Complement c3 in tumor-derived exosomes as a marker for renal cancer metastasis and applications thereof

By using complement C3 from tumor-derived exosomes as a biomarker, combined with Western blotting and CRISPR/Cas9 technology, a renal cell carcinoma metastasis detection kit and drug were developed, solving the problem of insufficient application of complement C3 and achieving efficient diagnosis and treatment of renal cell carcinoma metastasis.

CN119846211BActive Publication Date: 2026-03-24SOUTHEAST UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510034658.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-01-09
Publication Date
2026-03-24
Estimated Expiration
2045-01-09

AI Technical Summary

Technical Problem

There is insufficient research on the application of complement protein C3 in existing technologies, especially its role in renal cell carcinoma metastasis has not been fully revealed.

Method used

Using complement C3 from tumor-derived exosomes as a biomarker, and by knocking out the complement C3 gene through Western blotting and CRISPR/Cas9 technology, we developed a renal cell carcinoma metastasis detection kit and drugs to inhibit complement C3 expression and treat renal cell carcinoma.

Benefits of technology

This study provides new insights into the diagnosis and treatment of renal cell carcinoma metastasis, offers new directions for the development of renal cell carcinoma-related reagent kits and drugs, and improves the diagnostic accuracy and treatment efficacy of renal cell carcinoma metastasis through the application of exosome C3.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119846211B_ABST
    Figure CN119846211B_ABST
Patent Text Reader

Abstract

The application discloses tumor-derived exosomes, complement C3 as a marker for kidney cancer metastasis and application thereof, and belongs to the tumor immunity field.The first aspect of the application relates to a kidney cancer metastasis detection kit, comprising: a reagent for detecting complement protein C3, and application of the reagent in preparation of a product for detecting kidney cancer metastasis.The second aspect of the application relates to application of a reagent for inhibiting complement protein C3 in preparation of a medicine for treating kidney cancer.The application provides a new thought for diagnosis and treatment of kidney cancer metastasis, and provides a new research direction for development of a kidney cancer related kit and medicine.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of tumor immunology, specifically to complement C3 in tumor-derived exosomes as a marker of renal cell carcinoma metastasis and its application. Background Technology

[0002] Complement protein C3 is a central component of the complement system. Upon activation, C3 is cleaved into active fragments C3a and C3b. C3a, known as an allergen, induces an oxidative burst in macrophages, eosinophils, and neutrophils via C3aR, promoting acute inflammation under physiological conditions. However, current research on the application of complement protein C3 is insufficient. Therefore, this invention reveals the use of exosomal complement protein C3 in renal cell carcinoma metastasis. Summary of the Invention

[0003] To address the shortcomings of existing technologies, this invention proposes a marker for complement C3 from tumor-derived exosomes as a biomarker for renal cell carcinoma metastasis and its application.

[0004] The objective of this invention can be achieved through the following technical solutions:

[0005] A first aspect of the present invention relates to a renal cell carcinoma metastasis detection kit, comprising: a reagent for detecting complement protein C3.

[0006] Optionally, the reagents include Western blotting reagents.

[0007] A second aspect of the invention relates to the use of the above-described kit in the preparation of products for detecting renal cell carcinoma metastasis.

[0008] A third aspect of the invention relates to a medicament for treating renal cell carcinoma, characterized in that it comprises a reagent for inhibiting complement protein C3.

[0009] Optionally, the reagent is capable of knocking out the gene corresponding to complement protein C3, such as siRNA or the CRISPR / Cas9 system.

[0010] Optionally, the reagent capable of knocking out the gene corresponding to complement protein C3 includes CRISPR / Cas9-related reagents and two gRNA segments with sequences SEQ ID NO.1 and SEQ ID NO.2, respectively.

[0011] A fourth aspect of the invention relates to the use of an agent that inhibits complement protein C3 in the preparation of a medicament for treating renal cell carcinoma.

[0012] Optionally, the reagent is capable of knocking out the gene corresponding to complement protein C3, such as siRNA or the CRISPR / Cas9 system.

[0013] Optionally, the reagent capable of knocking out the gene corresponding to complement protein C3 includes CRISPR / Cas9-related reagents and two gRNA segments with sequences SEQ ID NO.1 and SEQ ID NO.2, respectively.

