Nucleic acid molecule for inhibiting PNO1 gene expression, related product and application

Abstract

The invention discloses a nucleic acid molecule for inhibiting PNO1 gene expression, a related product and application. The nucleic acid molecule comprises a double-stranded RNA or shRNA (short hairpin ribonucleic acid). The siRNA obtained by an RNAi method or a nucleic acid construct, a virus particle and a cell containing the siRNA sequence can effectively inhibit and remarkably reduce systolic pressure, diastolic pressure, mean arterial pressure, pulse wave propagation velocity and vascular wall thickness of aorta abdominalis after down-regulating expression of PNO1 gene, so that the effect of preventing and / or treating hypertension can be achieved; the compound can be used in drugs for treating hypertension, and opens up a new direction for hypertension treatment.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to a nucleic acid molecule for inhibiting PNO1 gene expression and related products and uses. Background Art

[0002] Hypertension is a chronic non-communicable disease that is prevalent worldwide. It is one of the main risk factors for cardiovascular disease and seriously affects human health and safety. According to data from the World Health Organization, in the past 30 years, the number of hypertensive patients aged 30 to 79 years has increased from 650 million to 1.28 billion worldwide. The prevalence of hypertension in my country is also on the rise. The latest Centers for Disease Control and Prevention data show that the number of patients in my country is 245 million. With the arrival of an aging population in China, the prevention and treatment of hypertension has also posed a huge challenge. Long-term and persistent hypertension can cause serious damage to target organs such as the kidneys, heart, and brain. Hypertension prevention and control urgently needs to find safer and more effective prevention and treatment strategies.

[0003] The partner of NOB1 homolog (PNO1) is a highly conserved protein with a K homology (KH) domain at its C-terminus and two putative nuclear localization signals at its N-terminus. The PNO1 gene is located in the human chromosome 2p14 region, with a genomic sequence of approximately 18kb. It plays an important role in ribosome biogenesis and promoting the maturation of the small ribosome subunit. PNO1 encodes a nucleolar protein that is one of the six assembly factors required for the maturation of 20SrRNA to 18SrRNA. It directly binds to NOB1 and enhances NOB1's affinity for RNA, driving NOB1 to cleave at the 3' end of the precursor 18SrRNA. The loss of PNO1 leads to a reduction in 18SrRNA and an imbalance in the assembly of the pre-40S ribosomal subunit. Imbalance in the ribosome biogenesis process is closely related to tumors.

[0004] In the previous study, the applicant's research group found that knocking in PNO1 led to increased blood pressure, decreased cardiac ejection fraction, shortened cardiac minor axis, thickened abdominal aorta wall thickness, increased abdominal aorta pulse wave propagation velocity, increased mesenteric artery resistance index, increased mesenteric artery pulsatility index, increased renal artery resistance index, and increased renal artery pulsatility index in mice. The blood pressure increase after PNO1 knock-in in Ang II-induced hypertensive mice was more obvious, and a hypertensive mouse model was constructed based on PNO1 knock-in. Therefore, inhibiting PNO1 expression can be an important way to prevent and treat hypertensive diseases.

[0005] Currently, there are many RNAi drugs in the research and development stage or have been approved for marketing, and they have shown good therapeutic effects. The development of RNAi drugs targeting the expression of hypertension target genes has become an important way to treat such diseases. Summary of the invention

[0006] In view of the above-mentioned shortcomings of the prior art, the object of the present invention is to provide a nucleic acid molecule for inhibiting the expression of the PNO1 gene and related products and uses, thereby solving the problems in the prior art.

[0007] To achieve the above objectives and other related objectives, the present invention is achieved through the following technical solutions.

[0008] The first aspect of the present invention protects a nucleic acid molecule for inhibiting the expression of the PNO1 gene, wherein the nucleic acid molecule comprises a double-stranded RNA or a shRNA, wherein the double-stranded RNA or the shRNA comprises a nucleotide sequence capable of hybridizing with the PNO1 gene, and the target sequence of the double-stranded RNA or the shRNA comprises a sequence shown in any one of SEQ ID NOs: 1 to 3.

[0009] The second aspect of the present invention protects a nucleic acid construct comprising nucleotides encoding the nucleic acid molecule as described above.

[0010] The third aspect of the present invention protects a virus particle obtained by packaging after the nucleic acid construct as described above infects a host cell.

[0011] The fourth aspect of the present invention protects a cell comprising the nucleic acid construct as described above or a cell in which a nucleotide encoding the nucleic acid molecule as described above is integrated into the genome.

[0012] The fifth aspect of the present invention protects the use of the nucleic acid molecule as described above; and / or, the nucleic acid construct as described above; and / or, the viral particle as described above; and / or, the cell as described above, wherein the use comprises at least one of A1)-A2): A1) for preparing a drug for preventing or treating hypertension; A2) for preparing a product for inhibiting the expression of the PNO1 gene in cells.

[0013] The sixth aspect of the present invention protects a composition for preventing or treating hypertension, the effective substance of which contains: the nucleic acid molecule as described above; and / or, the nucleic acid construct as described above; and / or, the virus particle as described above; and / or, the cell as described above, and a pharmaceutically acceptable carrier or excipient.

[0014] The technical solution of the present invention has the following beneficial effects:

[0015] 1) The present application designs a suitable RNAi target sequence for the target gene PNO1, synthesizes an oligo DNA double-stranded sequence, and constructs a lentiviral vector containing the above oligo DNA double-stranded sequence; the lentivirus can effectively reduce the mRNA and protein expression levels of the target gene PNO1, and the knockdown effect is very obvious.

[0016] 2) The present application further packages the nucleic acid construct containing shRNA into adeno-associated virus, and after administering it to SHR rats, it is found that it can significantly reduce the systolic blood pressure, diastolic blood pressure, mean arterial pressure, pulse wave propagation velocity, and vascular wall thickness of the abdominal aorta, thereby preventing and / or treating hypertension and improving the symptoms of reduced vascular function or vascular wall thickening caused by hypertension, and can be used in drugs for the treatment of hypertension. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 The graphs show the expression results of PNO1 in the abdominal aorta of SHR rats and WKY rats in Example 1 of the present invention, wherein A is an expression graph and B is a statistical analysis graph of the expression.

[0018] Figure 2 The graph shows the results of the three different sh-PNO1 lentiviruses in Example 2 of the present invention on the expression level of PNO1 mRNA in A7R5 cells.

[0019] Figure 3 The graphs show the results of the effects of three different sh-PNO1 lentiviruses on the expression level of PNO1 protein in A7R5 cells in Example 2 of the present invention. A is an expression graph, and B is a statistical analysis graph of the expression.

[0020] Figure 4A Shown is a map of the auxiliary plasmid pHelper 1.0 when constructing the lentiviral vector in Example 2 of the present invention.

[0021] Figure 4B Shown is a map of the auxiliary plasmid pHelper 2.0 when constructing the lentiviral vector in Example 2 of the present invention.

[0022] Figure 4C Shown is a map of the lentiviral vector GV248-sh-PNO1 constructed in Example 2 of the present invention.

[0023] Figure 5A Shown is a map of vector CV299 when the adeno-associated virus vector is constructed in Example 2 of the present invention.

[0024] Figure 5B Shown is a map of the serotype plasmid pAAV-RC when the adeno-associated virus vector is constructed in Example 2 of the present invention.

[0025] Figure 5C Shown is a map of the auxiliary plasmid pHelper when constructing the adeno-associated virus vector in Example 2 of the present invention.

[0026] Figure 5D Shown is a map of the adeno-associated virus vector rAAV-shRNA constructed in Example 2 of the present invention.

[0027] Figure 6 Shown is a comparison result diagram of the sequencing results of the sh-PNO1 adeno-associated virus in Example 2 of the present invention.

[0028] Figure 7 The results of the systolic blood pressure, diastolic blood pressure, mean arterial pressure and body weight of each group of rats after administration of sh-PNO1 adeno-associated virus in Example 3 of the present invention are shown. Among them, A is the result of the effect on systolic blood pressure, B is the result of the effect on diastolic blood pressure, C is the result of the effect on mean arterial pressure, and D is the result of the effect on body weight.

