities such as metal processing, mining, and the use of nickel-containing products, which are major contributors to soil nickel pollution (Rizwan et al., 2024). Once nickel ions enter the soil, they are absorbed by crops like wheat and enter the food chain, thus affecting human health. Studies have shown that high concentrations of nickel ions are carcinogenic, and long-term exposure or ingestion increases the risk of cardiovascular disease, lung disease, and various cancers (Cangul et al., 2002). Simultaneously, high concentrations of nickel ions are toxic, inhibiting key physiological processes such as seed germination, nutrient absorption, and photosynthesis, leading to a decline in wheat yield and quality (Nagajyoti et al., 2010). Furthermore, wheat, as a vital staple crop, provides approximately 20% of the energy and protein in the human diet (data from the World Health Organization). Contamination by heavy metals such as nickel ions poses a serious threat to human health. Therefore, breeding wheat varieties that can tolerate nickel stress and maintain an appropriate balance of nickel ion levels through biofortification is crucial for improving wheat yield and quality.

[0003] Like other trace element-related traits, nickel ion uptake and translocation are typical quantitative traits, controlled by multiple genes and exhibiting continuous phenotypic variation in natural populations. However, to date, only two studies have identified a small subset of QTL loci controlling nickel ion accumulation in wheat grains (Bhatta et al., 2018; Safdar et al., 2020), providing very limited data for identifying the main genetic loci for nickel ion accumulation in wheat grains and for screening dominant haplotypes of desirable genes.

[0004] Genome-wide association analysis (GWA) is an accurate statistical method for identifying quantitative trait loci, which greatly improves the resolution and accuracy of QTL mapping. Previous researchers have used this method to identify QTL loci controlling nickel ion accumulation in grains in various crops such as rice, soybean, and millet, and applied it to the genetic improvement of crops (Liu et al., 2024; Bellaloui et al., 2023). Summary of the Invention

[0005] (a) Technical problems to be solved

[0006] To address the problems existing in the prior art, this invention provides a QTL for nickel ion accumulation in wheat grains. qNi.hnaas-6BS Linked genetic markers are used to address the technical problems mentioned in the background section.

[0007] (II) Technical Solution

[0008] To achieve the above objectives, the present invention provides the following technical solution: a QTL for nickel ion accumulation in wheat grains. qNi.hnaas-6BS The linked genetic marker is located at nucleotide 125,482,475 on chromosome 6B of the wheat “Chinese Spring” reference genome. Its upstream and downstream sequences are CCAAGACGAGCCATGACACACAATCTTGCCTCACA[C / T]CTCATCAGTCGCTGCTTGTATGTATGTACCTTGTG, where the 36th base of this nucleotide sequence exhibits C / T polymorphism.

[0009] The present invention is further configured to perform haplotype analysis using SNP6872 genotyping data and wheat grain nickel ion content data from a natural population. The analysis revealed that at the population level, the grain nickel ion content of individuals with the CC genotype was significantly lower than that of individuals with the TT genotype. That is, when the locus is the CC genotype, the nickel ion content of wheat grains is significantly lower than that of individuals with the TT genotype. This indicates that the CC genotype is the dominant haplotype controlling nickel ion content in wheat grains and is a favorable allele for limiting nickel ion accumulation in wheat grains.

[0010] The present invention is further configured to be used for early prediction of nickel ion content in wheat grains, which not only helps breeders screen germplasm resources resistant to heavy metal stress, but also helps to cultivate new wheat varieties that are more resistant to nickel ion stress and have stronger environmental adaptability.

[0011] Genotyping using gene chip technology: Genotypes of natural populations were identified using the wheat 660K gene chip. Filtering was performed based on the criteria of allele frequency (MAF) greater than 0.05 and genotype missing data less than 10%, resulting in 224,706 valid marker loci that can be used for subsequent genome-wide association analysis.

