Recombinant virus vector, vesicular stomatitis-Langya chimeric virus and application of vesicular stomatitis-Langya chimeric virus

Abstract

The invention discloses a recombinant virus vector, a vesicular stomatitis-yellow rice chimeric virus and application of the vesicular stomatitis-yellow rice chimeric virus. The recombinant virus vector is a recombinant vector containing an expression cassette of a vesicular stomatitis-yellow rice chimeric genome; the expression cassette comprises a T7 promoter, a coding sequence of a vesicular stomatitis virus N protein, a coding sequence of a vesicular stomatitis virus P protein, a coding sequence of a vesicular stomatitis virus M protein, a coding sequence of a yellow virus F protein and a coding sequence of a vesicular stomatitis virus L protein which are connected in sequence. The replication-deficient recombinant virus for chimeric expression of the LayV F protein is constructed on the basis of the VSV vector, the safety is good, the immunogenicity is good, a high-titer specific IgG antibody and a neutralizing antibody aiming at LayV can be induced to be generated through intramuscular or subcutaneous injection, a new technical choice is provided for preventing or blocking LayV infection, and the replication-deficient recombinant virus has important use and popularization values.

Description

Technical Field

[0001] The present invention relates to the technical field of virology, and in particular to a recombinant virus vector, a vesicular stomatitis-Langya chimeric virus and applications thereof. Background Art

[0002] Langya Virus (LayV) is a member of the Henipavirus genus along with the highly pathogenic Hendra Virus (HeV) and Nipah Virus (NiV), and has a potential risk of epidemics among the population. Clinical symptoms of LayV infection include fever, fatigue, cough, loss of appetite, muscle pain, nausea, headache and vomiting, accompanied by thrombocytopenia, leukopenia, impaired liver and kidney function and other abnormalities. Dozens of cases of LayV infection have been reported in Central and East my country, suggesting that the virus has become prevalent in these areas and has a non-negligible risk of transmission. Therefore, it is very necessary to develop a vaccine against LayV and make advance preparations for the prevention of LayV.

[0003] There is no treatment for LayV infection in the prior art. Aamir Fahira, Sajjad Ahmad and others used immunoinformatics methods to predict cytotoxic T lymphocytes (CTL) epitopes, helper T lymphocytes (HTL) epitopes, and B lymphocyte epitopes, thereby designing a multi-epitope vaccine for LayV. After the physicochemical property prediction, structure verification and other procedures, only immune response prediction was performed, and no animal experiments were performed, so the immunogenicity of the vaccine could not be proved, and those skilled in the art could not predict whether the vaccine could prevent or block LayV infection. Therefore, it is urgent to develop a LayV vaccine that is truly immunogenic. Summary of the invention

[0004] In order to solve the above problems existing in the prior art, the present invention provides a recombinant virus vector, vesicular stomatitis-Langya chimeric virus and applications thereof.

[0005] The first object of the present invention is to provide a recombinant viral vector.

[0006] The second object of the present invention is to provide the use of the recombinant viral vector in the preparation of products for preventing and / or treating Langya virus.

[0007] The third object of the present invention is to provide a composition.

[0008] The fourth object of the present invention is to provide a vesicular stomatitis-Langya chimeric virus.

[0009] The fifth object of the present invention is to provide a method for preparing vesicular stomatitis-Langya chimeric virus.

[0010] The sixth object of the present invention is to provide the vesicular stomatitis-Langya chimeric virus prepared by the preparation method.

[0011] The seventh object of the present invention is to provide the use of the vesicular stomatitis-Langya chimeric virus as an immunogen in the preparation of Langya virus antibodies.

[0012] The eighth objective of the present invention is to provide the use of the vesicular stomatitis-Langya chimeric virus in the preparation of products for preventing and / or treating Langya virus.

[0013] The ninth object of the present invention is to provide a Langya virus vaccine.

