Complement C3 in tumor-derived exosome as marker for renal cancer metastasis and application of complement C3

Abstract

The invention discloses a complement C3 in tumor-derived exosomes as a marker for renal carcinoma metastasis and application of the complement C3, and belongs to the field of tumor immunity. On the first aspect, the invention relates to a kidney cancer metastasis detection kit which comprises a reagent for detecting complement protein C3 and application of the kit in preparation of a product for detecting kidney cancer metastasis. The second aspect of the invention relates to application of the reagent for inhibiting complement protein C3 in preparation of the medicine for treating kidney cancer. The invention provides a new thought for diagnosis and treatment of kidney cancer metastasis, and provides a new research direction for development of kits and drugs related to kidney cancer.

Description

Technical Field

[0001] The present invention relates to the field of tumor immunity, and in particular to complement C3 in tumor-derived exosomes as a marker for renal cancer metastasis and application thereof. Background Art

[0002] Complement protein C3 is the central component of the complement system. After the complement system is activated, C3 is cleaved into active fragments C3a and C3b. C3a is known as an anaphylatoxin, which induces oxidative bursts in macrophages, eosinophils and neutrophils through C3aR, promoting the production of acute inflammation under physiological conditions. However, the application research of complement protein C3 in the prior art is still insufficient. In view of this, the present invention discloses the use of exosomal complement protein C3 in renal cancer metastasis. Summary of the invention

[0003] In view of the deficiencies of the prior art, the present invention proposes complement C3 in tumor-derived exosomes as a marker for renal cancer metastasis and its application.

[0004] The purpose of the present invention can be achieved through the following technical solutions:

[0005] The first aspect of the present invention relates to a renal cancer metastasis detection kit, comprising: a reagent for detecting complement protein C3.

[0006] Optionally, the reagents include Western Blot related reagents.

[0007] The second aspect of the present invention relates to the use of the above-mentioned kit in the preparation of a product for detecting renal cancer metastasis.

[0008] The third aspect of the present invention relates to a drug for treating renal cancer, characterized in that it comprises an agent for inhibiting complement protein C3.

[0009] Optionally, the reagent is a reagent capable of knocking out the gene corresponding to complement protein C3, such as siRNA or CRISPR / cas9 system.

[0010] Optionally, the reagent capable of knocking out the gene corresponding to complement protein C3 includes CRISPR / Cas9-related reagents and two gRNAs, whose sequences are SEQ ID NO.1 and SEQ ID NO.2, respectively.

[0011] The fourth aspect of the present invention relates to the use of an agent for inhibiting complement protein C3 in the preparation of a drug for treating renal cancer.

[0012] Optionally, the reagent is a reagent capable of knocking out the gene corresponding to complement protein C3, such as siRNA or CRISPR / cas9 system.

[0013] Optionally, the reagent capable of knocking out the gene corresponding to complement protein C3 includes CRISPR / Cas9-related reagents and two gRNAs, whose sequences are SEQ ID NO.1 and SEQ ID NO.2, respectively.

[0014] Beneficial effects of the present invention:

[0015] The present invention discloses a new use of complement protein C3, specifically the use of exosomal complement protein C3 as a target for diagnosis or treatment in renal cancer metastasis. Based on the above application, the present invention provides a new idea for the diagnosis and treatment of renal cancer metastasis, and provides a new research direction for the development of renal cancer-related kits and drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] The present invention will be further described below in conjunction with the accompanying drawings.

[0017] Figure 1 The distribution of complement protein C3 in the cells and exosomes of renal cancer metastatic cell lines ACHN and Caki-1 and in situ cell lines 786-O and 769-P of the present application;

[0018] Figure 2 The invention relates to the construction of the C3 knockout (KO) cell line of the present invention, and the effects of KO C3 on the exosome morphology, secretion amount, growth, clone formation, migration and invasion of renal cancer cells;

[0019] Figure 3 The present invention relates to the effect of KO C3 in the renal cancer cell line on metastasis in immunodeficient and immunocompetent mice;

