Ammonia nitrogen assimilation bacterium and application thereof

Abstract

The invention belongs to the technical field of microorganisms and environmental governance and repair, and particularly relates to an ammonia nitrogen assimilation bacterium and application thereof. Specifically, research finds that the strain can metabolize ammonia nitrogen in an assimilation mode, nitrate and nitrite are not generated, nitrogen loss is not generated, and integrated removal of carbon, nitrogen and phosphorus nutrient substances can be achieved. Meanwhile, the strain has wider range of environmental adaptability, can effectively degrade ammonia nitrogen through a nitrogen assimilation approach even under the conditions of high salinity, low temperature and high ammonia nitrogen concentration, is simple to operate, low in price and environment-friendly, and shows that the nitrogen-containing wastewater is treated through the nitrogen assimilation approach, so that the nitrogen-containing wastewater treatment efficiency is greatly improved. The method not only can better recycle wastewater resources, but also has very good prospects in the aspects of environmental protection and sustainable development.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms and environmental governance and restoration, and specifically relates to an ammonia nitrogen assimilating bacterium and application thereof. Background Art

[0002] The information disclosed in this background technology section is only intended to enhance the understanding of the overall background of the invention, and should not necessarily be regarded as an admission or any form of suggestion that the information constitutes the prior art already known to a person skilled in the art.

[0003] In nature, nitrogen is an indispensable element for life, participating in the formation of proteins and nucleic acids, and playing a vital role in the health of ecosystems. However, when nitrogen enters water bodies at a rate that exceeds the purification capacity of nature, it will cause a series of ecological and environmental problems. The sources of nitrogen pollution are complex and diverse, including point source emissions and non-point source emissions. Point source emissions, such as direct emissions from sewage treatment plants and industrial enterprises, are relatively easy to regulate and control. Non-point source emissions, such as agricultural runoff and urban rainwater runoff, are more difficult to control because they involve a wide geographical area and multiple sources of pollution.

[0004] Excessive nitrogen nutrients can lead to eutrophication of water bodies, causing excessive growth of algae and phytoplankton. This excessive growth not only reduces the transparency of the water body, but also consumes a large amount of dissolved oxygen in the decomposition process after the algae die, causing hypoxia in the water body, which in turn affects the survival of other organisms in the water and even causes the death of a large number of fish and other aquatic organisms. The increase of nitrogen in the water body also promotes the growth of harmful algae, some of which can produce toxins that are toxic to humans and animals. These toxins can enter the human body through drinking water and the food chain, posing a serious threat to human health. In addition, nitrogen pollution can also destroy the ecological balance of water bodies and change biodiversity. The originally diverse aquatic ecosystem will become monotonous because some species have strong adaptability to eutrophic conditions. The excessive growth of these species will inhibit the growth of other species, and ultimately lead to the loss of biodiversity. Therefore, it is particularly important to develop effective nitrogen pollution control and treatment technologies. Among them, the use of microbial nitrogen assimilation technology to recover and reuse nitrogen in wastewater can not only reduce environmental pressure, but also achieve sustainable utilization of resources, which is of great significance for solving the problem of nitrogen pollution. Summary of the invention

[0005] Based on the above prior art, the present invention provides an ammonia nitrogen assimilating bacterium and its application. Specifically, the present invention screens a strain of Kunmingmonas stuzeri from a sludge sample, which degrades substrates through a nitrogen assimilation pathway, has not only a strong substrate degradation ability, but also a strong environmental adaptability, and while degrading ammonia nitrogen normally, no toxic byproducts are produced, providing an efficient strain resource for the degradation and recycling of ammonia nitrogen in wastewater, and has important theoretical and application value.

[0006] In order to achieve the above technical objectives, the present invention relates to the following technical solutions:

[0007] One aspect of the present invention provides a strain of Stutzerimonas kunmingensis B13, which was deposited in the China Center for Type Culture Collection (address: Wuhan University, Luojia Mountain, Wuchang, Wuhan City, Hubei Province) on May 15, 2024, and its biological collection number is CCTCC NO: M 2024948.

