A method for evaluating rice yield based on kasp multi-site detection

By using KASP multi-site detection technology, specific primer pairs were designed for key gene loci in rice, solving the problems of high cost, low efficiency, and environmental interference in rice breeding, and achieving efficient and accurate yield assessment and breeding optimization.

CN119776500BActive Publication Date: 2026-04-21SOUTH CHINA AGRICULTURAL UNIVERSITY +2
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510075500.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-01-17
Publication Date
2026-04-21
Estimated Expiration
2045-01-17

AI Technical Summary

Technical Problem

In existing rice breeding technologies, the breeding process relies on large-scale populations and multiple trait identifications, resulting in high costs, low efficiency, and yield assessment that is subject to environmental interference and difficult to control precisely.

Method used

Using KASP multi-site detection technology, specific primers were designed to perform molecular marker-assisted selection of key rice gene loci GW8, GNP1, GE, GS3, and GL3.2. Through KASP primer design and specificity testing, combined with genotype data, materials were selected for efficient and accurate yield assessment.

Benefits of technology

This has improved the accuracy and efficiency of rice yield assessment, shortened the breeding cycle, reduced costs, avoided environmental interference, and improved the precision of the breeding process.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119776500B_ABST
    Figure CN119776500B_ABST
Patent Text Reader

Abstract

This invention discloses a method for evaluating rice yield based on KASP multi-site detection, belonging to the field of rice breeding technology. The method includes the following steps: (1) using the Japonica rice 'Nipponbare' genome IRGSP-1.0 as a reference genome, determining the SNP genotypes at the following locations: GW8 gene at chromosome 8 (26505387 bp), GNP1 gene at chromosome 3 (36150781 bp), GE gene at chromosome 7 (24714487 bp), GS3 gene at chromosome 3 (16733441 bp), and GL3.2 gene at chromosome 3 (17340602 bp); (2) the count of homozygous mutations at the above 5 SNP sites is 1, the count of heterozygous mutations is 0.5, and the count of no mutations is 0; if the total mutation count of the 5 SNP sites is ≥4.5, it is presumed to be a high-yielding material. This invention provides technical support for evaluating the yield of rice materials.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of rice breeding technology, and in particular relates to a method for evaluating rice yield based on KASP multi-site detection. Background Technology

[0002] Rice is one of the world's most important food crops, with global consumption reaching 700 million tons annually. This demand continues to rise due to population growth and economic development. Increased rice production can ensure global food security, promote agricultural development, increase farmers' income, and contribute to socio-economic progress.

[0003] In recent years, pedigree technology has been used to cultivate a number of high-yielding new varieties. However, conventional hybridization and backcrossing selection often rely on large populations and extensive trait identification, significantly increasing breeding input and costs. With the successful cloning of key rice genes, breeders have been able to develop molecular markers for gene functional sites, analyze the gene combinations of target traits within breeding materials, and then, based on clear breeding optimization goals, introduce superior genes to achieve the propagation of new varieties. Furthermore, in breeding practice, many traits, such as yield, are often affected by external environmental factors, making accurate assessment difficult. However, by analyzing different allelic combinations of key genes controlling these traits, we can effectively identify them. This method bypasses direct observation of phenotypic traits, eliminates interference from environmental factors, improves the accuracy of breeding, optimizes the selection process, and accelerates the breeding process.

[0004] Rice yield is controlled by quantitative trait loci. Currently, several yield-related genes, such as GW8, GNP1, GE, GS3, and GL3.2, have been cloned through genetic segregation populations. These gene sequences exhibit extensive natural variation. For example, a base variation at position 16733441 in the GS3 coding region leads to amino acid changes; based on this SNP, the core germplasm material GS3 can be divided into two haplotypes, with certain yield differences between them. A 3bp deletion in the GW8 coding region (26501541-26501543) causes a frameshift in amino acid translation, resulting in gene function loss. Therefore, developing markers using variable gene base sites to identify favorable allelic variations in breeding materials plays a crucial role in the breeding of high-yielding rice varieties. However, different genes increase rice yield through different pathways; for example, GNP1 mainly improves panicle type; GE mainly regulates grain weight; while GW8, GS3, and GL3.2 mainly regulate grain type. Therefore, high-yield breeding can be achieved by simultaneously improving multiple yield components. Therefore, developing a complete set of functional markers for related genes can be used to perform targeted improvement of a certain trait in different breeding materials using marker-assisted selection (MAS) technology, or to carry out aggregated improvement of multiple traits.

