Rice lateral flowerlet regulatory gene lf2, mutant gene thereof and application thereof

By identifying and utilizing the rice lateral floret regulatory gene LF2 and its mutant lf2, the problem of insufficient number of florets in rice spikelets in existing technologies has been solved, realizing the complete development of lateral florets and improving yield, and providing a basis for 'three-floret spikelet' breeding.

CN119432865BActive Publication Date: 2026-06-26SOUTHWEST UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202310964896.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-08-02
Publication Date
2026-06-26
Estimated Expiration
2043-08-02

AI Technical Summary

Technical Problem

Existing technologies cannot effectively increase rice yield by increasing the number of florets within rice spikelets. The gain-of-function mutant lf1 produces a high proportion of lateral florets, but the structure is incomplete and the florets are sterile, so it cannot be directly applied to the breeding of 'three-floret spikelets'.

Method used

We identified and mutated the rice lateral floret regulatory gene LF2 and its mutant gene. Through nucleotide and amino acid sequence analysis, we found that a single base substitution from T to A in the fourth intron of the LF2 gene led to mRNA splicing disorder and the formation of multiple transcripts. The controlling gene LF2 and its mutant lf2 expressed lateral florets in rice and contained complete floral organ structures.

Benefits of technology

It provides evidence for the 'triflorescence spikelet' hypothesis and breeding, increases the number of grains per spikelet, and improves rice yield. The mutant lf2 has elongated spikelet lemma, elongated lemma with palea, and lateral florets or spikelets are produced in the leaf axils of some spikelet lemma or lemma. The lateral florets contain normal floral organ structures such as palea, lemma, pistil, stigma, and stamen.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119432865B_ABST
    Figure CN119432865B_ABST
Patent Text Reader

Abstract

The present application relates to the technical field of plant genetic engineering, and specifically discloses a rice lateral small flower regulation gene LF2, a mutant gene thereof and application. The nucleotide sequence of the rice lateral small flower regulation gene LF2 is shown as SEQ ID No. 1, and the amino acid sequence of the encoded protein is shown as SEQ ID No. 2. The gene has an interaction relationship with OsNF-YA3, HAP3J, HAP5A, HAP5B, HAP5D, HAP5E, and regulates the development of rice glume by regulating the expression of G1. The mutant gene of the rice lateral small flower regulation gene LF2 is a single base substitution from T to A at the first base of the fourth intron of the LOC_Os07g44210 gene, which causes mRNA splicing disorder to form various new transcripts, and the transcript sequences are shown as SEQ ID Nos. 3-6. The rice lateral small flower regulation gene LF2 and the mutant gene thereof disclosed in the present application provide more evidence and basis for the "three-flower spikelet" hypothesis and "three-flower spikelet" breeding, and provide a new gene for breeding to increase the number of spike grains, which has very important significance for further improving the yield of rice.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, specifically to the rice lateral floret regulatory gene LF2 and its mutant genes and applications. Background Technology

[0002] Rice, as a model plant for monocotyledonous plant research and an important food crop, is the staple food for nearly half the world's population. Rice yield is mainly influenced by three factors: the number of effective panicles per unit area, the number of grains per panicle, and the thousand-grain weight. Among these, the number of grains per panicle is the key factor affecting rice yield. Currently, the main approaches to increasing the number of grains per panicle are to increase the number, length, and grain density of branches. Cloned yield-increasing genes such as Gn1a, DEP1, Ghd7, and OsSPL14 primarily increase rice yield by increasing the number of branches. In addition, the number of florets within the spikelet is also an important factor affecting rice yield. Normally, a rice spikelet contains only one normal floret and two pairs of glumes (glumes and paraglumes), ultimately forming one grain. In 1937, scientists proposed the "trifloret spikelet" hypothesis, suggesting that a rice spikelet may consist of three florets: one terminal and two lateral florets, with glumes being a remnant of the two lateral florets from evolutionary processes. Current research provides evidence for this hypothesis. Studies on genes such as EG1, EG2, G1, OsMADS34 / PAP2, ASP1, NSG1, and OsMADS1 / LHS1 have revealed that the lemma and glumes are homologous organs, possibly representing the gradually degenerating lemma of the lateral florets. The gain-of-function mutant lf1 develops a new lateral floret with internal floral organs between the lemma and the terminal floret, providing direct evidence for the "three-floret spikelet" hypothesis. Theoretically, this reveals the possibility of increasing the total number of grains per spikelet through increasing the number of florets within the spikelet. However, the gain-of-function mutant lf1 produces a high proportion of lateral florets, but their structure is incomplete and they cannot produce seeds; therefore, it cannot be directly applied to the breeding of "three-floret spikelets." Therefore, exploring more lateral floret mutants and their regulatory genes, deeply analyzing the molecular mechanism of "three-floret spikelet" formation, and using molecular design to "restore" lateral florets to normal fertile florets will significantly increase rice yield and will be of great significance in rice breeding research. Summary of the Invention

[0003] The purpose of this invention is to provide a rice lateral floret regulatory gene LF2, its mutant gene, and its applications.

[0004] To achieve the above objectives, the present invention provides the following technical solution:

[0005] This invention provides a rice lateral floret regulatory gene LF2, the nucleotide sequence of which is shown in SEQ ID No.1, and the amino acid sequence of the encoded protein is shown in SEQ ID No.2.

[0006] The present invention also provides the protein encoded by the rice lateral floret regulatory gene LF2, the amino acid sequence of which is shown in SEQ ID No. 2.

[0007] The present invention also provides the use of the above-mentioned rice lateral floret regulatory gene LF2 and the protein encoded by the above-mentioned rice lateral floret regulatory gene LF2 in improving rice yield.

[0008] This invention provides a mutant gene of the rice lateral floret regulatory gene LF2, which is a single base substitution from T to A in the first base of the fourth intron of the LOC_Os07g44210 gene, resulting in disordered mRNA splicing and the formation of multiple new transcripts, the transcript sequences of which are shown in SEQ ID No. 3-6.

[0009] The present invention also provides a transcript of the mutant gene of the above-mentioned rice lateral floret regulatory gene LF2, the transcript sequence of which is shown in SEQ ID No. 3-6.