[0008] The second aspect of the present invention provides a microbial agent, which contains the above-mentioned Kunming Mononas stuzeri B13.

[0009] In another specific embodiment of the present invention, the microbial agent, in addition to the active ingredient, further contains a carrier, which can be a carrier commonly used in the field of microbial agents and is biologically inert.

[0010] Wherein, the carrier includes a liquid carrier or a solid carrier, and the solid carrier is one or more of ore, starch or polymer compound; the ore can be one or more of clay, talc, montmorillonite, zeolite, diatomaceous earth; the starch can be one or more of corn starch, potato starch, modified starch, pregelatinized starch; the polymer compound can be one or more of polyvinyl alcohol, polyglycol, Tween 80.

[0011] The liquid carrier can be an organic solvent, vegetable oil, mineral oil or water.

[0012] The dosage form of the bacterial agent can be a suspension, powder, granule, liquid, emulsion, etc.

[0013] As required, a surfactant, a binder, a stabilizer, a pH adjuster, etc. may be added to the bacterial agent.

[0014] The third aspect of the present invention provides the use of the above-mentioned Stutzerimonas kunmingensis B13 or microbial agent in any one or more of the following:

[0015] a) Ammonia nitrogen degradation;

[0016] b) Recycling of carbon, nitrogen and phosphorus nutrients;

[0017] c) Wastewater treatment;

[0018] d) Preparation of organic fertilizers;

[0019] e) Control of water eutrophication;

[0020] f) Water pollution remediation.

[0021] Wherein, in b), nitrogen recovery is carried out based on the nitrogen assimilation pathway;

[0022] In said f), the water body includes fresh water and sea water, preferably sea water.

[0023] A fourth aspect of the present invention provides a method for treating wastewater, the method comprising: applying the above-mentioned Stutzerimonas kunmingensis B13 and / or microbial agent to a wastewater environment.

[0024] Wherein, the wastewater includes salt-containing wastewater and / or ammonia nitrogen-containing wastewater, wherein the salinity of the wastewater may be no higher than 7%, such as 1%, 2%, 3%, 4%, 5%, 6% or 7%, and further may be 3-7%.

[0025] The ammonia nitrogen concentration in the wastewater may be no higher than 600 mg / L, such as 20, 50, 100, 200, 300, 400, 500 and 600 mg / L, and further may be 200-500 mg / L.

[0026] The temperature of the wastewater environment may be 10-40°C, further 15-37°C, with 30°C being most preferred.

[0027] The pH of the wastewater environment may be acidic, neutral or alkaline, further the pH is 4-11, further preferably the pH is 7-8.

[0028] Beneficial technical effects of one or more of the above technical solutions:

[0029] The above technical scheme obtained a strain of Stutzerimonas kunmingensis B13 with flocculation and nitrogen assimilation functions through screening and isolation. Studies have found that this strain can metabolize ammonia nitrogen by assimilation, does not produce nitrate and nitrite, does not cause nitrogen loss, and can achieve integrated removal of carbon, nitrogen and phosphorus nutrients.

[0030] At the same time, the strain has a wide range of environmental adaptability and can effectively degrade ammonia nitrogen through the nitrogen assimilation pathway even under conditions of high salinity, low temperature and high ammonia nitrogen concentration. It is simple to operate, low-cost and environmentally friendly, indicating that treating nitrogen-containing wastewater through the nitrogen assimilation pathway can not only better reuse wastewater resources, but also has very good prospects in environmental protection and sustainable development. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] The accompanying drawings in the specification, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0032] Figure 1 It is a colony morphology diagram of Stutzerimonas kunmingensis B13 in the present invention.

[0033] Figure 2 This is a graph showing the flocculation characteristics of Stutzerimonas kunmingensis B13 in the present invention.

[0034] Figure 3 It is the phylogenetic tree of Stutzerimonas kunmingensis B13 in the present invention.

[0035] Figure 4 It is a nitrogen balance analysis diagram of Stutzerimonas kunmingensis B13 in the present invention.

[0036] Figure 5 The graph shows the degradation characteristics of Stutzerimonas kunmingensis B13 to ammonia nitrogen at different concentrations.

