Aegifilum el1405 and its application in bacteriostasis and anti-inflammation
By using Eubacterium myxobolus El1405 and its fermentation products, the treatment challenges of Salmonella infection and inflammatory bowel disease have been solved. This approach achieves the inhibition of Salmonella and the reduction of inflammatory factors, alleviates intestinal mucosal damage, and provides a safe and effective antibacterial and anti-inflammatory solution.
Patent Information
- Application Number
- CN202411967307.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-30
- Publication Date
- 2026-05-29
- Estimated Expiration
- 2044-12-30
AI Technical Summary
In the current technology, there is a lack of effective new treatment strategies for bacterial infections such as Salmonella infection and inflammatory bowel disease. The overuse of antibiotics leads to drug resistance and drug residue problems. Moreover, existing treatments have inconsistent effects on inflammatory bowel disease and have significant side effects.
We provide E. myxobacterium EL1405 and its fermentation products, which can be used to prepare liquid or solid bacterial agents for inhibiting Salmonella infection and anti-inflammation. They can also be used to prepare antibacterial agents or drugs to inhibit Escherichia coli, Staphylococcus aureus, Salmonella typhimurium, etc., and to alleviate inflammatory bowel diseases such as ulcerative colitis and Crohn's disease.
Myxobacterium EL1405 significantly inhibits Salmonella infection, reduces viral load, alleviates inflammatory factor levels, reduces intestinal mucosal damage, improves symptoms of inflammatory bowel disease, and provides a safe and effective treatment strategy.
Smart Images

Figure CN119799564B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of microbial technology, and in particular to a myxobacterium el1405 and its application in antibacterial and anti-inflammatory effects. Background Technology
[0002] Bacterial infections, particularly those caused by foodborne pathogens such as Escherichia coli and Salmonella, have become a major public health challenge. Escherichia coli can cause common symptoms like diarrhea and urinary tract infections, and may also lead to more serious complications, posing a serious threat to human health. Salmonella, a widespread and highly pathogenic zoonotic bacterium, has diverse transmission routes and easily infects humans and animals through the food chain, causing severe symptoms such as acute fever, food poisoning, and gastroenteritis, and in extreme cases, even death. In livestock and poultry farming, Salmonella infection also causes significant economic losses, with infected livestock and poultry experiencing reduced productivity or death, and processed animal-derived foods potentially becoming a food safety hazard.
[0003] Currently, antibiotics are the primary treatment for Salmonella infections. However, the overuse of antibiotics has led to serious problems such as the proliferation of drug-resistant bacteria and drug residues, posing new threats to public health and food safety. Therefore, developing novel and effective anti-Salmonella drugs or treatment strategies is of great significance for protecting human and animal health and maintaining food safety.
[0004] Inflammatory bowel disease (IBD) is a group of chronic inflammatory bowel diseases, primarily including ulcerative colitis (UC) and Crohn's disease (CD). The pathogenesis of IBD is complex, involving the interaction of multiple factors such as genetics, environment, immunity, gut microbiota, and mucosal barrier function. Patients typically experience recurrent episodes of abdominal pain, diarrhea, weight loss, intestinal bleeding, and possible intestinal stricture or perforation, which severely impact their quality of life. Although various treatments are available, such as pharmacological therapy (including anti-inflammatory drugs, immunosuppressants, and biologics), nutritional support, and surgery when necessary, treatment outcomes vary from person to person, and some patients may experience drug side effects and a decline in quality of life. Therefore, in-depth research into the pathogenesis of IBD and the exploration of safer and more effective treatments remain a key focus of current medical research.
[0005] Myxobacterium belongs to the genus Eubacterium and is usually isolated from human feces. It is a resident flora in the human gut. Currently, no myxobacterium strains with antibacterial effects have been reported. Summary of the Invention
[0006] To address the problems existing in the prior art, the present invention provides a myxobacterium and its application in inhibiting microorganisms.