[0010] The present invention also provides the use of the mutant gene of the rice lateral floret regulatory gene LF2 and the transcript of the mutant gene of the rice lateral floret regulatory gene LF2 in improving rice yield.

[0011] The beneficial effects of this invention are as follows: This invention discloses a gain-of-function mutant lf2. In the lf2 mutant, the spikelet lemma elongates, the lemma elongates and becomes lemma-like, and lateral florets or spikelets are produced in the leaf axils of some spikelet lemma or lemma. The lateral florets contain normal floral organ structures such as palea and lemma, pistil, stigma, and stamen. This invention also discloses the LF2 gene, which controls the lf2 mutant trait, and its mutant gene. The cDNA sequence of the LF2 gene is shown in SEQ ID No. 1, and the amino acid sequence encoding the protein is shown in SEQ ID No. 2. The mutant gene of the LF2 gene, LOC_Os07g44210, has a single base substitution from T to A in the first base of the fourth intron, and its transcript sequence is shown in SEQ ID Nos. 3-6. The mutant lf2, the mutant trait control gene LF2, and the LF2 mutant gene disclosed in this invention provide more evidence and basis for the "three-flower spikelet" hypothesis and "three-flower spikelet" breeding, and provide a new gene for breeding to increase the number of grains per spikelet, which is of great significance for further improving rice yield. Attached Figure Description

[0012] Figure 1Phenotypic analysis of type I spikelets of the lf2 mutant; where AB: wild-type spikelet; CF: surface structure of wild-type glumes, lemma, palea, and paraglomerates; G: paraffin section of wild-type spikelet cross-section; HI: type I spikelet of lf2; JL: surface structure of elongated glumes, palea-like glumes, and elongated paraglomerates of lf2 spikelets; M: paraffin section of lf2 spikelet cross-section; NQ: expression analysis of characteristic genes of palea and lemma. rg: paraglomerate; sl: glumes; le: lemma; pa: palea; st: stamen; pi: pistil; esl: elongated glumes; lesl: palea-like glumes; erg: elongated paraglomerates. Scale bar: AB and HI 1000 μm, CF and JL 100 μm, G and M 500 μm.

[0013] Figure 2 Phenotypic analysis of type II spikelets of the lf2 mutant; where AE: wild-type spikelet; FJ: lf2 spikelet with incomplete lateral florets developing from the axil of the glume; KO: lf2 spikelet with complete lateral florets / spikes developing from the axil of the glume; PT: lf2 spikelet with lateral florets / spikes developing from the axil of the secondary glume. rg: secondary glume; sl: glume; le: lemma; pa: palea; lo: stigma; st: stamen; pi: pistil; tf: terminal floret; lf: lateral floret; ls: lateral spikelet; scale bar: 500 μm for figures E, J, O and T, 1000 μm for the rest.

[0014] Figure 3 For the analysis of floral organ characteristics of lateral florets, AB: stereomicroscopic observation of floral organs of wild-type florets and mutant lateral florets; CF: histological observation of floral organs of wild-type florets and mutant lateral florets; GH: pollen fertility detection of wild-type and lf2 mutant; I: expression analysis of floral organ characteristic genes in wild-type glumes, terminal florets and lf2 lateral florets; scale bar: AB = 1000 μm, CF = 500 μm, GH = 200 μm.

[0015] Figure 4 Scanning electron microscopy observations of early spikelets in wild-type and lf2 mutant strains; where AC: wild-type spikelet; DF: lf2 type I spikelet; GI: lf2 type II spikelet with lateral florets developing from the axil of the glumes; JL: lf2 type II spikelet with lateral florets developing from the axil of the secondary glumes; A, G, and J represent Sp3-4 stages; B, H, and K represent Sp5-6 stages; C, I, and L represent Sp7-8 stages. rg: secondary glumes; sl: glumes; le: lemma; pa: palea; lf: lateral florets; scale bar = 100 μm.

[0016] Figure 5Expression patterns of the meristematic characteristic genes OSH1 and OsMADS15 in wild-type and lf2 mutants were analyzed. AB: OSH1 gene expression analysis in wild-type and lf2 spikelets; CD: OsMADS15 gene expression analysis in wild-type and lf2 spikelets; black arrows indicate lateral floral meristems. fm: floral meristem; pi: pistil; lo: sclerotium; scale bar = 100 μm.

[0017] Figure 6 Map-based cloning of the LF2 gene; where A: location and mutation sites of the LF2 gene; B: transcript analysis of wild-type and lf2 mutants.

[0018] Figure 7 For the identification and phenotypic observation of complementary plants; where A: schematic diagram of complementary vector; B: sequencing peak diagram of endogenous mutation sites; C: GFP fluorescence observation of transgenic plants; D: phenotypic analysis of transgenic plants, scale bar = 1000μm.

[0019] Figure 8 To validate the CRISPR-Cas9 knockout of the LF2 gene; where A: LF2 gene editing site and effect; B: LF2 gene expression analysis in transgenic plants; C: phenotypic analysis of transgenic plants; scale bar = 1000 μm.

[0020] Figure 9 For the overexpression analysis of the LF2 gene; where A: qPCR analysis of the LF2 gene in overexpressing plants; B: spikelet phenotype of overexpressing plants; scale bar = 1000 μm.

[0021] Figure 10 The expression pattern of the LF2 gene was analyzed; where A: expression of the LF2 gene in various tissues of rice; B: in situ hybridization analysis of the LF2 gene; scale bar: BC is 500 μm, DI is 100 μm.

[0022] Figure 11 For the sequence and structure analysis of LF2 protein; where A: schematic diagram of LF2 protein domains; B: sequence analysis of LF2 homologous proteins in different species.

[0023] Figure 12 Phylogenetic analysis of the LF2 gene.

[0024] Figure 13 Subcellular localization of LF2 protein; where A: observation of fluorescence signal in LF2 overexpressing plants; B: subcellular localization of LF2 protein in rice protoplasts; scale bar = 50 μm.

[0025] Figure 14This study analyzed the transcriptional activity of the LF2 protein; A: LF2 protein self-activation detection; B: LF2 protein transcriptional activity detection using a dual-luciferase system.