[0029] Figure 8 The graphs show the pulse wave propagation velocity and vascular wall thickness of the abdominal aorta of each group of rats after administration of sh-PNO1 adeno-associated virus in Example 3 of the present invention. Among them, A is a representative ultrasound graph of the abdominal aorta of small animals, B is a statistical analysis graph of the pulse wave propagation velocity, and C is a statistical analysis graph of the vascular wall thickness.

[0030] Fig. 9 The graph shows the pathological morphology of the abdominal aorta of rats in each group after administration of sh-PNO1 adeno-associated virus in Example 3 of the present invention. DETAILED DESCRIPTION

[0031] The first aspect of the present invention protects a nucleic acid molecule for inhibiting the expression of the PNO1 gene, wherein the nucleic acid molecule comprises a double-stranded RNA or shRNA, wherein the double-stranded RNA or shRNA contains a nucleotide sequence capable of hybridizing with the PNO1 gene, and the target sequence of the double-stranded RNA or shRNA comprises a sequence as shown in any one of SEQ ID NOs: 1 to 3.

[0032] In the present invention, nucleic acid molecules refer to nucleic acid molecules that use PNO1 or its transcript as a target sequence and can inhibit PNO1 gene expression or gene transcription. The target sequence refers to the fragment of the PNO1 gene corresponding to the mRNA fragment recognized and silenced by the nucleic acid molecule when the nucleic acid molecule is used to specifically silence PNO1 gene expression.

[0033] In some embodiments, the nucleic acid molecule is a double-stranded RNA, the double-stranded RNA comprises a first strand and a second strand, the first strand and the second strand complement each other to form an RNA dimer, and the sequence of the first strand is the same as the target sequence. More preferably, the nucleotide sequence encoding the first strand comprises a sequence as shown in any one of SEQ ID NOs: 1 to 3, the sequence of the second strand is complementary to the sequence of the first strand, and plays a role in specifically silencing the expression of the PNO1 gene.

[0034] Furthermore, the double-stranded RNA is siRNA.

[0035] In other embodiments, the nucleic acid molecule is shRNA, the shRNA comprises a sense strand segment and an antisense strand segment, and a stem-loop structure connecting the sense strand segment and the antisense strand segment, the sequences of the sense strand segment and the antisense strand segment are complementary, and the sequence of the sense strand segment is the same as the target sequence, and the encoding nucleotide sequence of the shRNA comprises SEQ ID NO: 4 to 9. Specifically, the encoding nucleotide sequence of the shRNA comprises SEQ ID NO: 4 to SEQ ID NO: 5, or SEQ ID NO: 6 to SEQ ID NO: 7, or SEQ ID NO: 8 to SEQ ID NO: 9. The shRNA can become a small inhibitory RNA (siRNA) after enzyme processing, thereby playing a role in specifically inhibiting the expression of the PNO1 gene. In the present invention, shRNA refers to a single-stranded RNA base that self-hybridizes in a hairpin structure and can induce an RNA inhibition (RNAi) pathway during processing. The length of these molecules can vary (usually about 50-90 nucleotides in length, or in some cases up to more than 250 nucleotides in length, such as shRNA adapted to small inhibitory RNA). The shRNA molecule is processed within the cell to form siRNA, which in turn can knock down PNO1 gene expression. The shRNA can be incorporated into a vector. shRNA also refers to a DNA molecule from which a short hairpin RNA molecule can be transcribed.

[0036] Furthermore, the sequence of the stem-loop structure of the shRNA can be selected from any one of the following: Ccgg, GATCCAAAA, CTCGAG, TTTTTg.

[0037] Furthermore, the target sequence of the double-stranded or shRNA is as shown in SEQ ID NO. 3. When it is used to inhibit the expression of PNO1 gene, the inhibitory effect is most obvious.

[0038] Furthermore, the shRNA encoding nucleotide sequence is as shown in SEQ ID NO: 8 to SEQ ID NO: 9.

[0039] In the present invention, the PNO1 gene is derived from mouse, with gene ID: 289809.

[0040] Another aspect of the present invention is to protect a nucleic acid construct containing nucleotides encoding the nucleic acid molecule as described above. The nucleic acid construct can be obtained by cloning the nucleic acid molecule encoding the nucleic acid molecule as described above into a known vector, and the nucleic acid construct is packaged into infectious viral particles by a virus, and then infects cells to express the siRNA, which is used to specifically inhibit the expression of the PNO1 gene.

[0041] In some embodiments, the nucleic acid construct is selected from one or more of a lentiviral vector, an adeno-associated viral vector, and an adenoviral vector.

[0042] Furthermore, the nucleic acid construct is a lentiviral vector. After being packaged by lentivirus to become infectious lentiviral particles, the lentiviral vector is injected into the subject to express the siRNA for specific silencing of the expression of the PNO1 gene. The backbone plasmid of the lentiviral vector is GV298.

[0043] Furthermore, the nucleic acid construct is an adeno-associated virus vector. After the adeno-associated virus vector is packaged into infectious virus particles, it is injected into the subject to express the siRNA for specific silencing of the expression of the PNO1 gene. The backbone plasmid of the adeno-associated virus vector is CV299.

[0044] Another aspect of the present invention is to protect a method for preparing the nucleic acid construct as described above, comprising the following steps:

[0045] 1) Linearize the tool vector; obtain the target gene fragment;

[0046] 2) connecting the target gene fragment and the linearized tool vector and transforming the colony;

[0047] 3) Obtain the nucleic acid construct after colony PCR identification, sequencing, and plasmid extraction.

[0048] In certain embodiments, in step 1), the tool vector is selected from GV298 or CV299, wherein GV298 is used as a lentiviral tool vector, and CV299 (provided by GeneCare, see Figure 5A ) as an adeno-associated virus tool vector. The sequence of the target gene target fragment includes SEQ ID NO: 1, 2, 3. Specifically, the nucleotide encoding the nucleic acid molecule is inserted into the AgeI and EcoRI restriction sites in the lentiviral vector GV298, thereby constructing a lentiviral nucleic acid construct; the nucleotide encoding the nucleic acid molecule is inserted into the BamHI and Hind III restriction sites in the adeno-associated virus vector CV299, thereby constructing an adeno-associated virus nucleic acid construct.

[0049] In certain embodiments, in step 2), when the tool vector is GV298, a lentiviral vector is used as the basis for construction, and a nucleic acid molecule that inhibits the expression of the PNO1 gene is integrated to obtain a PNO1 gene interference lentiviral vector, wherein the target sequence of the nucleic acid molecule that inhibits the expression of the PNO1 gene comprises SEQ ID NO: 1, 2, and 3. A single-stranded primer comprising the sequence shown below: SEQ ID NO. 4-5 or SEQ ID NO. 6-7 or SEQ ID NO. 8-9 is used to obtain the target gene fragment.

[0050] The single-stranded primer anneals to form oligo DNA, which comprises an upstream sequence as shown below: SEQ ID NO.4 or SEQ ID NO.6 or SEQ ID NO.8, and a downstream sequence as shown below: SEQ ID NO.5 or SEQ ID NO.7 or SEQ ID NO.9.

[0051] In certain embodiments, in step 2), when the tool vector is GV299, it is constructed based on an adeno-associated virus vector, and a nucleic acid molecule that inhibits the expression of the PNO1 gene is integrated to obtain a PNO1 gene interference adeno-associated virus vector, and the target sequence of the nucleic acid molecule that inhibits the expression of the PNO1 gene comprises SEQ ID NO: 3. The primers comprising the sequences shown below: SEQ ID NO. 12-13 are used to obtain the target gene fragment.

[0052] In certain embodiments, in step 3), after the digested tool vector and the target gene fragment are reacted in a reaction system for 1 to 3 hours, the ligation product is transformed into competent cells for transformation.

[0053] Another aspect of the present invention is to protect a virus particle obtained by packaging a host cell infected with the nucleic acid construct as described above.

