A genetically engineered bacterium for synthesizing N-acetylglucosamine, its preparation method and application

By constructing a genetically engineered bacteria of probiotic E. coli Nissle 1917 as a host bacteria, knocking out relevant genes and overexpressing key enzyme systems, the problem of endotoxins in the production of GlcNAc by E. coli host bacteria is solved, and efficient and safe GlcNAc synthesis is achieved, which is suitable for industrial applications.

CN119101640BActive Publication Date: 2025-07-29BY HEALTH CO LTD

Patent Information

Application Number
CN202311431661.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-10-31
Publication Date
2025-07-29
Estimated Expiration
2043-10-31

AI Technical Summary

Technical Problem

In the prior art, bacterial endotoxin (LPS) is produced during the production process of GlcNAc with E. coli as the host bacteria, resulting in difficulty in purification of the product and poor safety. The traditional methods are low efficiency, poor specificity and high cost, which limits their industrial applications.

Method used

The genetically engineered bacteria of the probiotic E. coli Nissle 1917 is a host bacteria. By knocking out the deaminase gene nagB and the deacetylase gene nagA, and overexpressing the glucosamine synthase gene glmS and glucosamine acetylase gene gna1, the T7 RNA polymerase expression box was optimized, and the CRISPR/Cas9 gene editing or homologous recombination method was used for genetic modification to construct a metabolic engineering strain that efficiently synthesizes GlcNAc.

Benefits of technology

It realizes efficient and safe synthesis of N-acetylglucosamine, solves the endotoxin problem, improves the safety and production efficiency of the product, and is suitable for large-scale industrial production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119101640B_ABST
    Figure CN119101640B_ABST
Patent Text Reader

Abstract

The present invention provides a genetically engineered bacterium for synthesizing N-acetylglucosamine, a preparation method thereof, and an application thereof. The genetically engineered bacterium uses Escherichia coli as an initial bacterium, and related genes for the catabolism of N-acetylglucosamine are knocked out on the genome of the initial bacterium, and related genes for the metabolic synthesis of N-acetylglucosamine are overexpressed, so as to improve the production level of N-acetylglucosamine. Among them, the related genes for the catabolism of N-acetylglucosamine include any one or a combination of at least two of nagB, nagA, manX, nagE, nagK, or ptsG, and the related genes for the metabolic synthesis of N-acetylglucosamine include any one or a combination of at least two of glmS, gna1, glnA, yqaB, icaC, galP, or glk.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and particularly relates to a genetically engineered bacterium for synthesizing N-acetylglucosamine, a preparation method and application thereof, and particularly relates to the construction and application of a probiotic Escherichia coli genetically engineered bacterium for efficiently producing N-acetylglucosamine. Background Art

[0002] N-acetylglucosamine (GlcNAc) is an acetylated derivative of glucosamine (GlcN), and is the basic unit of many functional polysaccharides (such as hyaluronic acid, chondroitin sulfate, etc.) in organisms. It is widely present in bacteria, yeasts, filamentous fungi, plants and animals, and plays a key role in the life activities of organisms. GlcNAc plays an important role in the repair and health care of bone joints and the treatment of osteoarthritis. In addition, GlcNAc can enhance the immune function of the human body, can be used as a food additive, antioxidant and sweetener for diabetic patients, and can also promote the metabolic synthesis of human hyaluronic acid, playing a role in improving the skin moisture. Therefore, GlcNAc is widely used in the fields of medicine, food and cosmetics.

[0003] At present, the industrial production methods of GlcNAc mainly include acid hydrolysis method, enzymatic hydrolysis method and microbial fermentation method. Both the acid hydrolysis method and the enzymatic hydrolysis method use chitin extracted from shrimp and crab shells as raw materials, and then obtain GlcNAc through acid hydrolysis or enzymatic hydrolysis. However, both the acid hydrolysis method and the enzymatic hydrolysis method have many problems. For example, the source of chitin raw materials is limited, and GlcNAc produced from chitin extracted from shrimps and crabs is likely to cause allergic reactions; in addition, a large amount of strong acids and alkalis are used in the acid hydrolysis process, causing serious environmental pollution; while the enzymatic hydrolysis method has mild reaction conditions, but has problems such as high price of the required enzyme, long enzymatic hydrolysis time and low production efficiency; therefore, both the acid hydrolysis method and the enzymatic hydrolysis method are not suitable for future green industrial production.

[0004] In recent years, with the rapid development of synthetic biology technology, an industrial system for the biosynthesis of GlcNAc has been established. However, currently, the industrial fermentation production of GlcNAc mainly uses Escherichia coli as the host bacterium. However, as a prokaryotic expression host, E. coli will produce a type of bacterial endotoxin with a cytotoxic lipopolysaccharide (LPS) structure during the fermentation process. Bacterial endotoxins have a small molecular weight and strong stability to heat and chemical reagents. Currently, methods such as ion exchange, adsorption, ultrafiltration, and surfactants are mainly used to remove endotoxins from samples. However, the above methods still have problems such as low efficiency, poor specificity, toxicity of the reagents used in the process, difficulty in removal and purification, and high costs. These problems seriously restrict the wide application of E. coli as a host bacterium in industrial production.

[0005] Therefore, finding an endotoxin-free Escherichia coli as the host bacterium will greatly simplify the purification process of the target product in the industrial production process and greatly improve the safety of use of the target product. Summary of the Invention

[0006] Aiming at the deficiencies of the existing technology, the purpose of the present invention is to provide a genetically engineered bacterium for synthesizing N-acetylglucosamine, its preparation method and application. The present invention overcomes the deficiency that bacterial endotoxin (LPS) will be produced during the production process of GlcNAc with E. coli as the host, constructs a probiotic Escherichia coli genetically engineered bacterium with high-yield GlcNAc using probiotic Escherichia coli Nissle 1917 (Escherichia coli Nissle 1917, EcN) as the host bacterium, and performs genetic modification on it to achieve efficient fermentation synthesis of GlcNAc, while solving the safety problem of the product, providing a basis for realizing its large-scale safe industrial production of GlcNAc.

[0007] The present invention uses the probiotic Escherichia coli Nissle 1917 as the host bacterium, which does not contain pathogenic factors such as enterotoxin, hemolysin, and cytotoxin, and has no safety risk to the host.

[0008] To achieve the purpose of this invention, the following technical solutions are adopted by the present invention:

[0009] In the first aspect, the present invention provides a genetically engineered bacterium for synthesizing N-acetylglucosamine. The genetically engineered bacterium uses Escherichia coli as the initial bacterium, and the deaminase gene nagB and the deacetylase gene nagA are knocked out on the genome of the initial bacterium, and the glucosamine synthase gene glmS and the glucosamine acetylase gene gna1 are overexpressed.

[0010] Second aspect, the present invention provides a genetically engineered bacterium for synthesizing N-acetylglucosamine. The genetically engineered bacterium uses Escherichia coli as the initial bacterium, and the deaminase gene nagB and the deacetylase gene nagA are knocked out from the genome of the initial bacterium. Further, one or more of the mannose phosphate transporter gene manX, the N-acetylglucosamine transporter gene nagE, the N-acetylglucosamine kinase gene nagK, or the glucose transmembrane transporter gene ptsG are knocked out, and the glucosamine synthase gene glmS and the glucosamine acetylase gene gna1 are overexpressed.

[0011] Preferably, when the engineered bacterium knocks out the glucose transmembrane transporter gene ptsG, while overexpressing the glucosamine synthase gene glmS and the glucosamine acetylase gene gna1, the galactose symporter gene galP and the glucokinase gene glk are overexpressed.

[0012] Third aspect, the present invention provides a genetically engineered bacterium for synthesizing N-acetylglucosamine. The genetically engineered bacterium uses Escherichia coli as the initial bacterium, and the deaminase gene nagB, the deacetylase gene nagA, the mannose phosphate transporter gene manX, the N-acetylglucosamine transporter gene nagE, and the N-acetylglucosamine kinase gene nagK are knocked out from the genome of the initial bacterium. The glucosamine synthase gene glmS and the glucosamine acetylase gene gna1 are overexpressed, and further, one or more of the glutamine synthetase gene glnA, the fructose-1-phosphate phosphatase gene yqaB, and the N-acetylglucosamine transporter gene icaC are overexpressed.

[0013] Preferably, the Escherichia coli is selected from BL21(DE3) or the Nissle1917 engineered bacterium integrated with the T7 RNA polymerase expression cassette.