[0020] Figure 4 The effects of tumor-derived exosomes C3 and C3 KO exosomes on tumor metastasis in the mouse venous metastasis model of this application;

[0021] Figure 5 After staining the single cell suspension of the wild type (WT) exosome treatment group and the C3 KO exosome treatment group of the present application, flow cytometry was used to detect and analyze the results. DETAILED DESCRIPTION

[0022] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0023] Example 1

[0024] like Figure 1 As shown, in this example, Western Blot experiments showed that complement C3 was enriched in the exosomes of renal cancer metastatic cell lines ACHN and Caki-1, while the content in the exosomes of in situ cell lines 786-O and 769-P was lower.

[0025] It can be seen that the above data of this example can reflect that exosomal complement C3 can reveal or reflect the metastasis status of renal cancer to a certain extent, and can be used to evaluate or diagnose the health status, prognosis or risk of cancer cell metastasis of renal cancer patients.

[0026] In addition, it should be noted that the diagnostic application of complement protein C3 described in this embodiment does not mean that those skilled in the art use exosomal complement protein alone as a diagnostic indicator to perform diagnosis. Obviously, those skilled in the art should know that they can also be combined with other known markers or clinical symptoms related to renal cancer and its metastasis to further improve the accuracy or specificity of diagnosis.

[0027] Example 2

[0028] like Figure 2 As shown in the figure, the C3 gene was KOed in a mouse renal cancer cell line using CRISPR / Cas9 technology. Sanger sequencing and Western Blot experiments showed that KO was successful. Cryo-electron microscopy and nanoparticle tracer detection showed that C3 KO did not affect the morphology and secretion of exosomes. In vitro phenotypic experiments showed that C3 KO inhibited tumor cell proliferation and clone formation, but did not affect migration and invasion.

[0029] The C3 Double Nickase Plasmid (sc-419391) CRISPR-cas9 plasmid for knocking out (KO) the mouse C3 gene was purchased from Santa Cruz. The sequences of the two gRNAs were gRNA-M-C3-1 (SEQ ID NO.1: CTGTGCAAGACTTCCTAAAG) and gRNA-M-C3-2 (SEQ ID NO.2: GATGTCACCCTGAGCATCGT). The plasmid carried a GFP tag and a puromycin resistance gene. Plasmid transfection and monoclonal cell line screening were performed according to the plasmid instructions. The specific steps are as follows:

[0030] 1. On the first day, take Renca cells that are in good condition, negative for mycoplasma and in logarithmic growth phase, digest and centrifuge them, and then transfer 1×10 5 Renca cells were plated in 60 mm cell culture dishes.

[0031] 2. On the second day, use jetPRIME DNA transfection reagent to transfect the above plasmid into Renca cells. Add 200μL jetPRIME buffer into a centrifuge tube without RNase enzyme, add 2μg plasmid into the centrifuge tube and vortex for 10 seconds, then add 10μL jetPRIME transfection reagent, vortex for 10 seconds, and let stand at room temperature for 10 minutes, and finally add the transfection complex dropwise into the supernatant of Renca cells.

[0032] 3. 24 hours after transfection, observe the number of cells expressing green fluorescent protein GFP under a fluorescent microscope. After confirming that a certain amount of cells express GFP, add an appropriate amount of puromycin antibiotic for screening.

[0033] 4. After 2-3 days of drug screening, use the limiting dilution method to transfer the remaining surviving cells to a 96-well plate, ensuring that one cell is retained in each well. Place the cells in a cell culture incubator and wait for single cells to grow into clonal colonies. Digest and transfer the cells in sequence to 48-well plates, 24-well plates, 12-well plates, and finally to 6-well plates for expansion culture.

[0034] 5. Use a genomic DNA extraction kit to extract the genomic DNA of the monoclonal cell line.

[0035] 6. Design specific amplification primers near the knockout target site, and perform PCR reaction using genomic DNA as amplification template. The designed primer sequences are 5'-AGTGAGGAGAGGCTGAGGTA-3' (SEQ ID NO.3) and 5'-TACGGCTGACTGTAGTTCCA-3' (SEQ ID NO.4). The reaction system and reaction procedure were carried out according to the FastPfu DNA Polymerase instruction manual.