[0054] In certain embodiments, when the nucleic acid construct is a lentiviral vector, and further comprises an envelope plasmid and / or a packaging plasmid for assembling the lentiviral vector into a cell, the nucleic acid construct, the envelope plasmid, and the packaging plasmid are co-transfected into cells to produce lentiviral particles. Preferably, the envelope plasmid is pHelper 2.0, and the packaging plasmid is pHelper 1.0. The molar ratio of the lentiviral vector, the envelope plasmid, and the packaging plasmid is 20:15:20.

[0055] In certain embodiments, when the nucleic acid construct is an adeno-associated virus vector, it also comprises a packaging plasmid and / or an auxiliary plasmid for assembling the adeno-associated virus vector into a cell. The adeno-associated virus nucleic acid construct, packaging plasmid, and auxiliary plasmid are co-transfected into cells to produce adeno-associated virus particles. Preferably, the packaging plasmid is pAAV-RC, and the auxiliary plasmid is pHelper. The molar ratio of the adeno-associated virus vector, the serotype plasmid, and the auxiliary plasmid is 1:1:1.

[0056] Another aspect of the present invention protects a cell comprising the nucleic acid construct as described above or a cell having a nucleotide sequence encoding the nucleic acid molecule as described above integrated into its genome.

[0057] In some embodiments, the cell comprises a lentiviral vector and further comprises an envelope plasmid and / or a packaging plasmid for assembling the lentiviral vector into the cell. Preferably, the envelope plasmid is pHelper 2.0, and the packaging plasmid is pHelper 1.0.

[0058] Furthermore, when the nucleic acid construct is a lentiviral vector, the cell refers to 293T cells as host cells, and the PNO1 gene is knocked down by transfecting the lentiviral nucleic acid construct and the envelope plasmid or packaging plasmid. The present invention found that after lentiviral transfection of A7R5 cells, siRNA can significantly inhibit the expression of PNO1 mRNA and protein level in A7R5 cells.

[0059] In some other embodiments, the cell comprises an adeno-associated viral vector and further comprises a serotype plasmid and / or a helper plasmid for assembling the adeno-associated viral vector into the cell. Preferably, the packaging plasmid is pAAV-RC and the helper plasmid is pHelper.

[0060] Furthermore, when the nucleic acid construct is an adeno-associated virus vector, the cell refers to 293T cells as host cells, and the PNO1 gene is knocked out by transfecting the adeno-associated virus nucleic acid construct and packaging plasmid or helper plasmid.

[0061] The virus packaging process is a conventional technique in the art and is not particularly limited in the present invention.

[0062] Another aspect of the present invention protects the use of the nucleic acid molecule as described above; and / or, the nucleic acid construct as described above; and / or, the viral particle as described above; and / or, the cell as described above, said use comprising at least one of A1)-A2): A1) for preparing a drug for preventing or treating hypertension; A2) or for preparing a product for inhibiting the expression of the PNO1 gene in cells.

[0063] In some embodiments, the drug has one or more of the following effects:

[0064] B1) Improve decreased vascular function;

[0065] B2) Improve decreased heart function;

[0066] B3) Improves blood vessel wall thickening.

[0067] Furthermore, the reduced vascular function is induced by hypertension, which means that the vascular pulse wave propagation velocity increases, and the improvement of reduced vascular function means reducing the vascular pulse wave propagation velocity, and reducing the vascular pulse wave propagation velocity means making the vascular pulse wave propagation velocity of the target vessel close to or reaching the velocity of healthy blood vessels. For example, based on healthy blood vessels, the product can restore the vascular pulse propagation velocity of the target vessel to at least 70%, 80%, 90% or 100% of that of healthy blood vessels.

[0068] Furthermore, the reduced cardiac function is induced by hypertension, which means reduced cardiac ejection fraction or reduced left ventricular fractional shortening, and the improvement of reduced cardiac function means increasing cardiac ejection fraction or left ventricular fractional shortening, and increasing cardiac ejection fraction or left ventricular fractional shortening means making the cardiac ejection fraction and left ventricular fractional shortening of the subject close to or reaching the fraction of a healthy heart. For example, based on a healthy heart, the product can restore the cardiac ejection fraction and left ventricular fractional shortening of the subject's heart to at least 70%, 80%, 90% or 100% of that of a healthy heart.

[0069] Furthermore, the thickening of the blood vessel wall is induced by hypertension, and refers to the thickening of the blood vessel wall of the abdominal aorta, and the improvement of the thickening of the blood vessel wall refers to reducing the thickness of the blood vessel wall, and reducing the thickness of the blood vessel wall refers to making the blood vessel wall of the target close to or reach the thickness of a healthy blood vessel. For example, based on a healthy blood vessel, the product can make the blood vessel wall thickness of the target blood vessel not exceed 130%, 120%, 110% or 100% of the thickness of a healthy blood vessel.

[0070] In some embodiments, the nucleic acid molecule, the inhibitory nucleic acid construct, the viral particle, or the cell described above can be used to prepare a product for reducing PNO1 gene expression, including a chip, a preparation, a kit, or a nucleic acid membrane strip.

[0071] In some embodiments, the cells are selected from smooth muscle cells, such as thoracic aorta smooth muscle cells. The lentivirus constructed in the present application can significantly reduce the expression levels of PNO1 mRNA and protein in the cells after transfection of thoracic aorta smooth muscle cells A7R5.

[0072] Another aspect of the present invention protects a composition for preventing or treating hypertension, the effective substance of which contains: the nucleic acid molecule as described above; and / or, the nucleic acid construct as described above; and / or, the virus particle as described above; and / or, the cell as described above, and a pharmaceutically acceptable carrier or excipient.

[0073] In some embodiments, pharmaceutically acceptable carriers or excipients refer to carriers for the administration of therapeutic agents, including various excipients and diluents. Pharmaceutically acceptable carriers or excipients themselves are not necessary active ingredients, and there is no excessive toxicity after administration. Suitable carriers or excipients are well known to those of ordinary skill in the art. In the composition, pharmaceutically acceptable carriers or excipients may contain liquids, such as water, saline, and buffer. In addition, auxiliary substances may also be present in these carriers or excipients, such as fillers, lubricants, glidants, wetting agents or emulsifiers, pH buffer substances, etc.

[0074] In some embodiments, the form of the composition is not particularly limited, and can be in various forms such as solid, liquid, gel, semi-fluid, aerosol, etc.

[0075] In some embodiments, the composition is mainly targeted at mammals. The mammals are preferably rodents, artiodactyls, perissodactyls, lagomorphs, primates, etc. The primates are preferably monkeys, apes or humans.

[0076] In some embodiments, the dosage form of the composition includes tablets, capsules, granules, powders, injections, sprays, films, suppositories, nasal drops or pills. Preferably, it is an injection.

[0077] The present invention also protects a method for preventing or treating hypertension, which comprises administering to a subject a therapeutically effective amount of the nucleic acid molecule as described above; and / or, the nucleic acid construct as described above; and / or, the viral particle as described above; and / or, the cell as described above; and / or, the composition as described above.

[0078] In certain embodiments, the subject is a mammal. The mammal is preferably a rodent, an artiodactyl, a perissodactyl, a lagomorph, a primate, etc. The primate is preferably a monkey, an ape or a human.

[0079] In certain embodiments, the subject may be a patient suffering from hypertension or an individual with hypertension for whom treatment is desired.

[0080] In certain embodiments, the nucleic acid molecule as described above, the inhibitory nucleic acid construct as described above, or the inhibitory virus as described above can be administered to a subject before, during, or after receiving treatment for hypertension.

[0081] The "therapeutically effective amount" or "effective dose" in the present invention refers to the dose or concentration of a drug that is effective in treating a disease. For example, for the lentivirus and adeno-associated virus disclosed in the present invention, the therapeutically effective amount is the dose or concentration at which the lentivirus and adeno-associated virus can improve reduced vascular function, reduced cardiac function, and thickened vascular walls, thereby treating hypertension.