[0007] In a first aspect, the present invention provides a *Myxobacterium spp.* Eubacterium limosum El1405, this strain was deposited on July 3, 2024, at the China General Microbiological Culture Collection Center (CGMCC, address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, 100101, China), and is classified as *Myxobacterium*. Eubacterium limosum The accession number is CGMCC No.31231.
[0008] Secondly, the present invention provides a microbial agent comprising the aforementioned Myxobacterium el1405 or its fermentation product.
[0009] The fermentation product described in this invention can be either a product excluding the strain itself (supernatant) or a total product including the strain itself.
[0010] Further, the bacterial agent is a solid bacterial agent, a liquid bacterial agent, or a microbial bacterial agent, wherein the total viable count of *Eubacterium myxobacterium* E1405 in the bacterial agent is 1 × 10⁻⁶. 7-10 CFU / mL.
[0011] Preferably, the bacterial culture of *Eubacterium myxobacterium* El1405 obtained through culture can be prepared as a liquid bacterial agent directly or with the addition of excipients permitted in the field of microbial preparations. Alternatively, the bacterial cells in the bacterial culture can be collected, mixed with excipients permitted in the field of microbial preparations such as freeze-drying protectants, and then freeze-dried under vacuum to prepare a dry powder bacterial agent.
[0012] Thirdly, the present invention provides a method for preparing the bacterial agent, comprising:
[0013] Myxobacterium el1405 was inoculated into a culture medium for fermentation.
[0014] Furthermore, the culture medium is a reinforced Clostridium perfringens medium (RCM), and the fermentation culture conditions include: culturing at 35-40°C under anaerobic conditions for 36-60 hours.
[0015] Fourthly, the present invention provides a product comprising the aforementioned Myxobacterium el1405, or the aforementioned bacterial agent, or prepared by the aforementioned preparation method; the product is preferably an antibacterial agent or a drug.
[0016] Fifthly, the present invention provides the application of the aforementioned Myxobacterium el1405, or the aforementioned bacterial agent, in inhibiting microorganisms; the microorganisms include one or more of Listeria monocytogenes, Staphylococcus aureus, Salmonella typhimurium, or Escherichia coli.
[0017] The present invention further provides the use of the aforementioned Myxobacterium el1405, or the aforementioned bacterial agent, in the preparation of an antimicrobial agent for inhibiting microorganisms; the microorganisms include one or more of Listeria monocytogenes, Staphylococcus aureus, Salmonella typhimurium, or Escherichia coli.
[0018] The present invention further provides the use of the aforementioned *Eubacterium el1405*, or the aforementioned bacterial agent, in the preparation of products for any of the following applications:
[0019] i) Inhibit Salmonella infection,
[0020] ii) Anti-inflammatory,
[0021] iii) Prevention and treatment of inflammatory bowel disease,
[0022] iv) Resisting damage to the intestinal mucosa.
[0023] Furthermore, the inflammatory bowel disease is ulcerative colitis or Crohn's disease.
[0024] Furthermore, the inhibition of Salmonella infection includes: inhibiting weight loss, reducing Salmonella load, reducing inflammatory factor levels, or increasing anti-inflammatory factor levels.
[0025] Furthermore, the reduction of inflammatory factors refers to reducing the inflammatory factors in the serum of Salmonella-infected mice and DSS-induced colitis mice, and the inflammatory factors include: tumor necrosis factor-α (TNF-α), serum interleukin-1β (IL-1β), interleukin-17 (IL-17), interleukin-6 (IL-6), and lipopolysaccharide (LPS).
[0026] Furthermore, the anti-inflammatory factor includes interleukin-10 (IL-10).
[0027] Furthermore, in addition to containing E. myxobacterium EL1405, the aforementioned drug may also contain other effective ingredients that have preventive and therapeutic effects against Salmonella infection or inflammatory bowel disease, and / or contain carriers or excipients permitted in the pharmaceutical field.