[0036] 7. After the reaction is completed, take 8 μL of PCR reaction solution for DNA electrophoresis detection, select samples with bright and single target bands for sequencing, and compare with the wild type (WT) sequence to verify whether KO is successful.

[0037] Example 3

[0038] like Figure 3 As shown, immunodeficient NOG mice and immune-competent Balb / c mice were divided into four groups, and Renca WT and C3 KO cells were injected into NOG or Balb / c mice through the tail vein. In vivo imaging detection and lung metastasis foci statistics showed that in immunodeficient NOG mice, C3 KO had no effect on metastasis compared with the WT group, while in immune-competent mice, lung metastasis was reduced after C3 KO.

[0039] Example 4

[0040] like Figure 4 As shown in Figure 2, exosomes from Renca WT and C3 KO cells were extracted, and the density of exosomes was detected using NTA instrument, and the concentration was adjusted to 1×10 10 Exosomes / 100μL PBS. Each Balb / c mouse was injected with 100μL PBS-exosome suspension through the tail vein every two days for three weeks to simulate the process of tumor releasing exosomes into the circulatory system. The injection of exosomes was stopped in the third week and 1×10 5 luc + Renca cells were injected with D-luciferin potassium salt substrate every five days to detect the metastasis of tumor cells in vivo. In vivo imaging of small animals showed that the lung metastasis of renal cancer cells was reduced in the group injected with exosomes derived from C3 KO cells.

[0041] Example 5

[0042] like Figure 5 As shown in the figure, the mice were killed and the lung tissues were ground into single cell suspensions. Figure 4 After single cell suspensions of the WT exosome-treated group and C3 KO exosome-treated group in A were stained and analyzed using flow cytometry. The results showed that exosome C3 could recruit more bone marrow-derived immune cells with immunosuppressive function to infiltrate into the microenvironment of the lung metastasis site.

[0043] In the description of this specification, the description with reference to the terms "one embodiment", "example", "specific example", etc. means that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representation of the above terms does not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described can be combined in any one or more embodiments or examples in a suitable manner.

[0044] The above shows and describes the basic principles, main features and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments, and the above embodiments and descriptions are only for explaining the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention may have various changes and improvements, and these changes and improvements all fall within the scope of the present invention to be protected.

Claims

1. A renal cancer metastasis detection kit, characterized in that: include: Reagent for detection of complement protein C3.

2. The kit according to claim 1, characterized in that The reagents include Western Blot related reagents.

3. Use of the kit according to claim 1 or 2 in the preparation of a product for detecting renal cancer metastasis.

4. A drug for treating renal cancer, characterized in that: Included are agents for inhibiting complement protein C3.

5. The drug for treating renal cancer according to claim 4, characterized in that: The reagent is a reagent capable of knocking out the gene corresponding to complement protein C3.

6. The drug for treating renal cancer according to claim 5, characterized in that: The reagent capable of knocking out the gene corresponding to complement protein C3 includes CRISPR / Cas9 related reagents and two gRNAs, and the sequences are SEQ ID NO.1 and SEQ ID NO.2 respectively.

7. Use of an agent that inhibits complement protein C3 in the preparation of a drug for treating renal cancer.

8. Use of the reagent for inhibiting complement protein C3 according to claim 7 in the preparation of a drug for treating renal cancer, characterized in that: The reagent is a reagent capable of knocking out the gene corresponding to complement protein C3.

9. Use of the reagent for inhibiting complement protein C3 according to claim 8 in the preparation of a drug for treating renal cancer, wherein the reagent capable of knocking out the gene corresponding to complement protein C3 comprises a CRISPR / Cas9-related reagent and two gRNAs, whose sequences are SEQ ID NO.1 and SEQ ID NO.2, respectively.

10. Use of the reagent for inhibiting complement protein C3 according to claim 7 in the preparation of a drug for treating renal cancer, wherein the mechanism of treating renal cancer is to inhibit lung metastasis of renal cancer cells.

Images