[0014] The beneficial effects of this invention are:

[0015] This invention reveals a novel application of complement protein C3, specifically its use as a diagnostic or therapeutic target in renal cell carcinoma metastasis. Based on this application, this invention provides new insights for the diagnosis and treatment of renal cell carcinoma metastasis and offers new research directions for the development of renal cell carcinoma-related reagent kits and drugs. Attached Figure Description

[0016] The invention will now be further described with reference to the accompanying drawings.

[0017] Figure 1 The distribution of complement protein C3 of this application in the intracellular and exosomes of the renal cell carcinoma metastatic cell lines ACHN and Caki-1, as well as in the orthotopic cell lines 786-O and 769-P;

[0018] Figure 2 To construct the C3 knockout (KO) cell line of this application, and to investigate the effects of KO C3 on exosome morphology, secretion amount, renal cell carcinoma growth, colony formation, migration and invasion;

[0019] Figure 3 This application aims to investigate the effect of KO C3 renal cell carcinoma line on metastasis in immunodeficient and immunocompetent mice.

[0020] Figure 4 This application describes the effects of tumor-derived exosomes C3 and C3 KO exosomes on tumor metastasis in a mouse microvenous metastasis model.

[0021] Figure 5 After staining the single-cell suspensions of the wild-type (WT) exosome-treated group and the C3 KO exosome-treated group of this application, the results were analyzed by flow cytometry. Detailed Implementation

[0022] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0023] Example 1

[0024] like Figure 1 As shown in this embodiment, Western blotting experiments revealed that complement C3 was enriched in the exosomes of the renal cell carcinoma metastatic cell lines ACHN and Caki-1, while its content was lower in the exosomes of the in situ cell lines 786-O and 769-P.

[0025] Therefore, the data in this embodiment can reflect that exosome complement C3 can reveal or reflect the metastatic status of renal cell carcinoma to a certain extent, and can be used to assess or diagnose the health status, prognosis, or risk of cancer cell metastasis in renal cell carcinoma patients.

[0026] Furthermore, it should be noted that the diagnostic application of complement protein C3 described in this embodiment does not imply that those skilled in the art can use exosomal complement protein alone as a diagnostic indicator. Obviously, those skilled in the art should understand that it can also be combined with other known biomarkers or clinical symptoms related to renal cell carcinoma and its metastasis to further improve the accuracy or specificity of the diagnosis.

[0027] Example 2

[0028] like Figure 2 As shown, the C3 gene was knocked out in mouse renal cell carcinoma lines using CRISPR / Cas9 technology. Sanger sequencing and Western blotting experiments confirmed successful knockout. Cryo-electron microscopy and nanoparticle tracer analysis showed that C3 knockout did not affect exosome morphology or secretion. In vivo morphological experiments showed that C3 knockout inhibited tumor cell proliferation and colony formation, but did not affect migration and invasion.

[0029] The C3 Double Nickase Plasmid (sc-419391) CRISPR-cas9 plasmid for knocking out (KO) the mouse C3 gene was purchased from Santa Cruz Biotechnology. The two gRNA sequences are gRNA-M-C3-1 (SEQ ID NO.1: CTGTGCAAGACTTCCTAAAG) and gRNA-M-C3-2 (SEQ ID NO.2: GATGTCACCCTGAGCATCGT). The plasmid carries a GFP tag and a puromycin resistance gene. Plasmid transfection and single-clonal cell line screening were performed according to the plasmid instructions. The specific steps are as follows:

[0030] 1. On the first day, Renca cells in good condition, with negative mycoplasma test results and in logarithmic growth phase were collected, digested, centrifuged, and then 1×10⁻⁶ cells were added. 5 One Renca cell was seeded in a 60 mm cell culture dish.

[0031] 2. On the second day, the above plasmid was transfected into Renca cells using jetPRIME DNA transfection reagent. 200 μL of jetPRIME buffer was added to an RNase-free centrifuge tube, followed by 2 μg of plasmid, and vortexed for 10 seconds. Then, 10 μL of jetPRIME transfection reagent was added, vortexed for 10 seconds, and incubated at room temperature for 10 minutes. Finally, the transfection complex was added to the supernatant of the Renca cells.