[0012] Method for determining nickel ion content in wheat grains: After harvesting mature grains, drying, grinding, and microwave digestion, the nickel ion content of natural population wheat grains was determined by inductively coupled plasma mass spectrometry.

[0013] Major genetic locus identification: Three analytical methods, GLM (General Linear Model), MLM (Mixed Linear Model), and FarmCPU (Unified Model of Fixed and Random Cyclic Probabilities), were used to identify the genetic locus controlling nickel ion accumulation in wheat grains at the whole genome level. Analysis revealed a major genetic locus controlling nickel ion accumulation in wheat grains on chromosome 6BS. qNi.hnaas-6BS A SNP marker, SNP6872, closely linked to this mutation under multiple environmental conditions was identified, and its upstream and downstream nucleotide sequences are shown in SEQ IN NO:1. A 36C-36T allelic mutation exists at position 36 of this sequence, resulting in nucleotide polymorphism. Haplotype analysis, combining natural population wheat grain nickel ion phenotypic data and genotype data of this mutation site, revealed that wheat grains with the CC genotype at this site have lower nickel ion content, while those with the TT genotype have higher nickel ion content. This indicates that the CC genotype is a favorable haplotype for controlling nickel ion accumulation in wheat grains and is a favorable allele for reducing nickel ion toxicity in wheat grains and improving heavy metal stress tolerance.

[0014] The molecular markers identified in this invention can be used to screen wheat germplasm resources resistant to heavy metal nickel ion stress and to breed new wheat varieties (lines) resistant to heavy metal stress. They have important application value for improving the nutritional and health quality of wheat and enhancing the environmental adaptability of varieties.

[0015] (III) Beneficial Effects

[0016] Compared with existing technologies, this invention provides a QTL for nickel ion accumulation in wheat grains. qNi.hnaas-6BS Linked genetic markers have the following beneficial effects:

[0017] The purpose of this invention is to provide a genetic marker for the rapid and convenient detection of nickel ion content in wheat grains. This involves using a wheat 660K gene chip to genotype wheat SNPs and employing GWAS to screen for SNP loci associated with nickel ion accumulation in wheat grains. The genetic marker described in this invention is SNP6872, located at nucleotides 125,482,475 of wheat chromosome 6BS. Its upstream and downstream nucleotide sequences are shown in SEQ IN NO:1. This marker enables accurate and rapid prediction of nickel ion content in mature grains during the early stages of wheat growth and development, exhibiting high throughput and detection efficiency. It provides a new marker resource and application for breeding new wheat varieties resistant to heavy metal stress and improving wheat biofortification breeding methods. Attached Figure Description

[0018] Figure 1 This is a schematic diagram illustrating the normal distribution of nickel ion content phenotype data in different environmental natural populations in this invention;

[0019] Figure 2 Manhattan plot and QQ-plots for genome-wide association analysis of nickel ion content in wheat grains using GLM, MLM and FarmCPU models;

[0020] Figure 3 To control the main QTL of nickel ion accumulation in wheat grains qNi.hnaas-6BS Distribution of different alleles and their corresponding phenotypic data of the tightly linked molecular marker SNP6872 in a natural population. Detailed Implementation

[0021] The following examples illustrate the screening process and results of SNP molecular markers related to nickel ion accumulation in wheat grains according to the present invention, but are not intended to limit the scope of the invention. Unless otherwise specified, the techniques used in the examples are conventional methods well known to those skilled in the art.

[0022] Description of experimental materials: All experimental materials used in this invention were provided by the Henan Academy of Agricultural Sciences. The natural population consisted of 207 wheat varieties (lines) with rich genetic backgrounds. They were harvested after physiological maturity and used for subsequent analysis.

[0023] Example 1: Determination and Statistical Analysis of Nickel Ion Content in Wheat Grains

[0024] This embodiment measures the nickel ion content in wheat grains, and the specific process is as follows.

[0025] The concentration of nickel ions in wheat grains was determined by microwave digestion and inductively coupled plasma mass spectrometry (Table 1).