[0026] Figure 15 Screening for LF2-interacting proteins in cDNA libraries; A: Screening results of rice transcription factor libraries; B: Yeast two-hybrid interaction verification, 53+T7-T: pGBKT7-53+pGADT7-T as a positive control, 53+lam: pGBKT7-53+pGADT7-lam as a negative control; C: BiFC verification of LF2-HAP2H interaction; Scale bar = 50 μm.

[0027] Figure 16 Phenotypic analysis of OsNF-YA3 knockout plants.

[0028] Figure 17 The interaction between LF2 protein and rice nuclear factors was screened; 53+T7-T: pGBKT7-53+pGADT7-T served as a positive control, and 53+lam: pGBKT7-53+pGADT7-lam served as a negative control.

[0029] Figure 18 For lf2 transcriptome sequencing analysis; where A: transcriptome sequencing differential gene enrichment; B: differential gene qPCR validation.

[0030] Figure 19 GO and KEGG analyses were performed on the transcriptome data; where A: GO enrichment analysis; B: KEGG analysis.

[0031] Figure 20 The analysis included gene expression analysis related to the auxin signaling pathway; specifically, A: auxin content determination in wild-type and lf2 mutants; B: auxin synthesis gene expression analysis; C: auxin transport-related gene expression analysis; D: auxin response inhibitory factor expression analysis; and E: auxin response factor expression analysis.

[0032] Figure 21 For the binding analysis of LF2 and G1; where A: G1 expression analysis in lf2; B: detection of H3K27me3 level of G1 gene; C: phenotypic analysis of g1+lf2 double mutant; scale bar = 1000μm. Detailed Implementation

[0033] The technical solution of the present invention will be further described in detail below with reference to specific embodiments. It should be noted that the experimental materials used in the embodiments of the present invention are all commercially available. Experimental methods not specifying specific conditions in the embodiments of the present invention are generally performed under conventional conditions or according to the conditions recommended by the experimental material manufacturers. The specific descriptions of the experimental materials involved in the present invention are as follows:

[0034] 1.1 Plant materials

[0035] In this invention, the lateral flower development mutant lf2 and the wild-type maintainer line indica rice Xida 1B were both derived from the Rice Research Institute of Southwest University. The lateral flower development mutant lf2 was obtained by mutagenesis of the maintainer line indica rice Xida 1B (Oryza sativa L. ssp. indica) using ethyl methane sulfonate (EMS). The mutant trait of lf2 was stably inherited after multiple generations of self-pollination. The maintainer line indica rice Xida 1B was used as a wild-type control for mutant trait investigation and other related experiments. All rice materials used in this invention were cultivated at the Xiema planting base of the Rice Research Institute of Southwest University in Chongqing.

[0036] 1.2 Main strains and carriers

[0037] The strains involved in this invention mainly include Escherichia coli strain DH5α, Agrobacterium tumefaciens strain GV3101, and Y2HGold strain used in the GAL4 system yeast double-hybrid experiment, all of which were provided by the Rice Research Institute of the College of Agronomy and Biotechnology, Southwest University. The vectors involved mainly include: the TA cloning vector PMD19-T purchased from TaKaRa Biotechnology Co., Ltd. (Dalian); the plant expression vectors pCAMBIA1301-GFP(S65T)-NOS, pCAMBIA1300-2X35S-GFP-NOS, pCAMBIA1300-GFP-NOS, the subcellular localization vector pAN580, and the yeast two-hybrid expression vectors pGBKT7 and pGADT7, which were preserved and used by the Rice Research Institute of the College of Agronomy and Biotechnology, Southwest University; the bimolecular fluorescent complementary (BiFC) vectors pSCYNE and pSCYCE, which were donated by Professor Luo Keming's laboratory of the College of Life Sciences, Southwest University; and the dual-luciferase reporter vector CaMV35S-Ω-GAL4BD-NOS, which was donated by Qian Qian's laboratory of the China National Rice Research Institute.

[0038] 1.3 Reagent Kit

[0039] The plasmid miniprep kit, endotoxin-free medium-volume plasmid extraction kit, and universal gel DNA recovery kit involved in this invention were purchased from Beijing Tiangen Biotech Co., Ltd.; the plant total RNA extraction kit and dual-luciferase assay kit were purchased from Beijing Promega Biotechnology Co., Ltd.; the reverse transcription kit and quantitative fluorescence kit were purchased from TaKaRa Biotechnology Co., Ltd.; the DNA cleaning and recovery kit was purchased from AXYGEN Biotechnology Co., Ltd.; the digoxigenin RNA labeling (SP6 / T7) kit and digoxigenin detection kit were purchased from Roche GmbH, Germany; and the plant chromatin extraction and immunoprecipitation (ChIP) kit was purchased from Beijing Qiweiyicheng Technology Co., Ltd.

[0040] 1.4 Various enzymes and molecular biology reagents

[0041] The high-fidelity enzymes KOD FX and KOD FX neo involved in this invention were purchased from Toyobo Biotechnology Co., Ltd. (Japan). The high-fidelity enzyme PrimerStar MAX, various restriction endonucleases, DNase I digestive enzyme, and T4 rapid ligase were purchased from TaKaRa Biotechnology Co., Ltd. EasyTaq enzyme and seamless cloning recombinase t for conventional PCR amplification were purchased from Beijing TransGen Biotech Co., Ltd. The antibody anti-H3K27me3 used in the ChIP experiment was purchased from Abcom Biotechnology Co., Ltd. (USA), and anti-LF2 was synthesized by Shanghai Youke Biotechnology Co., Ltd. Tryptone, peptone, sodium chloride, yeast extract, glucose, and agar powder used in the preparation of various culture media; various antibiotics and molecular biology reagents such as CTAB and Tris-HCl were purchased from Sangon Biotech (Shanghai) Co., Ltd.; xylene, formaldehyde, anhydrous ethanol, and other reagents were purchased from Chengdu Kelong Chemical Reagent Factory; and solid and liquid reagents related to in situ hybridization and protoplast extraction experiments were purchased from Sigma-Aldrich (USA).