[0028] The present invention has the following beneficial effects:
[0029] This invention screened and obtained a strain of *Myxobacterium el1405*, which exhibits inhibitory effects against *Escherichia coli*, *Salmonella*, *Staphylococcus aureus*, and *Listeria monocytogenes*. Animal experiments verified that *Myxobacterium el1405* can alleviate infection symptoms in mice induced by *Salmonella typhimurium* SL1344, resist the tendency of mice to lose weight, and reduce the bacterial load in the liver and spleen of mice infected with *Salmonella typhimurium* SL1344. It is suitable as a probiotic preparation for alleviating *Salmonella* infection, providing a new strategy for the prevention and treatment of *Salmonella*, and has potential clinical application prospects.
[0030] Furthermore, validation using a DSS-induced colitis mouse model showed that the *Mycobacterium el1405* strain provided in this invention can alleviate symptoms such as diarrhea and bloody stools in mice, reduce the disease activity index, lessen colonic shortening, alleviate pathological changes in colonic tissue, and reduce intestinal mucosal damage and inflammatory response in colitis mice. This strain has preventive and therapeutic effects against inflammatory bowel disease, providing a new strategy for its prevention and treatment, and has potential clinical application prospects. Attached Figure Description
[0031] To more clearly illustrate the technical solutions in this invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.
[0032] Figure 1 The image shows the results of the gelatinase activity test provided in Example 2 of the present invention; the positive control is Staphylococcus aureus ATCC 25923, and the negative control is Lactobacillus rhamnoides LGG.
[0033] Figure 2 This is a graph showing the effect of Myxobacterium EL1405 on the body weight of Salmonella-infected mice, provided in Example 3 of this invention; where A is a graph showing the trend of body weight change of mice over 14 days; B is a statistical analysis of the body weight of mice on day 6, and the results are shown as x±SD; *: P<0.05; **: P<0.01; ***: P<0.001; ****: P<0.0001, N=8.
[0034] Figure 3 The statistical analysis of Salmonella load in mouse livers provided in Example 3 of this invention is shown in x±SEM; *: P<0.05; N=6.
[0035] Figure 4 The statistical analysis of Salmonella load in the spleen of mice provided in Example 3 of this invention is shown in x±SEM; *: P<0.05; N=6.
[0036] Figure 5 The following is a graph showing the levels of various factors in the serum of mice in each group provided in Example 3 of the present invention, with the results displayed as x±SEM; *: P<0.05; **: P<0.01; ***: P<0.001; ****: P<0.0001; N=8.
[0037] Figure 6 The following is a graph showing the factor levels in the ileum of each group of mice provided in Example 3 of the present invention, with the results displayed as x±SEM; *: P<0.05; **: P<0.01; ***: P<0.001; ****: P<0.0001; N=8.
[0038] Figure 7 The colon diagram and colon length statistics provided in Embodiment 4 of the present invention are shown in x±SEM; *: P<0.05; **: P<0.01; ***: P<0.001; ****: P<0.0001; N=8.
[0039] Figure 8 The results of the H&E stained pathological sections of mouse colon provided in Example 4 of this invention (scale bar: 200 μm; 50 μm) and pathological score statistical analysis are presented as x±SEM; *: P<0.05; **: P<0.01; ***: P<0.001; ****: P<0.0001; N=5.
[0040] Figure 9 The serum levels of each factor in each group of mice provided in Example 4 of this invention are shown in x±SEM; *: P<0.05; **: P<0.01; ***: P<0.001; ****: P<0.0001; N=8. Detailed Implementation
[0041] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.
[0042] Unless otherwise specified, the experimental methods involved in the following embodiments are conventional methods in the art. For example, you can refer to the experimental manual in the art or follow the conditions recommended in the manufacturer's instructions.
[0043] Unless otherwise specified, all experimental materials and reagents used in the following examples are commercially available, for example:
[0044] Example 1 Isolation and Identification of Strains
[0045] 1. Strains Isolation
[0046] Take an appropriate amount of healthy human fecal samples frozen at -80 ℃ and thaw them slowly on ice. After serial dilution with PBS, transfer 100 μL of the sample suspension at different dilutions to RCM medium, spread it evenly, and incubate it at 37 ℃ under anaerobic conditions for 2 days. Select colonies with different morphological characteristics for subculture and purification. Repeat the subculture 3 times. The purified strains can be used for experiments or cryopreservation.