[0014] In order to achieve the above object, the present invention is implemented by the following scheme:

[0015] Vesicular Stomatitis Virus (VSV) is a mature viral vector with the advantages of safety, rapid reproduction, no pre-existing immunity, and the ability to induce strong humoral and cellular immunity. It is considered to be one of the most promising viral vaccine vectors. Wild-type VSV is an enveloped virus with a single-stranded negative-sense RNA genome (-ssRNA), and its replication depends on the viral RNA polymerase (RNA-dependent RNA polymerase, RdRp). It contains five structural proteins: nucleoprotein (N), phosphorylated protein (P), matrix protein (M), glycoprotein (G) and RNA-dependent RNA polymerase (L). VSV viral vectors can efficiently use the envelope protein of heterologous viruses for pseudotyping. The main process is as follows: First, Escherichia coli is used to construct a VSV-ΔG transfer vector that can transcribe the negative-sense RNA chain encoding the VSV genome, and its transcription product serves as a template for RdRp to synthesize viral RNA. This vector and four auxiliary vectors (respectively expressing the N, P, G and L proteins of VSV) are co-transfected into 293T cells expressing bacteriophage T7 RNA polymerase inoculated with poxvirus. T7 RNA polymerase acts on the T7 promoter on the transfer vector to drive the VSV-ΔG genome to transcribe negative-sense RNA. Recombinant VSV is assembled and released in the cells, and the cell supernatant is collected and used to infect 293T cells expressing G protein again to obtain a high yield of G protein-complemented recombinant VSV. Subsequently, the G protein-complemented VSV is transduced into 293T cells expressing heterologous viral envelope proteins to prepare pseudoviruses of the target enveloped virus.

[0016] The fusion (F) protein and glycoprotein (G) protein of LayV are potential targets for neutralizing antibodies. In order to rescue VSV expressing LayV F protein, the present invention first replaces the G gene in the VSV genome vector with the F gene of LayV, and successfully constructs the recombinant viral vector pVSV-ΔG-LayV-F. Subsequently, based on VSV reverse genetics technology, the recombinant chimeric virus rV SV-ΔG-LayV-F expressing LayV F protein was successfully packaged, and a preliminary evaluation was carried out by immunizing mice by intramuscular and subcutaneous injection. The vital signs and pathological conditions of mice indicate that the recombinant virus will not cause damage to mice, and can induce mice to produce specific IgG antibodies and neutralizing antibodies, and promote T lymphocytes to differentiate into CD4 + T lymphocytes and CD8 + T lymphocytes can be used as candidate vaccine strains to prevent LayV infection.

[0017] Therefore, the present invention requests protection for the following:

[0018] A recombinant viral vector is a recombinant vector comprising an expression cassette of a vesicular stomatitis-Langya chimeric genome; the expression cassette comprises a T7 promoter, a coding sequence of a vesicular stomatitis virus N protein, a coding sequence of a vesicular stomatitis virus P protein, a coding sequence of a vesicular stomatitis virus M protein, a coding sequence of a Langya virus F protein and a coding sequence of a vesicular stomatitis virus L protein, which are connected in sequence.

[0019] Preferably, the amino acid sequence of the Langya virus F protein is as shown in SEQ ID NO.1.

[0020] More preferably, the nucleotide sequence of the coding sequence of the Langya virus F protein is as shown in SEQ ID NO.2.

[0021] Preferably, the amino acid sequence of the vesicular stomatitis virus N protein is as shown in SEQ ID NO.3.

[0022] More preferably, the nucleotide sequence of the coding sequence of the vesicular stomatitis virus N protein is shown as SEQ ID NO.4.

[0023] Preferably, the amino acid sequence of the vesicular stomatitis virus P protein is as shown in SEQ ID NO.5.

[0024] More preferably, the nucleotide sequence of the coding sequence of the vesicular stomatitis virus P protein is shown as SEQ ID NO.6.

[0025] Preferably, the amino acid sequence of the vesicular stomatitis virus M protein is as shown in SEQ ID NO.7.

[0026] More preferably, the nucleotide sequence of the coding sequence of the vesicular stomatitis virus M protein is as shown in SEQ ID NO.8.

[0027] Preferably, the amino acid sequence of the vesicular stomatitis virus L protein is as shown in SEQ ID NO.11.

[0028] More preferably, the nucleotide sequence of the coding sequence of vesicular stomatitis virus L protein is shown as SEQ ID NO.12.

[0029] Preferably, the recombinant viral vector uses pVSV-Fl+(2) vector as the backbone.

[0030] More preferably, the recombinant viral vector is obtained by replacing the coding sequence of the vesicular stomatitis virus G protein in the pVSV-Fl+(2) vector with the coding sequence of the Langya virus F protein.

[0031] Further preferably, the amino acid sequence of the vesicular stomatitis virus G protein is as shown in SEQ ID NO.9.

[0032] More preferably, the nucleotide sequence of the coding sequence of vesicular stomatitis virus G protein is as shown in SEQ ID NO.10.

[0033] Use of any of the above recombinant viral vectors in the preparation of products for preventing and / or treating Langya virus.