[0042] 1.5 Primers involved in this invention

[0043] 1.5.1 Gene localization primers

[0044]

[0045] 1.5.2 Candidate gene sequencing primers

[0046]

[0047]

[0048] 1.5.3 Construction of complementary vectors and primers for genetic transformation

[0049]

[0050] 1.5.4 Construction of Overexpression Vectors and Transformation Primers

[0051]

[0052] 1.5.5 Primers for gene expression analysis (qPCR)

[0053]

[0054]

[0055]

[0056] 1.5.6 In situ hybridization primers

[0057]

[0058] 1.5.7 Subcellular localization primers

[0059]

[0060] 1.5.8 Yeast Two-Hybrid Primers

[0061]

[0062]

[0063] 1.5.9 Primers for bimolecular fluorescence complementation experiments

[0064]

[0065] 1.5.10 Primers for Dual-Luciferase Reporter Assay

[0066]

[0067] Example 1: Obtaining and Phenotypic Analysis of the lf2 Mutant

[0068] Using ethyl methanesulfonate (EMS) to induce the development of the indica rice maintainer line Xida 1B, a genetically stable lateral floret development mutant was discovered and named lf2. The gene regulating the lateral floret mutant trait was named LF2. Compared with the wild type, this mutant develops only one floret containing four whorls of floral organs on the spikelet. In the mutant, the secondary glumes of the spikelet are elongated, the glumes are elongated and the lemma is transformed, and lateral florets or lateral spikelets are produced in the leaf axils of some secondary glumes or glumes. The lateral florets contain normal floral organ structures such as palea, lemma, pistil, sclerotium, and stamen.

[0069] In wild-type rice, a single spikelet contains a terminal floret, below which are a pair of glumes and a pair of accessory glumes. The terminal floret consists of four whorls of floral organs: palea, lemma, sclerotia, stamens, and pistil. The palea and lemma are similar in shape and closed together, enclosing the three whorls of floral organs inside. Two lung-shaped, transparent sclerotia are located on one side of the lemma, and six stamens grow around the central pistil. Figure 1 (AB). The palea and lemma are relatively hard, with silicified cells and numerous burrs on the surface. The palea, unlike the lemma, also contains a smooth, transparent edge structure. Figure 1 (DE). The glumes are located on both sides of the base of the terminal floret and are two transparent, thin, plate-like organs with a very smooth surface, lacking silicified cells. Figure 1 C). The secondary gleam is extremely degenerated and located below the gleam, with a rough surface structure covered with burrs and pores. Figure 1 F).

[0070] During the vegetative growth stage, the lf2 mutant showed no significant difference from the wild-type plant. During the reproductive growth stage, the spikelet development of the lf2 mutant exhibited obvious defects, and its phenotype was mainly divided into two categories: elongation of the glumes and lemma (Category I) and formation of lateral florets (Category II).

[0071] In type I spikelets, the secondary glumes are significantly elongated, and their surface, like that of the wild-type secondary glumes, is covered with numerous bristles and stomata. Figure 1 HI, L), the glumes showed varying degrees of elongation, and a large number of silicified cells appeared on the surface ( Figure 1 (HK), some glumes are consistent with the palea in morphology, size, and degree of silicification. Histological analysis revealed that the wild-type palea contains 5 vascular bundles, and the palea contains 3 vascular bundles. Both the palea and the palea contain four layers of cell structure, including silicified upper epidermal cells, sclerenchyma cells, parenchyma cells, and unsilicified lower epidermal cells. The edge of the palea is mainly composed of parenchyma cells and a small number of sclerenchyma cells. The glumes contain a large number of parenchyma cells and only one vascular bundle. Figure 1 In type I spikelets, the lemma develops a four-layered cell structure consistent with the lemma. Figure 1 In addition, expression analysis of the glume characteristic gene OsMADS34 and the palea and lemma characteristic genes OsMADS1, OsMADS6, and DL in different glumes and palea revealed that the expression patterns of these genes in the unelongated glumes of lf2 were basically consistent with those in wild-type glumes. In elongated glumes, the expression of OsMADS34 was significantly reduced, while OsMADS6 and DL were almost not expressed or expressed at very low levels, consistent with wild-type glumes. However, in palea glumes, the expression level of OsMADS34 was significantly reduced, and there was extremely strong ectopic expression of the palea characteristic gene DL, while the palea characteristic gene OsMADS6 was not expressed. Figure 1The above results indicate that in the lf2 mutant, the lemma feature is transformed into the palea to varying degrees.

[0072] In type II spikelets, the terminal floret contains morphologically and numerically complete palea and lemma, stigmas, stamens, pistils, and other organs; in a few cases, the gleynium elongates. Figure 2 Unlike wild-type mature pollen grains, lf2 pollen grains cannot be stained in iodine–potassium iodide (I2–KI) solution, exhibiting sterility. Figure 3 , GH). Compared to the wild type, 17.6% of lf2 spikelets developed lateral florets / spikes ( Figure 3 In these lf2 spikelets, most spikelets develop lateral florets containing partial floral organs (lacking lemma) or complete lateral florets in the axil of the inferior glume. Figure 2 ,FM), some spikelet lemma axils develop spikelet-like organs, including lemma organs and tissues similar to early, tender spikelets ( Figure 2 (NO), and in a very small number of lf2 spikelets develop lateral florets in the axil of the secondary glume, usually accompanied by elongation of the glume and the other secondary glume, or even lateral florets / spikelets developing simultaneously in the axils of both the glume and the secondary glume. Figure 2 (RT). In the lateral florets, morphological and histological observations revealed that the various floral organs, such as the palea, stigmas, stamens, and pistils, were consistent with the wild type in morphology and cellular structure, but their numbers were usually reduced compared to the wild type. For example, the palea was absent, and the number of stamens was only 2-5. Figure 3 , AF). Further qPCR analysis was conducted to detect the expression levels of relevant floral organ characteristic genes, including the lemma characteristic gene OsMADS1, the lemma and stamen characteristic genes OsMADS2, OsMADS4, and OsMADS16, the palea characteristic gene OsMADS6, the lemma and carpel characteristic gene DL, the stamen and carpel characteristic genes OsMADS3 and OsMADS58, and the ovule characteristic gene OsMADS13, in wild-type glumes, terminal florets, and lf2 lateral florets. The results showed that these genes were highly expressed in lateral florets, while they were almost not expressed in glumes, indicating that the lateral florets developed from the lf2 mutant possess complete floral organ characteristics. Figure 3 I).