[0047] This invention isolated a strain of Myxobacterium tumefaciens (named El1405) from fecal samples of healthy individuals and evaluated the antibiotic susceptibility of the strain. The results showed that the strain was sensitive to all tested antibiotics except for penicillin. The efficacy of the strain in alleviating Salmonella infection in mice was also tested (all test methods are described in Examples 2-4).
[0048] 2. Preservation of microbial strains
[0049] The bacterial strain was cryopreserved using RCM liquid medium containing 20% glycerol as the preservation solution. The method was as follows: 1.5 mL of preservation solution was added to a 2 mL preservation tube, and the tube was autoclaved at 121 °C for 15 min before use. After the strain was transferred three times on RCM solid medium, the bacterial cells were scraped into the preservation tube with a sterile inoculation loop and fully incorporated into the preservation solution. After mixing, the tube was frozen at -80 °C.
[0050] 3. Identification of the 16S rRNA gene of the strain
[0051] Bacterial genomic DNA was extracted, and the 16S rRNA gene of the isolated strain was amplified using universal primers for the 16S rRNA gene (27F: AGAGTTTGATCCTGGCTCA; 1492R: AAGTCGTAACAAGGTAGCCGT). The PCR amplification products were sequenced, and the obtained sequences were compared with the NCBI online database using BLAST. The PCR reaction conditions and the composition of the PCR system (30 μL) are as follows:
[0052] PCR reaction system (30 μL): Premix Taq, 15 μL; ddH2O, 12 μL; forward and reverse primers, 1 μL each; genomic DNA, 1 μL.
[0053] PCR amplification conditions: 94 ℃ pre-denaturation, 5 min; 94 ℃ denaturation, 0.5 min, 55 ℃ annealing, 0.5 min, 72 ℃ extension, 0.5 min, 30 cycles; 72 ℃ final extension, 1 min.
[0054] Sequencing results showed that the 16S rRNA gene sequence of the strain (SEQ ID NO.1) was as follows:
[0055]
[0056] The sequencing results of the test strains were compared with those of the NCBI BLAST algorithm. The results showed that the sequence identity of the test strain El1405 with the Myxobacterium type strain ATCC 8486 was 99.87%, which exceeded the interspecies threshold of 98.75%. Therefore, the isolated strains were determined to be Myxobacterium strains.
[0057] Eubacterium mucilaginosa ( Eubacterium limosum El1405 was deposited on July 3, 2024, at the China General Microbiological Culture Collection Center (CGMCC, address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, 100101, China), and classified as *Myxobacterium*. Eubacterium limosum The accession number is CGMCC No.31231.
[0058] Example 2 Characteristic analysis of Myxobacterium EL1405
[0059] 1. Antibiotic susceptibility testing of Myxobacterium EL1405
[0060] Based on the Clinical and Laboratory Standards Institute (CLSI) M100 standard, recommended antibiotics for anaerobic bacteria testing, namely penicillin, ampicillin, imipenem, meropenem, amoxicillin, ceftriaxone sodium, clindamycin, moxifloxacin, metronidazole, and tetracycline, were selected to conduct antibiotic susceptibility tests on *Myxobacterium el1405*. Bacteroides fragilis ATCC 25285 was used as a quality control strain (QC), and its minimum inhibitory concentration (MIC) value was read using the antibiotic concentration gradient method (E-test method).
[0061] The results are shown in Table 1, where S represents sensitive and R represents resistant. Except for penicillin resistance, the Myxobacterium EL1405 strain was sensitive to the other 9 selected antibiotics, indicating a high safety profile.