[0005] KASP genotyping is a unique competitive allele-specific PCR technique that enables high-precision biallelic genotyping of various genomic nucleic acid samples for single nucleotide polymorphisms (SNPs) and indels (insertion deletions). KASP is simple to operate, provides stable and accurate analysis, and is relatively inexpensive. Molecular markers developed using the aforementioned five gene functional loci can be used to screen and optimize the combination of dominant alleles at yield-related gene loci in propagation materials, achieving effective transfer and accumulation of target beneficial genes, thereby increasing crop yield. This not only avoids the blind spots of traditional breeding, significantly reducing the required population size, but also saves costs and greatly improves the accuracy and efficiency of the selection process. Summary of the Invention

[0006] This invention discloses a method for KASP multi-site detection and evaluation of rice yield, as detailed below:

[0007] a. KASP primer design and specificity testing

[0008] Five key SNP sites with positive yield effects were obtained from the "Core-1" liquid-phase breeding chip of rice developed by Borui Biotechnology Co., Ltd. (Shijiazhuang), based on gene function and associated secondary yield traits. KASP primers (including two upstream primers and one downstream primer) were designed for these sites using Primer3 (https: / / bioinfo.ut.ee / primer3-0.4.0 / ). The specificity of KASP primers was tested using the Primer-BLAST website (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / index.cgi). For primer pairs with high specificity, FAM (SEQ ID NO.18: 5'-GAAGGTGACCAAGTTCATGCT-3') and HEX (SEQ ID NO.19: 5'-GAAGGTCGGAGTCAACGGATT-3') fluorescent sequences were added to the 5' ends of the two upstream primers, respectively (referred to as F and H, respectively; the common downstream primer is referred to as C) to obtain the final KASP primers. KASP primers were synthesized, and PCR amplification was performed using F+C and H+C as upstream and downstream primer combinations, respectively, with "Nipponbare" rice leaf DNA as the amplification template. The target band was detected by agarose gel electrophoresis. The amplified band size should meet expectations, and the specificity should be high (single band, non-diffuse, no tailing) before it can be used for subsequent KASP detection.

[0009] b. Select testing materials based on phenotypic and genotypic data.

[0010] Based on the phenotypic data of the three yield elements (number of effective panicles per plant, number of grains per panicle, and thousand-grain weight) of rice population materials, the simulated yield per plant was calculated for all materials using the formula: "Simulated yield per plant = number of effective panicles per plant × number of grains per panicle × thousand-grain weight ÷ 1000". The number of effective panicles per plant, number of grains per panicle, and thousand-grain weight were obtained from reported data or small-scale planting calculations. According to the simulated yield per plant, from highest to lowest, eight high-yielding, eight medium-yielding, and eight low-yielding materials were selected from the top third, middle third, and bottom third, respectively, forming the "high-yielding group," "medium-yielding group," and "low-yielding group." The selection criteria were that the simulated yields per plant in each group of eight materials should not be too close, the origins should be as different as possible, and the material types should ideally include both local materials (landrace) and breeding lines (breeding line) to ensure the representativeness of the selected materials for the rice population. These 24 materials were used as testing materials for subsequent verification of the accuracy of the designed KASP.