[0073] Early spikelet development in wild-type and mutant plants was observed using scanning electron microscopy (SEM). In the wild type, the spikelet primordium first differentiates into paraglomerular primordia and glumes, which then transform into floral meristems. From Sp3 to Sp8, primordia of floral organs such as the lemma, palea, lemma segments, stamens, and pistil (including ovules and carpels) differentiate sequentially. By Sp8, the palea primordium and lemma primordium close together. Figure 4In the type I spikelets of the lf2 mutant, the development of the lemma primordia was significantly accelerated, and the development of some lemma primordia was similar to that of the lemma primordia, with their size and shape being very similar to those of the lemma primordia. Figure 4 DF). In the type II spikelets of the lf2 mutant, additional lateral meristems were observed in the axils of the glumes or paraglumes starting from approximately Sp4 stage. These meristems gradually differentiated into various internal floral organ primordia as the spikelet development progressed. However, the lateral florets were significantly smaller than the terminal florets, and the development of each floral organ primordium lagged behind that of the terminal florets and wild-type floral organ primordia by 1-2 stages. Figure 4 In addition, some lf2 spikelets differentiate into lateral meristems in the axils of the secondary glume primordia and gradually differentiate into complete internal floral organ primordia. The development process of each organ primordia lags behind that of the terminal floret and wild-type floral organ primordia by 2-3 periods. Figure 4 The results showed that the development process of the spikelet lemma primordium in the lf2 mutant was similar to that of the lemma primordium, and lateral floral meristems differentiated from the early spikelet development, which was consistent with the spikelet phenotype at maturity.

[0074] Further in situ hybridization analysis was conducted to examine the expression of meristem characteristic genes OSH1 and OsMADS15 in wild-type and lf2 young spikelets. The results showed that the OSH1 gene was strongly expressed in the wild-type spikelet meristem. Figure 5 (A1-A2), when the pistil primordium forms, the expression of the OSH1 gene is significantly reduced ( Figure 5 (A3-A4). In the terminal florets of the lf2 mutant, the expression pattern of the OSH1 gene was consistent with that of the wild-type spikelet, while from the Sp4 stage onwards, a significant OSH1 expression signal was detected at the glume primordia. Figure 3-5 OsMADS15 is strongly expressed in wild-type floral meristems, and its expression increases with the differentiation of floral organ primordia, particularly in primordia of sclerotia, pistils, and other floral organs. Figure 5 (C1-C4). In the lf2 mutant, OsMADS15 is strongly expressed in the meristems of both terminal and lateral flowers. Figure 5 (D1-D4). The above results indicate that the ectopic expression of the OSH1 and OsMADS15 genes induced the formation of lateral florets in the lf2 mutant.

[0075] Example 2: Gene identification of the LF2 gene

[0076] 1. Gene localization and candidate gene sequencing analysis of the LF2 gene

[0077] The LF2 gene was located using map-based cloning, between SSR markers R-20 and R-39 on the long arm of chromosome 7, a physical distance of approximately 180 kb. Figure 6 (A). This interval contains 31 annotated genes, including eight expressed proteins, four putative proteins, three cytochrome proteins, two MYB proteins, two transposon proteins, one transcription factor, one SNF2 family transcription factor, and some functional proteins (Table 1). No genes that regulate rice flower / panicle development have been reported.

[0078] Sequencing analysis of genes within the region revealed that in the lf2 mutant, a single base substitution from T to A occurred at the first base of the fourth intron of the LOC_Os07g44210 gene, leading to disordered mRNA splicing and the formation of multiple new transcripts. Figure 6 B, the transcript sequence is shown in SEQ ID No. 3-6), leading to severe changes in protein function. According to the annotation information provided on the website, the LOC_Os07g44210 gene contains 24 exons, with a full-length genomic sequence of 12318 bp and a full-length cDNA of 2244 bp (sequence shown in SEQ ID No. 1), encoding a protein containing 747 amino acids (sequence shown in SEQ ID No. 2). Therefore, the LOC_Os07g44210 gene is positioned as a candidate gene for the LF2 gene.

[0079] Table 1 Gene annotation information within the localization interval

[0080]

[0081] 2. Transgenic verification of the LF2 gene

[0082] 2.1 Complementarity Verification

[0083] Construct a complementary vector for the LOC_Os07g44210 gene (including a 2995-bp promoter and a full-length CDS sequence) fused with GFP. Figure 7 (A). Since the lf2 mutant is sterile, the complementary vector was transformed into callus induced by lf2 heterozygous seeds using Agrobacterium infection, resulting in 25 transgenic plants, which were planted at the Xiema planting base of the Rice Research Institute of Southwest University. Individual DNA was extracted from the plants as they grew, and exogenous GFP amplification primers were designed for amplification. The results showed that all transgenic plants were positive. Further analysis was conducted using specific primers for the endogenous LF2 gene (containing the mutation site), followed by sequencing analysis of the amplified fragments. GFP fluorescence signals in the transgenic plants were also observed. The results showed that 7 plants contained heterozygous mutation sites and had normal phenotypes, 4 plants contained homozygous lf2 mutation sites (3 of which had phenotypes consistent with wild type), and 1 plant exhibited a mutant phenotype. Figure 7(B, D), the remaining plants all contained wild-type sites and had normal phenotypes. Furthermore, obvious GFP fluorescence signals were observed in all 11 transgenic plants containing homozygous / heterozygous mutant sites. Figure 7 The results (C) indicate that the introduction of the complete CDS sequence of the LOC_Os07g44210 gene can restore the lf2 mutant phenotype, meaning that the LOC_Os07g44210 gene is the LF2 gene.