[0082] The present invention designs and synthesizes nucleic acid molecules that inhibit the expression of PNO1 gene, constructs shRNA nucleic acid constructs, virus particles and cells for the target sequence, and the siRNA produced by the nucleic acid construct, virus particles and cells can effectively inhibit the expression of PNO1, and is used to treat hypertension, hypertension-induced increased vascular function or vascular wall thickening. The siRNA, shRNA, nucleic acid construct, virus particles and cells of the present invention are introduced into rats, and it is found that the systolic pressure, diastolic pressure and mean arterial pressure of SHR rats can be significantly reduced; the PWV of the abdominal aorta is significantly reduced; the thickness of the abdominal aorta vascular wall is significantly reduced; and there is no obvious effect on body weight. Therefore, the nucleic acid molecules, nucleic acid constructs, virus particles and cells of the present application can prevent and / or treat hypertension and improve the symptoms of decreased vascular function or vascular wall thickening caused by hypertension, and can be used in drugs for treating hypertension; or can reduce the expression of PNO1 gene in cells. 。

[0083] The following describes the embodiments of the present invention through specific examples, and those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and the details in this specification can also be modified or changed in various ways based on different viewpoints and applications without departing from the spirit of the present invention.

[0084] Before further describing the specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terms used in the examples of the present invention are for describing the specific embodiments rather than for limiting the scope of protection of the present invention; in the present specification and claims, unless otherwise expressly stated herein, the singular forms "a", "an" and "the" include plural forms.

[0085] When the embodiments give numerical ranges, it should be understood that, unless otherwise specified in the present invention, both endpoints of each numerical range and any numerical value between the two endpoints can be selected. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those generally understood by those skilled in the art. In addition to the specific methods, equipment, and materials used in the embodiments, according to the grasp of the prior art by those skilled in the art and the record of the present invention, any methods, equipment, and materials of the prior art similar or equivalent to the methods, equipment, and materials described in the embodiments of the present invention can also be used to realize the present invention.

[0086] In the following examples of this application, the information of animals, experimental drugs and main reagents is as follows:

[0087] Experimental drugs and main reagents: DMEM culture medium (Therm Fisher Scientific, USA, C11995500BT); penicillin / streptomycin double antibody (Hyclone, USA, SV30010); eosin staining solution (Beijing Solebow Technology Co., Ltd., G1100); hematoxylin staining solution (Beijing Solebow Technology Co., Ltd., G1140); isoflurane for animals (Shenzhen Reward Life Science Co., Ltd., 970-00026-00); 4% paraformaldehyde universal tissue fixative (Anhui Biosharp Co., Ltd., 23319084), anhydrous ethanol (Xilong Science Co., Ltd., 1280340101602), xylene (Xilong Science Co., Ltd., 1430030101600) and other chemical reagents.

[0088] SPSS27.0 software (SPSS / PC+) was used for statistical analysis. The Shapiro-Wilk test was used to test the normality of the data. The data are expressed as mean ± standard deviation. When comparing the differences between the two groups of data, for data that conformed to the normal distribution and had homogeneous variance, ANOVA multiple group comparisons and Bonferroni test were used; for data that conformed to the normal distribution but had unequal variances, ANOVA multiple group comparisons and Kruskal-Wallis test were used. For data that did not conform to the normal distribution, the rank sum test was used. P < 0.05 was considered statistically significant.

[0089] Example 1 Study on the expression level of PNO1 gene in SHR rats and WHY rats

[0090] In this Example 1, the expression level of PNO1 gene in SHR rats and WHY rats was studied.

[0091] 1.1 Experimental Animals

[0092] Rats: 14 spontaneously hypertensive rats (SHR) and 14 Wistar Kyoto (WKY) rats of 4-week-old SPF male were used. The experimental animals were purchased from Beijing Weitong Lihua Experimental Animal Technology Co., Ltd. (License No.: SYXK (Beijing) 2022-0052). The experimental animals were kept in the SPF laboratory of the Medical Experimental Animal Center of Fujian University of Traditional Chinese Medicine, with adequate diet and water, 12h light / dark cycle, temperature 23±1℃, and humidity controlled at 50%, all within the acceptable range for experimental animals. All experimental operations were in accordance with the ethics of experimental animals and the regulations of the Medical Experimental Animal Center of Fujian University of Traditional Chinese Medicine.

[0093] SHR rats, also known as spontaneously hypertensive rats, are naturally hypertensive rats with a systolic blood pressure of over 200 mmHg. They are used as the optimal animal model for screening antihypertensive drugs. WKY (Wistar-Kyoto) rats are often used as a normal blood pressure control group for SHR rats.

[0094] 1.2 Sample Collection

[0095] After the experiment, the rats were sampled. The rats were anesthetized with isoflurane and then killed. The abdominal aorta of the rats was taken through the abdomen, and the residual blood was rinsed in pre-cooled saline, and the extravascular connective tissue was stripped. The abdominal aorta was divided into 3 equal sections, one of which was placed in 4% paraformaldehyde for subsequent pathological sections, and the other two sections were quickly stored in liquid nitrogen for standby use. The abdominal aorta was first soaked in 4% paraformaldehyde for 48 hours, then placed in an embedding box, and the organ number and group were clearly marked. The tissue was dehydrated and waxed, and the waxed tissue was placed in the embedding machine. The tissue was placed in the embedding mold before the liquid wax solidified, and it was placed on an ice table for cooling. After the paraffin solidified, the wax block was taken out and trimmed.

[0096] 1.3 Immunohistochemistry

[0097] After the tissue sample wax blocks of WKY and SHR rats were sliced ​​and dewaxed, they were repaired with 100℃ citrate repair solution for 10 minutes and cooled to room temperature. 0.25% Triton reagent was prepared with PBS solution, and 30μL Triton reagent was added to each sample. The membrane was broken for 10 minutes at room temperature and washed 3 times with 1×PBS, each time for 5 minutes. About 30μL endogenous peroxidase was added to each sample for 10 minutes, and PBS was washed 3 times, each time for 5 minutes. Blocking solution was used for 1 hour at room temperature. The primary antibody (PNO1: sc-514727; Santa Cruz Biotechnology) working solution was prepared in PBS solution according to the corresponding ratio and incubated in a refrigerator at 4℃ overnight. The next day, the secondary antibody (Goat anti-mouse secondary antibody: L3032; Signalway Antibody LLC) was used for incubation for 1 hour and washed 3 times with 1×PBS for 5 minutes each time. Incubate with streptomycin for 1 hour, wash with PBS three times, 5 minutes each time; stain with DAB colorimetric reagent, then stain with hematoxylin, wash off the staining solution, return to blue with ultrapure water for 5 minutes, dry with a hair dryer, and seal with neutral gum; the slides were imaged with an intelligent automatic optical microscope at 400 times, and 6 field of view screenshots were randomly selected for each sample, and then the protein expression of each group was analyzed and statistically analyzed using Image J software.

[0098] 1.5 Experimental Results

[0099] The expression of PNO1 in the abdominal aorta of SHR rats and WHY rats was detected by immunohistochemistry. Figure 1 shown.

[0100] from Figure 1 It can be seen that compared with WKY rats, the expression of PNO1 in spontaneously hypertensive SHR rats was significantly increased, and the difference was statistically significant (*P<0.05), indicating that the expression level of PNO1 is closely related to hypertension.

[0101] Example 2 shRNA design and construction of lentivirus and adeno-associated virus

[0102] In this Example 2, the siRNA sequence of the PNO1 gene was designed, and a lentiviral vector and an adeno-associated viral vector were constructed, and then lentiviral packaging and adeno-associated viral packaging were performed respectively.

[0103] According to the transcript of Rat PNO1 gene, siRNA target sequence was designed, single-stranded primer was synthesized according to siRNA target sequence, single-stranded primer was annealed to form double-stranded oligo DNA, and then double-stranded oligo DNA was connected with linearized RNA inhibition vector after double enzyme digestion to obtain PNO1 specific interference shRNA lentivirus. Transformed into Escherichia coli competent cells, colony PCR screened transformants, and the screened positive clones were sequenced for verification. Sequencing verified the correct clones and high-purity plasmid was extracted. Then, 293T cells were co-transfected with lentiviral packaging plasmid pHelper 1.0 and lentiviral envelope plasmid pHelper 2.0 to package and produce lentivirus. The virus titer was determined, and A7R5 cells were infected with lentiviral particles of appropriate titer. The PNO1 protein expression level was detected at the protein level by Western-blot to screen the best inhibitory fragment.