[0011] c. Verification of KASP primer typing effectiveness

[0012] The five sites selected in “a.KASP primer design and specificity test” have a certain positive effect on rice yield. Therefore, the yield of the material can be inferred by counting the number of mutation sites in the material. The rules are as follows: count the number of mutation sites in the material. If a site has a homozygous mutation, the count is 1; if it has a heterozygous mutation, the count is 0.5; if no mutation occurs, the count is 0. If the number of mutation sites in the five sites is ≥4.5, it is inferred to be a high-yielding material; >3 and <4.5, it is inferred to be a medium-yielding material; ≤3, it is inferred to be a low-yielding material.

[0013] The amplification system and amplification conditions for KASP are as follows:

[0014] Using the 2×Master Mix for ASPCR kit (Chengdu Hanchen Guangyi Technology Co., Ltd.), a 10 μL PCR system was prepared (5 μL Mix, 0.1 μL each of F and H, 0.3 μL C, 3.5 μL LEPC water; 1 μL of 50 ng / μL sample DNA). The PCR program was as follows: pre-denaturation at 95℃ for 10 min; cycle 2 (denaturation at 95℃ for 20 s, annealing / extension at 61℃-55℃ (-0.6℃ / cycle) for 40 s) for 10 cycles; cycle 3 (denaturation at 95℃ for 20 s, annealing / extension at 55℃ for 40 s) for 27 cycles (if the clustering is not obvious, 1-3 more cycles can be added); fluorescence scan at 30℃ for 30 s.

[0015] Leaves from 24 materials in section "b. Determination of field yield of representative materials" were collected, and gDNA was extracted using the TPS method (Wang et al., 2020). The concentration of the extracted gDNA was adjusted to 50 ng / μL, and KASP-PCR was performed on the gDNA of the 24 materials using the 2×Master Mix for ASPCR kit (Chengdu Hanchen Guangyi Technology Co., Ltd., catalog number HC-1011) and the KASP primers designed for the 5 sites in section "a. KASP primer design and specificity test". The genotyping results of the control materials were analyzed using a KASP microplate reader (POLARstar Omega fully automated multifunctional microplate reader) and KlusterCaller software. If the material cluster boundaries were clear, the KASP primer pair was preliminarily identified as suitable for detection.

[0016] In the KASP results graph, the materials are clustered into red dot regions (near the y-axis), green dot regions (xy-axis angle bisectors), and blue dot regions (near the x-axis). For the sites selected in "a. KASP primer design and specificity testing," 200 bp fragments upstream and downstream of these sites were obtained from the genome, totaling 401 bp fragments including the SNP site. Sequencing primers for this 401 bp fragment were designed using Primer3. A representative material was selected from each of the red, green, and blue dot regions in the KASP results graph for each SNP site. The gDNA from these three materials was amplified using the aforementioned 401 bp sequencing primers, and the amplified fragments were sent to a biotechnology company (Guangzhou Ruibo Biotechnology Co., Ltd.) for Sanger sequencing to determine the genotypes represented by the materials in the red, green, and blue dot regions.

[0017] According to this method, the number of mutation sites in 24 materials can be calculated from the KASP results. It can be determined whether the number of mutation sites in each material matches the yield group (low-yield group, medium-yield group, and high-yield group) to judge the overall effect of the primer combination.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] This invention has clear technical indicators, strong operability, and certain technical innovation, providing technical system support for developing KASP primer combinations for rice yield-related gene loci and for rapid detection and evaluation of rice material yield. Attached Figure Description

[0020] Figure 1 The results are the KASP detection results for 5 sites in Example 1.

[0021] Figure 2 The KASP test results for 27 materials at 5 loci in Example 3 are shown in the following 5 images from top to bottom and from left to right. These images show the genotyping results of the 27 representative materials at the five loci: GW8, GNP1, GE, GS3, and GL3.2. The red dots represent materials with mutations at the loci, the blue dots represent materials without mutations at the loci, and the green dots represent materials with heterozygous mutations at the loci.