[0084] 2.2 CRISPR-Cas9 Knockout Verification

[0085] The LOC_Os07g44210 genome sequence was analyzed on the CRISPR-P website, and two editing target sites (a: TGATCCGTTGGGTACAAGGA; b: CCAGGAGTCTTGCTTCGGCA) were designed on the first exon. The knockout vector was constructed by Wuhan Boyuan Biotechnology Co., Ltd. and transformed into the japonica rice variety ZH11, resulting in 16 transgenic plants. Genome sequence analysis of the transgenic plants showed that 10 lines exhibited editing effects. At site a, short fragment deletions of T bases or GATCCGT or CTGAATCCCATGATCCGTTGGGTACAA occurred, while at site b, deletions of G bases or TTCG occurred. Figure 8 RNA was extracted from the plants, and two pairs of primers were designed to detect the expression of the LF2 gene. The results showed that the expression level of the LF2 gene in Cas9 knockout plants was significantly lower than that in wild-type plants. Figure 8 Phenotypic observation of transgenic plants with editing effects during flowering revealed that some plants showed no significant difference in spikelet morphology from the wild type, but their fertility was significantly reduced. Additionally, five lines exhibited various abnormal spikelet developmental characteristics similar to the lf2 mutant, such as elongated / lemma-like glumes, degenerated palea, and formation of lateral florets. Figure 8 The above results further prove that LOC_Os07g44210 is the LF2 gene.

[0086] 2.3 Overexpression Analysis

[0087] Using wild-type plant cDNA as a template, the CDS sequence of the LOC_Os07g44210 gene was amplified and fused with GFP to form a fusion protein. The LF2-GFP fusion protein was then transformed into japonica rice ZH11 callus using the 2×35S promoter, resulting in 10 overexpressing plants, which were then planted at the Xiema Base of the Southwest University Rice Research Institute. After the plants matured, RNA was extracted from single-plant tissues for expression analysis. In these plants, the expression level of the LOC_Os07g44210 gene was significantly increased. Figure 9(A). However, the spikelets of the overexpressing plants were identical to those of the wild-type spikelets throughout their growth and development. When the seeds from the harvested transgenic plants were planted again the following year, the spikelets of the overexpressing plants still showed no significant difference from those of the wild-type, indicating that the overexpression of the LOC_Os07g44210 gene did not cause abnormal development in the rice plants. Figure 9 B).

[0088] Example 3: Analysis of LF2 gene expression patterns

[0089] To investigate the function of the LF2 gene, its expression pattern was analyzed. First, qPCR was used to detect the expression of the LF2 gene in different tissues. The results showed that LF2 gene expression was relatively low in roots, but strong in other tissues such as leaves, sheaths, buds, and inflorescences. Furthermore, expression in inflorescences gradually decreased with growth and development. Among the spikelet organs, the LF2 gene was extremely strongly expressed primarily in the glumes, and expressed relatively weakly in other whorls of floral organs. Figure 10 Further in situ hybridization was used to detect the expression of the LF2 gene in the inflorescence and various floral organs, revealing a strong LF2 expression signal, especially in the spikelet meristem and floral meristem. Figure 10 (BD), with the differentiation and development of various organs, obvious LF2 expression signals were detected in the paraglomerates, glumes, and various floral organs. Figure 10 (EI). The above results indicate that the LF2 gene is a non-specific expression gene, with high expression in both vegetative reproduction and reproductive growth organs.

[0090] Example 4: The LF2 gene encodes a chromatin remodeling factor located in the cell nucleus.

[0091] 1. Phylogenetic tree and protein sequence analysis of LF2 protein

[0092] The LF2 gene encodes an SNF2 family chromatin remodeling factor, belonging to the SMARCAL1 subfamily (Hu et al., 2013). The SMART protein analysis website predicts that the LF2 protein contains a DEXDc domain and a HELECc domain. Figure 11 (A) The DEXDc and HeLECc domains contain ATP-binding sites, enabling them to bind and hydrolyze ATP to release energy. In addition, the HeLECc domain contains nucleic acid-binding sites, allowing it to bind to target gene sequences and influence transcriptional activation or repression. LF2 and its homologs in different species all contain both DEXDc and HeLECc domains, and the protein sequences, especially the portions containing these two domains, exhibit extremely high conservation, showing over 70% similarity. Figure 11 B).

[0093] Previous studies have identified 41 SNF2 family chromatin remodeling factors in Arabidopsis thaliana, which can be divided into 18 subfamilies. These proteins play important roles in plant development regulation, stress response, and epigenetics (Knizewski et al., 2008). According to information listed in the chromDB database, rice contains 42 SNF2 family chromatin remodeling factors, among which the SMARCAL1 subfamily includes two members, LF2 and CHR726 (LOC_Os07g40730), which are homologous to AtCHR18 and AtCHR14 in Arabidopsis thaliana, respectively (Hu et al., 2013). Further phylogenetic analysis of LF2 homologous genes from different species showed that LF2 proteins have high homology, and LF2 and CHR726 form independent branches with their respective homologous proteins. Furthermore, LF2 homologous proteins from monocots and dicots each form a small branch. Within the monocotyledonous clade, a smaller branch is formed from proteins derived from grasses such as rice, maize, sorghum, wheat, and *Brucea diplospalum*, indicating a closer phylogenetic relationship. Figure 12 ).

[0094] 2. Subcellular localization of LF2 protein

[0095] To clarify the cellular localization of the LF2 protein, young spikelets from LF2-overexpressing plants were first observed under a ZEISS LSM800 confocal microscope to examine the fluorescence of the LF2-GFP fusion protein. The results showed a strong fluorescent signal in the young spikelets, specifically accumulating within the cell nucleus. Figure 13 (A) Further verification of the subcellular localization of the LF2 protein was conducted by transiently expressing the LF2-GFP fusion protein in rice protoplasts. Rice protoplasts were transiently transformed with the empty pAN580-GFP vector and the pAN580-LF2-GFP fusion expression vector, respectively. After culture, the fluorescence signal in the protoplasts was observed under a ZEISS LSM 800 confocal microscope. The results showed that in the pAN580-GFP control, strong green fluorescence signals were observed in all parts of the cell (except vacuoles), while in cells expressing the LF2-GFP fusion protein, only the nucleus showed a significant fluorescence signal. Figure 13 The results above indicate that the LF2 protein is located in the cell nucleus.