[0014] Preferably, the transformation method of the Nissle 1917 engineered bacterium integrated with the T7 RNA polymerase expression cassette is optimized and modified according to the method described in Patent CN202310516515.6.

[0015] Preferably, the genetic transformation of the Nissle 1917 engineered bacterium integrated with the T7 RNA polymerase expression cassette includes: inserting the T7 RNA polymerase expression cassette into the genome of Nissle 1917, knocking out the endA gene and the ompT gene on the genome, and knocking out the cryptic plasmids pMUT1 and pMUT2.

[0016] Preferably, the T7 RNA polymerase (T7 RNAP) expression cassette includes a promoter sequence, an operator sequence, an RBS sequence, a spacer sequence, and a T7 RNA polymerase sequence (Gene ID: 1261050) located downstream of the spacer sequence downstream of the RBS. Its 5' end is as shown in SEQ ID NO. 19, and the sequence of the modified and optimized T7 RNAP expression cassette is as shown in SEQ ID NO. 83.

[0017] Preferably, the overexpression is achieved by integrating one or more of the genes glmS, gna1, glnA, yqaB, icaC, galP, or glk onto an exogenous plasmid and introducing it into an engineered bacterium for expression.

[0018] Preferably, the exogenous plasmid is selected from any one or a combination of at least two of pETDuet, pCOLADuet, pRSFDuet, or pCDFDuet.

[0019] Preferably, the knockout is performed by using the CRISPR gene editing method or homologous recombination to knockout or silence a gene, thereby downregulating or removing the function of the relevant gene.

[0020] Preferably, the glucosamine synthase gene glmS is derived from: Escherichia coli K-12 MG1655, Bacillus subtilis, Corynebacterium glutamate; more preferably from Escherichia coli K-12 MG1655.

[0021] Preferably, the glucosamine acetylase gene gna1 is derived from: Saccharomyces cerevisiae, Caenorhabditis elegans, or the glucosamine acetylase gene gna1 is the codon-optimized gna1 from Saccharomyces cerevisiae or Caenorhabditis elegans in Escherichia coli; more preferably, the glucosamine acetylase gene gna1 is the gna1 gene derived from Saccharomyces cerevisiae, and its nucleotide sequence is as shown in SEQ ID NO. 7.

[0022] Preferably, the galP, glk, glnA, and yqaB genes are derived from Escherichia coli K-12 MG1655. Among them, the nucleotide sequence of galP is shown in SEQ ID NO.14, the nucleotide sequence of glk is shown in SEQ ID NO.15, the nucleotide sequence of glnA is shown in SEQ ID NO.16, and the nucleotide sequence of yqaB is shown in SEQ ID NO.17; the icaC gene is derived from Bacillus subtilis, and the nucleotide sequence of icaC is shown in SEQ ID NO.18.

[0023] Fourthly, the present invention provides the application of the genetically engineered bacterium for synthesizing N-acetylglucosamine described in any one of the first, second, or third aspects in the production of N-acetylglucosamine and / or glucosamine.

[0024] Fifthly, the present invention provides a preparation method of the genetically engineered bacterium for synthesizing N-acetylglucosamine described in any one of the first, second, or third aspects. The preparation method includes:

[0025] (1) Knock out the genes related to the catabolism of N-acetylglucosamine in the genome of the initial bacterium, including: the deaminase gene nagB and the deacetylase gene nagA;

[0026] (2) Construct a recombinant plasmid overexpressing the genes related to the metabolic synthesis of N-acetylglucosamine, and transduce the recombinant plasmid into the initial strain. The genes related to the metabolic synthesis of N-acetylglucosamine include: the glucosamine synthase gene glmS and the glucosamine acetyltransferase gene gna1;

[0027] Among them, the initial strain is Escherichia coli BL21(DE3) or the Nissle 1917 engineered bacterium integrated with the T7 RNA polymerase expression cassette.

[0028] Preferably, the transformation method of the Nissle 1917 engineered bacterium integrated with the T7 RNA polymerase expression cassette is optimized and transformed according to the method described in patent CN202310516515.6.

[0029] Preferably, in step (1), the genes related to the catabolism of N-acetylglucosamine further include one or more of the mannose phosphate transporter gene manX, the N-acetylglucosamine transporter gene nagE, the N-acetylglucosamine kinase gene nagK, or the glucose transmembrane transporter gene ptsG.

[0030] Preferably, in step (1), when the glucose transmembrane transporter gene ptsG is knocked out in the engineered bacteria, while overexpressing the glucosamine synthase gene glmS and the glucosamine acetylase gene gna1, the galactose symporter gene galP and the glucokinase gene glk are overexpressed.

[0031] Preferably, in step (2), the genes related to the metabolic synthesis of N-acetylglucosamine further include: one or more of the glutamine synthetase gene glnA, the fructose-1-phosphate phosphatase gene yqaB, or the N-acetylglucosamine transporter gene icaC.

[0032] Preferably, in step (1), the knockout is performed by using the CRISPR gene editing method or the homologous recombination method for gene knockout / silencing, so as to down-regulate or remove the functions of related genes.

[0033] In the present invention, the nucleotide sequences of the genes related to the catabolism of N-acetylglucosamine are shown as follows:

[0034] The nucleotide sequence of the deaminase gene nagB is shown as SEQ ID NO.1.

[0035] The nucleotide sequence of the deacetylase gene nagA is shown as SEQ ID NO.2.

[0036] The nucleotide sequence of the mannose phosphate transporter gene manX is shown as SEQ ID NO.10.

[0037] The nucleotide sequence of the N-acetylglucosamine transporter gene nagE is shown as SEQ ID NO.11.

[0038] The nucleotide sequence of the N-acetylglucosamine kinase gene nagK is shown as SEQ ID NO.12.

[0039] The nucleotide sequence of the glucose transmembrane transporter gene ptsG is shown as SEQ ID NO.13.

[0040] In the present invention, in step (1), the nucleotide sequence of the sgRNA targeting the deaminase gene nagB is shown as SEQ ID NO.22.

[0041] In step (1), the nucleotide sequence of the sgRNA targeting the deacetylase gene nagA is shown as SEQ ID NO.23.

[0042] In step (1), the nucleotide sequence of the sgRNA targeting the mannose phosphate transporter gene manX is shown as SEQ ID NO.24.

[0043] In step (1), the nucleotide sequence of the sgRNA targeting the N-acetylglucosamine transporter gene nagE is as shown in SEQ ID NO.25.

[0044] In step (1), the nucleotide sequence of the sgRNA targeting the N-acetylglucosamine kinase gene nagK is as shown in SEQ ID NO.26.

[0045] In step (1), the nucleotide sequence of the sgRNA targeting the glucose transmembrane transporter gene ptsG is as shown in SEQ ID NO.27.

[0046] Preferably, in step (2), when constructing a recombinant plasmid overexpressing a gene related to N-acetylglucosamine metabolism and synthesis, the plasmid is selected from any one or a combination of at least two of pETDuet, pCOLADuet, pRSFDuet, or pCDFDuet.

[0047] Preferably, in step (2), the glucosamine synthase gene glmS is derived from any one of Escherichia coli K-12 MG1655, Bacillus subtilis, or Corynebacterium glutamate.

[0048] In the present invention, the nucleotide sequence of EcglmS derived from Escherichia coli K-12 MG1655 is as shown in SEQ ID NO.3.

[0049] In the present invention, the nucleotide sequence of BsglmS derived from Bacillus subtilis is as shown in SEQ ID NO.5.

[0050] In the present invention, the nucleotide sequence of CgglmS derived from Corynebacterium glutamicum is as shown in SEQ ID NO.6.

[0051] Preferably, the glucosamine synthase gene glmS is derived from Escherichia coli K-12 MG1655, and the nucleotide sequence is as shown in SEQ ID NO.3.

[0052] Preferably, the glucosamine acetylase gene gna1 is derived from: Saccharomyces cerevisiae, Caenorhabditis elegans, or the glucosamine acetylase gene gna1 is the gna1 derived from Saccharomyces cerevisiae optimized for E. coli codons, with the nucleotide sequence shown in SEQ ID NO.4, or the glucosamine acetylase gene gna1 is the gna1 derived from Caenorhabditis elegans optimized for E. coli codons, with the nucleotide sequence shown in SEQ ID NO.9;

[0053] Preferably, the glucosamine acetylase gene gna1 is the gna1 gene derived from Saccharomyces cerevisiae, with the nucleotide sequence shown in SEQ ID NO.7.