[0034] A composition comprises any one of the above-mentioned recombinant viral vectors and an auxiliary vector, wherein the auxiliary vector is a recombinant vector that expresses vesicular stomatitis virus N protein, vesicular stomatitis virus P protein, vesicular stomatitis virus G protein and vesicular stomatitis virus L protein respectively.

[0035] Preferably, the amino acid sequence of the vesicular stomatitis virus G protein is shown in SEQ ID NO.9.

[0036] More preferably, the nucleotide sequence of the coding sequence of vesicular stomatitis virus G protein is shown as SEQ ID NO.10.

[0037] Preferably, it further comprises T7 RNA polymerase and / or a host cell.

[0038] Use of any of the compositions in the preparation of products for preventing and / or treating Langya virus.

[0039] A vesicular stomatitis-Langya chimeric virus is packaged by any of the above-mentioned recombinant virus vectors and an auxiliary vector; the auxiliary vector is a recombinant vector that expresses vesicular stomatitis virus N protein, vesicular stomatitis virus P protein, vesicular stomatitis virus G protein and vesicular stomatitis virus L protein respectively.

[0040] A method for preparing a vesicular stomatitis-Langya chimeric virus, comprising introducing any of the recombinant viral vectors, an auxiliary vector and T7 RNA polymerase into a host cell, then culturing the host cell and harvesting the released viral particles; the auxiliary vector is a recombinant vector that expresses vesicular stomatitis virus N protein, vesicular stomatitis virus P protein, vesicular stomatitis virus G protein and vesicular stomatitis virus L protein, respectively.

[0041] The vesicular stomatitis-Langya chimeric virus prepared by the preparation method should also be within the protection scope of the present invention.

[0042] The application of the preparation method in the preparation of products for preventing and / or treating Langya virus should also be within the protection scope of the present invention.

[0043] The use of any of the vesicular stomatitis-Langya chimeric viruses as an immunogen in the preparation of Langya virus antibodies should also be within the scope of protection of the present invention.

[0044] The use of any of the vesicular stomatitis-Langya chimeric viruses in the preparation of products for preventing and / or treating Langya virus should also be within the scope of protection of the present invention.

[0045] A Langya virus vaccine comprising any of the vesicular stomatitis-Langya chimeric viruses.

[0046] Preferably, it further comprises a pharmaceutically acceptable carrier and / or adjuvant.

[0047] Compared with the prior art, the present invention has the following beneficial effects:

[0048] The present invention constructs a replication-deficient recombinant virus chimerically expressing LayV F protein based on a VSV vector, which has good safety and immunogenicity, and can induce the production of high-titer specific IgG antibodies and neutralizing antibodies against LayV through intramuscular or subcutaneous injection. It provides a new technical option for preventing or blocking LayV infection, and has important use and promotion value. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] Figure 1 Figure 3 is the identification of the recombinant chimeric virus rVSV-ΔG-LayV-F; A is a schematic diagram of the construction of the pVSV-ΔG-LayV-F vector; B is the indirect immunofluorescence detection result of the expression of LayV F protein in the experimental group and the control group, scale: 150μm; C is the Western blotting detection result of the expression of LayV F protein and VSV M protein in the experimental group and the control group, and the PCR detection result of LayV F gene in the cell culture supernatant; D is an electron microscope photo of rVSV-ΔG-LayV-F; E is the growth curve of rVSV-ΔG-LayV-F.

[0050] Figure 2 HE staining of the liver, kidney, and spleen of mice in the LayV F-IM group, LayV F-SC group, PBS-IM group, and PBS-SC group.

[0051] Figure 3 The immune responses of mice in the LayV F-IM group and the PBS-IM group after intramuscular injection of rVSV-ΔG-LayV-F; A is the IgG antibody level detected by ELISA; B is the neutralization antibody level detected by neutralization test; C is the CD4 + 、CD8 + T lymphocyte ratio, **P<0.01, ***P<0.001, t-test.

