Specific primers for molecular markers of HIRA, a gene related to fertility in Ujumqin sheep, and their applications

Abstract

This invention belongs to the field of molecular biology, specifically relating to specific primers for molecular markers of the fertility-related gene HIRA in Ujumqin sheep and their applications. The specific primer sequences for the molecular markers of the fertility-related gene HIRA in Ujumqin sheep are shown in SEQ ID NO.1 and SEQ ID NO.2. This invention designs specific primers to detect the presence of a G→A mutation at 1273 bp in the coding region of the HIRA gene in the Ujumqin sheep genome, determining the genotype of individual Ujumqin sheep at this locus, and realizing the detection of single nucleotide polymorphism (SNP) c.1273G>A in the HIRA gene to compare the polymorphism of HIRA gene c.1273G>A in the Ujumqin sheep breed. This invention utilizes the HIRA gene c.1273G>A polymorphism to assist in the breeding of Ujumqin sheep, increasing the number of lambs born, and can serve as an effective method to assist in improving the multiparity trait of Ujumqin sheep.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology, specifically relating to specific primers for molecular markers of the HIRA gene, which is related to fertility in Ujumqin sheep, and their applications. Background Technology

[0002] The Ujumqin sheep originates from the Ujumqin grassland in eastern Xilingol League, Inner Mongolia, mainly distributed in East Ujumqin Banner and West Ujumqin Banner. Suitable for year-round grazing, it is characterized by rapid weight gain, strong fat accumulation, high meat yield, and early sexual maturity. It is well-suited for grazing and fattening during the peak pasture growth period, or for planned lamb production. Furthermore, the Ujumqin sheep is an excellent recipient sheep for purebred embryo transfer, producing offspring with robust constitutions, strong disease resistance, and good adaptability.

[0003] HIRA (histone cell cycle regulator gene) is a histone chaperone. The sheep HIRA gene is located on chromosome 17, containing 24 exons and a coding region of 3063 bp, encoding 1021 amino acids. Its product, HIR / HIRA, is a histone chaperone protein involved in various chromatin regulatory processes, such as gene transcription and sperm chromatin remodeling. In eukaryotes, DNA binds to histones to form stable structures called nucleosomes, thereby participating in various biological processes (e.g., DNA replication, repair, and transcription; myoblast differentiation; heart development; and embryonic development). Studies by Buhe et al. found that HIRA is crucial for transcriptional regulation and DNA methylation during mouse oogenesis; HIRA deficiency in primordial follicle cells can lead to severe developmental defects, resulting in the death of a large number of oocytes. Further research in vertebrates has revealed that HIRA mainly participates in fertilization or embryonic development, but has no significant effect on oogenesis or meiosis. It is evident that HIRA has a wide range of effects, but there is currently no research on the specific role of the HIRA gene in the reproductive process of Ujumqin sheep. Summary of the Invention

[0004] The purpose of this invention is to provide a specific primer for a molecular marker of the HIRA gene, which is related to the fertility of Ujumqin sheep.

[0005] Another object of the present invention is to provide applications of the above-mentioned specific primers.

[0006] This invention uses DNA sequencing technology to detect whether there is a G→A mutation at 1273 bp in the coding region of the HIRA gene in the Ujumqin sheep genome. By determining the genotype of individual Ujumqin sheep at this site, single nucleotide polymorphism detection is performed on the HIRA gene c.1273G>A to compare the polymorphism of HIRA gene c.1273G>A in the Ujumqin sheep breed and determine that c.1273G>A is a molecular marker associated with the polyfertility trait of Ujumqin sheep.

[0007] The nucleotide sequence of the HIRA gene c.1273G>A in Ujumqin sheep is located in the region from 72677979bp to 72726550bp on chromosome 17 of the sheep, with NCBI Reference Sequence NC_056070.1.

[0008] Specific primers for the molecular marker of the fertility-related gene HIRA in Ujumqin sheep according to a specific embodiment of the present invention, the primer sequences of which are as follows:

[0009] SEQ ID NO.1: 5'-CCGAGGGTCTCAATTTCAGTT-3';

[0010] SEQ ID NO. 2: 5'-TGCAGCCACAAGCACAGG-3'.

[0011] The specific primers for the molecular marker of the HIRA gene, which is related to the fertility of Ujumqin sheep, can be used in kits for detecting the polygamous trait in Ujumqin sheep, or in assisted breeding of Ujumqin sheep.

[0012] Preferably, the present invention provides the application of specific primers for molecular markers of the fertility-related gene HIRA in Ujumqin sheep in assisting in the assessment of the fertility of Mongolian sheep.