[0054] Preferably, the galP, glk, glnA, and yqaB genes are derived from Escherichia coli K-12 MG1655, wherein the nucleotide sequence of galP is shown in SEQ ID NO.14, the nucleotide sequence of glk is shown in SEQ ID NO.15, the nucleotide sequence of glnA is shown in SEQ ID NO.16, and the nucleotide sequence of yqaB is shown in SEQ ID NO.17;

[0055] Preferably, the icaC gene is derived from Bacillus subtilis, and the nucleotide sequence of icaC is shown in SEQ ID NO.18.

[0056] Preferably, the deaminase gene nagB, the deacetylase gene nagA, the mannose phosphate transporter gene manX, the N-acetylglucosamine transporter gene nagE, and the N-acetylglucosamine kinase gene nagK are knocked out in the initial strain, and the glucosamine synthase gene glmS and the glucosamine acetylase gene gna1 are overexpressed.

[0057] Preferably, the deaminase gene nagB, the deacetylase gene nagA, the mannose phosphate transporter gene manX, the N-acetylglucosamine transporter gene nagE, and the N-acetylglucosamine kinase gene nagK are knocked out in the initial strain, the glucosamine synthase gene glmS and the glucosamine acetylase gene gna1 are overexpressed, and one or more of the glutamine synthetase gene glnA, the fructose-1-phosphate phosphatase gene yqaB, or the N-acetylglucosamine transporter gene icaC are further overexpressed.

[0058] Preferably, the deaminase gene nagB, deacetylase gene nagA, mannose phosphate transporter gene manX, N-acetylglucosamine transporter gene nagE, N-acetylglucosamine kinase gene nagK, and glucose transmembrane transporter gene ptsG are knocked out in the initial bacteria. While overexpressing the glucosamine synthase gene glmS and glucosamine acetylase gene gna1, the galactose symporter gene galP and glucokinase gene glk are overexpressed.

[0059] Preferably, the genetic modification of the Nissle 1917 engineered bacteria integrated with the T7 RNA polymerase expression cassette includes: inserting the T7 RNA polymerase expression cassette at the attB site of the Nissle 1917 genome, knocking out the endA gene and ompT gene on the genome, and knocking out the cryptic plasmids pMUT1 and pMUT2;

[0060] Among them, the T7 RNA polymerase (T7RNAP) expression cassette includes a promoter sequence, an operator sequence, an RBS sequence, a spacer sequence, and a T7RNA polymerase sequence located downstream of the spacer sequence downstream of the RBS. Its 5' end is as shown in SEQ ID NO.19, and the sequence of the modified and optimized T7RNAP expression cassette is as shown in SEQ ID NO.83.

[0061] In the present invention, the method for knocking out is selected from the CRISPR-Cas9 gene editing method or the homologous recombination method.

[0062] In the present invention, when inserting the T7 RNA polymerase expression cassette at the attB site of the Nissle 1917 genome, the nucleotide sequence of the sgRNA targeting the attB site is as shown in SEQ ID NO.81.

[0063] In the present invention, the endA gene is knocked out by the CRISPR-Cas9 gene editing method, and the nucleotide sequence of the sgRNA targeting the endA gene is as shown in SEQ ID NO.20.

[0064] In the present invention, the ompT gene is knocked out by the CRISPR-Cas9 gene editing method, and the nucleotide sequence of the sgRNA targeting the ompT gene is as shown in SEQ ID NO.21.

[0065] In the present invention, the cryptic plasmid pMUT1 is knocked out by the CRISPR-Cas9 gene editing method, and the nucleotide sequence of the sgRNA targeting pMUT1 is as shown in SEQ ID NO.79.

[0066] In the present invention, the cryptic plasmid pMUT2 was knocked out using the CRISPR-Cas9 gene editing method, and the nucleotide sequence of the sgRNA targeting pMUT2 is shown in SEQ ID NO.80.

[0067] As a preferred embodiment of the probiotic Escherichia coli engineering bacteria of the present invention, the specific construction method of the engineering bacteria is as follows: using the CRISPR / Cas9 gene editing technology, sgRNAs of nagB, nagA, manX, nagE, nagK, and ptsG were designed respectively to knock them out; a recombinant plasmid containing multiple genes such as glucosamine synthase gene glmS, glucosamine acetyltransferase gene gna1, glutamine synthase gene glnA, fructose-1-phosphate phosphatase gene yqaB, N-acetylglucosamine transporter gene icaC, galactose symporter gene galP, and glucokinase gene glk was constructed.

[0068] Overexpression in the present invention means multi-copy expression of a gene on a plasmid.

[0069] The plasmid in the present invention is selected from pETDuet, pCOLADuet, pRSFDuet, or pCDFDuet.

[0070] The host in the present invention is BL21(DE3) and EcNcΔattB(lacUV5-T7)ΔendAΔompT (named TCBJ117), and preferably TCBJ117.

[0071] The present invention provides a method for producing GlcNAc, which is to use the genetically engineered bacteria to ferment and produce GlcNAc with glucose as the carbon source.

[0072] Specifically, the fermentation includes: recombinant Escherichia coli was cultured overnight at 37 °C and 220 rpm for about 15 hours in 2 mL of LB medium containing the corresponding antibiotics. 1 mL of the overnight cultured seed solution was transferred into 50 mL of LB medium containing the corresponding antibiotics, and glucose with a final concentration of 40 g / L was added, and the culture was carried out at 30 °C and a shaker speed of 250 rpm for about 6 hours (the OD of the bacterial solution 600 was about 0.8). IPTG with a final concentration of 0.1 mM was added, and the induction fermentation was continued at 25 °C and a shaker speed of 250 rpm for 48 - 72 hours. After the fermentation was completed, the fermentation supernatant was collected by centrifugation. The supernatant was boiled at 100 °C for 10 minutes, centrifuged again, the supernatant was diluted 10 times with sterile water, the sample was filtered through a 0.22 μm filter membrane, and the contents of GlcNAc and GlcN were detected by external standard method on a liquid chromatograph.

[0073] Compared with the prior art, the present invention has the following beneficial effects:

[0074] The present invention uses probiotic Escherichia coli TCBJ117 as the host bacterium, and obtains a metabolic engineering bacterium strain for synthesizing GlcNAc by overexpressing glucosamine synthase gene glmS, glucosamine acetyltransferase gene gna1, glutamine synthetase gene glnA, fructose-1-phosphate phosphatase gene yqaB, N-acetylglucosamine transporter gene icaC; knocking out deaminase gene nagB, deacetylase gene nagA, mannose phosphate transporter encoding gene manX, N-acetylglucosamine transporter encoding gene nagE, N-acetylglucosamine kinase nagK. Fermentation verification in shake flasks was carried out using the metabolic engineering bacterium of the present invention. The results showed that when glucose was used as the substrate, the yields of GlcNAc and GlcN reached 17.73 g / L and 2.62 g / L respectively. The metabolic engineering bacterium constructed by the present invention achieved the purpose of safely and efficiently synthesizing GlcNAc. Description of the Drawings

[0075] Figure 1 are the sequencing results after knocking out the nagB and nagA gene loci of the genomes of probiotic Escherichia coli E. coli TCBJ117 and Escherichia coli BL21(DE3).

[0076] Figure 2 are the sequencing results after knocking out the manX, nagE, nagK and ptsG gene loci of the genome of Escherichia coli E. coli TCBJ117ΔnagBΔnagA.

[0077] Figure 3 is the HPLC-MS diagram of GlcNAc, where (a) represents the HPLC result of the GlcNAc standard; (b) represents the HPLC result of the GlcNAc sample; (c) represents the MS result of the GlcNAc sample. Detailed Embodiments

[0078] To more clearly describe the technical solution of the present invention, the technical solution of the present invention will be further described below through specific embodiments. Unless otherwise specified, the technical means used in the present invention are all methods well known to those skilled in the art. Those skilled in the art should understand that the described embodiments are only helpful for understanding the present invention and should not be regarded as specific limitations on the present invention. These are only partial embodiments of the present invention, and the essence and scope of the present invention are only defined by the claims. For those skilled in the art, without departing from the essence and scope of the present invention, various changes or modifications to the material components and dosages in these embodiments also belong to the protection scope of the present invention.

[0079] For those technical details or conditions not specified in the examples, they shall be in accordance with the techniques or conditions described in the literature in this field or in accordance with the product specifications. For reagents or instruments without indicating the manufacturer, they are all conventional products that can be obtained through regular channels of commercial purchase.