[0052] Figure 4 The immune responses of mice in the LayV F-SC group and the PBS-SC group after subcutaneous injection of rVSV-ΔG-LayV-F; A is the IgG antibody level detected by ELISA; B is the neutralization antibody level detected by neutralization test; C is the CD4 + 、CD8 + T lymphocyte ratio, **P<0.01, ***P<0.001, t-test. DETAILED DESCRIPTION

[0053] The present invention is further described in detail below in conjunction with the accompanying drawings and specific examples of the specification. The examples are only used to explain the present invention and are not used to limit the scope of the present invention. The test methods used in the following examples are all conventional methods unless otherwise specified; the materials and reagents used are reagents and materials that can be obtained from commercial channels unless otherwise specified. The vector information involved in the following examples is as follows: the product number of the pVSV-Fl+(2) vector is EH1001, purchased from Kerafast; the product number of the auxiliary vector system (pBS-VSV-N, pBS-VSV-P, pBS-VSV-G, pBS-VSV-L) is EH1002, purchased from Kerafast; pCAGGS-VSV-G, pCAGGS-LayV-F, and pCAGGS-LayV-G vectors are stored in this laboratory; poxvirus vTF7-3 was donated by Researcher Bu Zhigao of Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences.

[0054] Example 1 Preparation of recombinant chimeric virus rVSV-ΔG-LayV-F

[0055] 1. Construction of recombinant viral vector

[0056] The gene sequence of LayV F protein (SEQ ID NO. 1) was downloaded from Genbank (Genbank No.: OM101130), and the F gene fragment of LayV (SEQ ID NO. 2) was synthesized.

[0057] The pVSV-Fl+(2) vector expressing the VSV full genome vector contains an expression cassette of the VSV full genome, namely, a T7 promoter, a coding sequence (SEQ ID NO.4) of the VSV N protein (SEQ ID NO.3), a coding sequence (SEQ ID NO.6) of the VSV P protein (SEQ ID NO.5), a coding sequence (SEQ ID NO.8) of the VSV M protein (SEQ ID NO.7), a coding sequence (SEQ ID NO.10) of the VSV G protein (SEQ ID NO.9), and a coding sequence (SEQ ID NO.12) of the VSV L protein (SEQ ID NO.11) connected in sequence.

[0058] like Figure 1 As shown in A in the figure, using pVSV-Fl+(2) as the backbone, the coding sequence (SEQ ID NO.10) of the VSV G protein (SEQ ID NO.9) in the expression cassette of the VSV whole genome was replaced with the F gene fragment (SEQ ID NO.1) of LayV by molecular cloning, thereby obtaining a recombinant viral vector, which was recorded as pVSV-ΔG-LayV-F vector.

[0059] 2. Packaging of recombinant chimeric viruses

[0060] (1) Cell culture

[0061] 293T cells were cultured at 5 × 10 5 The cells were inoculated at a density of 100 / mL in a 6-well plate in DMEM medium containing 10% FBS and cultured at 37°C and 5% CO2 for 18 h.

[0062] (2) Infection

[0063] When the 293T cells in the culture dish grow to 70% to 80%, the culture medium is replaced with serum-free DM EM medium. According to the principle of VSV reverse genetics technology, 293T cells are first infected with a poxvirus encoding T7 RNA polymerase (vTF7-3) at a dose of 0.006 MOI to provide T7 RNA polymerase for genome transcription.

[0064] (3) Transfection

[0065] After 1 hour of infection, the pVSV-ΔG-LayV-F vector constructed in this embodiment and four auxiliary vectors containing the N gene, P gene, G gene and L gene of VSV, respectively (i.e., pBS-VSV-N, pBS-VSV-P, pBS-VSV-G and pBS-VSV-L) were co-transfected into 293T cells at a ratio of 5:3:5:8:1 using a transfection reagent for packaging the recombinant chimeric virus rVSV-ΔG-LayV-F. pBS-VSV-N, pBS-VSV-P, and pBS-VSV-L are used to support the synthesis of the genomic RNA of the recombinant chimeric virus. Since the present invention only chimerizes the F protein of LayV, the packaged rVSV-ΔG-LayV-F is still replication-deficient. Therefore, pBS-VSV-G is used to support the synthesis of the envelope protein of the recombinant chimeric virus, thereby packaging the progeny virus with infection ability.

[0066] In addition, the G gene of VSV (SEQ ID NO.2) on the pVSV-Fl+(2) vector was deleted, and the resulting vector was named pVSV-ΔG vector. It was inoculated with four auxiliary vectors in the same manner into 293T cells for packaging the recombinant deletion virus VSV-ΔG.

[0067] (4) Collecting samples

[0068] 48 hours after transfection, the cell culture supernatant was aspirated and centrifuged at 2000g for 5 min to remove cell debris, and the supernatant was collected to obtain the virus solution containing P0 generation rVSV-ΔG-LayV-F and the virus solution containing P0 generation VSV-ΔG, which were then packaged and stored in a -80°C refrigerator.