[0062] Table 1. Antibiotic susceptibility results of *Myxobacterium spp.* CGMCC No. 31231
[0063]
[0064] 2. Gelatinase activity test of Myxobacterium EL1405
[0065] To prepare 3% gelatin-RCM medium: add 3% gelatin to RCM solid medium and autoclave. Adjust the concentration of *Eubacterium myxobolus* El1405 to 1×10⁻⁶. 8CFU / mL, 10 μL was inoculated onto the culture medium and cultured anaerobically at 37 ℃ for 48 h until colonies formed. Saturated ammonium sulfate was then poured onto the plate, and the halo was observed immediately. Staphylococcus aureus ATCC25923 was used as a positive control, and Lactobacillus rhamnoides LGG as a negative control. Results are as follows: Figure 1 As shown, the gelatinase activity test of Myxobacterium EL1405 was negative.
[0066] 3. Biochemical identification of Myxobacterium EL1405
[0067] The biochemical reactions of *Myxobacterium el1405* were identified using the API 50CHB / E bacterial system biochemical identification card manufactured by bioMérieux. The results are shown in Table 2.
[0068] Table 2. Results of Biochemical Characteristic Identification
[0069]
[0070] Note: +, positive; -, negative; w, weak positive.
[0071] 4. Antibacterial test of Eubacterium myxobacterium El1405
[0072] An antibacterial test was conducted on *Eubacterium elutum* EL1405 using the agar stacking method. The concentration of *Eubacterium elutum* EL1405 was adjusted to 1×10⁻⁶ with PBS. 8 CFU / mL, take 10 μL and drop it onto an RCM plate, incubate at 37 ℃ under anaerobic conditions for 24 h until colonies form.
[0073] Adjust the concentration of the pathogenic bacteria to be tested to 1×10⁻⁶. 9 CFU / mL was added at 0.1% to LB medium containing 0.6% agar, mixed well, and then spread onto RCM plates where colonies had formed. After drying, the plates were incubated at 37 ℃ under aerobic conditions for 4-12 h (incubation time depends on the growth rate of the pathogenic bacteria). The antibacterial results of Myxobacterium el1405 are shown in Table 3, indicating that Myxobacterium el1405 has an inhibitory effect on Escherichia coli, Salmonella, Staphylococcus aureus, and Listeria monocytogenes.
[0074] Table 3. Results of antibacterial properties of Eubacterium myxobacterium El1405
[0075]
[0076] 5. Antibacterial test of fermentation supernatant of *Myxobacterium spp.* CGMCC No. 31231
[0077] With a concentration of 1×10 8CFU / mL of *Eubacterium myxobolus* El1405 was inoculated into RCM liquid medium at a ratio of 1:100 and cultured anaerobically at 37 °C for 48 h. The supernatant was collected by centrifugation at 8000 r / min for 10 min and concentrated to 10× using a high-speed freeze dryer. The concentrated supernatant was then filtered through a 0.22 μM filter membrane to obtain 10× sterile fermentation supernatant.
[0078] The Oxford cup method was used to conduct an antibacterial test on the fermentation supernatant of Myxobacterium EL1405 concentrated 10 times. First, LB medium containing 1.5% agar was prepared, and a thin layer was poured onto a petri dish. After drying, an autoclaved Oxford cup was placed on the dish, and then the dish was filled with LB medium. After drying, the Oxford cup was removed with autoclaved tweezers.
[0079] Adjust the concentration of the pathogenic bacteria to be tested to 1×10⁻⁶. 9 CFU / mL was spread onto LB medium with a cotton swab, and 200 μL of concentrated fermentation supernatant was added to the well. The mixture was incubated at 37 °C for 12 h. RCM medium was used as a negative control. The antibacterial results of the fermentation supernatant of Myxobacterium el1405 are shown in Table 4, indicating that the fermentation supernatant of Myxobacterium el1405 has an inhibitory effect on Escherichia coli, Salmonella and Staphylococcus aureus.
[0080] Table 4. Antibacterial properties of fermentation supernatant from *Eubacterium myxobacterium* El1405.