[0104] Then the best inhibitory fragment is constructed to obtain an adeno-associated virus vector, and then an adeno-associated virus packaging is performed.

[0105] 2.1. Screening of the best inhibitory fragment

[0106] 2.1.1. Target design and primer synthesis

[0107] For rat PNO1 (ID: 289809), the PNO1 gene sequence and the general design principles of RNAi design were selected from GenBank and Shanghai Genetech Gene Medical Technology Co., Ltd. was commissioned to design three siRNA target sequences, including sh-PNO1-90, sh-PNO1-89 and sh-PNO1-88. At the same time, a negative control sequence CON207 with one base randomly disrupted was designed. The sequence design was synthesized by Shanghai Genetech Gene Medical Technology Co., Ltd.

[0108] The corresponding oligo primers were designed and synthesized according to the siRNA target sequences. The target sequences of the three candidate siRNAs are shown in Table 1.

[0109] Table 1 siRNA target sequences

[0110] serial number Gene NCBI ID TargetSeq SEQ sh-PNO1-88 PNO1 NM_199083 GCTAACAGATACACACCATTA SEQ ID No.1 sh-PNO1-89 PNO1 NM_199083 GGACTTGTAAAGACACCAAGG SEQ ID No.2 sh-PNO1-90 PNO1 NM_199083 GCAACCTCATCCTAGGAAACC SEQ ID No.3 CON207 NC None TTCTCCGAACGTGTCACGT SEQ ID No.15

[0111] 2.1.2 Synthesis of double-stranded oligo DNA

[0112] Design double-stranded oligo DNA according to the sequence and structure in Table 2, dissolve the single-stranded oligo primer in Table 3 into 20 μM using oligoannealing buffer, and then take 30 μL of the dissolved oligo primers and mix them to obtain an oligo mixture.

[0113] The oligo mixture was then heated at 90°C in a water bath for 15 min, and then the water bath was opened to allow natural cooling to room temperature to anneal and form double-stranded oligo fragments.

[0114] Take 1 μL of the double-stranded oligo fragment for the subsequent ligation reaction in step 2.2.1 (2), and store the rest at -20°C.

[0115] Table 2 Double-stranded oligo DNA

[0116]

[0117] The shRNAs are shown in Table 3.

[0118] Table 3

[0119]

[0120] 2.2 Construction of lentiviral vector, acquisition of lentiviral particles, and investigation of knockout efficiency after transfection of cells

[0121] 2.2.1. Construction of lentiviral vector

[0122] (1) Preparation of linearized tool vector

[0123] The expression vector GV298 (provided by GeneCare, vector name: GV298) was digested with AgeI and EcoRI restriction endonucleases to make it linear. The digestion reaction system is shown in Table 4.

[0124] Table 4 Enzyme digestion reaction system

[0125] Reagents Capacity (μL) <![CDATA[ddH2O]]> 41 10×CutSmart Buffer 5 GV298 plasmid DNA (1 μg / μL) 2 Age I (10U / μL) 1 EcoRI (10U / μL) 1 Total 50

[0126] Prepare 50 μL of enzyme digestion system according to Table 4. Add various reagents in order according to the table, mix them by gently blowing with a pipette, centrifuge briefly, and react at 37°C for 3 hours or overnight. Perform agarose gel electrophoresis on the vector digestion product, recover the target band, and obtain the linearized tool vector.

[0127] (2) Ligation reaction

[0128] The double-stranded oligo fragment obtained in step 2.1.2 and the linearized tool vector GV298 obtained in step (1) were connected using T4 DNA ligase. The reaction system is shown in Table 5. The connection was carried out at 16° C. overnight to obtain a connection product.

[0129] Table 5 Ligation reaction system

[0130]

[0131]

[0132] (3) Transformation of competent cells

[0133] The ligation product obtained in step (2) was transfected into DH5α competent cells. The transfection method was referred to the "Succinct Molecular Biology Experiment Guide", and then spread on a plate and incubated at 37°C overnight.

[0134] (4) Identification of positive transformants by colony PCR

[0135] The transformants grown on the plate were picked and resuspended in 10 μL LB culture medium. 1 μL was taken as a template for colony PCR identification to determine whether the constructed recombinant lentiviral vector was correct.

[0136] The positive clones obtained by colony identification were sent to the sequencing company for sequencing verification. The sequencing results were compared and analyzed using Vector NTI software. The correct cloned bacterial solution was expanded and extracted to obtain high-purity plasmids for downstream lentiviral packaging.

[0137] The correct positive clones were verified by sequencing, and plasmids were extracted to obtain three PNO1-specific shRNA expression lentiviral vectors GV248-sh-PNO1-88, GV248-sh-PNO1-89, GV248-sh-PNO1-90, and a negative control lentiviral vector GV248-NC. The map of the specific shRNA expression lentiviral vector is shown in Figure 4C .

[0138] 2.2.2 Lentivirus packaging

[0139] Separately transfer the three PNO1-specific shRNA lentiviral vectors obtained in step 2.2.1 into the lentiviral packaging plasmid pHelper1.0 (see Figure 4A ) and lentiviral envelope plasmid pHelper 2.0 (see Figure 4B ) were co-transfected into 293T cells and packaged to produce lentivirus. Lentivirus sh-PNO1-88, sh-PNO1-89 and sh-PNO1-90 were obtained. The titer of lentivirus was determined by fluorescence method.

[0140] Transfer the correctly sequenced bacterial suspension in step 2.2.1 into 50 mL of LB liquid culture medium containing antibiotics, culture at 37°C overnight, and extract the plasmid using a kit.

[0141] 1) 48 hours before transfection, HEK293T cells in the logarithmic growth phase were digested with trypsin and the cell density was adjusted to 5×10 in DMEM medium containing 10% FBS. 6cells / 15mL, re-inoculated into a 10 cm cell culture dish, cultured in a 37°C, 5% CO2 incubator, and after 48 hours when the cell density reaches 70% to 80%, it can be used for transfection.

[0142] 2) One hour before transfection, the cell culture medium was replaced with DMEM medium containing 2% FBS.

[0143] 3) Add the lentiviral vectors GV248-sh-PNO1-88, GV248-sh-PNO1-89, GV248-sh-PNO1-90 or the negative control lentiviral vector GV248-NC obtained in step 2.2.1 of this example, as well as pHelper1.0 and pHelper 2.0 (GV248-sh-PNO1-88, GV248-sh-PNO1-89, GV248-sh-PNO1-90 or GV248-NC 20 μg, pHelper 1.0 plasmid 15 μg, pHelper 2.0 plasmid 20 μg) to a sterile centrifuge tube, mix evenly with the corresponding volume of transfection reagent, adjust the total volume to 1 mL, and incubate at room temperature for 15 minutes.

[0144] 4) Slowly add the mixed solution after incubation in step 3) to the HEK293T cell culture medium (pay attention to the uniformity during the addition process to avoid blowing the cells up) and mix well, and place in a cell culture incubator at 37° C. and 5% CO 2 .

[0145] 5) After 6 hours of culture, the culture medium of the transfection mixture was aspirated, 10 mL of PBS was added to wash once, and 10 mL of fresh complete culture medium was added to culture.

[0146] 6) Slowly add 12 mL of cell culture medium containing 2% FBS and continue culturing in a 37° C., 5% CO 2 incubator for 48 hours.

[0147] 2.2.4 Lentivirus concentration and purification

[0148] 48 hours after transfection, the supernatant of HEK293T cells was collected. Centrifuged at 4000g for 10 minutes at 4°C to remove cell debris and impurities. The supernatant was filtered through a 0.45 μm filter into a 40 mL ultracentrifuge tube; centrifuged at 25000 rpm at 4°C for 2 hours to obtain the purified lentivirus sh-PNO1.

[0149] The titer was determined by fluorescence method. The virus titer of lentivirus sh-PNO1-88 was 3×10 9 TU / mL; the virus titer of lentivirus sh-PNO1-89 is 8×10 8 TU / mL; the virus titer of lentivirus sh-PNO1-90 is 8×10 8 TU / mL.