[0037] Figure 6 It is the degradation characteristics of Stutzerimonas kunmingensis B13 in the present invention under different temperature conditions.

[0038] Figure 7 It is the degradation characteristics of Stutzerimonas kunmingensis B13 in the present invention under different pH conditions.

[0039] Figure 8The degradation characteristics of Stutzerimonas kunmingensis B13 in the present invention under different carbon-nitrogen ratios.

[0040] Fig. 9 The graph shows the degradation characteristics of Stutzerimonas kunmingensis B13 under different carbon source conditions.

[0041] Fig.10 The degradation characteristics of Stutzerimonas kunmingensis B13 in the present invention under different salinity conditions.

[0042] Fig.11 It is the degradation characteristic of Stutzerimonas kunmingensis B13 under optimal conditions in the present invention. DETAILED DESCRIPTION

[0043] It should be noted that the following detailed descriptions are exemplary and are intended to provide further explanation of the present invention. Unless otherwise specified, all technical and scientific terms used in the present invention have the same meanings as those commonly understood by those skilled in the art to which the present invention belongs.

[0044] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit the exemplary embodiments of the present invention. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should be understood that when the terms "comprising" and / or "including" are used in this specification, it indicates the presence of features, steps, operations, devices, components and / or combinations thereof.

[0045] In a typical embodiment of the present invention, a strain of Stutzerimonas kunmingensis B13 is provided, which has been deposited in the China Center for Type Culture Collection on May 15, 2024 (address: Wuhan University, Luojia Mountain, Wuchang, Wuhan City, Hubei Province), and its biological collection number is CCTCC NO: M2024948. The strain degrades the substrate through the nitrogen assimilation pathway, not only has a strong substrate degradation ability, but also has a strong environmental adaptability. While degrading ammonia nitrogen normally, no toxic by-products are produced, which provides an efficient strain resource for the degradation and recycling of ammonia nitrogen in wastewater, and has important theoretical and application value. The strain was identified as Stutzerimonas kunmingensis B13, which was Gram-negative and aerobic. After being cultured on the surface of LB solid medium for 1-2 days, the colonies were yellow-white, short rod-shaped, with wrinkles on the surface and irregular skirts on the edges. The 16S rRNA gene sequence was shown in SEQ ID NO.1.

[0046] Strain B13 was inoculated into nitrogen medium (NM) containing allylthiourea (ATU) blocker, and nitrogen balance analysis was performed by measuring the supernatant nitrogen in the culture medium, the intracellular nitrogen of the strain and the total nitrogen of the entire system. The results showed that ATU did not affect the degradation of ammonia nitrogen by the strain, and the supernatant nitrogen in the culture medium decreased, the intracellular nitrogen increased, and the total nitrogen remained unchanged, indicating that strain B13 degraded ammonia nitrogen by nitrogen assimilation pathway.

[0047] B13 was inoculated into NM medium with ammonia nitrogen as the only nitrogen source, and its degradation of ammonia nitrogen was investigated by changing the temperature, initial pH, salt concentration, carbon source and carbon-nitrogen ratio of the medium. It was found that strain B13 had the ability to degrade ammonia nitrogen when the temperature was 15-37°C, pH was 6-11, salt concentration was 1-6%, and carbon-nitrogen ratio was 5:1-30:1. This result shows that strain B13 has excellent environmental adaptability and good application potential.

[0048] Strain B13 was inoculated into NM culture medium with ammonium chloride as the sole nitrogen source. When the initial ammonia nitrogen concentration was in the range of 0-100 mg / L, the assimilation and degradation rate of ammonia nitrogen by strain B13 reached more than 90%. At 200, 300, 400 and 500 mg / L ammonia nitrogen, the assimilation effects were 50.5%, 39.3%, 14.5% and 8.6% respectively. The results showed that B13 had a wide range of ammonia nitrogen assimilation, providing bacterial resources for the degradation of ammonia nitrogen in wastewater containing ammonia nitrogen.