[0080] Example 1

[0081] Preparation of Escherichia coli EcNcΔattB(lacUV5-T7)ΔendAΔompT (This method is also described in CN202310516515.6)

[0082] 1.1 In the original strain of probiotic Escherichia coli Nissle1917 (E. coli Nissle1917), based on the CRISPR / Cas9 gene editing technology, using a homologous recombination kit (Pro Ligation-Free Cloning Kit, abm company, product number E086), the Cas9 fragment was ligated with the NcoI / XhoI double-digested fragment of the pKD46 plasmid to construct the pKD-Cas9 plasmid. The pKD-Cas9 plasmid was transformed into E. coli Nissle1917 cells, and positive clones were screened and named EcN-Cas9.

[0083] 1.2 While preparing EcN-Cas9, sgRNAs of the cryptic plasmids pMTU1 and pMTU2 were designed and prepared respectively, and transferred into EcN-Cas9 for the knockout of the cryptic plasmids, thereby constructing an Escherichia coli strain with the cryptic plasmids removed, named EcNc.

[0084] Among them: sgRNA-pMTU1: agttaccggataaggcgcagcgg; (SEQ ID NO.79)

[0085] sgRNA-pMTU2: gtttggcgcagaacctcggacgg. (SEQ ID NO.80)

[0086] 1.3 The optimized T7RNAP expression cassette was inserted into the genome of Nissle 1917 bacteria, and the insertion site of the expression cassette was the attB site on the genome.

[0087] The optimized T7RNAP expression cassette (abbreviated as "lacUV5-T7") includes a promoter sequence, an operator sequence, an RBS sequence, a spacer sequence, and the sequence of T7 RNA polymerase (Gene ID: 1261050) located downstream of the spacer sequence downstream of the RBS. The 5' end of the T7RNAP expression cassette sequence is shown in SEQ ID NO. 19, where the promoter sequence is "tttacactttatgcttccggctcgtataatg", the operator sequence is "ttgtgagcggataacaa", the RBS sequence is "AAAGAGGAGAAA", the spacer sequences are "GGCCACTACTAGAG" (the spacer sequence upstream of the RBS) and "TACTAG" (the spacer sequence downstream of the RBS), "ATGAACACGATTAACATCGCTAAGAAC" is the upstream partial sequence of the coding gene of T7 RNA polymerase (Gene ID: 1261050), and ATG is the start codon.

[0088] tttacactttatgcttccggctcgtataatgtgtggaattgtgagcggataacaaGGCCACTACTAGAGAAAGAGGA GAAA TACTAG ATGAACACGATTAACATCGCTAAGAAC (SEQ ID NO. 19). The complete optimized T7RNAP expression cassette sequence is shown in SEQ ID NO. 83.

[0089] Refer to step 1.1 to construct EcNc-Cas9, then co-transform the pUC-sgRNA-attB plasmid and the Donor fragment (the Donor fragment contains the T7 RNAP fragment (i.e., the T7RNAP expression cassette) and homologous arms with a length of about 300 bp upstream and downstream of the attB site) into EcNc-Cas9 cells, and use the CRISPR / Cas9 system to integrate the T7RNAP fragment into the attB site of the EcNc strain to obtain the strain EcNcΔattB (lacUV5-T7), abbreviated as EcNc-T7.

[0090] Among them, the sgRNA nucleotide sequence targeting the attB site is shown in SEQ ID NO. 81.

[0091] sgRNA-attB: ctaacttgagcgaaacgggaagg. (SEQ ID NO. 81)

[0092] The nucleotide fragment of the Donor fragment is shown in SEQ ID NO. 82:

[0093] 1.4 Knock out the endA and ompT genes in the probiotic Escherichia coli EcNc-T7 strain based on the CRISPR / Cas9 gene editing technology to prepare EcNcΔattB(lacUV5-T7)ΔendAΔompT.

[0094] Design sgRNAs for the genes endA and ompT respectively. The nucleotide sequence of the sgRNA for endA is as shown in SEQ ID NO.20; the nucleotide sequence of the sgRNA for ompT is as shown in SEQ ID NO.21. Transform the CRISPR / Cas9 knockout system into the target strain EcNc-T7, that is, knock out the target genes in EcNc-T7 to obtain EcNcΔattB(lacUV5-T7)ΔendAΔompT, and name it "TCBJ117".

[0095] sgRNA-endA: tttttctcaagcgaaagccgcgg (SEQ ID NO.20);

[0096] sgRNA-ompT: tactcctgacaacataaatgcgg (SEQ ID NO.21).

[0097] In addition to using the CRISPR / Cas9 gene editing technology, homologous recombination technology can also be used to knock out related genes and plasmids, and the finally obtained strain is consistent with TCBJ117.

[0098] Example 2

[0099] Knockout of nagB and nagA genes in Escherichia coli TCBJ117 and BL21(DE3)

[0100] Using the CRISPR / Cas9 gene editing technology, design sgRNAs targeting the genes nagB (shown in SEQ ID NO.1) and nagA (shown in SEQ ID NO.2) respectively, and clone the sgRNAs and the Donor sequences into the gene editing vector Donor plasmid.

[0101] The nucleotide sequences of the sgRNAs targeting the deaminase genes nagB and nagA are as shown in SEQ ID NO.22-23. The nucleotide sequences of the Donor sequences used to knock out nagB and nagA are as shown in SEQ ID NO.28-29.

[0102] sgRNA-nagB: (SEQ ID NO.22): 5'ctgactaccgctgaacaggtcgg 3'.

[0103] sgRNA-nagA: (SEQ ID NO.23): 5'catcagcgataacaaccgcgtgg 3'.

[0104] The specific experimental procedures include the following steps:

[0105] (1) Prepare electrocompetent cells of TCBJ117 and BL21(DE3) strains.

[0106] (2) Transform the pUC-Cas9 plasmid into TCBJ117 and BL21(DE3) cells, spread the bacterial solution on a kanamycin-resistant plate, and culture at 30°C.

[0107] (3) Pick monoclonal colonies for PCR verification the next day, prepare electrocompetent cells from the positive clones, and name them TCBJ117-Cas9 and BL21(DE3)-Cas9 respectively.

[0108] (4) Transform pUC-sgRNA-nagB into TCBJ117-Cas9 and BL21(DE3)-Cas9 cells, spread the bacterial solution on a Kan+Spec-resistant plate, and culture at 30°C.

[0109] (5) Pick monoclonal colonies for scale-up culture the next day, amplify the target gene fragment using primers nagB-F and nagB-R, and identify by agarose gel electrophoresis and sequencing.

[0110] nagB-F: 5'agacgccggttcgttaaatgcaat 3'; (SEQ ID NO.34)

[0111] nagB-R: 5'gctgcaaattgtactgccgatgttct 3'. (SEQ ID NO.35)

[0112] (6) Use the same strategy as above, combined with the sgRNA sequence of the nagA gene to knock it out.

[0113] (7) Use the positive clone as a template, amplify the upstream and downstream sequences of the nagA gene knockout site using primers nagA-F and nagA-R. Recover the correct band by agarose gel and verify by sequencing. The sequence of the knockout fragment is consistent with the Donor fragment.

[0114] nagA-F: 5'acgcctggttcggatgttt; (SEQ ID NO.36)

[0115] nagA-R: 5'cgacggtcatattgcatttaacgaacc 3'. (SEQ ID NO.37)

[0116] The sequencing results of nagB and nagA knockout in TCBJ117 and BL21(DE3) strains are shown in Figure 2. Figure 1 As shown, (a) and (b) represent the sequencing results of PCR products of nagB and nagA genes of TCBJ117, respectively, and (c) and (d) represent the sequencing results of PCR products of nagB and nagA genes of BL21(DE3), respectively.

[0117] Sequencing verification showed that the knockout fragment sequence was consistent with the Donor designed fragment, and the nagB and nagA genes of the TCBJ117 and BL21(DE3) strains were successfully knocked out, obtaining recombinant bacteria TCBJ117ΔnagB, TCBJ117ΔnagBΔnagA, BL21(DE3)ΔnagB, and BL21(DE3)ΔnagBΔnagA, respectively.

[0118] (8) Plasmid construction: Using the genome of Escherichia coli K-12MG1655 as a template, the EcglmS gene fragment (shown in SEQ ID NO. 3) was cloned using primers EcglmS-F and EcglmS-R. Suzhou Hongxun Biotechnology Co., Ltd. was commissioned to artificially synthesize the codon-optimized gna1 gene from Saccharomyces cerevisiae in Escherichia coli and named it Scgna1. opt (shown in SEQ ID NO.4), using primer Scgna1 opt -F and Scgna1 opt -R amplification of Scgna1 opt Gene, gel electrophoresis and gel cutting to recover DNA fragments. opt The gene fragment was connected to the vector pETDuet by homologous recombination to construct the expression plasmid pET-EcglmS-Scgna1 opt .