[0150] At the same time, the control sequence CON207 was used in the same way to obtain a negative control lentivirus (sh-Ctrl).

[0151] 2.2.5 Effects of sh-PNO1 lentivirus on PNO1 mRNA expression and PNO1 protein expression in A7R5 cells

[0152] A7R5 cells (rat thoracic aorta smooth muscle cells) were purchased from Hubei Wuhan Pu Nuo Sai (Cat. No.: CL0316) and cultured with DMEM complete medium (containing 10% FBS, 100 U / mL penicillin and 100 μg / mL streptomycin). Cells in good condition were placed in a cell culture incubator with a constant temperature of 37°C and a saturated humidity of 5% CO2.

[0153] The lentivirus sh-PNO1-88, sh-PNO1-89 and sh-PNO1-90 prepared in step 2.2.4 were transfected into A7R5 cells and verified by real-time fluorescence quantitative PCR (qPCR) experiment.

[0154] A7R5 cells were infected by lentivirus coated with three sequences of sh-PNO1, and the mRNA expression level in A7R5 cells was detected by qPCR experiment. The experimental results are shown in Figure 2 shown.

[0155] The steps for the qPCR experiment results are as follows: After the cell experiment, add 1mL of Trizol, fully lyse it for 5min, and then centrifuge it at 12000rpm at 4℃ for 15min. After aspirating the supernatant, transfer it to an RNase-free centrifuge tube, add 0.2mL of chloroform solution, shake it vigorously for 15s, let it stand for 5min, and centrifuge it at 12000rpm at 4℃ for 15min. After aspirating the supernatant, transfer it to another RNase-free centrifuge tube, add 500mL of isopropanol, mix it up and down, let it stand at room temperature for 10min, put it in a 4℃ low-temperature high-speed centrifuge and centrifuge it at 12000rpm for 10min, discard the supernatant, and white precipitate can be seen at the bottom. Add 1mL of 75% pre-cooled ice ethanol to each sample, centrifuge it at 10000rpm for 10min, discard the supernatant, place the centrifuge tube at room temperature to dry naturally for 5-10min, and then add an appropriate amount of DEPC water to shake and mix the RNA. The sample OD was measured using NanDrop2000 ultra-micro spectrophotometer. 260 With OD 280 The experiment was carried out according to the instructions provided by the company. The Q-PCR reaction system was prepared according to the table below and placed in a 7500Fast Realtime PCR instrument for mRNA expression level detection. The Q-PCR reaction system and reaction time are shown in Tables 6 and 7 below.

[0156] Table 6 Q-PCR reaction system preparation

[0157] Reagents Usage SYBR Mix (2×) 5μL Front chain primer (10μM) 0.2μL Back strand primer (10 μM) 0.2μL <![CDATA[RNase Free dH2O]]> 4.6μL

[0158] Front chain primer for detecting PNO1 expression level: ACACCAAGGATGTCAGTGC (SEQ ID NO: 10)

[0159] Back strand primer for detecting PNO1 expression level: AAGCGCATCCTCTACCTGAA (SEQ ID NO: 11)

[0160] Table 7 Q-PCR reaction conditions

[0161]

[0162] After amplification, the expression level was calculated. The formula for calculating the mRNA expression level is: △Ct of mRNA = Ct (sample to be tested) - CT (internal reference); △△Ct = △Ct - △Ct (average value); the relative expression level of mRNA is 2 -△△ct The internal reference is β-actin.

[0163] from Figure 2 It can be seen that after the lentivirus sh-PNO1 infected A7R5 cells, the expression of PNO1 mRNA was significantly downregulated, and the sh-PNO1-90 sequence had the best knockdown effect.

[0164] In addition, the expression level of PNO1 protein in A7R5 cells was detected by Western-blot experiment. The experimental results are shown in Figure 3 shown.

[0165] The specific operation of the Western-blot experiment is as follows: according to a certain system, sh-PNO1 lentivirus was transfected into A7R5 cells, digested with EDTA, neutralized with DMEM, and then the cells were collected. The collected cells were added with lysis buffer for cell lysis, shaken once every 5 minutes, 5 seconds each time, for a total of three times; centrifuged at 14000rpm for 20 minutes at 4℃; after BCA protein denaturation, SDS-PAGE gel electrophoresis and transfer were performed, and skim milk was blocked for 2 hours and then incubated with primary antibody (PNO1: sc-514727; Santa Cruz Biotechnology) at 4℃, and then incubated with secondary antibody (Goat anti-mouse secondary antibody: L3032; SignalwayAntibody LLC) at room temperature for imaging, and image Lab software was used for data analysis.

[0166] from Figure 3As shown in Figure 3A and Figure 3B, the expression of PNO1 protein in A7R5 cells was reduced after sh-PNO1 lentivirus infected A7R5 cells, among which the reduction of sh-PNO1-90 sequence was the most obvious.

[0167] In summary, sh-PNO1-90 was the best inhibitory fragment, and subsequent experiments were carried out with this inhibitory fragment.

[0168] 2.3 Construction of adeno-associated virus vector

[0169] The sh-PNO1-90 sequence and the control sh-Ctrl sequence in Example 1 were used to construct an adeno-associated virus vector, and the adeno-associated virus particles were formed by adeno-associated virus packaging. GeneCare Gene was commissioned to carry out the work. The details are as follows:

[0170] 2.3.1. Construction of adeno-associated virus vector rAAV-shRNA

[0171] ]PCR amplifies the target gene. The tool vector is digested to form a linearized vector. The target gene and the linearized vector are homologously recombined and transformed into E. coli competent cells. The transformants are identified by colony PCR, and the positive clones are sent for sequencing. The clones with correct sequencing are subjected to plasmid extraction. The construction of adeno-associated virus vector rAAV-shRNA is as follows:

[0172] 1) The target gene fragment was obtained by PCR amplification using the following primers. The size of the PCR amplification product was 173 bp.

[0173] Primer 1: AGATCGCCGTGTAAGCTAGCCTGGAGGCTTGCTGAAGGCTGTATGCTG (SEQ ID NO: 12)

[0174] Primer 2: GCCTCAGCTATTTAAAGCTTGGGCCATTTGTTCCATGTGAGTGCTAGT (SEQ ID NO: 13)

[0175] The primers contain exchange pairing bases, restriction sites, and the 5' end sequence of the target gene for PCR to fish for the target gene.

[0176] 2) Target gene homologous recombination insertion tool vector

[0177] The PCR product of 1) and the linear tool vector CV299 (see the map) after digestion with BamHI and Hind III Figure 5A ) for homologous recombination, prepare the reaction system according to Table 8 below, react at 37°C for 30 min, then cool in an ice water bath for 5 min and transform immediately.

[0178] Table 8 Reaction system

[0179] Reagents Usage <![CDATA[dH2O]]> 3.5μL 5×CE II Buffer 2μL CV299 plasmid after restriction digestion 2.5 PCR product of step 1) 1μL <![CDATA[Exnase TM II]]> 1μL Total 10μL

[0180] 3) Conversion

[0181] Add 10 μL of the exchange reaction product to 100 μL of DH5α competent cells, flick the tube wall several times to mix, and place on ice for 30 minutes. Heat shock at 42°C for 90 seconds, and incubate in an ice water bath for 2 minutes. Add 500 μL of antibiotic-free LB medium and place on a shaker at 37°C for 1 hour. Take an appropriate amount of bacterial solution and evenly spread it on a plate containing the corresponding antibiotics, and invert and culture it in a constant temperature incubator for 12-16 hours.

[0182] 4) PCR identification

[0183] Primer 3 and primer 2 were used to identify the transformed colonies, and the size of the PCR product of the positive transformant was 272 bp.

[0184] Primer 3: GAGGAGTTGTGTTTGTGGAC (SEQ ID NO: 14)

[0185] Primer 2: GCCTCAGCTATTTAAAGCTTGGGCCATTTGTTCCATGTGAGTGCTAGT (SEQ ID NO: 13)

[0186] 5) Sequencing

[0187] The identified positive clone transformants were inoculated into an appropriate amount of LB liquid medium containing the corresponding antibiotics, cultured at 37°C for 12-16 hours, and an appropriate amount of bacterial liquid was taken for sequencing. The sequencing results were compared with the target gene sequence. The comparison results are shown in Figure 6 .