[0022] Figure 3 This is a Sanger sequencing peak diagram of the GS3 site in the three materials from Example 3. Detailed Implementation

[0023] Example 1: KASP primer design and specificity test

[0024] This embodiment provides a method for developing KASP primer combinations for rice yield-related gene loci, the specific steps of which are as follows:

[0025] From the loci on the "Core 1" liquid-phase breeding chip for rice, one locus each of the following yield-related genes was selected: GW8 (RAP-DB number Os08g0531600, the same below), GNP1 (Os03g0856700), GE (Os07g0603700), GS3 (Os03g0407400), and GL3.2 (Os03g0417700), for a total of 5 loci. KASP primers were designed to form a "KASP primer set for rice yield detection" consisting of 5 pairs of rice yield-related genes. These 5 genes involve multiple secondary yield traits, with GW8 related to grain width, GNP1 related to grain number per panicle, GE related to grain weight, and GS3 and GL3.2 related to grain length. The KASP primers are as follows:

[0026] (1) Primer 1: A pair of KASP primers were designed for the GW8 gene and their specificity and genotyping efficacy were verified.

[0027] Using the Japonica rice 'Nipponbare' genome IRGSP-1.0 as the reference genome, the SNP of the primers was designed at 26505387bp on chromosome 8 (C for wild type / A for mutant).

[0028] The primer sequences are as follows:

[0029] Specific primer F1 (SEQ ID NO.1):

[0030] GAAGGTGACCAAGTTCATGCTGCGAGATCAGCTTCGGCA C ;

[0031] Specific primer H1 (SEQ ID NO.2):

[0032] GAAGGTCGGAGTCAACGGATTCGAGATCAGCTTCGGCA A ;

[0033] Universal primer C1 (SEQ ID NO.3):

[0034] GAGGAGCTACCGTCTTCAGAAGTG.

[0035] (2) Primer 2: A pair of KASP primers were designed targeting the GNP1 gene and their specificity and genotyping efficacy were verified.

[0036] Using the Japonica rice 'Nipponbare' genome IRGSP-1.0 as the reference genome, the SNP of the primers was located at 36150781 bp on chromosome 3 (G for wild type / A for mutant).

[0037] The primer sequences are as follows:

[0038] Specific primer F2 (SEQ ID NO.4):

[0039] GAAGGTGACCAAGTTCATGCTCCAGCTGCTGGGGATGA G ;

[0040] Specific primer H2 (SEQ ID NO.5):

[0041] GAAGGTCGGAGTCAACGGATTCCAGCTGCTGGGGATGA A ;

[0042] Universal primer C2 (SEQ ID NO.6):

[0043] CCGATGGAGATATGATAGATGCAA.

[0044] (3) Primer 3: A pair of KASP primers were designed for the GE gene and their specificity and genotyping efficacy were verified.

[0045] Using the Japonica rice 'Nipponbare' genome IRGSP-1.0 as the reference genome, the SNP of the primers was located at 24714487bp on chromosome 7 (A for wild type / C for mutant).

[0046] The primer sequences are as follows:

[0047] Specific primer F3 (SEQ ID NO.7):

[0048] GAAGGTGACCAAGTTCATGCTAGCGGCACGGCGAC A ;

[0049] Specific primer H3 (SEQ ID NO.8):

[0050] GAAGGTCGGAGTCAACGGATTAGCGGCACGGCGAC C ;

[0051] Universal primer C3 (SEQ ID NO.9):

[0052] GAGGTCGTACCCTTCGGTGAC.

[0053] (4) Primer 4: A pair of KASP primers were designed targeting the GS3 gene and their specificity and genotyping efficacy were verified.

[0054] Using the Japonica rice 'Nipponbare' genome IRGSP-1.0 as the reference genome, the SNP of the primers was located at 16733441 bp on chromosome 3 (G for wild type / T for mutant).