[0119] EcglmS-F: 5'gtataagaaggagatatacatatgtgtggaattgttggcgcgatcgcg 3'; (SEQ ID NO. 38)

[0120] EcglmS-R: 5'cagcggtttctttaccagactcgagttatcaaccgtaaccgattttg 3'. (SEQ ID NO.39)

[0121] Scgna1 opt-F: 5'ctttaagaaggagatataccatgggcatgagtctgccggacggtttttac 3'; (SEQ ID NO.40)

[0122] Scgna1 opt -R: 5'cgcgccgagctcgaattcggatccttatttgcggatctgcatttc 3'. (SEQ ID NO.41)

[0123] (9) Construction of the strain: Transfer the recombinant plasmid constructed in the above step (8) into the strain constructed in step (7) to obtain an engineered strain for producing GlcNAc.

[0124] (10) Shake flask fermentation for synthesizing GlcNAc: Inoculate the engineered strain for producing GlcNAc obtained in step (9) into 2 mL of LB medium containing the corresponding antibiotic, and culture it overnight at 37 °C and 220 rpm in a shake flask for about 15 hours to obtain a seed solution; Take 1 mL of the overnight-cultured seed solution and inoculate it into 50 mL of LB medium containing the corresponding antibiotic, add glucose with a final concentration of 20 g / L, and culture it at 30 °C with a shaker speed of 250 rpm for about 6 hours (OD of the bacterial solution 600 is about 0.8). Add IPTG with a final concentration of 0.1 mM, and continue the induced fermentation at 25 °C with a shaker speed of 250 rpm for 48 hours. After the fermentation is completed, centrifuge to collect the fermentation supernatant. The supernatant is boiled at 100 °C for 10 minutes, centrifuged again, take the supernatant and dilute it 10 times with sterile water. The sample is filtered through a 0.22 μm filter membrane, and the contents of GlcNAc and GlcN are detected by the external standard method using liquid chromatography.

[0125] The results of the GlcNAc and GlcN yields of the engineered strain are shown in Table 1. The strain TCBJ117ΔnagBΔnagA / pET-EcglmS-Scgna1 opt has the highest yield. After 48 hours of fermentation, the yields of GlcNAc and GlcN reach 1.97 g / L and 0.67 g / L respectively.

[0126] Compared with BL21(DE3)ΔnagBΔnagA / pET-EcglmS-Scgna1 opt the yield of TCBJ117ΔnagBΔnagA / pET-EcglmS-Scgna1 opt is increased by 1.68 times. Therefore, the strain TCBJ117ΔnagBΔnagA / pET–EcglmS-Scgna1 opt is selected for further modification.

[0127] Table 1

[0128]

[0129] Example 3

[0130] Construction of GlcNAc Biosynthesis Pathway

[0131] (1) Screening of different expression vectors:

[0132] Using plasmid pET-EcglmS-Scgna1 opt as a template, the gene fragment of EcglmS-Scgna1 opt was cloned with primers Scgna1 opt -F and EcglmS-R in Example 2 and ligated to vector pCOLADuet or pRSFDuet or pCDFDuet by homologous recombination to construct a series of expression plasmids, including: pCOLA-EcglmS-Scgna1 opt , pRSF-EcglmS-Scgna1 opt , pCDF-EcglmS-Scgna1 opt .

[0133] The constructed recombinant plasmids were transformed into the strain TCBJ117ΔnagBΔnagA constructed in Example 2 to obtain engineering strains for producing GlcNAc. The shake flask fermentation process was the same as step (10) in Example 2.

[0134] The GlcNAc and GlcN yields of the engineering strains are shown in Table 2. The yield of TCBJ117ΔnagBΔnagA / pRSF-EcglmS-Scgna1 opt was the highest. After 48-hour fermentation, the GlcNAc and GlcN yields reached 2.77 g / L and 0.93 g / L respectively.

[0135] Table 2

[0136] Group Chassis cell Plasmid GlcNAc production GlcN production 1 TCBJ117ΔnagBΔnagA <![CDATA[pET-EcglmS-Scgna1 opt > 1.88 0.61 2 TCBJ117ΔnagBΔnagA <![CDATA[pCOLA-EcglmS-Scgna1 opt > 1.43 0.72 3 TCBJ117ΔnagBΔnagA <![CDATA[pRSF-EcglmS-Scgna1 opt > 2.77 0.93 4 TCBJ117ΔnagBΔnagA <![CDATA[pCDF-EcglmS-Scgna1 opt > 1.94 0.67

[0137] (2) Screening of glmS genes from different sources:

[0138] Using the genome of Bacillus subtilis as a template, the gene fragment of BsglmS (shown in SEQ ID NO.5) was cloned with primers BsglmS-F and BsglmS-R.

[0139] BsglmS-F: 5'gtataagaaggagatatacatatgtgtggaatcgtaggttatatcg 3'; (SEQ ID NO.42)

[0140] BsglmS-R: 5' cagcggtttctttaccagactcgagttactccacagtaacactcttcgc 3'. (SEQ ID NO.43)

[0141] Using the genome of Corynebacterium glutamicum as a template, the gene fragment of CgglmS (shown in SEQ ID NO.6) was cloned using primers CgglmS-F and CgglmS-R.

[0142] CgglmS-F: 5' gtataagaaggagatatacatatgtgtggaattgttggatatattggc 3'; (SEQ ID NO.44)

[0143] CgglmS-R: 5' cagcggtttctttaccagactcgagttattcgacggtgacagactttgc 3'. (SEQ ID NO.45)

[0144] The DNA fragment was recovered by gel electrophoresis and gel cutting. The recovered BsglmS and CgglmS gene fragments were used to replace the EcglmS gene in the plasmid pRSF-EcglmS-Scgna1 constructed in step (1) through homologous recombination opt to construct a series of expression plasmids, including: pRSF-BsglmS-Scgna1 opt and pRSF-CgglmS-Scgna1 opt .

[0145] The recombinant plasmid was transformed into the strain TCBJ117ΔnagBΔnagA to obtain an engineered strain for producing GlcNAc. The shake flask fermentation process was the same as step (10) in Example 2.

[0146] The production results of GlcNAc and GlcN of the engineered strains are shown in Table 3. The yield of TCBJ117ΔnagBΔnagA / pRSF-EcglmS-Scgna1 opt was the highest. After 48 hours of fermentation, the yields of GlcNAc and GlcN reached 2.83 g / L and 0.95 g / L, respectively.

[0147] Table 3

[0148] Group Chassis cell Plasmid GlcNAc production GlcN production 1 TCBJ117ΔnagBΔnagA <![CDATA[pRSF-EcglmS-Scgna1 opt > 2.83 0.95 2 TCBJ117ΔnagBΔnagA <![CDATA[pRSF-BsglmS-Scgna1 opt > 2.12 0.61 3 TCBJ117ΔnagBΔnagA <![CDATA[pRSF-CgglmS-Scgna1 opt > 1.87 0.68

[0149] (3) Screening of gna1 genes from different sources: Entrusted Suzhou Huoxun Biotechnology Co., Ltd. to artificially synthesize the gna1 genes from Saccharomyces cerevisiae and Caenorhabditis elegans, named Scgna1 (shown in SEQ ID NO.7) and Cegna1 (shown in SEQ ID NO.8) respectively. Use primers Scgna1-F and Scgna1-R to amplify the gene fragment of Scgna1; use primers Cegna1-F and Cegna1-R to amplify the gene fragment of Cegna1; at the same time, artificially synthesize Cegna1 optimized with Escherichia coli codons, named Cegna1 opt (shown in SEQ ID NO.9). Use primers Cegna1 opt -F and Cegna1 opt -R to clone the gene fragment of Cegna1 opt .