[0188] The adeno-associated virus vector with correct sequencing was named adeno-associated virus vector rAAV-shRNA (see the map for details) Figure 5D ).

[0189] At the same time, based on the control sequence numbered CON207 in Table 1, a negative control adeno-associated virus vector rAAV-Ctrl was formed.

[0190] 2.3.2 Packaging of recombinant adeno-associated virus

[0191] Transfer the correctly sequenced bacterial suspension in step 2.3.1 into 50 mL of LB liquid medium containing antibiotics, culture at 37°C overnight, and extract the plasmid using an endotoxin-free plasmid mini-prep kit.

[0192] 1) 24 hours before transfection, AVV-293T cells (human embryonic kidney cells) in the logarithmic growth phase were digested with trypsin and the cell density was adjusted to 5×10 in DMEM medium containing 10% FBS.6 cells / 15mL, re-inoculated into a 10 cm cell culture dish, cultured in a 37°C, 5% CO2 incubator, and after 24 hours when the cell density reaches 70% to 80%, it can be used for transfection.

[0193] 2) 2 hours before transfection, the cell culture medium was replaced with PBS-free medium.

[0194] 3) Add the recombinant adeno-associated virus vector rAAV-shRNA obtained in step 2.3.1 of this example and the packaging plasmid pAAV-RC (Gene Gene, see Figure 5B )) and the shuttle helper plasmid pHelper ((Ji Kai gene, see Figure 5C )(rAAV-shRNA 5 μg, pAAV-RC packaging plasmid 5 μg, pHelper shuttle auxiliary plasmid 5 μg), mixed evenly with the corresponding volume of transfection reagent, adjusted the total volume to 1 mL, and incubated at room temperature for 15 minutes.

[0195] 4) Slowly add the mixed solution after incubation in step 3) to the 293T cell culture medium (pay attention to the uniformity during the addition process to avoid blowing the cells up) and mix well, and place in a cell culture incubator at 37° C. and 5% CO 2 .

[0196] 5) After 6 hours of culture, the culture medium of the transfection mixture was aspirated, 10 mL of PBS was added to wash once, and 10 mL of fresh complete culture medium was added to culture.

[0197] 6) Slowly add 10 mL of cell culture medium containing 5% FBS, and continue culturing in a 37° C., 5% CO 2 incubator for 48-72 hours to obtain adeno-associated virus CV299-sh-pno1-90 (abbreviated as sh-pno1).

[0198] At the same time, the shRNA fragment (ie, sh-PNO1-90) in step 2.3.1 1) was replaced with the sh-Ctrl sequence and then the control adeno-associated virus (sh-Ctrl) was obtained using the same method.

[0199] 2.3.3 Concentration and purification of recombinant adeno-associated virus sh-pno1

[0200] 72 hours after transfection, collect the supernatant and cells of AVV-293T cells. Centrifuge at 3000g for 5 minutes at 4°C to separate the cells and the supernatant. Add the JiKai AVV virus concentration kit to the supernatant to obtain the virus in the supernatant; add the resuspension solution to the cell pellet and resuspend it, freeze and thaw it repeatedly in liquid nitrogen / 37°C for 4 times, and centrifuge it; then, combine the two parts of the virus. Then centrifuge at 18°C ​​and 63000rpm for 2 hours. Absorb the separation layer where the virus is located, put it into the ultrafiltration column for ultrafiltration until it becomes a colorless or light pink clear liquid, and then sterilize the virus liquid through a 0.22μm filter membrane, and package it to obtain the purified adeno-associated virus sh-pno1.

[0201] The purified adeno-associated virus sh-pno1 was subjected to pyrogen detection, microbial detection and other tests to ensure that there was no pyrogen, no microbial contamination such as bacteria, fungi, viruses, and no wild virus replication.

[0202] GeneCare was commissioned to detect the genome copy number of the AAV vector in the genome by Real-Time-PCR to determine the number of AAV virus particles. The titer of adeno-associated virus sh-pno1 is as follows: sh-PNO1: 2.12E+13vg / mL.

[0203] Example 3 In vivo experiment

[0204] The adeno-associated virus sh-PNO1 constructed in Example 2 was administered to rats, and the blood pressure, body weight, pulse wave propagation velocity of the abdominal aorta, vascular wall thickness and abdominal aortic pathological morphology were studied. The following were included:

[0205] 3.1 Animal grouping and adeno-associated virus injection

[0206] Male rats were divided into 4 groups, 7 rats in each group, as follows:

[0207] WKY rats were randomly divided into 2 groups: WKY+sh-Ctrl control group and WKY+sh-pno1 experimental group;

[0208] SHR were randomly divided into 2 groups: SHR+sh-Ctrl control group and SHR+sh-pno1 experimental group.

[0209] The WKY+sh-pno1 experimental group refers to WKY rats administered with adeno-associated virus sh-pno1; the SHR+sh-pno1 experimental group refers to SHR rats administered with adeno-associated virus sh-pno1.

[0210] The WKY+sh-NC control group refers to WKY rats given the control adeno-associated virus sh-Ctrl; the SHR+sh-ctrl experimental group refers to SHR rats given the control adeno-associated virus sh-Ctrl.

[0211] Injection of adeno-associated virus: Place the virus on ice and dilute the adeno-associated virus with saline to an appropriate titer (1×10 12 Infectious units / mL), then fix the rat with a rat tail vein injection device, and expose its tail outward; wipe the rat tail with an alcohol cotton ball to dilate its blood vessels; inject the control adeno-associated virus sh-Ctrl and adeno-associated virus sh-pno1 into WKY and SHR mice, respectively, and draw 100 μL of virus with a 1mL syringe; straighten the rat tail to make its red vein clearly visible, insert the needle at 1 / 3 of the distance from the tail tip, slowly inject the virus and then pull it out, and press the injection point with a cotton ball to stop bleeding; remove the rat from the fixator and put it back to the original cage for normal feeding.

[0212] 3.2. Study on adeno-associated virus for the treatment of hypertension

[0213] 3.2.1. Blood pressure measurement

[0214] The non-invasive rat tail artery blood pressure monitor produced by Kent Company of the United States was used to carefully observe the systolic blood pressure (SBP), diastolic blood pressure (DBP) and mean arterial pressure (MAP) of each group of rats.

[0215] The experimental process is as follows: ensure that the non-invasive sphygmomanometer is installed correctly, check the equipment to avoid air leakage or other abnormal conditions. Use a restraint to fix the rat, place an occlusion sleeve about 1 cm away from the base of the rat's tail, and then put in a volume pressure sensor until the sensor can no longer move toward the base of the rat's tail. Then, place the fixed restraint on the heating plate, adjust it to the most suitable temperature, and cover it with a blackout cloth to maintain the stability of the measurement environment. To ensure the accuracy of the experimental data, let the rat rest in a quiet state for 5 minutes, then start blood pressure measurement, and take the average value as a reference. After the measurement is completed, the rat is returned to the original cage and continues its normal feeding procedure. To ensure the continuity and reliability of the experimental data, the blood pressure of each group of rats is measured once a week before sampling, and the measurement is continued for 10 weeks.

[0216] 3.2.2 Measurement of pulse wave propagation velocity and vessel wall thickness of abdominal aorta

[0217] Vevo 2100 ultra-high resolution small animal ultrasound was used to detect cardiac function. Before the test, the chest hair of the mice was removed with depilatory cream, and the rats were anesthetized by inhaling 2% isoflurane. Then the rats were fixed in a supine position on a 37°C constant temperature operating table, and the heart rate of the rats was controlled (450-600bp). Coupling agent was applied to the abdomen of the rats, and the ultrasound probe was used to obtain the abdominal aorta image under the sternum; the probe was rotated parallel to the midline of the abdomen to obtain the aortic section image. After the ultrasound, VevoSoftware (Vevo LAB 1.7.1) was used for analysis to calculate the pulse wave velocity (PWV) and vascular wall thickness of the abdominal aorta. The calculation formula of the pulse wave velocity of the abdominal aorta was: PWV = abdominal aorta length / (distal end conduction time-cardiac end conduction time). Each rat was measured at least 3 times and the average value was taken.