[0049] The strain B13 can assimilate and degrade 92.89% of ammonia nitrogen in wastewater within 24 hours in an NM culture medium with a temperature of 30°C, a pH of 7, a salt concentration of 3%, a carbon source of sodium acetate, a carbon-nitrogen ratio of 10:1, a rotation speed of 200 rpm, and an initial ammonia nitrogen concentration of 100 mg / L.

[0050] The present invention is further explained by the following examples, but it is not intended to limit the present invention. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. Wherein, the nitrogen medium (NM) formula is: sodium acetate 3500mg, KH2PO4 400mg, NH4Cl 390mg, trace elements 2mL (EDTA-Na 50g, MnCl2 5.1g, (NH4)2MoO4 1.1g, CoCl2 1.6g, CuSO4 1.6g, FeSO4 5.0g, CaCl2 5.5g, ZnSO4 2.2g, pH is adjusted to 7.2-7.5, distilled water is added to make up to 1L) distilled water is added to make up to 1L, and the pH is adjusted to 7.0.

[0051] Example

[0052] 1. Isolation and screening of ammonia nitrogen-degrading strain B13

[0053] Take an appropriate amount of sludge and add it to 100mL sterile saline. Shake it thoroughly at 30℃ and 200rpm for 1h. Dilute the treated sample, spread 100μL on solid LB culture medium after dilution, and then invert it in a 30℃ constant temperature incubator for culture. Observe it regularly. When colonies grow on the plate, pick a single colony on the plate, separate and purify it by streaking multiple times, pick the purified single colony, inoculate it in the pre-configured NM liquid culture medium containing 100mg / L ammonia nitrogen and 33mg / L ATU, and culture it in a shaker at 30℃ and 200rpm. Regularly detect the ammonia nitrogen concentration in the culture medium. If the ammonia nitrogen concentration decreases, it means that the strain has a degradation effect on ammonia nitrogen, and the degradation pathway is inferred by nitrogen balance analysis. Through the above method, a strain that degrades ammonia nitrogen by assimilation was successfully screened and named B13.

[0054] The LB medium formula is: peptone 10g, NaCl 10g, yeast powder 5g, distilled water is added to 1L, and the pH is adjusted to 7.0. Solid LB medium is liquid LB medium with 2% (g / v) agar powder added; solid NM medium is liquid NM medium with 2% (g / v) agar powder added; ATU is a blocking agent that can block the nitrification-denitrification pathway of the strain.

[0055] 2. Identification and biological characteristics of ammonia-nitrogen-degrading strain B13

[0056] The strain B13 was cultured on the surface of solid LB medium for 1 day. Microscopic observation showed that the colonies were short rod-shaped, yellow-white, opaque, with irregular skirts on the edges and wrinkles on the surface ( Figure 1 The strain was cultured in LB liquid medium for 24 hours, and it was found that the strain had good flocculation properties and could be completely flocculated to the bottom of the medium within 3 minutes ( Figure 2 ). Using the fresh bacterial culture of strain B13 as a template, the 16S rRNA gene sequence universal primers 27F and 1492R were used for amplification. The gene sequence of about 1400 bp was obtained by sequencing. The sequence was compared and analyzed in the EzBioCloud database (https: / / www.ezbiocloud.net) to construct a phylogenetic tree ( Figure 3 ), the results showed that strain B13 belonged to the genus Pseudomonas and had a 100% similarity to the strain Stutzerimonas kunmingensis, so it was named Stutzerimonas kunmingensis B13.

[0057] 3. Preparation of Seed Solution of Ammonia-Nitrogen-Degrading Strain B13

[0058] A single colony of the purified strain B13 was picked and inoculated into 100 mL of LB liquid culture medium, and cultured at 30° C. and 200 rpm with sufficient shaking until the logarithmic growth phase, and stored as seed liquid.