[0055] The primer sequences are as follows:

[0056] Specific primer F4 (SEQ ID NO.10):

[0057] GAAGGTGACCAAGTTCATGCTCAGCAGGCTGGCTTACTCTCT G ;

[0058] Specific primer H4 (SEQ ID NO.11):

[0059] GAAGGTCGGAGTCAACGGATTCAGCAGGCTGGCTTACTCTCT T ;

[0060] Universal primer C4 (SEQ ID NO.12):

[0061] AGGGTGAAATAAATTCAATCGAAGG.

[0062] (5) Primer 5: A pair of KASP primers were designed targeting the GL3.2 gene and their specificity and genotyping efficacy were verified.

[0063] Using the Japonica rice 'Nipponbare' genome IRGSP-1.0 as the reference genome, the SNP of the primers was located at 17340602 bp on chromosome 3 (T for wild type / C for mutant).

[0064] The primer sequences are as follows:

[0065] Specific primer F5 (SEQ ID NO.13):

[0066] GAAGGTGACCAAGTTCATGCTACAGCCCCATACTCCTTGATCA T ;

[0067] Specific primer H5 (SEQ ID NO.14):

[0068] GAAGGTCGGAGTCAACGGATTACAGCCCCATACTCCTTGATCA C ;

[0069] Universal primer C5 (SEQ ID NO.15):

[0070] CCTGAACATGTCGCTGGAGAT.

[0071] Agarose gel electrophoresis showed that the KASP primers designed for the above five sites amplified bands as expected, with high specificity (single bands, no diffusion, no tailing), and can be used for subsequent KASP detection. Figure 1 ).

[0072] Example 2: Selection of testing materials based on simulated yield per plant

[0073] Using 593 natural rice germplasm accessions collected by the National Engineering Research Center for Space Breeding of Plants as population materials, the simulated yield per plant was calculated based on the phenotypic data of the three yield elements (number of effective panicles per plant, number of grains per panicle, and thousand-grain weight) of the population materials collected in the late 2019 crop. Following the procedure described in "b. Selection of test materials based on phenotypic and genotypic data," 10 materials each from the high-yield, medium-yield, and low-yield groups were selected, totaling 24 materials (Table 1). The materials in Table 1 are recorded in Appendix S1 of Xie H, Lin C, Lu W, et al. OsBLS6.2: Arice bacterial leaf streak resistance gene identified by GWAS and RNA-seq. The Crop Journal 11.6(2023):1862-1871.

[0074] Table 1. Yield factors and simulated yield per plant for 124 representative test materials.

[0075] serial number Place of origin type Simulated yield per plant (g) Yuenanheinuo Vietnam Local materials 203.24 Suinongjiahong6 China Local materials 199.17 Dongnuo2 China Local materials 179.04 Zhanjiangnongkeheimi China Local materials 166.97 Hongnian2 China Local materials 155.24 Wuchuanhuangpoheimi China Local materials 128.06 Jinnuo6hao China breeding materials 126.31 Heinuo1 China Local materials 108.76 Yuetaiyouzhan China breeding materials 77.58 Xinyinchanglizhong China Local materials 76.37 NsicRc11 the Philippines Local materials 72.29 Om6073 Vietnam Local materials 59.20 646-K2001 China Local materials 54.82 Biaojidao China breeding materials 53.22 Cimelati Indonesia Local materials 48.30 Nigeria5 Nigeria Local materials 40.45 Tianhongtian China Local materials 28.89 Basmati 370 Pakistan breeding materials 28.45 Meghi India Local materials 25.71 Om66 Vietnam Local materials 24.79 S562 China Local materials 22.88 Chuan7hao China breeding materials 21.70 Meijianglixian China Local materials 18.05 Yuehesimiao China breeding materials 12.59

[0076] Example 3: Selection of testing materials based on simulated yield per plant

[0077] gDNA from 24 leaf samples in Example 2 was analyzed at 5 loci using KASP, and the results are as follows: Figure 2 .