[0218] 3.2.4 HE staining

[0219] The abdominal aorta of rats was dissected and fixed in 4% paraformaldehyde for 48 hours, then dehydrated with different concentrations of ethanol, immersed in xylene to replace the ethanol, and immersed in wax. After embedding, the tissue block was switched into 4 μm slices with a paraffin slicer, spread in 40°C water, transferred to a slide, and baked, dried, hydrated in xylene, and dewaxed with different concentrations of ethanol. The rehydrated slices were placed in hematoxylin stain for 1 minute and then washed with pure water once, immersed in 1% hydrochloric acid alcohol for differentiation for 1 second, placed in water for anti-blueing, and then placed in eosin solution for staining for 2 seconds, dried, sealed, and the pathological morphological changes of the tissues were observed under a microscope.

[0220] 3.3 Results

[0221] 3.3.1 Effects of administration of adeno-associated virus sh-pno1 on blood pressure and body weight in rats

[0222] Blood pressure monitoring of rats in each group Figure 7 shown.

[0223] from Figure 7 It can be seen that compared with the WKY+sh-Ctrl group, the blood pressure of the rats in the SHR+sh-Ctrl group, including systolic blood pressure ( Figure 7 Middle A), diastolic pressure ( Figure 7 B) and mean arterial pressure ( Figure 7 C) was significantly increased (*P<0.05), and there was no significant change in body weight; compared with the SHR+sh-Ctrl group, the systolic blood pressure of rats in the SHR+sh-pno1 group ( Figure 7 Middle A), diastolic pressure ( Figure 7 B) and mean arterial pressure ( Figure 7The body weight in the groups (#P<0.05) was significantly decreased (#P<0.05), and the difference was statistically significant; there was no significant change in body weight among the groups.

[0224] 3.3.2 Effects of administration of adeno-associated virus sh-pno1 on pulse wave propagation velocity and vascular wall thickness in the abdominal aorta of rats

[0225] Vascular elasticity is an important indicator for evaluating vascular function, and the pulse wave propagation velocity can reflect the elasticity of blood vessels to some extent. It is a commonly used method for early diagnosis of vascular function in clinical practice. A high pulse wave propagation velocity represents a high blood vessel hardness, indicating that the elasticity of the blood vessel wall is reduced. In addition, damage to the vascular system after hypertension occurs can lead to thickening of the arterial wall. The suppression of arterial wall thickening means that it can play a role in treating hypertension.

[0226] Small animal ultrasound was used to detect the abdominal aorta PWV and vascular wall thickness of rats in each group. Figure 8 As shown in A and B.

[0227] from Figure 8 As shown in A and B, compared with the WKY+sh-Ctrl group, the PWV values ​​of the abdominal aorta in the SHR+sh-Ctrl group were significantly increased ( * P<0.05); compared with the SHR+sh-Ctrl group, the PWV value of the abdominal aorta of the rats in the SHR+sh-pno1 group was significantly decreased ( & P<0.05); compared with the WKY+sh-Ctrl group, there was no significant difference in the PWV values ​​of the abdominal aorta in the WKY+sh-pno1 group. This shows that silencing the PNO1 gene can improve vascular dysfunction caused by hypertensive rats.

[0228] The results of abdominal aorta wall thickness test of rats in each group are as follows Figure 8 As shown in A and C.

[0229] from Figure 8 As shown in Figure C, compared with the WKY+sh-Ctrl group, the thickness of the abdominal aorta wall in the SHR+sh-Ctrl group was significantly increased ( * P<0.05); compared with the SHR+sh-Ctrl group, the thickness of the abdominal aorta wall of rats in the SHR+sh-pno1 group was significantly decreased ( & There was no significant difference in the thickness of the abdominal aorta wall between the WKY+sh-pno1 group and the WKY+sh-Ctrl group (P<0.05), indicating that silencing the PNO1 gene can improve the increase in vascular wall thickness caused by hypertension.

[0230] 3.3.3 Effects of administration of adeno-associated virus sh-pno1 on the pathological morphology of abdominal aorta in rats

[0231] HE staining was used to detect the pathological changes of abdominal aorta in each group of rats. Fig. 9 .

[0232] from Fig. 9 It can be seen that compared with the WKY+sh-Ctrl group, the abdominal aorta wall of rats in the SHR+sh-Ctrl group was significantly thickened ( * P<0.05); compared with the SHR+sh-Ctrl group, the thickness of the abdominal aorta wall of rats in the SHR+sh-pno1 group was significantly decreased ( # P<0.05). The results showed that silencing PNO1 could improve the pathological morphology of abdominal aorta in spontaneously hypertensive rats.

[0233] The above examples are for the purpose of illustrating the embodiments disclosed by the present invention and are not to be construed as limitations of the present invention. In addition, the various modifications listed herein and the variations of methods and compositions in the invention are obvious to those skilled in the art without departing from the scope and spirit of the present invention. Although the present invention has been specifically described in conjunction with various specific preferred embodiments of the present invention, it should be understood that the present invention should not be limited to these specific embodiments. In fact, various modifications obvious to those skilled in the art as described above to obtain the invention should be included within the scope of the present invention.

Claims

1. A nucleic acid molecule for inhibiting PNO1 gene expression, characterized in that: The nucleic acid molecule comprises double-stranded RNA or shRNA, wherein the double-stranded RNA or shRNA contains a nucleotide sequence capable of hybridizing with the PNO1 gene, and the target sequence of the double-stranded RNA or shRNA comprises a sequence shown in any one of SEQ ID NOs: 1-3.

2. The nucleic acid molecule according to claim 1, characterized in that The double-stranded RNA comprises a first strand and a second strand, the first strand and the second strand are complementary to each other and together form an RNA dimer, and the nucleotide sequence encoding the first strand comprises a sequence shown in any one of SEQ ID NOs: 1 to 3; And / or, the shRNA comprises a sense chain fragment and an antisense chain fragment, and a stem-loop structure connecting the sense chain fragment and the antisense chain fragment, the sequences of the sense chain fragment and the antisense chain fragment are complementary, and the encoding nucleotide sequence of the shRNA comprises the sequence shown in SEQ ID NOs: 4 to 9.

3. The nucleic acid molecule according to claim 2, characterized in that The double-stranded RNA is siRNA.

4. A nucleic acid construct, characterized in that Contains nucleotides encoding the nucleic acid molecule according to any one of claims 1 to 3.

5. The nucleic acid construct according to claim 4, characterized in that The nucleic acid construct is a viral vector, and the viral vector is selected from one or more of a lentiviral vector, an adeno-associated viral vector and an adenoviral vector.

6. A virus particle, characterized in that The nucleic acid construct according to claim 4 or 5 is obtained by packaging after infecting a host cell.

7. A cell, characterized in that The method comprises a nucleic acid construct as claimed in claim 4 or 5 or a nucleotide encoding a nucleic acid molecule as claimed in any one of claims 1 to 3 integrated into the genome.

8. The nucleic acid molecule according to any one of claims 1 to 3; and / or, the nucleic acid construct according to claim 4 or 5; and / or, the viral particle according to claim 6; and / or, the use of the cell according to claim 7, wherein the use comprises at least one of A1) to A2): A1) for preparing a drug for preventing or treating hypertension; A2) for preparing a product for inhibiting the expression of the PNO1 gene in cells.

9. The use according to claim 8, characterized in that The drug has one or more of the following effects: B1) Improve decreased vascular function; B2) Improve decreased heart function; B3) Improves blood vessel wall thickening.

10. A composition for preventing or treating hypertension, characterized in that: The effective substance contains: the nucleic acid molecule according to any one of claims 1 to 3; and / or the nucleic acid construct according to claim 4 or 5; and / or the virus particle according to claim 6; and / or the cell according to claim 7, and a pharmaceutically acceptable carrier or excipient.

Images