[0059] 4. Nitrogen Balance Analysis of Strain B13

[0060] The strain B13 seed liquid was inoculated with 10% inoculum into NM medium with an initial pH of 7, a salinity of 3%, sodium acetate as the sole carbon source and ammonium chloride as the sole nitrogen source, wherein the ammonia nitrogen content was 100 mg / L and the ATU was 33 mg / L, and cultured in a shaking incubator at 30°C and 200 rpm. An appropriate amount of sample was taken at regular intervals, and the ammonia nitrogen degradation amount was measured using the Nessler reagent colorimetric method. The results are as follows Figure 4 ATU could not block the degradation of ammonia nitrogen by strain B13, and the free nitrogen lost in the culture medium was basically converted into intracellular nitrogen. In addition, no nitrate nitrogen and nitrite nitrogen were produced, which proved that the degradation pathway of ammonia nitrogen by the strain was nitrogen assimilation pathway.

[0061] 5. Degradation characteristics of ammonia nitrogen-degrading strain B13 on different concentrations of ammonia nitrogen

[0062] The strain B13 seed liquid was inoculated with 10% inoculation volume to a pH of 7 in NM medium with ammonium chloride as the sole nitrogen source. Ammonia nitrogen was added to each treatment at a final concentration of 20, 50, 100, 200, 300, 400, 500 and 600 mg / L, respectively, and cultured in a shaking incubator at 30°C and 200 rpm. An appropriate amount of sample was taken at regular intervals, and the amount of ammonia nitrogen degradation was measured using the Nessler reagent colorimetric method. A curve of the amount of ammonia nitrogen degradation versus time was plotted with time as the horizontal axis and the amount of ammonia nitrogen degradation as the vertical axis, which was the degradation curve of ammonia nitrogen by strain B13. The results are shown in Figure 2. Figure 5 As shown, when the initial ammonia nitrogen concentration was 20, 50, and 100 mg / L, the strain B13 degraded ammonia nitrogen to a final concentration of 5.34, 5.52, and 10.15 mg / L, respectively, and the degradation rates were 94.66%, 94.48%, and 89.85%, respectively. When the initial ammonia nitrogen concentration was 200, 300, 400, and 500 mg / L, although the ammonia nitrogen could not be completely degraded, it was still able to degrade 49.77%, 38.0%, 14.74%, and 9.2% of the ammonia nitrogen, proving that the strain B13 has the application potential for degrading high-concentration ammonia nitrogen wastewater.

[0063] 6. Degradation characteristics of ammonia nitrogen-degrading strain B13 under different temperature conditions

[0064] The strain B13 seed liquid was inoculated with 10% inoculum to a pH of 7, with ammonium chloride as the only nitrogen source and a final ammonia nitrogen concentration of 100 mg / L in NM medium, and cultured at different temperatures (15°C, 25°C, 30°C and 37°C) with shaking at 200 rpm. An appropriate amount of sample was taken at regular intervals, and the amount of ammonia nitrogen degradation was measured using the Nessler reagent colorimetric method. A curve of the amount of ammonia nitrogen degradation versus time was plotted with time as the horizontal axis and the amount of ammonia nitrogen degradation as the vertical axis, which was the ammonia nitrogen degradation curve of strain B13. The results are shown in Figure 2. Figure 6 As shown, B13 can degrade ammonia nitrogen at temperatures of 15℃, 25℃, 30℃ and 37℃. At 30℃, the degradation rate of ammonia nitrogen by B13 reaches 3.13 mg / (L·h) within 24 hours, proving that its optimal degradation temperature is 30℃.

[0065] 7. Degradation characteristics of ammonia nitrogen-degrading strain B13 under different pH conditions

[0066] 10% of the strain B13 seed liquid was inoculated into NM medium with ammonium chloride as the sole nitrogen source and a final ammonia nitrogen concentration of 100 mg / L, and cultured at different pH values ​​(4, 5, 6, 7, 8, 9, 10, and 11) at 30°C and 200 rpm on a shaker. An appropriate amount of sample was taken at regular intervals, and the amount of ammonia nitrogen degradation was measured using the Nessler reagent colorimetric method. A curve of the amount of ammonia nitrogen degradation versus time was plotted with time as the horizontal axis and the amount of ammonia nitrogen degradation as the vertical axis, which was the degradation characteristic of strain B13 under different pH conditions. The results are shown in Figure 7 As shown, ammonia nitrogen can be degraded in the pH range of 4-11, and the degradation rates are 3.3%, 7.1%, 53.13%, 90.3%, 91.2%, 37.92%, 16% and 7.6% respectively. Considering that the pH of wastewater is mostly 7 when actually used in wastewater treatment, and the degradation rate of B13 under pH 7 and pH 8 is not much different, the strain B13 is suitable for wastewater treatment with a pH of 7.