[0081]
[0082] Example 3: Alleviating effect of Myxobacterium el1405 on Salmonella infection in mice
[0083] 1. Methods for establishing a mouse model of Salmonella infection: Female BALB / c mice (5-6 weeks old, 15-17 g) were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. Mice were housed at 23 ± 2℃, 55% ± 5℃ relative humidity, a 12-hour light-dark cycle, and under specific pathogen-free conditions.
[0084] At the end of the 3-day adaptation period, the mice were randomly divided into 3 groups (8 mice in each group). From day -7 to day 6, each mouse was given (1) NC control group: 0.2 mL PBS (2) PBS model group: 0.2 mL PBS (3) El1405 intervention group: 0.2 mL Myxobacterium elutum El1405 by gavage (1×10 8 CFU / 0.2 mL (suspended in PBS solution) was administered by gavage. On day 0, each mouse in groups (2) and (3) was given 1×10⁻⁶ CFU / mL. 8CFU of Salmonella Typhimurium SL1344 was used. Mice were weighed daily, and sacrificed on day 6. Serum, liver, and spleen were collected. 0.1 g of liver and spleen were weighed separately and homogenized in 1 mL of PBS with 3 mm steel balls. Salmonella selective medium supplemented with streptomycin (50 μg / mL) was prepared, and Salmonella colony counts were performed on the Salmonella load in the mouse liver and spleen.
[0085] 2. Experimental Results:
[0086] The effects of Myxobacterium EL1405 on the body weight of Salmonella-infected mice are shown in Table 5. Figure 2 As shown in the figure. Mice were pre-gavaged with PBS or *Mycobacterium acnes* El1405 for seven days (Day 7 to Day 1). No mouse deaths were observed in any of the three groups, and there was no difference in body weight change between the PBS and NC groups (P>0.05). From days 4 to 6, the body weight of mice in the NC group was significantly higher than that in the PBS group (P<0.05); on day 6, the body weight of mice in the El1405 group was significantly higher than that in the PBS group (P<0.05), demonstrating that *Mycobacterium acnes* El1405 has the function of resisting the decrease in body weight in mice infected with Salmonella.
[0087] Table 5. Daily body weight (g) of experimental mice.
[0088]
[0089] Note: Compared with the PBS group, *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001.
[0090] like Figure 3 As shown, the Salmonella load in the liver of mice in the Myxobacterium EL1405 group was significantly lower than that in the liver of mice in the PBS group (P<0.05).
[0091] like Figure 4 As shown, the Salmonella load in the spleen of mice in the Myxobacterium EL1405 group was significantly lower than that in the spleen of mice in the PBS group (P<0.05). This indicates that Myxobacterium EL1405 reduces the Salmonella load in the viscera of Salmonella-infected mice.
[0092] The results are shown in Tables 6 and 7. Figure 5 and Figure 6 As shown:
[0093] Compared with the NC group, the levels of inflammatory factors such as tumor necrosis factor-α (TNF-α), serum interleukin-1β (IL-1β), and interleukin-6 (IL-6) in the serum and ileum of mice in the PBS group were significantly increased (P<0.0001).
[0094] Compared with the PBS group, the levels of tumor necrosis factor-α (TNF-α, P<0.0001 in serum, P<0.001 in ileum), interleukin-1β (IL-1β, P<0.01 in serum, P<0.0001 in ileum), and interleukin-6 (IL-6, P<0.0001) in serum and ileum of mice in the El1405 group were significantly reduced.
[0095] Compared with the NC group, the levels of anti-inflammatory factors such as interleukin-10 (IL-10) in the serum and ileum of mice in the PBS group were significantly decreased (P<0.01 in serum, P<0.0001 in ileum); compared with the PBS group, the levels of interleukin-10 (IL-10) in the serum and ileum of mice in the E1405 group were significantly increased (P<0.05 in serum, P<0.0001 in ileum).
[0096] The results showed that *Myxobacterium elutum* El1405 reduced TNF-α by more than 30.3% and 23.6%, reduced IL-1β by more than 13.8% and 45.8%, reduced IL-6 by more than 18.3% and 24.1%, and increased IL-10 by more than 25.3% and 58.3%.