[0013] Preferably, the present invention provides a kit for detecting the multiple birth traits of Ujumqin sheep, which includes the primers described above. More preferably, the kit includes 1 μL of each specific primer, 1 μL of template, 6 μL of premixed solution, and 11 μL of deionized water. The PCR amplification program suitable for the above kit is as follows: 95℃ pre-denaturation for 3 min, 98℃ denaturation for 10 s, 62℃ annealing for 15 s, 68℃ extension for 57 s, 30 cycles, 68℃ extension for 7 min, storage at 4℃, and then sequencing.

[0014] According to a specific embodiment of the present invention, a method for improving the fertility of Ujumqin sheep includes the step of amplifying the genomic DNA of Ujumqin sheep using the aforementioned specific primers.

[0015] Specifically, according to a specific embodiment of the present invention, the method for improving the fertility of Ujumqin sheep includes the following steps:

[0016] (1) Extract genomic DNA from the Ujumqin sheep to be tested;

[0017] (2) Using the genomic DNA of Ujumqin sheep extracted in step (1) as a template, PCR amplification was performed using specific primers to obtain the amplification product;

[0018] (3) Determine the genotype of the 1273rd nucleotide of the HIRA gene in the Ujumqin sheep genome in the amplification product, and select Ujumqin sheep with the AA genotype at the 1273rd position of the HIRA gene coding region as the parent for breeding.

[0019] The detection method for c.1273G>ASNP of the HIRA gene in the Ujumqin sheep genome is as follows:

[0020] The fragment of nucleotides 72677979 to 72726550 of the HIRA gene of Ujumqin sheep with GenBank Accession Number NC_056070.1 was amplified by PCR, and the amplified product was sequenced.

[0021] If a single peak appears at position 72,697,217 of chromosome 17 and the genotype is G, then the genotype is GG.

[0022] If a peak appears at the position of the 72,697,217th base on chromosome 17, the genotype is GA. If a single peak appears at the position of the 72,697,217th base on chromosome 17 and the genotype is A, the genotype is AA.

[0023] The mutation at this site is selected from alanine at position 425 of the amino acid sequence. When the site is G, the corresponding amino acid is alanine; when the site is A, the corresponding amino acid is threonine.

[0024] The average number of lambs born to Ujumqin sheep with the AA genotype is higher than that of the GA genotype, and the average number of lambs born to Ujumqin sheep with the GA genotype is higher than that of the GG genotype.

[0025] In this invention, the reproductive capacity of Ujumqin sheep is specifically reflected in the number of lambs produced per litter.

[0026] According to the specific embodiments of the present invention, in the method for increasing the reproductive capacity of Ujumqin sheep, during step (2) PCR amplification, the total volume of the amplification system is 20 μL, including 1 μL each of upstream and downstream primers, 1 μL of template, 6 μL of premixed solution, and 11 μL of deionized water.

[0027] According to the specific embodiments of the present invention, the method for improving the reproductive capacity of Ujimqin sheep, step (2) PCR amplification program is as follows: 95℃ pre-denaturation for 3 min, 98℃ denaturation for 10 s, 62℃ annealing for 15 s, 68℃ extension for 57 s, 30 cycles, 68℃ extension for 7 min, storage at 4℃, and then sequencing.

[0028] The beneficial effects of this invention are:

[0029] This invention discovered that the nucleotide sequence of the HIRA gene c.1273G>T, with NCBI Reference Sequence NC_056070.1, contains a molecular marker associated with the polyfertility trait of Ujumqin sheep in the region from 72677979bp to 72726550bp on chromosome 17 of sheep.

[0030] This invention designs specific primers and uses DNA sequencing technology to detect whether there is a G→A mutation at 1273bp in the coding region of the HIRA gene in the Ujumqin sheep genome, to determine the genotype of individual Ujumqin sheep at this site, and to realize the detection of single nucleotide polymorphism of HIRA gene c.1273G>A, so as to compare the polymorphism of HIRA gene c.1273G>A in the Ujumqin sheep breed.

[0031] Statistical results show that the specific primers of this invention can detect the molecular marker, which can be used to assist in the breeding of Ujumqin sheep, screen for Ujumqin sheep with high fertility, and increase the number of lambs born in Ujumqin sheep. The method of this invention can be used as an effective method to assist in improving or screening for the polyfertility trait of Ujumqin sheep. Attached Figure Description

[0032] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0033] Figure 1 This is a PCR product diagram of HIRA NC_056070.1:c.1273G>A of the present invention.

[0034] Figure 2 This is a sequencing result diagram of HIRA NC_056070.1:c.1273G>A of the present invention. Detailed Implementation

[0035] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be described in detail below. Obviously, the described embodiments are only a part of the embodiments of this invention, and not all of them. Based on the embodiments of this invention, all other implementation methods obtained by those skilled in the art without creative effort are within the scope of protection of this invention.