[0078] Primers for Sanger sequencing of five loci were designed according to the method described in "c.KASP Primer Genotyping Effectiveness Verification". The primer sequences for GS3 and GW8 loci are shown below as examples. Taking GS3 Sanger sequencing as an example, according to... Figure 2 Based on the KASP results of GS3 sequencing, three materials were selected: Biaojidao (blue dot region), Tianhongtian (green dot region), and Nsic Rc 11 (red dot region). The genotypes of these three materials were detected using GS3 sequencing primers (see below). (Sequencing peak diagram results are shown below.) Figure 3 ( ), to determine the genotype represented by different colors.

[0079] GS3 sequencing upstream primer (SEQ ID NO.16):

[0080] TATTTTATTGAAGTTGCTTAAAAAGATAACG;

[0081] GS3 sequencing downstream primer (SEQ ID NO.17):

[0082] TCCCTCAGACATCACCTGAAAAG.

[0083] Confirmed using Sanger sequencing results Figure 2 In the KASP results image, red dots represent materials with mutations at the sites, blue dots represent materials without mutations at the sites, and green dots represent materials with heterozygous mutations at the sites. Based on the mutation distribution of the 24 materials at 5 sites, the detection performance of this primer combination was scored and evaluated (Table 2), showing good detection performance.

[0084] Table 2. Evaluation of Genotyping Effect of KASP Primer Combinations for Rice Yield-Related Loci

[0085]

[0086]

[0087] Table Notes: Above the names of the five loci are the relevant phenotypes of the genes containing those loci, and below are the mutation status of the loci in 24 representative materials. "1" indicates that a locus in a given material is a mutant genotype, and the number of mutation sites is recorded as 1; "0.5" indicates a heterozygous mutation, and the number of mutation sites is recorded as 0.5; "0" indicates no mutation occurred, and the number of mutation sites is recorded as 0. "Total Detection Score" is the total number of mutation sites in the five loci for a given material. "Group Score Standard" is the theoretically required total detection score for the group to which a given material belongs. The "Matching" column determines whether the "Total Detection Score" meets the "Group Score Standard".

[0088] Rice yield is a crucial comprehensive trait in rice breeding, involving numerous secondary phenotypes such as grain phenotype, panicle phenotype, and tiller phenotype. In breeding practice, it is difficult to qualitatively detect yield using a single KASP marker. This invention utilizes a set of gene loci closely related to rice yield to detect and infer yield performance in rice, enabling yield prediction and elimination of low-yielding materials at the seedling stage, thereby shortening the breeding cycle and reducing breeding costs.

[0089] This invention takes into account the numerous secondary phenotypes involved in yield. When selecting representative loci, it strives to cover a broad range of secondary phenotypes, enabling a single detection to assess multiple secondary phenotypes and thus making the yield evaluation more accurate. This primer combination involves four secondary phenotypes: grain width (GW8), number of grains per panicle (GNP1), grain weight (GE), and grain length (GS3 and GL3.2). These secondary phenotypes encompass both grain and panicle phenotypes, aligning with the current trend in rice breeding to select materials with large panicles, long grains, and high yield.

[0090] The method described in this invention combines theoretical verification and experimental verification when developing KASP primers, rigorously validating the specificity and detection accuracy of the primers to better preserve primers with good detection performance. In addition to using the Primer-BLAST website to confirm the theoretical specificity of the loci on the rice genome from a bioinformatics analysis perspective (theoretical verification), agarose gel electrophoresis and Sanger sequencing were performed on the loci, and the detection accuracy (overall concordance rate) of the primer pairs was evaluated based on the KASP results (experimental verification). This multi-dimensional and multi-method verification ensures that the KASP primers developed in this invention have high detection specificity and accuracy.

[0091] This invention also provides a method for selecting suitable representative materials from rice populations to verify the detection effect of yield-related KASP primers. This method can select materials with strong representativeness and gradient differences in yield, resulting in a more ideal detection effect for the primers. When selecting representative materials, this invention divides the materials into high-yield, medium-yield, and low-yield groups, verifying the accuracy of the primers by group rather than by individual materials, thus providing a more objective detection effect. When selecting materials for each group, multiple characteristics of the materials are considered as much as possible, such as origin, type, and yield similarity. Therefore, the obtained representative materials have a high degree of differentiation, simulating to some extent the real situation of large differences between various breeding materials in actual breeding processes, thereby achieving a more realistic detection effect for the primers.