[0026] (1) Sample pretreatment: After the wheat has reached physiological maturity, the wheat from natural populations planted in Kaifeng and Shangqiu was harvested, threshed, and dried at 55℃ for 24 hours. The wheat was then ground using a small experimental mill and screened using a sieve with a pore size of 0.15 mm to obtain experimental samples that meet the requirements for subsequent nickel ion content determination. 200 mg of dried whole wheat flour was weighed and placed in 8 ml of concentrated nitric acid solution (8 mol / L, analytical grade). The mixture was allowed to stand for 4-8 hours and then digested using a microwave digester according to the digestion steps of 120℃-5 minutes, 150℃-10 minutes, and 190℃-20 minutes. The digestion solution was filtered and diluted to 50 mL with 1% nitric acid solution for later use.

[0027] (2) Establishment of standard curve: The mixed standard solution was injected into the inductively coupled plasma mass spectrometer, and the signal response values ​​of nickel and internal standard were measured. The standard curve was plotted with the concentration of nickel as the abscissa and the ratio of the response signal values ​​of nickel to the selected internal standard as the ordinate.

[0028] (3) Determination of nickel ion content: The blank solution and the sample solution were injected into the inductively coupled plasma mass spectrometer, and the signal response values ​​of nickel and internal standard were measured. The concentration of nickel in the digestion solution was obtained according to the standard curve. The nickel ion content data in wheat grains were obtained by repeating the process three times.

[0029] (4) Phenotypic data analysis of nickel ion content in wheat grains

[0030] First, using the "lem4" package in R software version 4.2.2, the best linear unbiased prediction (BLUP) for each variety in the two planting locations was estimated according to the method Y = (1|Line) + (1|Loc) + (1|Rep% in% Line: Loc) + (1|Line: Loc). This BLUP was used as one environmental data point for candidate association analysis. Second, the "psych" package was used to perform descriptive statistics on the phenotypic data of natural populations in different environments. As shown in Table 1, the nickel ion content in wheat grains varied from 23.46 ug / kg to 294.05 ug / kg in different environments. Figure 1 A, Table 2), and the phenotypic data of nickel ion content in natural populations under different environments all conform to a normal distribution ( Figure 1 B) indicates that the wheat varieties contained in this population have extensive genetic diversity, making it an ideal population for subsequent GWAS analysis.

[0031] Table 1. Nickel ion content in wheat grains from natural populations under different environments

[0032]

[0033] Table 2. Descriptive statistics of nickel ion content in natural populations in different environments.

[0034]

[0035] 1 SD, standard deviation;

[0036] 2. Kurtosis, a characteristic number that characterizes the peak value of a probability density distribution curve at its mean.

[0037] 3. Skewness: A measure of the direction and degree of skewness in the distribution of statistical data; it is a numerical characteristic of the degree of asymmetry in the distribution of statistical data.

[0038] Example 2: Genotype Detection

[0039] (a) Extraction of genomic DNA from wheat leaves using the CTAB (Cetyl trimethylammonium bromide) method

[0040] 1) Take 0.5g of fresh wheat leaf sample and freeze it in liquid nitrogen for 30 seconds, then quickly grind and crush it;

[0041] 2) Add 5000 μL of CTAB extraction solution at 65℃, incubate in a water bath for 30 min, and lyse the tissue;

[0042] 3) After cooling to room temperature, add 500 μL of chloroform:isoamyl alcohol (24:1) solution to extract the sample;

[0043] 4) Centrifuge at room temperature for 5 min (12000 rpm / min), aspirate 400 μL of supernatant and transfer it to a 1.5 mL centrifuge tube;

[0044] 5) Add an equal volume of frozen isopropanol to precipitate flocculent DNA. Centrifuge for 5 min (12000 rpm / min), discard the supernatant, and obtain the DNA precipitate;

[0045] 6) Rinse twice with 75% ethanol solution and 100% ethanol solution in sequence. Air dry for 8 hours, then dissolve the DNA in 200 μL of deionized water for later use (dissolves in 4-8 hours).