[0150] Scgna1-F: 5'ctttaagaaggagatataccatgagcttacccgatggattttatataag 3; (SEQID NO.46)

[0151] Scgna1-R: 5'cgcgccgagctcgaattcggatccctattttctaatttgcatttccac 3'. (SEQID NO.47)

[0152] Cegna1-F: 5'ctttaagaaggagatataccatgtctcacatttttgatgcgtct 3’; (SEQ IDNO.48)

[0153] Cegna1-R: 5'cgcgccgagctcgaattcggatccttagaagcgctgagtcataaaat 3'. (SEQ IDNO.49)

[0154] Cegna1 opt -F: 5'ctttaagaaggagatataccatgagccacatttttgacgcgagc 3’; (SEQ IDNO.50)

[0155] Cegna1 opt -R: 5'cgcgccgagctcgaattcggatccttaaaaacgctgggtcatgaagttg 3'. (SEQ ID NO.51)

[0156] Gel electrophoresis was performed to excise and recover DNA fragments. The recovered gene fragments were used to replace the Scgna1 gene fragment on the vector pRSF-EcglmS-Scgna1 through homologous recombination. opt on pRSF-EcglmS-Scgna1 opt to construct a series of expression plasmids, including: pRSF-EcglmS-Scgna1, pRSF-EcglmS-Cegna1, pRSF-EcglmS-Cegna1. opt The above-constructed recombinant plasmids were transformed into the strain TCBJ117ΔnagBΔnagA constructed in Example 2 to obtain an engineered strain for producing GlcNAc.

[0157] The fermentation process was the same as step (10) in Example 2. The results are shown in Table 4. The yield of TCBJ117ΔnagBΔnagA / pRSF-EcglmS-Scgna1 was the highest. After 48 hours of fermentation, the yields of GlcNAc and GlcN reached 4.58 g / L and 1.34 g / L, respectively.

[0158] After screening the vectors and the glmS and gna1 genes, the strain TCBJ117ΔnagBΔnagA / pRSF-EcglmS-Scgna1 with the highest GlcNAc yield was obtained.

[0159] Table 4

[0160] Group Chassis cell Plasmid GlcNAc production GlcN production 1 TCBJ117ΔnagBΔnagA <![CDATA[pRSF-EcglmS-Scgna1 opt > 2.79 0.93 2 TCBJ117ΔnagBΔnagA pRSF-EcglmS-Scgna1 4.58 1.34 3 TCBJ117ΔnagBΔnagA pRSF-EcglmS-Cegna1 1.32 0.75 4 TCBJ117ΔnagBΔnagA <![CDATA[pRSF-EcglmS-Cegna1 opt > 0.91 0.77

[0161] Example 4

[0162] Knockout of manX, nagE, nagK, and ptsG genes in probiotic Escherichia coli TCBJ117ΔnagBΔnagA

[0163] Using the CRISPR / Cas9 gene editing technology, sgRNAs targeting the genes manX (shown in SEQ ID NO.10), nagE (shown in SEQ ID NO.11), nagK (shown in SEQ ID NO.12), and ptsG (shown in SEQ ID NO.13) were designed respectively, and the sgRNAs and the Donor sequences were cloned into the gene editing vector Donor plasmid.

[0164] The nucleotide sequences of the sgRNAs targeting manX, nagE, nagK, and ptsG are shown in SEQ ID NO.24 - 27 respectively. The nucleotide sequences of the Donor sequences for knocking out manX, nagE, nagK, and ptsG are shown in SEQ ID NO.30 - 33 respectively.

[0165] sgRNA - manX: (SEQ ID NO.24): 5'ttaggcgagcaggaaaacgtcgg 3'

[0166] sgRNA - nagE: (SEQ ID NO.25): 5'cgatggcgaagattaatgcgagg 3'

[0167] sgRNA - nagK: (SEQ ID NO.26): 5'gcgcttggcgtgtttgatagcgg 3'

[0168] sgRNA - ptsG: (SEQ ID NO.27): 5'gatgccataggcaacaactgcgg 3'

[0169] The specific experimental procedure includes the following steps:

[0170] (1) Prepare electrocompetent cells of strain TCBJ117ΔnagBΔnagA.

[0171] (2) Transform the pUC - Cas9 plasmid into TCBJ117ΔnagBΔnagA cells, spread the bacterial solution on a kanamycin - resistant plate, and incubate at 30°C.

[0172] (3) Pick monoclonal colonies the next day for PCR verification, prepare electrocompetent cells from the positive clones, and name them TCBJ117ΔnagBΔnagA - Cas9.

[0173] (4) Transfer pUC - sgRNA - manX into TCBJ117ΔnagBΔnagA - Cas9 cells, spread the bacterial solution on a Kan+Spec - resistant plate, and incubate at 30°C.

[0174] (5) Pick monoclonal colonies the next day for expanded culture, amplify the target gene fragment using primers manX - F and manX - F, and identify by agarose gel electrophoresis and sequencing.

[0175] manX - F: 5'ctttgcaaacgaatgtgacaagga 3'; (SEQ ID NO.52)

[0176] manX - R: 5'ttggctttcagtgctttcacgc 3'. (SEQ ID NO.53)

[0177] (6) Using the same strategy as above, knock out nagE, nagK, and ptsG genes in combination with their sgRNA sequences.

[0178] (7) Using the positive clones as templates, the upstream and downstream sequences of the gene knockout sites nagE, nagK, and ptsG genes were PCR amplified using primers nagE-F and nagE-R; nagK-F and nagK-R; ptsG-F and ptsG-R, respectively. The correct bands were recovered by agarose gel electrophoresis and verified by sequencing. The sequences of the knockout fragments were consistent with those of the donor fragments.

[0179] nagE-F: 5'cgtttaatttgcgatacgaattaaa 3'; (SEQ ID NO.54)

[0180] nagE-R: 5'tagcgtgctgtaccggcg 3'. (SEQ ID NO.55)

[0181] nagK-F: 5'gttatcggcgtggtggtttcact 3'; (SEQ ID NO.56)

[0182] nagK-R: 5'ggcagacgcatatggccaaact 3'. (SEQ ID NO.57)

[0183] ptsG-F: 5'cccccttgccacgcgt 3'; (SEQ ID NO.58)

[0184] ptsG-R: 5'gtaagcagcccactgagagaaggt 3'. (SEQ ID NO.59)

[0185] The sequencing identification results of the knockout of manX, nagE, nagK, and ptsG genes in strain TCBJ117ΔnagBΔnagA are as Figure 2 shown. The sequencing results of the PCR products of manX, nagE, nagK, and ptsG genes represented by (a), (b), (c), and (d) respectively were verified by sequencing. The sequences of the knockout fragments were consistent with those of the Donor designed fragments. The manX, nagE, nagK, and ptsG genes of strain TCBJ117ΔnagBΔnagA were successfully knocked out, and a series of strains were obtained, including:

[0186] TCBJ117ΔnagBΔnagAΔmanX;

[0187] TCBJ117ΔnagBΔnagAΔmanXΔnagE;

[0188] TCBJ117ΔnagBΔnagAΔmanXΔnagEΔnagK;

[0189] TCBJ117ΔnagBΔnagAΔmanXΔnagEΔnagKΔptsG。

[0190] (8) Construction of recombinant plasmids: Using the genome of Escherichia coli K-12 MG1655 as a template, the gene fragments of galP (shown in SEQ ID NO.14) and glk (shown in SEQ ID NO.15) were cloned with primers galP-F and galP-R, glk-F and glk-R respectively; Gel electrophoresis was performed and the DNA fragments were recovered by cutting the gel. The recovered galP gene fragment and EcglmS recovered in step (8) of Example 2 were ligated to the vector pRSFDuet by homologous recombination to obtain the recombinant plasmid pRSF-EcglmS-galP; The recovered glk gene fragment and the Scgna1 gene fragment recovered in step (3) of Example 3 were ligated to the vector pCDFDuet by homologous recombination to obtain the recombinant plasmid pCDF-glk-Scgna1.

[0191] galP-F: 5'ctttaagaaggagatataccatgggcatgcctgacgctaaaaaacaggggc 3'; (SEQID NO.60)

[0192] galP-R: 5'cgcgccgagctcgaattcggatccttaatcgtgagcgcctatttcgcgcag 3'. (SEQID NO.61)

[0193] glk-F: 5'gtataagaaggagatatacatatgacaaagtatgcattagtcggtgatg 3'; (SEQ IDNO.62)

[0194] glk-R: 5'cagcggtttctttaccagactcgagttacagaatgtgacctaaggtctggcg 3'. (SEQID NO.63)

[0195] (10) Construction of strains: The best recombinant plasmid pRSF-EcglmS-Scgna1 screened in Example 3 was transferred into a series of strains constructed in step (7) to obtain a series of engineered strains for producing GlcNAc; among them, the ptsG gene was knocked out in the strain TCBJ117ΔnagBΔnagAΔmanXΔnagEΔnagKΔptsG. In order to compensate for the glucose transport function, the galP and glk genes need to be overexpressed. Therefore, the recombinant plasmids pRSF-EcglmS-galP and pCDF-glk-Scgna1 were used to replace pRSF-EcglmS-Scgna1 and were simultaneously transformed into the strain TCBJ117ΔnagBΔnagAΔmanXΔnagEΔnagKΔptsG to obtain the strain TCBJ117ΔnagBΔnagAΔmanXΔnagEΔnagKΔptsG / pRSF-EcglmS-galP / pCDF-glk-Scgna1.