[0092] References

[0093] Xie H, Lin C, Lu W, et al. OsBLS6.2: Arice bacterial leafstreakresistancegene identified by GWAS and RNA-seq. The Crop Journal 11.6(2023):1862-1871.

[0094] Wang W,Wang J,WuY,et al.Genome-wide analysis ofcoding and non-codingRNAreveals a conserved miR164-NAC regulatory pathway for fruit ripening[J].New Phytologist,2020,225(4):1618-1634.

[0095] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A method for evaluating rice yield based on KASP multi-site detection, characterized in that, The method includes the following steps: (1) Using the IRGSP-1.0 genome of japonica rice "Nipponbare" as a reference genome, the SNP genotypes at the following locations were determined: GW8 gene at 26505387 bp on chromosome 8, GNP1 gene at 36150781 bp on chromosome 3, GE gene at 24714487 bp on chromosome 7, GS3 gene at 16733441 bp on chromosome 3, and GL3.2 gene at 17340602 bp on chromosome 3. The CC site of the GW8 gene SNP is wild-type. For each gene type, AA is a homozygous mutant and AC is a heterozygous mutant. For the GNP1 gene SNP site, GG is wild-type, AA is a homozygous mutant, and AG is a heterozygous mutant. For the GE gene SNP site, AA is wild-type, CC is a homozygous mutant, and AC is a heterozygous mutant. For the GS3 gene SNP site, GG is wild-type, TT is a homozygous mutant, and GT is a heterozygous mutant. For the GL3.2 gene SNP site, TT is wild-type, CC is a homozygous mutant, and TC is a heterozygous mutant. (2) The number of homozygous mutations at the above 5 SNP sites is 1, the number of heterozygous mutations is 0.5, and the number of mutations without mutations is 0; if the total number of mutations at the 5 SNP sites is ≥4.5, it is presumed to be a high-yield material; The rice variety being tested is indica rice.

2. The method according to claim 1, characterized in that, In step (1), the rice to be tested is detected. GW8 Gene, GNP1 Gene, GE Gene, GS3 Genes and GL3.2 The KASP primers for the gene are SEQ ID NO.1-3, SEQ ID NO.4-6, SEQ ID NO.7-9, SEQ ID NO.10-12, and SEQ ID NO.13-15, respectively; among them, SEQ ID NO.1-2, 4-5, 7-8, 10-11, and 13-14 are specific primers, and SEQ ID NO.3, 6, 9, 12, and 15 are universal primers.

3. The method according to claim 2, characterized in that, The amplification system for KASP is as follows: The 10 μL amplification system consisted of: 5 μL Mix, 0.1 μL of each of the two specific primers, 0.3 μL of the universal primer, 3.5 μL of LEPC water, and 1 μL of sample DNA.

4. The method according to claim 3, characterized in that, The concentration of the sample DNA was 50 ng / μL.

5. The method according to claim 4, characterized in that, The KASP amplification program is as follows: pre-denaturation at 95℃ for 10 min; denaturation at 95℃ for 20 s, annealing / extension at 61℃-55℃, -0.6℃ / cycle, 40 s, for 10 cycles; denaturation at 95℃ for 20 s, annealing / extension at 55℃ for 40 s, for 27 cycles.

6. The application of the method according to any one of claims 1-5 in identifying whether rice is high-yielding, wherein the rice is indica rice.

Citation Information

Patent Citations

  • Cloning and application of gene Os03g0626100 for regulating and controlling rice grain length

    CN115094069A

  • Molecular markers of GS3 gene and GW5 gene for improving rice quality

    CN115852033A