[0046] 7) Take 2 μL of the solution and use the NanoDrop™ One system to determine its concentration and purity.

[0047] (ii) Genotyping using SNP chips

[0048] Genotyping of all varieties (lines) in natural populations was performed using the Wheat Breeders 660K Axiom® microarray. This physical microarray contains over 630,000 specific SNP loci evenly distributed throughout the wheat genome, providing a sufficient number of SNP markers for genotyping.

[0049] (III) Genotype Quality Control

[0050] Using PLINK v2.0 software (https: / / www.cog-genomics.org / plink / 2.0 / ), quality control was performed on the genotype data of 207 natural population materials according to the criteria of allele frequency (MAF) greater than 0.05 and missing genotype data less than 10%, and finally 224,706 valid SNP markers were obtained for subsequent GWAS analysis.

[0051] Example 3: Identification and Utilization of the SNP6872 Molecular Marker

[0052] (a) Genome-wide association analysis

[0053] By combining phenotypic and genotypic data of nickel ion content in wheat grains from 207 different wheat varieties (lines), association analysis was conducted using GLM, MLM, and FarmCPU models in the GAPIT (Genome Association and Prediction Integrated Tool) software to identify stable genetic loci controlling nickel ion accumulation in wheat grains that were commonly identified under multiple environmental conditions by different models.

[0054] (II) Results Analysis

[0055] Under various environmental conditions, three analytical models jointly identified a significant association between nucleotides located at positions 125,482,475 of chromosome 6BS and nickel ion content in wheat grains. Figure 2 ).

[0056] (III) Utilization of SNP6872 molecular marker

[0057] The upstream and downstream nucleotide sequences of this marker are CCAAGACGAGCCATGACACACAATCTTGCCTCACA[C / T]CTCATCAGTCGCTGCTTGTATGTATGTACCTTGTG. A 36C-36T allele mutation exists at position 36 of this sequence. Table 3 shows that the nickel ion content in wheat grains from individuals with the CC genotype is significantly lower than that from individuals with the TT genotype. This indicates that the CC genotype is the dominant haplotype controlling nickel ion accumulation in wheat grains and is a favorable allele for reducing nickel ion toxicity in wheat grains and improving heavy metal stress tolerance. Figure 3 ).

[0058] Table 3. Effects of different SNP6872 marker genotypes on nickel ion accumulation in wheat grains

[0059]

[0060] 1. The number of varieties (lines) with different alleles in a natural population;

[0061] 2. Analysis of variance was used to analyze the differences in nickel ion content in wheat grains from different allelic populations. P-value < 0.05 was considered statistically significant, and P-value < 0.01 was considered highly statistically significant.

[0062] Figure 2Manhattan plots and QQ-plots are shown for genome-wide association analysis of nickel ion content in wheat grains using GLM, MLM, and FarmCPU models. The red solid line represents the threshold line of -log10P=4, indicating that SNP sites above the threshold line are significantly associated with nickel ion content in wheat grains. The red circle represents SNP6872, a SNP site significantly associated with nickel ion content in wheat grains, identified using all three analysis models.

[0063] Figure 3 The main QTL for controlling nickel ion accumulation in wheat grains qNi.hnaas-6BS Distribution of closely linked molecular marker SNP6872 across different alleles and their corresponding phenotypic data in a natural population. Orange represents the distribution of BLUP values ​​in the phenotypic data of CC genotype varieties (lines), and green represents the distribution of BLUP values ​​in the phenotypic data of TT genotype varieties (lines). The nickel ion content in wheat grains of CC genotype varieties (lines) is significantly lower than that of TT genotype varieties (lines), indicating a favorable allele.

[0064] Main references:

[0065] Rizwan, M, Usman, K, Alsafran, M. Ecological impacts and potentialhazards of nickel on soil microbes, plants, and human health [J]. Chemosphere, 2024, 357, 142028.