[0196] (11) Shake-flask fermentation for the synthesis of GlcNAc: The fermentation process was the same as that in step (10) of Example 2. The fermentation results are shown in Table 5. The strain TCBJ117ΔnagBΔnagAΔmanXΔnagEΔnagK / pRSF-EcglmS-Scgna1 had the highest yield. After 48 hours of fermentation, the yields of GlcNAc and GlcN reached 8.22 g / L and 1.94 g / L, respectively. Knocking out the genes manX, nagE, and nagK increased the GlcNAc yield by 1.84 times; knocking out ΔptsG did not further increase the yields of GlcNAc and GlcN.

[0197] Table 5

[0198]

[0199] Example 5

[0200] Enhancement of the GlcNAc Biosynthesis Pathway

[0201] (1)Obtaining of glnA, yqaB and icaC gene fragments and construction of recombinant plasmids: Using pRSF-EcglmS-Scgna1 as a template, the Scgna1-(glnA) gene fragment was cloned using the primers Scgna1-F and Scgna1-R(glnA) in Example 3; the Scgna1-(yqaB) gene fragment was cloned using the primers Scgna1-F and Scgna1-R(yqaB); the Scgna1-(icaC) gene fragment was cloned using the primers Scgna1-F and Scgna1-R(icaC); using the genome of Escherichia coli K-12 MG1655 as a template, the gene fragment of glnA (shown in SEQ ID NO.16) was cloned using the primers glnA-F and glnA-R; the gene fragment of yqaB (shown in SEQ ID NO.17) was cloned using the primers yqaB-F and yqaB-R; using the genome of Bacillus subtilis 168 as a template, the icaC (shown in SEQ ID NO.18) gene fragment was cloned using the primers icaC-F and icaC-R, and the DNA fragments were recovered by gel electrophoresis and gel cutting. Recombinant plasmid pRSF-EcglmS-Scgna1 opt Digested with NcoI and BamHI to obtain linearized pRSF-EcglmS, and the DNA fragments were recovered by gel electrophoresis and gel cutting.

[0202] Scgna1-R(glnA): 5'tcagcggacatggtatatctccttctattttctaatttgcatttccacg3'). (SEQ ID NO.64)

[0203] Scgna1-R(yqaB): 5'cgctcgtacatggtatatctccttctattttctaatttgcatttccacg3'. (SEQ ID NO.65)

[0204] Scgna1-R(icaC): 5'taatttgcatggtatatctccttctattttctaatttgcatttccacg 3'. (SEQ ID NO.66)

[0205] glnA-F: 5'tagaaaatagaaggagatataccatgtccgctgaacacgtactga 3'; (SEQ IDNO.67)

[0206] glnA-R: 5'cgcgccgagctcgaattcggatccttagacgctgtagtacagctcaaa 3'. (SEQ ID NO.68)

[0207] yqaB-F: 5'tagaaaatagaaggagatataccatgtacgagcgttatgcaggtttaat 3'; (SEQ ID NO.69)

[0208] yqaB-R: 5'cgcgccgagctcgaattcggatcctcacagcaagcgaacatccacggcg 3'. (SEQ ID NO.70)

[0209] icaC-F: 5'tagaaaatagaaggagatataccatgcaaattaaagaaatttttatgatc 3'; (SEQ ID NO.71)

[0210] icaC-R: 5'cgcgccgagctcgaattcggatcctcaccctgcgtgatcacgcacttcg 3'. (SEQ ID NO.72)

[0211] The recovered Scgna1-(glnA) and glnA were ligated to the linearized plasmid pRSF-EcglmS by homologous recombination to obtain the recombinant plasmid pRSF-EcglmS-Scgna1-glnA; the recovered Scgna1-(yqaB) and yqaB were ligated to the linearized plasmid pRSF-EcglmS by homologous recombination to obtain the recombinant plasmid pRSF-EcglmS-Scgna1-yqaB; the recovered Scgna1-(icaC) and icaC were ligated to the linearized plasmid pRSF-EcglmS by homologous recombination to obtain the recombinant plasmid pRSF-EcglmS-Scgna1-icaC.

[0212] (2) Construction of a two-plasmid system for overexpressing 5 genes: The glnA gene fragment was obtained by PCR amplification using primers glnA-F2 and glnA-R2; the recovered glnA was ligated to the linearized plasmid pRSF-EcglmS in step (1) by homologous recombination to obtain pRSF-EcglmS-glnA.

[0213] glnA-F2: 5'ctttaagaaggagatataccatgggcatgtccgctgaacacgtactgacgatgc 3'; (SEQ ID NO.73)

[0214] glnA-R2: 5' cgcgccgagctcgaattcggatccttagacgctgtagtacagctcaaactc 3'. (SEQ ID NO.74)

[0215] Using plasmid pRSF-EcglmS-Scgna1-icaC as a template, the Scgna1-icaC gene fragment was amplified with primers Scgna1-F and icaC-R in step (1); pCDF-EcglmS-Scgna1 was digested with NcoI and BamHI opt to obtain a linearized fragment pCDF-EcglmS. The recovered Scgna1-icaC gene fragment was ligated to the linearized fragment pCDF-EcglmS by homologous recombination to obtain the recombinant plasmid pCDF-EcglmS-Scgna1-icaC.

[0216] Using pRSF-EglmS-Scgna1-yqaB as a template, the yqaB-2 gene fragment was cloned with primers yqaB-F2 and yqaB-R2; using pCDF-EglmS-Scgna1-icaC as a template and pCDF-Scgna1-icaC-F and pCDF-Scgna1-icaC-R as primers, a linearized pCDF-Scgna1-icaC fragment was obtained. The recovered yqaB-2 was ligated to the linearized plasmid pCDF-Scgna1-icaC by homologous recombination to obtain the recombinant plasmid pCDF-yqaB-Scgna1-icaC.

[0217] yqaB-F2: 5' aagtataagaaggagatatacatatgtacgagcgttatgcaggtt 3'; (SEQ ID NO.75)

[0218] yqaB-R2: 5' ggtttctttaccagactcgagtcacagcaagcgaacatccacg 3'. (SEQ ID NO.76)

[0219] pCDF-Scgna1-icaC-F: 5' atgtatatctccttcttatacttaactaatatactaa 3'; (SEQ ID NO.77)

[0220] pCDF-Scgna1-icaC-R: 5' gtggatgttcgcttgctgtgactcgagtctggtaaagaaacc 3'. (SEQ ID NO.78)

[0221] (3) Construction of strains: The recombinant plasmids constructed in steps (1) and (2) were transferred into the competent cells of probiotic Escherichia coli TCBJ117ΔnagBΔnagAΔmanXΔnagEΔnagK constructed in Example 4 to obtain a series of engineered strains for producing GlcNAc, as shown in Table 6.

[0222] (4) Shake flask fermentation for synthesizing GlcNAc: The fermentation process was the same as step (10) in Example 2. The fermentation results are shown in Table 6. The strain TCBJ117ΔnagBΔnagAΔmanXΔnagEΔnagK / pRSF-EcglmS-glnA / pCDF-Scgna1-yqaB-icaC had the highest yield. After 48 hours of fermentation, the yields of GlcNAc and GlcN reached 17.73 g / L and 2.62 g / L, respectively.

[0223] Table 6

[0224]

[0225] Example 6

[0226] Qualitative detection method for GlcNAc

[0227] The fermentation broth containing GlcNAc obtained in the example of the present invention was centrifuged at 10,000 rpm for 1 minute to obtain the supernatant of the fermentation broth; the supernatant of the fermentation broth was diluted 200 times and then passed through a 0.22 μm aqueous filter membrane. The diluted fermentation supernatant was used as the sample to be tested for HPLC-MS detection.

[0228] HPLC detection conditions: Chromatographic column: EclipsePlus C18 RRHD 1.8 μm 2.1×50 mm; Mobile phase: Pump A was H2O + 0.1% formic acid, and pump B was methanol; Elution gradient was as shown in Table 7 (Liquid phase elution conditions for GlcNAc); Column temperature was 30°C.