[0067] 8. Degradation characteristics of strain B13 under different salinity conditions

[0068] 10% of strain B13 seed liquid was inoculated into NM medium at 30°C, pH 7, with ammonium chloride as the only nitrogen source and a final ammonia nitrogen concentration of 100 mg / L. The salinity was adjusted to 0%, 1%, 3%, 4%, 5%, 6%, and 7%, respectively, and the culture was shaken at 200 rpm. The degradation of ammonia nitrogen was measured using Nessler's reagent colorimetry. The curve of ammonia nitrogen degradation versus time was plotted with time as the horizontal axis and ammonia nitrogen degradation as the vertical axis, which is the degradation characteristic of strain B13 under different salinity conditions. The results are shown in Figure 8 As shown, in the salinity range of 0-7%, strain B13 has the ability to degrade ammonia nitrogen, and the ammonia nitrogen degradation rates are 6.3%, 61.8%, 86.7%, 79.1%, 72.2%, 24.4% and 3.2%, respectively. The optimal degradation salinity is 3%, and the final concentration of ammonia nitrogen can reach 14.31 mg / L.

[0069] 9. Degradation characteristics of ammonia nitrogen-degrading strain B13 under different carbon source conditions

[0070] 10% of the strain B13 seed liquid was inoculated into NM medium at 30°C, with a final ammonia nitrogen concentration of 100 mg / L and a pH of 7, and with ammonium chloride as the only nitrogen source. The medium was cultured on a shaker at 200 rpm under different carbon sources (glucose, sodium acetate, sodium propionate, sucrose and sodium carbonate). The degradation of ammonia nitrogen was measured using the Nessler reagent colorimetric method. The ammonia nitrogen degradation curve was plotted with time as the horizontal axis and the ammonia nitrogen degradation as the vertical axis, which was the degradation characteristics of the strain B13 under different carbon source conditions. The results are shown in Fig. 9 As shown in the figure, strain B13 has good degradation ability for ammonia nitrogen when sodium acetate and sodium propionate are used as carbon sources. When sodium acetate is used as carbon source, the degradation ability is the best, and the degradation rate of ammonia nitrogen within 48 hours is 3.68 mg / (L·h), and the degradation rate is 91.4%.

[0071] 10. Degradation characteristics of ammonia nitrogen-degrading strain B13 under different carbon-nitrogen ratios

[0072] The strain B13 seed liquid was inoculated with 10% to pH 7 in NM medium with ammonium chloride as the only nitrogen source, and cultured at different carbon-nitrogen ratios (5:1, 10:1, 15:1, 20:1, 25:1 and 30:1) at 30°C and 200rpm in a shaking table. The degradation of ammonia nitrogen was measured using the Nessler reagent colorimetric method. The change curve of ammonia nitrogen degradation over time was plotted with time as the horizontal axis and ammonia nitrogen degradation as the vertical axis, which is the degradation characteristics of strain B13 under different carbon-nitrogen ratios. The results are shown in Fig.10 As shown in the figure, when the inoculation amount is in the range of 5:1-30:1, strain B13 has a good ability to degrade ammonia nitrogen. When the carbon-nitrogen ratio is 5:1, the ammonia nitrogen degradation reaches 60 mg / L, but the ammonia nitrogen cannot be degraded any further. The reason may be that the carbon source is insufficient, causing the strain to be unable to synthesize and transform ammonia nitrogen. When the carbon-nitrogen ratio is 10:1, the degradation trend of ammonia nitrogen is stable and the rate is fast, making the final concentration of ammonia nitrogen 10.12 mg / L and the degradation rate 89.88%, proving that the optimal carbon-nitrogen ratio for strain B13 to degrade ammonia nitrogen is 10:1.