[0036] Example 1: Establishment of a method for detecting molecular markers for the polyfertility trait in Ujumqin sheep

[0037] 1) Template material preparation

[0038] Blood samples were collected from Ujumqin sheep, and the number of lambs and parity were recorded. The Ujumqin sheep collected came from East Ujumqin Banner, Xilingol League, Inner Mongolia. The blood samples were stored in anticoagulant tubes for later use.

[0039] 2) Sequencing of PCR products

[0040] Twelve Ujumqin sheep (six consecutive twin-lambing ewes and six consecutive single-lambing ewes) were selected for PCR product sequencing, and the SNP site located in the coding region of the HIRA gene, namely NC_056070.1:c.1273G>A, was found.

[0041] 3) Primer design

[0042] Based on the sheep gene sequence reported in GeneBank (GeneBank accession number: NC_056070.1), this invention designed upstream and downstream primers F and R. Through comparison and screening, the final primer sequences are as follows:

[0043] F:5'-CCGAGGGTTCCAATTTCAGTT-3';

[0044] R:5'-TGCAGCCACAAGCACAGG-3'.

[0045] Using the genome extracted from Ujumqin sheep experimental materials as a template, amplification was performed using the aforementioned primers.

[0046] The amplification system for the upstream and downstream primers was consistent, with a total volume of 20 μL, including 1 μL each of the upstream and downstream primers, 1 μL of the template, 6 μL of the premix, and 11 μL of deionized water.

[0047] The amplified products were subjected to 30 cycles of pre-denaturation at 95℃ for 3 min, denaturation at 98℃ for 10 s, annealing at 62℃ for 15 s, extension at 68℃ for 57 s, followed by a final extension at 68℃ for 7 min. The amplified products were then stored at 4℃ and sequenced.

[0048] The PCR amplification results of HIRA NC_056070.1:c.1273G>A are shown below. Figure 1 .

[0049] The nucleotide sequence of the PCR product is shown in SEQ ID NO.3:

[0050] Ccgagggtctcaatttcagttcagcgagagtttcttgctatttgttctgcgtcagacctgccagagggtcaggcattcactcgcatccccaggtgtagacgccttgaaggctgtaagcgcccgagtagggtgcagggccgctcctgacacgtagtcagcagcaggcaggccgcgggagggctcagggaccctgcccggggccccgtcttccctgagtggggagctactcacaacttgcccacgggtgggcagcgtcacacccctcaatcggccttccccagagccgcatccaccaggccacctacggcaagagcctggccatcatgaccgaggcccagctgtccaccgctgtcatcgagaaccccgagatgctgcagtaccagcacaggcagcagcagctggaccacaagggccccgcggccagggacgccgcacccgcggccagggacacaggctccgccccctcggtcgctggcgtcgtcaatggggagagcctggaggacattcggaaggtgagggctgggcctggtgctccgaggacactgcccacagcctttccagagcggtgcacccagggcagtgggcctcgggccctgccctctggagactatcagctccttgtctttccttgggcgccgtgctcccctggggtgcgggtgcgggtggggggggtgggaagggcaacgacggagct gggggctaaagccatccccaggtgctcgtgcagggcgccccccgcccccggtggagcgcacacagggtgcggcgggagccctcggttatgagcctttggtgggaagcttttacaaaccatggtttagagacaggaggtcaggtctcgcccggtaggtgactccgcgtggagcctgtgcttgtggctgca

[0051] The sequencing results are shown in Figure 2If a single peak appears at the 72,697,217th base position on chromosome 17 and the genotype is G, then the genotype is GG. If a double peak appears at the 72,697,217th base position on chromosome 17, then the genotype is GA. If a single peak appears at the 72,697,217th base position on chromosome 17 and the genotype is A, then the genotype is AA.

[0052] Example 2: Statistical analysis of HIRA genotype and its relationship with polygamous traits in Ujumqin sheep population

[0053] Genetic testing of Ujumqin sheep was performed using primers designed in Example 1, and the genotype frequency and allele frequency of Ujumqin sheep were calculated. The statistical results are shown in Table 1.

[0054] Table 1. Statistical results of genotype and allele frequencies in Ujumqin sheep.

[0055]

[0056] Note: The number in parentheses is the sample size.

[0057] The results are shown in Table 1. The genotype frequencies of GG, GA and AA in Ujumqin sheep were 0.700, 0.248 and 0.052, respectively, and the allele frequencies of G and A were 0.824 and 0.176, respectively. The G allele was the dominant allele.

[0058] The association between the HIRA genotype and the polyfertility trait in Ujumqin sheep was analyzed, and the specific experiments are as follows:

[0059] (1) Individual genotype analysis was performed on some loci in the selected experimental sample population to calculate allele frequencies and genotype frequencies, and χ² analysis was performed. 2 test.