[0096] 3. Transcriptional activity analysis of LF2 protein

[0097] The transcriptional activity of LF2 protein was detected using a dual-luciferase reporter gene system in yeast. First, the pGBKT7-LF2 expression vector was constructed. pGBKT7-LF1 (LF1 protein is known to have self-activation activity) was used as a positive control, and the empty pGBKT7 vector as a negative control. Both the pGBKT7-LF1 and pGBKT7-LF2 fusion expression vectors were transformed into Y2HGold yeast cells. The self-activation activity of LF2 protein was verified using SD / -Trp and SD / -Trp-His-Ade deficient media. The results showed that yeast cells transformed with pGBKT7-LF1 could grow on both SD / -Trp and SD / -Trp-His-Ade media. Yeast cells transformed with both the empty pGBKT7 vector and the pGBKT7-LF2 fusion vector grew normally on the media but not on SD / -Trp-His-Ade media, indicating that LF2 protein does not have self-activation activity. Figure 14 Next, the transcriptional activity of the dual luciferase (LUC) reporter gene was further investigated (the LUC gene has 5 copies of binding sites that can act on GAL4), and the activity of LUC in rice protoplasts was detected. The LF2 cDNA was fused with the GAL4 DNA-binding domain (BD), driven by the 35S promoter of cauliflower mosaic virus. The transcription activator VP16 was used as a positive control, and GAL4-BD as a negative control (Ren et al., 2016). GAL4BD-VP16, GAL4BD-LF2, and GAL4-BD effectors were transiently expressed in rice protoplasts. The results showed that the positive control GAL4BD-VP16 had strong luciferase activity (Firefly / Rellinaratio), and the luciferase activity of GAL4BD-LF2 protein was slightly higher than that of the negative control GAL4BD, but the difference in activity was not significant, further indicating that the LF2 protein does not have significant transcriptional activation activity. Figure 14 B).

[0098] Screening and validation of 5 LF2 interacting proteins

[0099] 1. cDNA library screening

[0100] To elucidate the mechanism by which the LF2 gene induces lateral florets and regulates floral organ development, the pGBKT7-LF2 vector, which had been verified to lack self-activation activity, was first provided to Shanghai Ouyi Biotechnology Co., Ltd. as bait for one-to-one screening of the rice transcription factor AD library to identify LF2 protein interacting factors. The pGBKT7-LF2 was mated with the rice transcription factor library. On the non-selective medium SD / -Trp / -Leu, all clones grew normally. On the selection medium SD / -Trp-Leu-His-Ade / X-α-gal / AbA, a total of 6 transcription factors interacting with LF2 were screened. Figure 15 (A). These six transcription factors were then cloned and ligated into the pGADT7 vector, and their interaction with the LF2 protein was verified in yeast. The results showed that, except for LOC_Os11g08210, which did not grow on the selection medium SD / -Trp-Leu-His-Ade, the other five transcription factors all grew on SD / -Trp-Leu-His-Ade. Figure 15 (B) This indicates that five transcription factors, excluding LOC_Os11g08210, interact with the LF2 protein. Analysis of the gene information of these five transcription factors revealed that the LOC_Os03g44540 gene encodes the A subunit of nuclear factor Y (NF-Y), with the gene symbol OsNF-YA3. Nuclear factor Y, also known as CCAAT-binding factor (CBF) or heme activator protein (HAP), is widely found in eukaryotes such as yeast, plants, and animals. HAP is a heterotrimeric complex containing three subunits: HAP2 / NF-YA / CBF-B, HAP3 / NF-YB / CBF-A, and HAP5 / NF-YC / CBF-C. The HAP complex can bind to the CCAAT sequence in the promoter, regulating the expression of target genes (Thirumurugan et al., 2008). In rice, nuclear factors play important roles in multiple aspects, including embryonic development, regulation of organ developmental characteristics, flowering regulation, leaf development, seed germination, and resistance (Alam et al., 2015; Ito et al., 2011; Miyoshi et al., 2003; Sun et al., 2014). Therefore, the interaction between LF2 and OsNF-YA3 was further verified in tobacco epidermal cells using a bimolecular fluorescence complementation (BiFC) assay. Obvious yellow fluorescence was observed in tobacco leaf cells co-expressing YN-LF2 and YC-OsNF-YA3, which overlapped with the blue fluorescence in the cell nucleus stained with DAPI, demonstrating an interaction between LF2 and OsNF-YA3 proteins. Figure 15 C).

[0101] To determine the role of the nuclear factor subunit OsNF-YA3 in rice panicle development, OsNF-YA3 was knocked out in ZH11 using CRISPR technology. Transgenic plants were grown in a greenhouse; during the flowering period, OsNF-YA3... cas9 Elongated secondary glumes and lemma-like glumes were observed in the spikelets, similar to the lf2 mutant. Additionally, extra lemma-like organs and glumes were observed in the spikelets. Figure 16 This indicates that OsNF-YA3 plays an important regulatory role in rice spikelet development, and its regulation of glume development is similar to that of the LF2 gene.

[0102] 2. Screening for the interaction between LF2 and rice nuclear factors

[0103] Because the three subunits of nuclear factors need to form a heterotrimer, the complex binds to the CCAAT sequence in the promoter of the target gene to regulate the expression of the target gene. Currently, 11 HAP2, 11 HAP3, and 12 HAP5 genes have been reported in rice. Based on gene expression information provided on the website (http: / / rice.plantbiology.msu.edu / ), 9 HAP3 and 7 HAP5 genes expressed in rice inflorescences were cloned into the pGADT7 vector, and their interaction was verified using a yeast two-hybrid assay with pGBKT7-LF2. Finally, on SD / -Trp-Leu-His-Ade medium, one HAP3 subunit (HAP3J) and four HAP5 subunits (HAP5A, HAP5B, HAP5D, and HAP5E) were screened, indicating that in addition to HAP2H, the LF2 protein also interacts with these five nuclear factors. These proteins may form a heterotrimer that interacts with LF2, thereby affecting the expression of downstream genes. Figure 17 ).

[0104] Example 6: Transcriptome analysis of lf2 and wild type

[0105] To determine the downstream target genes and functional pathways of the LF2 gene, transcriptome sequencing analysis was performed on young inflorescences (less than 2 cm) of both the LF2 mutant and wild-type plants during the heading stage. In the mutant, 835 upregulated genes and 832 downregulated genes were identified. Figure 18A). These genes include several flower development-related genes, such as OsMADS1, OsMADS6, OsMADS14, and OsMADS15, which regulate lemma development; OsMADS2 and OsMADS4, which regulate sapwood development; OsMADS7, OsMADS16, and DL, which regulate stamen and pistil development; OsMADS18 and OSH1, which regulate meristem development; and OsMADS34, which regulates glume and branchlet development. qPCR validation of these genes revealed that the expression of OsMADS1, OsMADS6, OsMADS7, OsMADS16, and DL genes was significantly downregulated in the inflorescence, while the expression of OsMADS2, OsMADS4, OsMADS14, OsMADS15, OsMADS18, OsMADS34, and OSH1 was significantly upregulated. Figure 18 (B) The results are consistent with the transcriptome sequencing results and the lf2 mutation trait.