[0073] 11. Degradation characteristics of ammonia nitrogen-degrading strain B13 under optimal conditions

[0074] The strain B13 seed solution was inoculated with 10% inoculum into NM medium with an initial pH of 7, salinity of 3%, sodium acetate as the only carbon source, ammonium chloride as the only nitrogen source, carbon-nitrogen ratio of 10:1, and ammonia nitrogen content of 100 mg / L, and cultured at 30°C and 200 rpm in a shaking table. The amount of ammonia nitrogen degradation was measured using Nessler's reagent colorimetric method. The results are shown in Fig.11 As shown, when the ammonia nitrogen concentration was 100 mg / L, the ammonia nitrogen degradation rate of strain B13 was 3.83 mg / (L·h) within 24 hours, the degradation rate was 92.01%, and the final ammonia nitrogen concentration was 7.99 mg / L, which met the requirements of my country's "Pollutant Emission Standards for Aquatic Product Processing Industry" GB37 / 432-2006.

[0075] 12. Practical wastewater application of ammonia nitrogen degradation strain B13

[0076] There are often a variety of nitrogen compounds in industrial wastewater. The current traditional biological treatment methods are to convert these nitrogen compounds into nitrogen gas through biological means to achieve the nitrogen removal effect. However, nitrogen recovery through nitrogen assimilation is a more ideal sustainable wastewater treatment strategy. Through microbial assimilation, carbon, nitrogen and phosphorus in wastewater can be synergistically recovered and converted into biomass without causing nitrogen loss and accumulation of intermediate toxic nitrogen (nitrite nitrogen), which is beneficial to greenhouse gas emission reduction. In addition, the nitrogen in biomass can be reused as fertilizer, feed or industrial raw material in agriculture, aquaculture and industry.

[0077] This patent uses the flocculation characteristics of B13 to simulate seafood processing wastewater in an SBR sequencing batch reactor without adding sludge substrate to construct a microbial community system with B13 as the main body. In the reactor, B13 showed good growth and flocculation characteristics, and was able to degrade 70mg / L of ammonia nitrogen within an eight-hour cycle, showing great development potential in practical applications. (Simulated wastewater formula: 1820mg / L sodium acetate, 50mg / L potassium dihydrogen phosphate, 520mg / L ammonium chloride, 33g / L sea salt)

[0078] In summary, it can be seen that the nitrogen assimilation strain B13 has a wide range of environmental adaptability, and can effectively degrade ammonia nitrogen through the nitrogen assimilation pathway even under conditions of high salinity, low temperature and high ammonia nitrogen concentration. This shows that microorganisms treat nitrogen-containing wastewater through the nitrogen assimilation pathway, which can not only better reuse wastewater resources, but also has very good prospects in environmental protection and sustainable development.

[0079] Strain B13 16S rRNA gene sequence:

[0080] TGCAAGTCGAGCGGATGAGGAGGGCTTGCTCTCTGATTCAGCGGCGGACGGGTGA

[0081] GTAATGCCTAGGAATCTGCCTGATAGTGGGGGACAACGTTTCGAAAGGAACGCTAA

[0082] TACCGCATACGTCCTACGGGAGAAAGCAGGGGGACCTTCGGGCCTTGCGCTATCAGA

[0083] TGAGCCTAGGTCGGATTAGCTAGTTGGTGAGGTAACGGCTCACCAAGGCGACGATC

[0084] CGTAACTGGTCTGAGAGGATGATCAGTCACACTGGAACTGAGACACGGTCCAGACT

[0085] CCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCC

[0086] ATGCCGCGTGTGTGAAGAAGGTCTTCGGATTGTAAAGCACTTTAAGTTGGGAGGAA

[0087] GGGCATTAACCTAATACGTTAGTGTTTTGACGTTACCGACAGAATAAGCACCGGCTA

[0088] ACTTCGTGCCAGCAGCCGCGGTAATACGAAGGGTGCAAGCGTTAATCGGAATTACT

[0089] GGGCGTAAAGCGCGCGTAGGTGGTTTGTTAAGTTGAATGTGAAAGCCCCGGGCTCA

[0090] ACCTGGGAACTGCATCCAAAACTGGCAAGCTAGAGTATGGCAGAGGGTGGTGGAA

[0091] TTTCCTGTGTAGCGGTGAAATGCGTAGATATAGGAAGGAACACCAGTGGCGAAGGC

[0092] GACCACCTGGGCTAATACTGACACTGAGGTGCGAAAGCGTGGGGAGCAAACAGGA

[0093] TTAGATACCCTGGTAGTCCACGCCGTAAACGATGTCGACTAGCCGTTGGGATCCTTG

[0094] AGATCTTAGTGGCGCAGCTAACGCATTAAGTCGACCGCCTGGGGAGTACGGCCGCA

[0095] AGGTTAAAACTCAAATGAATTGACGGGGGCCCGCACAAGCGGTGGAGCATGTGGTT

[0096] TAATTCGAAGCAACGCGAAGAACCTTACCAGGCCTTGACATGCAGAGAACTTTCCA

[0097] GAGATGGATTGGTGCCTTCGGGAACTCTGACACAGGTGCTGCATGGCTGTCGTCAG

[0098] CTCGTGTCGTGAGATGTTGGGTTAAGTCCCGTAACGAGCGCAACCCTTGTCCTTAGT

[0099] TACCAGCACGTTAAGGTGGGCACTCTAAGGAGACTGCCGGTGACAAACCGGAGGA

[0100] AGGTGGGGATGACGTCAAGTCATCATGGCCCTTACGGCCTGGGCTACACACGTGCT

[0101] ACAATGGTCGGTACAAAGGGTTGCCAAGCCGCGAGGTGGAGCTAATCCCATAAAAC

[0102] CGATCGTAGTCCGGATCGCAGTCTGCAACTCGACTGCGTGAAGTCGGAATCGCTAG

[0103] TAATCGTGAATCAGAATGTCACGGTGAATACGTTCCCGGGCCTTGTACACACCGCCC

[0104] GTCACACCATGGGAGTGGGTTGCTCCAGAAGTAGCTAGTCTAACCTTCGGGGGGAC(SEQ ID NO.1)

[0105] Finally, it should be noted that the above is only a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the aforementioned embodiments, it is still possible for those skilled in the art to modify the technical solutions described in the aforementioned embodiments, or to perform equivalent replacements on parts thereof. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present invention should be included in the protection scope of the present invention. Although the above describes the specific implementation methods of the present invention, it is not intended to limit the protection scope of the present invention. Those skilled in the art should understand that, based on the technical solution of the present invention, various modifications or deformations that can be made by those skilled in the art without creative labor are still within the protection scope of the present invention.

Claims

1. A strain of Stutzerimonas kunmingensis B13, which was deposited in the China Center for Type Culture Collection on May 15, 2024, and its biological deposit number is CCTCC NO: M 2024948.

2. A microbial agent, characterized in that: The microbial agent comprises the Kunming Mononas stuzeri B13 described in claim 1.

3. The microbial agent according to claim 2, characterized in that The microbial agent contains a carrier.

4. Use of Stutzerimonas kunmingensis B13 according to claim 1 or the microbial agent according to any one of claims 2 to 3 in any one or more of the following: a) Ammonia nitrogen degradation; b) Recycling of carbon, nitrogen and phosphorus nutrients; c) Wastewater treatment; d) Preparation of organic fertilizers; e) Control of water eutrophication; f) Water pollution remediation.

5. The use according to claim 4, characterized in that In b), nitrogen recovery is carried out based on the nitrogen assimilation pathway.

6. The use according to claim 4, characterized in that In said f), the water body includes fresh water and sea water.

7. A method for treating wastewater, characterized in that: The method comprises: applying the Stutzerimonas kunmingensis B13 described in claim 1 and / or the microbial agent described in any one of claims 2-3 to a wastewater environment.

8. The method according to claim 7, characterized in that The wastewater includes saline wastewater and / or ammonia nitrogen-containing wastewater.

9. The method according to claim 7, characterized in that The temperature of the wastewater environment is 10-40°C, further 15-37°C, further 30°C.

10. The method according to claim 7, characterized in that The pH of the wastewater environment is acidic, neutral or alkaline, further the pH is 4-11, and further the pH is 7-8.

Images