[0229] Table 7

[0230] Time (minutes) A% B% Flow rate mL / min Upper pressure limit bar 0 40 60 0.3 600 1 40 60 0.3 600 4.5 2 98 0.3 600 7 2 98 0.3 600 7.1 40 60 0.3 600 10 40 60 0.3 600

[0231] MS detection conditions: Ionization mode: Electrospray positive ion mode; Detection mode: Product Ion; Nebulizing gas pressure: 40 psi; Ion spray voltage: 4000 V; Dryer temperature: 350°C; Dry gas flow rate: 8 L / min. The qualitative ion pairs, fragmentation voltage, and collision energy are shown in Table 8:

[0232] Table 8

[0233]

[0234] The HPLC-MS results of GlcNAc standard and sample are shown in the appendix Figure 3 。The peak time of GlcNAc standard is 13.024 minutes. The peak time of the product peak in the GlcNAc sample is the same as that of the GlcNAc standard. And in the MS results of the sample, m / z 222.1, 204.1, 168.1 and 138.0 are mainly generated. Among them, 222.1 is the parent ion peak (M+1), and m / z 204.1, 168.1 and 138.0 are daughter ion peaks, which are consistent with the MS results of GlcNAc reported in the literature, proving that the product of the present invention is indeed GlcNAc.

[0235] In summary, the present invention provides a probiotic Escherichia coli engineering strain for efficiently synthesizing N-acetylglucosamine and a construction method thereof. During the construction of the engineering strain, 5 genes in the original strain TCBJ117 genome can be knocked out during the synthesis of glucosamine: the deaminase gene nagB, the deacetylase gene nagA, the mannose phosphate transporter encoding gene manX, the N-acetylglucosamine transporter encoding gene nagE and the N-acetylglucosamine kinase nagK; and it is obtained by strengthening and overexpressing the glucosamine synthase gene glmS, the N-acetylglucosamine acetylase gene gna1, the glutamine synthetase gene glnA, the fructose-1-phosphate phosphatase gene yqaB and the N-acetylglucosamine transporter gene icaC.

[0236] The scheme of the present invention can promote the synthesis of N-acetylglucosamine, and at the same time block the transport of the product N-acetylglucosamine from the extracellular to the intracellular, thereby increasing the yield of N-acetylglucosamine in the fermentation broth. The present invention uses the Escherichia coli probiotic Nissle1917 as the host for the biosynthesis of N-acetylglucosamine, laying a foundation for the industrial safety production of N-acetylglucosamine.

[0237] The applicant declares that the above is only the specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily thought of by those skilled in the art within the technical scope disclosed by the present invention fall within the protection scope and the disclosure scope of the present invention.

Claims

1. A genetically engineered bacterium for synthesizing N-acetylglucosamine, characterized in that, The genetically engineered bacterium uses Escherichia coli as the initial bacterium, and the deaminase gene is knocked out from the genome of the initial bacterium nagB and the deacetylase gene nagA, mannose phosphate transporter gene manX , N-acetylglucosamine transporter gene nagE , N-acetylglucosamine kinase gene nagK , overexpress the glucosamine synthase gene glmS and the glucosamine acetylase gene gna1, and further overexpress the glutamine synthetase gene glnA , fructose-1-phosphate phosphatase gene yqaB and the N-acetylglucosamine transporter gene icaC ; Among them, glmS the nucleotide sequence is as shown in SEQ ID NO.3, gna1 the nucleotide sequence is as shown in SEQ ID NO.7, glnA the nucleotide sequence of is as shown in SEQ ID NO.16, yqaB the nucleotide sequence of is as shown in SEQ ID NO.17, icaC the nucleotide sequence of is as shown in SEQ ID NO.18; The Escherichia coli is the Nissle 1917 engineered bacterium integrated with the T7 RNA polymerase expression cassette; The genetic modification of the Nissle 1917 engineered bacteria integrating the T7 RNA polymerase expression cassette includes: inserting the T7 RNA polymerase expression cassette into the genome of Nissle 1917, knocking out the endA gene and ompT gene, knocking out the cryptic plasmids pMUT1 and pMUT2 ; The T7 RNA polymerase expression cassette includes a promoter sequence, an operator sequence, an RBS sequence, a spacer sequence, and a T7 RNA polymerase sequence located downstream of the spacer sequence downstream of the RBS. Its 5' end is as shown in SEQ ID NO.19, and the T7 RNA polymerase expression cassette sequence is as shown in SEQ ID NO.

83.

2. The genetically engineered bacterium for synthesizing N-acetylglucosamine according to claim 1, characterized in that, The overexpression is to integrate one or more of the genes glmS, gna1, glnA, yqaB or icaC into an exogenous plasmid and introduce it into an engineered bacterium for expression.

3. The genetically engineered bacterium for synthesizing N-acetylglucosamine according to claim 2, wherein The exogenous plasmid is selected from any one or a combination of at least two of pETDuet, pCOLADuet, pRSFDuet, or pCDFDuet.

4. The genetically engineered bacterium for synthesizing N-acetylglucosamine according to claim 1, characterized in that, The knockout is performed by using the CRISPR gene editing method or homologous recombination method for gene knockout or silencing, so as to down-regulate or remove the functions of related genes.

5. Use of the genetically engineered bacterium for synthesizing N-acetylglucosamine according to any one of claims 1-4 in the production of N-acetylglucosamine and / or glucosamine.

6. A method for preparing a genetically engineered bacterium for synthesizing N-acetylglucosamine according to any one of claims 1-4, characterized in that, The preparation method includes: (1) Knock out the genes related to N - acetylglucosamine catabolism in the genome of the initial bacterium, including: deaminase gene nagB , deacetylase gene nagA , mannose phosphate transporter gene manX, N - acetylglucosamine transporter gene nagE, N - acetylglucosamine kinase gene nagK; (2)Construct recombinant plasmids overexpressing genes related to the metabolic synthesis of N-acetylglucosamine, and transduce the recombinant plasmids into the initial strain. The genes related to the metabolic synthesis of N-acetylglucosamine include: glucosamine synthase gene glmS , glucosamine acetylase gene gna1 , and further overexpress glutamine synthetase gene glnA , fructose-1-phosphate phosphatase gene yqaB , and N-acetylglucosamine transporter gene icaC ; Among them, glmS the nucleotide sequence is as shown in SEQ ID NO.3, gna1 the nucleotide sequence is as shown in SEQ ID NO.7, glnA the nucleotide sequence of yqaB is as shown in SEQ ID NO.16, icaC the nucleotide sequence of is as shown in SEQ ID NO.17; the nucleotide sequence of is as shown in SEQ ID NO.18; The initial bacterium is Escherichia coli, and the Escherichia coli is the Nissle 1917 engineered bacterium integrated with the T7 RNA polymerase expression cassette; The genetic modification of the Nissle 1917 engineered bacterium integrated with the T7 RNA polymerase expression cassette includes: inserting the T7 RNA polymerase expression cassette at the attB site of the Nissle 1917 genome, knocking out the endA gene and ompT gene on the genome, and knocking out the cryptic plasmids pMUT1 and pMUT2; Among them, the T7 RNA polymerase expression cassette includes a promoter sequence, an operator sequence, an RBS sequence, a spacer sequence, and a T7 RNA polymerase sequence located downstream of the spacer sequence downstream of the RBS. Its 5' end is as shown in SEQ ID NO.19, and the T7 RNA polymerase expression cassette sequence is as shown in SEQ ID NO.

83.

7. The preparation method according to claim 6, characterized in that, In step (1), the knockout is performed by using the CRISPR gene editing method or homologous recombination method for gene knockout / silencing, so as to down-regulate or remove the functions of related genes.

8. The preparation method according to claim 6, characterized in that In step (2), the overexpression is to integrate one or more of genes glmS, gna1, glnA, yqaB or icaC onto an exogenous plasmid and introduce it into an engineered bacterium for expression.

9. The preparation method according to claim 8, wherein In step (2), the plasmid is selected from any one or a combination of at least two of pETDuet, pCOLADuet, pRSFDuet, or pCDFDuet.

Citation Information

Patent Citations

  • T7 expression system-based Nissel 1917 engineering bacterium as well as preparation method and application of T7 expression system-based Nissel 1917 engineering bacterium

    CN118931930A

  • Production of GlcNAc-containing biological products in cells

    CN116249781A

  • Escherichia coli probiotic T7 expression system and application thereof

    CN116769814A

Cited By

  • Glucosamine-6 phosphate synthetase mutant and application thereof

    CN121065128A

  • Construction and application of escherichia coli for producing N-acetylglucosamine

    CN121674440A