[0069] 3. Identification of recombinant chimeric viruses

[0070] (1) Cell culture

[0071] 293T cells were cultured at 5 × 10 5 The cells were inoculated at a density of 100 / mL in a 6-well plate in DMEM medium containing 10% FBS and cultured at 37°C and 5% CO2 for 18 h.

[0072] (2) Transfection

[0073] The pCAGGS-VSV-G vector was transfected into 293T cells using a transfection reagent.

[0074] (3) Infection

[0075] 24 hours after transfection, 293T cells were infected with the P0 generation rVSV-ΔG-LayV-F and P0 generation VSV-ΔG prepared in Example 1 at an MOI of 0.01, and they were recorded as the experimental group and the control group, respectively.

[0076] (4) Expression and identification of LayV F protein

[0077] After 48 hours of infection, the expression of LayV F protein in the experimental group and the control group was detected by indirect immunofluorescence technique and Western Blotting, respectively. The specific steps are as follows.

[0078] Indirect immunofluorescence technique: 4% paraformaldehyde (Biyuntian, P0099) fixation; 0.1% Triton X-100 permeabilization (Biyuntian, ST795); 5% skim milk (Biyuntian, 232100) blocking; antibody incubation and nuclear staining (Biyuntian, C1005). Observation was performed using a fluorescence microscope. The primary antibody used was rabbit anti-LayV F antibody (Antibody System, PVV18201), and the secondary antibody was FITC-labeled goat anti-rabbit IgG (ThermoFisher, 31636).

[0079] Western Blotting: After polyacrylamide gel electrophoresis, the samples were transferred to nitrocellulose membrane NC membrane, blocked with 5% skim milk (Bidec, 232100), and finally incubated with antibodies. Scanning and development were performed using an infrared fluorescence scanning imaging system (Odyssey). The primary antibody used was rabbit anti-LayV F antibody (Antibody Sy stem, PVV18201), and the secondary antibody was infrared goat anti-rabbit IgG (LI-COR, 926-68071).

[0080] (5) Expression and identification of LayV F gene

[0081] After 48 hours of infection, the cell culture supernatants of the experimental group and the control group were collected, RNA was extracted, and reverse transcribed (Novozyme, R223-01) into cDNA, and then PCR and agarose gel electrophoresis were used to detect the expression of LayV F gene in progeny viruses. The primers used were: Forward primer: ATGCTTGACAACGT GAAATCCGGC; Reverse primer: CCACGGAGATCAGGATATCGCC.

[0082] (6) Morphological identification of rVSV-ΔG-LayV-F

[0083] The cell culture supernatant of the experimental group was aspirated, centrifuged at 5000g for 5 min to remove cell debris, and the supernatant was collected. Centrifuged again at 160000g for 1 h using a Beckman ultracentrifuge, the supernatant was discarded, and the virus pellet was resuspended in PBS. The morphology of the progeny rVSV-ΔG-LayV-F was observed using an electron microscope and photographed for record.

[0084] (7) Identification results

[0085] like Figure 1 As shown in B and C, the cells in the experimental group successfully expressed LayV F protein, while the control group did not express LayV F protein, and the LayV F gene was only detected in the supernatant of the experimental group.

[0086] like Figure 1 As shown in D, the morphology of rVSV-ΔG-LayV-F is bullet-shaped, which is consistent with the typical morphology of rhabdovirus VS V.

[0087] The above results indicate that the recombinant chimeric virus rVSV-ΔG-LayV-F was packaged successfully.

[0088] 4. Replication dynamics of rVSV-ΔG-LayV-F

[0089] Using the method in this example, 293T cells pre-transfected with pCAGGS-VSV-G were infected with P0 generation rVSV-ΔG-LayV-F, and cell culture supernatants were collected at 12h, 24h, 36h, 48h, 60h and 72h after infection, RNA was extracted, and the mRNA level of the VSV N gene in the progeny rVSV-ΔG-LayV-F was detected by fluorescent quantitative PCR (i.e., qPCR), and the growth curve of the progeny virus was drawn using GraphPad Prism 8.0 according to the test results. The quantitative primers used were: Forward primer: TGG AGCATTAAAGGACATCCG; Reverse primer: GGGCTTTCAAGGATACAAGGT C.

[0090] like Figure 1 As shown in E, as the infection time increases, the growth curve of the progeny rVSV-ΔG-LayV-F is a typical "S" shape.