[0060] (2) Based on the experimental results, the gene frequency and genotype frequency of the locus were calculated, and the Hardy-Weinberg equilibrium chi-square test was performed on the distribution of genotypes at the locus. SPSS 19.0 software was used to analyze the association between the polyfertility trait and genotype in the Ujumqin sheep population. The statistical model included genotype as a fixed effect and rams as a random effect. A mixed linear model (MLM) was constructed as follows:

[0061] Y = μ + G + R + e;

[0062] Where: Y is the recorded number of lambs; μ is the population mean; G is the genotype effect; R is the ram effect; e is the random residual effect.

[0063] The average number of lambs born to different genotypes in Ujumqin sheep and the standard error are shown in Table 2.

[0064] Table 2. Statistical results of average and standard error of lambing number in Ujumqin sheep with different genotypes.

[0065]

[0066] Note: a, c: p < 0.01.

[0067] The results are shown in Table 2. The AA genotype had a 0.38 higher lambing number than the GG genotype, indicating that the mutation from the G allele to the A allele has a significant impact on the lambing trait of Ujumqin sheep, and the differences in lambing number between different genotypes at this locus are statistically significant (p<0.01). These results suggest that the genetic diversity at this locus can be used to screen for breeding sheep that improve the multiparity trait of Ujumqin sheep.

[0068] Example 3: Methods to improve the fertility of Ujumqin sheep

[0069] The method for improving the fertility of Ujumqin sheep in this embodiment includes the following steps:

[0070] (1) Extract genomic DNA from the Ujumqin sheep to be tested;

[0071] (2) Perform PCR amplification using specific primers;

[0072] The genome extracted from Ujumqin sheep experimental materials was used as a template and amplified using the primers described in Example 1. The total volume of the amplification system was 20 μL, including 1 μL each of the upstream and downstream primers, 1 μL of the template, 6 μL of the premix solution, and 11 μL of deionized water.

[0073] Pre-denaturation at 95℃ for 3 min, denaturation at 98℃ for 10 s, annealing at 62℃ for 15 s, extension at 68℃ for 57 s, 30 cycles, extension at 68℃ for 7 min, storage at 4℃, sequencing.

[0074] (3) Determine the genotype of the HIRA gene at position 1273 in the Ujumqin sheep genome.

[0075] If a single peak appears at the 72,697,217th base position on chromosome 17 and the genotype is G, then the genotype is GG. If a double peak appears at the 72,697,217th base position on chromosome 17, then the genotype is GA. If a single peak appears at the 72,697,217th base position on chromosome 17 and the genotype is A, then the genotype is AA.

[0076] Ujumqin sheep with the AA genotype at position 1273 of the HIRA gene coding region were selected as breeding parents.

[0077] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention should be included within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope of the claims.

Claims

1. A method for screening Ujumqin sheep with high fertility, characterized in that, The method includes the step of amplifying the genomic DNA of Ujumqin sheep using specific primers; The specific primer sequences are as follows: SEQ ID NO.1: 5'-CCGAGGGTCTCAATTTCAGTT-3'; SEQ ID NO.2: 5'-TGCAGCCACAAGCACAGG-3'; The specific primers are specific primers for the c.1273G>A SNP site of the HIRA gene in the Ujumqin sheep genome. The nucleotide sequence of the amplification product is shown in SEQ ID NO.3; Determine the genotype of nucleotide 1273 of the HIRA gene in the Ujumqin sheep genome of the amplified product, and select Ujumqin sheep with the AA genotype at nucleotide 1273 of the HIRA gene coding region.

2. The method for screening highly fertile Ujumqin sheep according to claim 1, characterized in that, The method includes the following steps: (1) Extract genomic DNA from the Ujumqin sheep to be tested; (2) Using the genomic DNA of Ujumqin sheep extracted in step (1) as a template, PCR amplification was performed using specific primers to obtain the amplification product; (3) Determine the genotype of the 1273rd nucleotide of the HIRA gene in the Ujumqin sheep genome in the amplification product, and select Ujumqin sheep with the AA genotype at the 1273rd position of the HIRA gene coding region.

3. The method for screening highly fertile Ujumqin sheep according to claim 2, characterized in that, In step (2) PCR amplification, the total volume of the amplification system is 20 μL, including 1 μL of specific primers, 1 μL of template, 6 μL of premixed solution, and 11 μL of deionized water.

4. The method for screening highly fertile Ujumqin sheep according to claim 2, characterized in that, The amplification program in step (2) is as follows: 30 cycles of pre-denaturation at 95℃ for 3 min, denaturation at 98℃ for 10 s, annealing at 62℃ for 15 s, extension at 68℃ for 57 s, and extension at 68℃ for 7 min.

Images