[0032] 3. Observe the number of cells expressing green fluorescent protein (GFP) under a fluorescence microscope 24 hours after transfection. After confirming that a certain number of cells express GFP, add an appropriate amount of puromycin antibiotic for screening.

[0033] 4. After screening for 2-3 days, use the limiting dilution method to transfer the remaining surviving cells to 96-well plates, ensuring that one cell is retained in each well. Place the plates in a cell culture incubator and wait for the single cells to grow into clonal colonies. Then, digest and passage the cells sequentially to 48-well plates, 24-well plates, 12-well plates, and finally 6-well plates for large-scale culture.

[0034] 5. Use a genomic DNA extraction kit to extract genomic DNA from monoclonal cell lines.

[0035] 6. Specific amplification primers were designed near the knockout target site, and PCR reactions were performed using genomic DNA as a template. The designed primer sequences were 5'-AGTGAGGAGAGGCTGAGGTA-3' (SEQ ID NO.3) and 5'-TACGGCTGACTGTAGTTCCA-3' (SEQ ID NO.4). According to... The reaction system and procedure recommended in the FastPfu DNA Polymerase instruction manual shall be followed.

[0036] 7. After the reaction is complete, take 8 μL of PCR reaction solution for DNA electrophoresis detection. Select samples with bright and single target bands for sequencing and compare them with wild-type (WT) sequences to verify whether KO was successful.

[0037] Example 3

[0038] like Figure 3 As shown, immunodeficient NOG mice and immunocompetent Balb / c mice were divided into four groups. Renca WT and C3 KO cells were injected into NOG or Balb / c mice via the tail vein, respectively. After in vivo imaging and lung metastasis foci statistics, it was found that in immunodeficient NOG mice, C3 KO had no effect on metastasis compared with the WT group, while lung metastasis was reduced after C3 KO in immunocompetent mice.

[0039] Example 4

[0040] like Figure 4 As shown, exosomes were extracted from Renca WT and C3 KO cells, respectively. After detecting the density of exosomes using an NTA instrument, the concentration was adjusted to 1×10⁻⁶. 10 One exosome / 100 μL PBS. Each Balb / c mouse was injected with 100 μL of PBS-exosome suspension via the tail vein every two days for three weeks to simulate the release of exosomes from the tumor into the circulatory system. At week three, exosome injections were stopped, and the mice were injected with 1 × 10⁻⁶ exosomes / 100 μL PBS. 5 luc + Renca cells were injected with D-fluorescein potassium substrate every five days to detect tumor cell metastasis in vivo. In vivo imaging in small animals showed that lung metastasis of renal cell carcinoma cells was reduced after injection of C3 KO cell-derived exosomes.

[0041] Example 5

[0042] like Figure 5 As shown, after euthanizing mice, lung tissue was collected, ground into a single-cell suspension, and analyzed by flow cytometry. Figure 4 After staining single-cell suspensions of the A-type WT exosome-treated group and the C3-type KO exosome-treated group, flow cytometry analysis was performed. The results showed that exosome C3 could recruit more bone marrow-derived immune cells with immunosuppressive function to infiltrate the microenvironment of lung metastases.

[0043] In the description of this specification, references to terms such as "an embodiment," "example," "specific example," etc., indicate that a specific feature, structure, material, or characteristic described in connection with that embodiment or example is included in at least one embodiment or example of the invention. In this specification, illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples.

[0044] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the claimed invention.

Claims

1. Use of an agent that inhibits complement protein C3 in the manufacture of a medicament for the treatment of renal cancer, characterized in that, The reagent comprises a CRISPR / Cas9 related reagent, and two gRNAs with sequences of SEQ ID NO. 1 and SEQ ID NO. 2 respectively.

2. Use of the reagent for inhibiting complement protein C3 in the preparation of a drug for treating kidney cancer, the mechanism of treating kidney cancer being inhibition of lung metastasis of kidney cancer cells.

Citation Information

Patent Citations

  • Composition and method for inhibiting expression of complement component c3 protein

    WO2023186056A1