[0091] 5. Purification of rVSV-ΔG-LayV-F

[0092] Plaque purification was used to remove the residual poxvirus vTF7-3 in the P0 generation rVSV-ΔG-LayV-F. The specific steps are as follows:

[0093] The virus solution containing P0 rVSV-ΔG-LayV-F was diluted 6 times in a 10-fold gradient and then used to infect 293T cells pre-transfected with pCAGGS-VSV-G in a 6-well plate.

[0094] After 2 hours of adsorption at 37°C, the culture medium was discarded and the prepared nutrient agarose solution was added to the 6-well plate. After solidification, the culture plate was inverted and placed in a 37°C CO2 incubator. The nutrient agarose solution was prepared by adding 4g agarose to 200mL ultrapure water to prepare a 2% agarose solution, which was then sterilized by high pressure and placed in a 42°C water bath, and then mixed with an equal volume of DMEM culture medium containing 10% FBS preheated to 42°C.

[0095] After 48 h of culture, obvious plaques appeared. Plaque monoclones were picked and placed in serum-free DMEM medium and inoculated into a new batch of 293T cells pre-transfected with pCAGGS-VSV-G. The obtained cells were recorded as monoclonal infected cells.

[0096] 48 hours after inoculation, the cell culture supernatant was aspirated and centrifuged at 2000g for 5 minutes to remove cell debris. The supernatant was collected to obtain the virus solution containing P1 generation rVSV-ΔG-LayV-F, which was packaged and stored in a -80°C refrigerator.

[0097] The virus liquid of P1 generation rVSV-ΔG-LayV-F and DNA from monoclonal infected cells were extracted, and the vTF7-3 load was detected by qPCR. The quantitative primers used were: Forward primer: TGAGACATATCCG TGTCATCAAA; Reverse primer: CATGGGACTGCTGTCTATTGT. The results showed that there was no vTF7-3 contamination in P1 generation rVSV-ΔG-LayV-F, indicating that rVSV-ΔG-LayV-F was successfully purified.

[0098] 6. Amplification of rVSV-ΔG-LayV-F

[0099] Purified P1 generation rVSV-ΔG-LayV-F was used to infect 293T cells pre-transfected with pCAGGS-VSV-G, and a large amount of cell supernatant containing progeny virus was harvested. The progeny virus was ultrafiltered and concentrated using a 100KDa ultrafiltration tube, recorded as P2 generation rVSV-ΔG-LayV-F, and stored in aliquots at -80°C.

[0100] Example 2 Safety Evaluation of Recombinant Chimeric Virus rVSV-ΔG-LayV-F

[0101] 1. Animal experiments

[0102] (1) Grouping

[0103] Forty BALB / c mice (6-8 weeks old, female) were randomly divided into four groups with 10 mice / group, namely LayVF-IM group, LayV F-SC group, PBS-IM group and PBS-SC group. Among them, LayV F-IM group and LayV F-SC group were collectively referred to as immune group, PBS-IM group and PBS-SC group were collectively referred to as blank group; PBS-IM group served as control of LayV F-IM group, and PBS-SC group served as control of LayV F-SC group.

[0104] (2) Immunization

[0105] The LayV F-IM group was immunized with the P2 generation rVSV-ΔG-LayV-F prepared in Example 1 by intramuscular injection (IM) on day 0 and day 21, respectively; the LayV F-SC group was immunized with the P2 generation rVSV-ΔG-LayV-F prepared in Example 1 by subcutaneous injection (SC) on day 0 and day 21, respectively; the single immunization dose of mice in each immunization group was 10 6 TC ID 50 The PBS-IM group received the same volume of PBS by intramuscular injection on day 0 and day 21, and the PBS-SC group received the same volume of PBS by subcutaneous injection on day 0 and day 21.

[0106] The first day after the first injection of each group was recorded as 1 day after immunization, i.e. 1 dpv. Blood was collected from mice in each group at 14 dpv, 28 dpv, 42 dpv and 56 dpv, and serum was separated for later use. At 35 dpv, 5 mice were randomly selected from each of the 4 groups of mice, euthanized, and the liver, kidney and spleen were collected. At the same time, the spleen was also taken to prepare splenocytes for later use.

[0107] After immunization, the coat condition, eating, drinking, exercise and other activities of mice in each group were observed every day. Until the end of the experiment, the vital signs of mice in each group were stable, no abnormal phenomena occurred, and no death occurred.