[0097] Table 6. Concentrations of inflammatory factors in mouse serum (pg / mL)
[0098]
[0099] Note: Compared with the PBS group, *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001.
[0100] Table 7. Concentrations of inflammatory factors in the mouse ileum (pg / mL)
[0101]
[0102] Note: Compared with the PBS group, *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001.
[0103] Example 4: Myxobacterium el1405 improves DSS-induced colitis in mice
[0104] 1. Methods for constructing a DSS-induced mouse colitis model: Female C57BL / 6J mice (5-6 weeks old, 16-18 g) were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. Mice were housed at 23±2 ℃, 55%±5 ℃ relative humidity, 12 h light-dark cycle, and under specific pathogen-free conditions. At the end of the 3-day adaptation period, the mice were randomly divided into 3 groups (8 mice in each group). From day -7 to day 6, each mouse was given (1) NC control group: 0.2 mL PBS (2) PBS model group: 0.2 mL PBS (3) El1405 intervention group: 0.2 mL Myxobacterium elutiferum El1405 by gavage (1×10 8 Mice were administered CFU / 0.2 mL (suspended in PBS solution) via gavage. From day 0 to day 6, 3% (CFU / 0.2 mL, suspended in PBS solution) was added to the drinking water of mice in both the PBS model group and the El1405 intervention group. w / v DSS. The weight, fecal characteristics, and occult blood status of the mice were recorded daily, and the Disease Activity Index (DAI) was calculated according to the scoring criteria shown in Table 8.
[0105] DAI = Score obtained from weight loss + Score obtained from stool characteristics + Score obtained from occult blood status.
[0106] Table 8 Disease Activity Index Scoring Criteria
[0107]
[0108] After the experiment, the length of the mouse colon was measured, and the distal colon was soaked in 4% paraformaldehyde for subsequent histopathological analysis. The pathological scoring criteria are shown in Table 9.
[0109] Table 9 Pathological Scoring Criteria
[0110]
[0111] 2. Experimental Results:
[0112] The effects of *Myxobacterium el1405* on the body weight of colitis mice are shown in Table 10. After pre-gavage administration of PBS or *Myxobacterium el1405* for seven days (Day 7 to Day 1), there was no significant difference in body weight between the PBS and NC groups (P>0.05). Starting from day 4, the body weight of mice in the PBS group began to decrease, with the NC group showing a significantly higher body weight than the PBS group (P<0.01). On day 6, the body weight of mice in the El1405 group was significantly higher than that in the PBS group (P<0.05), demonstrating that *Myxobacterium el1405* has the function of resisting body weight loss in colitis mice.
[0113] Table 10 Daily body weight (g) of mice in each group
[0114]
[0115] Note: Compared with the PBS group, *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001.
[0116] Table 11 shows that the DAI score of the NC control group mice was significantly lower than that of the PBS model group from day 2 (P<0.05) and remained so until the end of the experiment; the DAI score of the El1405 intervention group was significantly lower than that of the PBS group on days 3 and 6 (P<0.05).
[0117] Table 11 DAI Score Table
[0118]
[0119] Note: Compared with the PBS group, *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001.
[0120] Table 12 Colon Length and Pathological Scoring Table
[0121]
[0122] Note: Compared with the PBS group, *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001.
[0123] Table 12 shows the colon length for each group. Figure 7 The results of the colon statistical diagram of mice showed that the colon length of the PBS group and the El1405 group was significantly shorter than that of the NC group, and the colon of the El1405 group was significantly longer than that of the DSS group (P<0.01), which proved that *Mycobacterium mucinum* El1405 has the ability to resist colon shortening in mice with colitis.