[0106] Furthermore, GO and KEGG enrichment analyses of all differentially expressed genes obtained from transcriptome sequencing revealed that almost all differentially expressed genes were enriched in various biological processes such as transcription, translation, and molecular synthesis, with only a very few enriched in molecular components and functions. They primarily function in nucleic acid binding and transcription factor activity, indicating that the LF2 gene plays an important role in multiple biological processes of plant development. Figure 19 KEGG signaling pathway analysis revealed that the plant hormone signaling pathway had the most enriched genes, among which the auxin signaling pathway had the most genes involved. Figure 19 B).

[0107] Studies have shown that auxin plays a crucial role in flower development. In Arabidopsis, the auxin-responsive factor MONOPTEROS (MP) recruits the SWI / SNF chromatin remodeling complex to increase DNA accessibility, thereby activating key regulatory factors that induce the initiation of floral primordia (Wu et al., 2015). Therefore, the auxin IAA content in the young spikelets of wild-type and lf2 mutants was determined by liquid chromatography. The results showed that the IAA content in the mutant was significantly lower than that in the wild-type. Figure 20 A).

[0108] qPCR expression analysis of key genes in the auxin synthesis pathway (OsYUCCAs), key genes in polar transport (OsPINs), and auxin response factors Aux / IAA (OsIAAs) and OsARFs revealed significantly decreased expression levels of key auxin synergistic genes OsYUCCA2 and OsYUCCA4, and polar transport-related genes OsPIN1, OsPIN2, OsPIN5a, OsPIN6, and OsPIN10b. Figure 20In the auxin response pathway, when auxin concentration is low, the repressor Aux / IAA binds to auxin response factors ARFs to form a dimer, inhibiting the transcriptional activity of ARFs and thus suppressing the expression of auxin-responsive genes. When intracellular auxin levels rise, Aux / IAA binds to the SCF ubiquitin complex (SCF...). TIR / AFB The auxin-binding protein is ubiquitinated and degraded via the 26S proteasome. ARFs are released, activating or inhibiting the expression of downstream genes. qPCR results showed that the expression of OsIAA5, 10, 13, 24, and 26 was significantly upregulated in the lf2 mutant, while the expression of auxin-responsive factors ARF3, 4, 6, 7, 8, 9, 10, 11, 14, 18, 19, 20, 22, 23, and 24 was significantly downregulated, indicating that the auxin response was also weakened in the mutant. Figure 19 The results (DE) indicate that the LF2 gene may be involved in the auxin synthesis pathway.

[0109] Example 7 ChIP-Seq analysis of If2 and wild type

[0110] Chromatin remodeling factors can typically affect the methylation level of target genes, thereby influencing their expression levels. Therefore, RNA was extracted from young panicles of wild-type and lf2 mutants, precipitated with H3K27me3 antibody, and then subjected to ChIP-Seq. The results were then correlated with transcriptome data to identify potential downstream target genes of the LF2 gene. Analysis of the correlation data screened out some genes that may be involved in rice growth and development, including the creeping growth gene PROG1; the RING-H2 zinc finger protein ATL5A; the glumpy characteristic development regulation gene G1 / ELE; hormone pathway-related genes: BR receptor kinase OsBRLv1, the secondary response gene of strigolactone OsRR5, the auxin polar transport gene OsPIN9, and an auxin inhibitor gene; the branch and glumpy development regulation gene OsMADS34 / PAP2; the tapetum development regulation gene OsTDL1A; and a DNA-binding protein (Table 2). Among these genes, the rice glume-bearing gene G1 / ELE is involved in glume fate determination, inhibiting glumes from developing into lemmas. Furthermore, in the g1 mutant, glumes homologously transform into lemmas (Yoshida et al., 2009), largely similar to the phenotype of the lf2 mutant. qPCR results showed that the expression of the G1 / ELE gene was significantly downregulated in the lf2 mutant. Figure 21ChIP-Seq data showed two distinct H3K27me3 binding peaks at the G1 / ELE gene site, and the H3K27me3 level at the G1 / ELE site was increased in lf2. Chromatin from wild-type and lf2 mutant spikelets was extracted and precipitated with H3K27me3 antibody for ChIP-qPCR verification. The results showed a significant increase in H3K27me3 levels in lf2 at the P1 site on the G1 / ELE promoter and CDS, corresponding to the downregulation of G1 / ELE gene expression. Figure 21 (B). Furthermore, the phenotype of spikelets was observed in double mutants of lf2 and g1. In the g1 mutant, the elongation of the two glumes and the lemma were similar in morphology and size, and the internal floral organs developed normally. In the lf2 mutant, the secondary glumes were elongated, and the glumes were elongated or lemmaed to varying degrees, with a reduction in the number of stamens in some spikelets. In the g1+lf2 double mutant, elongation of the secondary glumes was observed, with both glumes elongating and lemmaing, and the degree of elongation was higher than in the g1 and lf2 single mutants. The number of stamens was also significantly reduced, indicating that the LF2 gene acts upstream of the G1 gene and regulates the development of rice glumes by inhibiting G1 expression by affecting the H3K27me3 level of the G1 gene. Figure 21 C).

[0111] Table 2. Gene screening by ChIP-Seq and transcriptome association analysis.

[0112]

[0113] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. The application of a mutant gene of the LF2 gene in the breeding of lateral-floret rice varieties, characterized by, The mutated gene is a T→A single base substitution at the first base of the 5' end of the fourth intron of the LOC_Os07g44210 gene, which leads to mRNA splicing disorder and the formation of the transcript shown in SEQ ID No. 3-6. The mutated gene of the LF2 gene will result in loss of function of the LF2 gene, induce the development of lateral florets, elongation and lemma of the glumes, and elongation of the secondary glumes.