[0108] 2. Pathological testing

[0109] The liver, kidney and spleen of the four groups of mice were stained with hematoxylin-eosin (HE). Figure 2 As shown, the liver, kidney and spleen of mice in the LayV F-IM group, LayV F-SC group, PBS-IM group and PBS-SC group had no lesions, indicating that the recombinant chimeric virus rVSV-ΔG-LayV-F prepared by the present invention would not affect the normal physiological activities of mice by intramuscular or subcutaneous immunization, and has high safety.

[0110] Example 3 Evaluation of the immunogenicity of the recombinant chimeric virus rVSV-ΔG-LayV-F

[0111] 1. Specific IgG antibody detection

[0112] The specific IgG antibody of LayV F was detected by indirect ELISA method. The specific steps were as follows: first, LayV F protein (Antibody System, EVV18201) was coated into the wells of the ELISA plate at a coating dose of 150 ng / well using ELISA coating solution (Elabscience, E-ELIR-001); blocked with ready-to-use ELISA blocking solution (Elabscience, E-ELIR-003); sera from the four groups of mice collected at 14 dpv, 28 dpv, 42 dpv and 56 dpv in Example 2 were diluted with PBS and diluted with 2 6 As the minimum dilution factor, 2 times dilution to 2 17 times to obtain serum of different dilutions, which were then added to the coated wells and incubated at 37°C for 1 h; the liquid in the wells was discarded, the plates were washed, and enzyme-labeled secondary antibodies (Abcam, ab6728) were added, and the wells were incubated at 37°C for 1 h; the liquid in the wells was discarded, the plates were washed, TMB (Elabscience, E-IR-R201) was added for color development, and the wells were incubated at 37°C for 15 min; the stop solution (Elabscience, E-ELIR-006) was added to stop the color development, and the optical density (OD) value of each well at 450 nm was read on a microplate reader.

[0113] According to the OD value, the ratio (P / N) of the serum OD450 value (P) of each immune group (positive) to the serum OD450 value (N) of the corresponding blank group (negative) was calculated, and the highest serum dilution factor corresponding to P / N>2 was taken as the specific IgG antibody titer of the immune group.

[0114] The specific IgG antibody titers of the LayV F-IM group and the LayV F-SC group were Figure 3 A and Figure 4 As shown in A, mice were immunized with rVSV-ΔG-LayV-F by IM or SC, and the specific IgG antibody titers induced at 14 dpv were all 1:2 12 One week after immunization (i.e. 28 dpv), the specific IgG antibody titer induced reached 1:2 14 .

[0115] 2. Neutralizing antibody (nAb) detection

[0116] The LayV recombinant VSV pseudovirus rVSVΔG-LayV-luc carrying the firefly luciferase reporter gene was used to detect mouse serum neutralizing antibody nAb. The specific steps are as follows:

[0117] In order to construct rVSVΔG-LayV-luc, pVSV-Fl+(2) was used as the backbone, and the coding sequence of VSV G protein in the VSV whole genome was replaced with the Luciferase gene by a molecular cloning method, thereby obtaining a recombinant viral vector pVSVΔG-luc; the reverse genetics technique in Example 1 was used to package the P0 generation VSV pseudovirus rVSVΔG-luc that can express Luciferase; the plaque purification technique in Example 1 was used to obtain the P1 generation rVSVΔG-luc without vTF7-3 contamination; the P1 generation rVSVΔG-luc was used to infect 293T cells pre-transfected with pCAGGS-LayV-F and pCAGGS-LayV-G, and the LayV pseudovirus rVSVΔG-LayV-luc that can express Luciferase was packaged.

[0118] The serum of the four groups of mice collected at 14 dpv, 28 dpv, 42 dpv and 56 dpv in Example 2 was inactivated at 56°C for 30 min and then diluted with serum-free DMEM medium. 4 The initial dilution factor is 2 times dilution, and the dilution factor is 2 times dilution. 12 60 μL of the diluted serum was added to each well of the 96-well plate. 50 / 60μL dose of rVSVΔG-LayV-luc was added and incubated at 37°C, 5% CO2 for 1h. Then 100μL was drawn from each well and added to a 96-well plate with A549 cells. At the same time, cells to which only rVSVΔG-LayV-luc was added were used as virus controls, and cells to which only serum-free DMEM medium was added were used as blank cell controls. After 24h, the expression of Luciferase in each group of cells was detected using a multifunctional microplate reader (i.e., the luminescence value was detected). Since there was a background value (0-100) when detecting the luminescence value, the wells with Luciferase <100 were determined to be free of virus infection, i.e., all viruses were determined to be neutralized. The maximum serum dilution factor that can neutralize all viruses was used as the nAb titer of the serum of each group of mice.