[0066] Cangul, H, Broday, L, Salnikow, K, Sutherland, J, Peng, W, Zhang, Q, Poltaratsky, V, Yee, H, Zoroddu, MA, Costa, M. Molecular mechanisms of nickel carcinogenesis [J]. Toxicology Letters, 2002, 127, 69-75.

[0067] Nagajyoti, PC, Lee, KD, Sreekanth, TV M. Heavy metals, occurrence and toxicity for plants: a review [J]. Environmental Chemistry Letters, 2010,8, 199-216.

[0068] Bhatta, M, Baenziger, P S, Waters, B M, Poudel, R, Belamkar, V,Poland, J, Morgounov, A. Genome-wide association study reveals novel genomicregions associated with 10 grain minerals in synthetic hexaploid wheat [J].Int J Mol Sci, 2018, 19, 3237.

[0069] Safdar, L B, Almas, F, Rehman, A u, Umer, M J, Ali Shah, S M, Uddin,S, Ashfaq, S, Rahman, H U, Quraishi, U M. Genetic dissection of Ni toxicityin a spring wheat diversity panel by using 90K SNP array [J]. Current PlantBiology, 2020, 24, 100175。

[0070] Liu, H, Zhang, X, Shang, Y, Zhao, S, Li, Y, Zhou, X, Huo, X, Qiao, P,Wang, X, Dai, K, Li, H, Guo, J, Shi, W. Genome-wide association study revealsgenetic loci for ten trace elements in foxtail millet (Setaria italica) [J].Theoretical and Applied Genetics, 2024, 137, 186.

[0071] Bellaloui, N, Knizia, D, Yuan, J, Song, Q, Betts, F, Register, T,Williams, E, Lakhssassi, N, Mazouz, H, Nguyen, HT, Meksem, K, Mengistu, A,Kassem, M A. Genetic mapping for QTL associated with seed nickel and molybdenum accumulation in the soybean 'Forrest' by 'Williams 82' RILpopulation [J]. Plants, 2023, 12, 3709.

[0072] sequence

[0073] SEQ IN NO:1

[0074] CCAAGACGAGCCATGACACACAATCTTGCCTCACACCTCATCAGTCGCTGCTTGTATGTATGTACCTTGTG.

[0075] Although embodiments of the invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and alterations can be made to these embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents.

Claims

1. Application of a QTL locus qNi.hnaas-6BS-linked genetic marker in the early prediction of nickel ion content in wheat grains, characterized in that, The genetic marker is SNP6872, a QTL locus tightly linked to qNi.hnaas-6BS, which controls nickel ion accumulation in wheat grains. This marker is located at nucleotide 125482475 on chromosome 6B of the wheat "Chinese Spring" reference genome, with upstream and downstream sequences of CCAAGACGAGCCATGACACACAATCTTGCCTCACA[C / T]CTCATCAGTCGCTGCTTGTATGTATG TACCTTGTG. The 36th base of this nucleotide sequence exhibits C / T polymorphism. Haplotype analysis using SNP6872 genotyping data from natural populations and wheat grain nickel ion content data revealed that, at the population level, individuals with the CC genotype had significantly lower grain nickel ion content than those with the TT genotype. Furthermore, when the locus is CC, the wheat grain nickel ion content is significantly lower than that of individuals with the TT genotype. This indicates that the CC genotype is the dominant haplotype controlling nickel ion accumulation in wheat grains and is a favorable allele limiting nickel ion accumulation in wheat grains.

2. The application of a QTL locus qNi.hnaas-6BS linked genetic marker according to claim 1 in the early prediction of nickel ion content in wheat grains, characterized in that: This not only helps breeders screen out germplasm resources that are resistant to heavy metal nickel ion stress, but also helps to cultivate new wheat varieties that are more resistant to nickel ion stress and have stronger environmental adaptability.

Images