[0124] The histopathological results are shown in Table 12. The total pathological score of the El1405 intervention group was significantly lower than that of the PBS model group (P<0.001). Figure 8This study demonstrated the effect of *Myxobacterium mucinum* El1405 on the pathological changes of colonic tissue in a DSS-induced colitis model mouse. In the PBS model group, extensive ulceration was observed in the colonic tissue, with a small number of lymphocytes, granulocytes, and necrotic cell fragments visible in the intestinal lumen. The mucosal epithelium and intestinal gland structures were lost, goblet cells disappeared, and extensive connective tissue hyperplasia was observed. Widespread infiltration of scattered lymphocytes, granulocytes, and macrophages was also observed. Extensive edema was observed in the submucosa, with loose connective tissue arrangement, vasodilation, and numerous scattered lymphocytes, granulocytes, and macrophages infiltrating. Compared to the PBS model group, the El1405 intervention group showed milder pathological symptoms. Pathological phenomena such as crypt damage and abscesses, connective tissue hyperplasia, goblet cell loss, and intestinal mucosal structural destruction were alleviated, and the inflammatory response was milder. These results indicate that *Myxobacterium mucinum* El1405 can alleviate the pathological changes in colonic tissue.
[0125] The results are shown in Table 13. Figure 9 As shown, compared with the NC group, the levels of inflammatory factors such as tumor necrosis factor-α (TNF-α, P<0.01), interleukin-1β (IL-1β, P<0.01), interleukin-17 (IL-17, P<0.0001), interleukin-6 (IL-6, P<0.001), and lipopolysaccharide (LPS, P<0.0001) in the serum of mice in the PBS group were significantly increased; compared with the PBS group, the levels of TNF-α (P<0.001), IL-1β (P<0.05), IL-17 (P<0.001), LPS (P<0.001), and IL-6 (P<0.001) in the serum and ileum of mice in the E1405 group were significantly decreased.
[0126] Compared with the NC group, the levels of anti-inflammatory factors such as interleukin-10 (IL-10) in the serum and ileum of mice in the PBS group were significantly decreased (P<0.05); compared with the PBS group, the levels of IL-10 in the serum and ileum of mice in the El1405 group were significantly increased (P<0.05). These results indicate that *Mycobacterium elutum* El1405 can reduce the levels of inflammatory factors in the serum of colitis-affected mice while simultaneously increasing the levels of serum anti-inflammatory factors.
[0127] Table 13. Concentrations of serum inflammatory factors (pg / mL) in mice with colitis
[0128]
[0129] Note: Compared with the PBS group, *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001.
[0130] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.
Claims
1. A type of myxobacterium ( Eubacterium limosum El1405, characterized in that, The preservation number of the myxobacterium El1405 is CGMCC No. 31231.
2. A microbial agent, characterized in that, Includes the Myxobacterium el1405 or its fermentation supernatant as described in claim 1.
3. The microbial agent according to claim 2, characterized in that, The bacterial agent is a solid or liquid bacterial agent, and the total viable count of *Eubacterium myxobacterium* E1405 in the bacterial agent is 1 × 10⁻⁶. 7 -1×10 10 CFU / mL.
4. The method for preparing the microbial agent according to claim 2 or 3, characterized in that, include: Myxobacterium el1405 was inoculated into a culture medium for fermentation.
5. The preparation method according to claim 4, characterized in that, The culture medium is a reinforced Clostridium culture medium, and the fermentation culture conditions include: culture at 35~40℃ under anaerobic conditions for 36~60 hours.
6. A drug, characterized in that, The drug comprises the Myxobacterium el1405 as described in claim 1.
7. The use of the Myxobacterium el1405 of claim 1, or the bacterial agent of claim 2 or 3, in the preparation of an antimicrobial agent for inhibiting microorganisms; wherein the microorganism is one or more of Listeria monocytogenes, Staphylococcus aureus, Salmonella typhimurium, or Escherichia coli.
8. The use of the *Myxobacterium el1405* as described in claim 1 in the preparation of products for any of the following applications: i) Inhibits Salmonella typhimurium infection. ii) Anti-inflammatory, iii) Prevention and treatment of inflammatory bowel disease; The inflammatory bowel disease is colitis; the anti-inflammatory treatment is to reduce the inflammatory response associated with colitis.
Citation Information
Patent Citations
Eubacterium mucilaginosus E11405 and application thereof
CN120536280A