[0119] The nAb titers of LayV F-IM group and PBS F-IM group were Figure 3 As shown in B, the nAb titers of the LayV F-SC group and the PBS F-SC group are as follows Figure 4As shown in B, mice were immunized with rVSV-ΔG-LayV-F by IM or SC, and the titers of nAb induced at 14 dpv were all 1:2 6 One week after immunization (i.e. 28 dpv), the titer of induced nAb reached 1:2 9 .

[0120] 3. Flow cytometry

[0121] The spleen cells of each group of mice obtained at 35 dpv in Example 2 were prepared into single cell suspensions. TM After staining with four flow cytometry antibodies, Fixable Viability Kit (BioLegend, 423101), PE anti-mouse CD4 Antibody (BioLegend, 100407), APC anti-mouse CD8a Antibody (BioLegend, 100711) and FITCanti-mouse CD3e Antibody (BioLegend, 100305), the fluorescence signal was detected on a flow cytometer and analyzed by FlowJo software. + T lymphocytes and CD8 + The proportion of T lymphocytes was plotted and statistically analyzed using GraphPadPrism 8.0.

[0122] like Figure 3 As shown in C, CD4 + The proportion of T lymphocytes (72.34%) and CD8 + The proportion of T lymphocytes (29.14%) was significantly higher than that of PBS F-IM group (CD4 + : 62.72%, CD8 + :19.82%). Figure 4 As shown in C, CD4 + (69.7%) T lymphocyte ratio and CD8 + The proportion of T lymphocytes (27.02%) was significantly higher than that of PBS F-SC group (CD4 + : 54.36%, CD8 + :19.64% ).

[0123] The above results indicate that the recombinant chimeric virus rVSV-ΔG-LayV-F prepared by the present invention can effectively induce immune response in mice by intramuscular or subcutaneous immunization and has good immunogenicity.

[0124] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit the protection scope of the present invention. For ordinary technicians in this field, other different forms of changes or modifications can be made based on the above descriptions and ideas. It is not necessary and impossible to list all the implementation methods here. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the claims of the present invention.

Claims

1. A recombinant viral vector, characterized in that: A recombinant vector containing an expression cassette of a vesicular stomatitis-Langya chimeric genome; The expression cassette comprises a T7 promoter, a coding sequence of a vesicular stomatitis virus N protein, a coding sequence of a vesicular stomatitis virus P protein, a coding sequence of a vesicular stomatitis virus M protein, a coding sequence of a Langya virus F protein and a coding sequence of a vesicular stomatitis virus L protein, which are connected in sequence.

2. Use of the recombinant viral vector according to claim 1 in the preparation of products for preventing and / or treating Langya virus.

3. A composition, characterized in that The invention comprises the recombinant viral vector and an auxiliary vector according to claim 1, wherein the auxiliary vector is a recombinant vector for expressing vesicular stomatitis virus N protein, vesicular stomatitis virus P protein, vesicular stomatitis virus G protein and vesicular stomatitis virus L protein, respectively.

4. The composition according to claim 3, characterized in that Also included is a T7 RNA polymerase and / or a host cell.

5. A vesicular stomatitis-Langya chimeric virus, characterized in that: The method is obtained by packaging the recombinant viral vector and the auxiliary vector according to claim 1; The auxiliary vector is a recombinant vector for expressing vesicular stomatitis virus N protein, vesicular stomatitis virus P protein, vesicular stomatitis virus G protein and vesicular stomatitis virus L protein respectively.

6. A method for preparing a vesicular stomatitis-Langya chimeric virus, characterized in that: The recombinant viral vector, the auxiliary vector and the T7 RNA polymerase according to claim 1 are introduced into a host cell, and then the host cell is cultured and the released viral particles are harvested to obtain; The auxiliary vector is a recombinant vector for expressing vesicular stomatitis virus N protein, vesicular stomatitis virus P protein, vesicular stomatitis virus G protein and vesicular stomatitis virus L protein respectively.

7. Vesicular stomatitis-Langya chimeric virus prepared by the preparation method of claim 6.

8. Use of the vesicular stomatitis-Langya chimeric virus according to claim 5 or claim 7 as an immunogen in the preparation of Langya virus antibodies.

9. Use of the vesicular stomatitis-Langya chimeric virus according to claim 5 or claim 7 in the preparation of a product for preventing and / or treating Langya virus.

10. A Langya virus vaccine, characterized in that: Comprising the vesicular stomatitis-Langya chimeric virus according to claim 5 or claim 7.

Images