Phosphorus compound and application thereof in anti-tumor aspect

Abstract

The invention relates to a phosphorus compound and an application thereof in an anti-tumor aspect. Specifically, the invention provides application of a compound as shown in a formula I, or an optical isomer, or a raceme, or a pharmaceutically acceptable salt thereof, the compound is used for preparing a composition or a preparation, and the composition or the preparation is used for preventing and / or treating tumors. The compound provided by the invention has low expression, no expression, low activity or no activity on mitochondrial membrane permeability conversion pores, low expression, no expression, low activity or no activity on peptidyl prolyl isomerase F, low expression or no expression on NNMT genes, high expression on DNA methylase, high expression on UHRF1, high methylation level on NNMT gene nucleotide sites, and low expression or no expression on NNMT genes. And / or the NNMT gene region DNA CpG site methylation level is high, so that the NNMT gene region DNA CpG site methylation level has a remarkable and excellent precise treatment effect on tumors. # imgabs0 #

Description

Technical Field

[0001] The present invention relates to the field of pharmaceuticals, and particularly to a phosphorus compound and its application in anti-tumor treatment. Background Art

[0002] Tumors are common diseases that seriously endanger human health, and the mortality rate of malignant tumors has been on the rise. Due to the heterogeneity of tumors, if the same treatment method or the same drug is simply used according to its origin or pathological characteristics, etc., it is easy to cause problems of improper treatment, delaying the precious treatment time and opportunities of patients. Therefore, for different situations of tumors, it is very necessary to adopt precision treatment. With the development of biological technologies, tumors are continuously classified at the molecular level such as genes and proteins, and more and more changes in the expression and activity of tumor-related genes and proteins have been successively discovered. The changes in the expression and activity of tumor-related genes and proteins play an important role in the development of malignant tumors. The discovery and application of biomarkers will provide precise guidance for the application of related drugs, making precision treatment of tumors possible, thereby realizing targeted drug administration, significantly improving the tumor treatment effect, reducing the drug dosage, and reducing the toxic and side effects.

[0003] Therefore, there is an urgent need in the art to develop a drug that can precisely treat tumors. Summary of the Invention

[0004] The present invention provides a compound, and the compound has excellent precision treatment effects on tumors with low expression, no expression, low activity or no activity of the mitochondrial membrane permeability transition pore, low expression, no expression, low activity or no activity of peptidyl-prolyl isomerase F, low expression or no expression of the NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, high methylation level of nucleotide sites of the NNMT gene, and / or high methylation level of DNA CpG sites in the NNMT gene region.

[0005] In the first aspect of the present invention, there is provided the use of a compound of formula I, or its optical isomer, or its racemate, or its pharmaceutically acceptable salt, for preparing a composition or a preparation, and the composition or the preparation is used for preventing and / or treating tumors;

[0006]

[0007] Wherein,

[0008] R 1 、R 2 、R 3 and R 4Each independently is a substituted or unsubstituted C1-C16 alkyl group, a substituted or unsubstituted C1-C16 haloalkyl group, a substituted or unsubstituted C2-C8 alkenyl-substituted or unsubstituted C1-C10 alkyl group, a substituted or unsubstituted C3-C16 cycloalkyl group, a substituted or unsubstituted 3-16 membered heteroalkyl group, a substituted or unsubstituted C6-C16 aryl group, a substituted or unsubstituted 3-16 membered heteroaryl group, a substituted or unsubstituted C6-C16 aryl-substituted or unsubstituted C1-C8 alkyl group, a substituted or unsubstituted 3-16 membered heteroaryl-substituted or unsubstituted C1-C8 alkyl group, a substituted or unsubstituted C2-C10 ester group-substituted or unsubstituted 3-12 membered heteroalkyl group, or a substituted or unsubstituted C2-C10 ester group-substituted or unsubstituted C1-C10 alkyl group.

[0009] In another preferred example, the heteroaryl group is a 5-16 membered heteroaryl group, a 5-12 membered heteroaryl group or a 5-10 membered heteroaryl group.

[0010] In another preferred example, R 1 、R 2 、R 3 and R 4 Each independently is a substituted or unsubstituted C1-C12 alkyl group, a substituted or unsubstituted C1-C12 haloalkyl group, a substituted or unsubstituted C2-C6 alkenyl-substituted or unsubstituted C1-C6 alkyl group, a substituted or unsubstituted C3-C12 cycloalkyl group, a substituted or unsubstituted 3-12 membered heteroalkyl group, a substituted or unsubstituted C6-C12 aryl group, a substituted or unsubstituted 3-12 membered heteroaryl group, a substituted or unsubstituted C6-C12 aryl-substituted or unsubstituted C1-C6 alkyl group, a substituted or unsubstituted 3-12 membered heteroaryl-substituted or unsubstituted C1-C6 alkyl group, a substituted or unsubstituted C2-C8 ester group-substituted or unsubstituted 3-10 membered heteroalkyl group, or a substituted or unsubstituted C2-C8 ester group-substituted or unsubstituted C1-C8 alkyl group.

[0011] In another preferred example, R 1 、R 2 、R 3 and R 4Each independently is a substituted or unsubstituted C1-C10 alkyl group, a substituted or unsubstituted C1-C10 haloalkyl group, a substituted or unsubstituted C2-C4 alkenyl-substituted or unsubstituted C1-C4 alkyl group, a substituted or unsubstituted C3-C10 cycloalkyl group, a substituted or unsubstituted 3-10 membered heteroalkyl group, a substituted or unsubstituted C6-C12 aryl group, a substituted or unsubstituted 3-12 membered heteroaryl group, a substituted or unsubstituted C6-C12 aryl-substituted or unsubstituted C1-C4 alkyl group, a substituted or unsubstituted 3-12 membered heteroaryl-substituted or unsubstituted C1-C4 alkyl group, a substituted or unsubstituted C2-C8 ester-substituted or unsubstituted 3-8 membered heteroalkyl group, or a substituted or unsubstituted C2-C6 ester-substituted or unsubstituted C1-C6 alkyl group.

[0012] In another preferred embodiment, R 1 , R 2 , R 3 and R 4 each independently is a substituted or unsubstituted C1-C10 alkyl group, a substituted or unsubstituted C1-C8 haloalkyl group, a substituted or unsubstituted C2-C4 alkenyl-substituted or unsubstituted C1-C2 alkyl group, a substituted or unsubstituted C3-C8 cycloalkyl group, a substituted or unsubstituted 3-8 membered heteroalkyl group, a substituted or unsubstituted C6-C10 aryl group, a substituted or unsubstituted 3-12 membered heteroaryl group, a substituted or unsubstituted C6-C10 aryl-substituted or unsubstituted C1-C2 alkyl group, a substituted or unsubstituted 3-12 membered heteroaryl-substituted or unsubstituted C1-C2 alkyl group, a substituted or unsubstituted C3-C8 ester-substituted or unsubstituted 5-8 membered heteroalkyl group, or a substituted or unsubstituted C2-C5 ester-substituted or unsubstituted C1-C6 alkyl group.

[0013] In another preferred embodiment, R 1 , R 2 , R 3 and R 4 each independently is a substituted or unsubstituted C1-C10 alkyl group, a substituted or unsubstituted C1-C6 haloalkyl group, a substituted or unsubstituted C2-C4 alkenyl-substituted or unsubstituted C1-C2 alkyl group, a substituted or unsubstituted C4-C6 cycloalkyl group, a substituted or unsubstituted 5-7 membered heteroalkyl group, a substituted or unsubstituted C6-C8 aryl group, a substituted or unsubstituted 5-10 membered heteroaryl group, a substituted or unsubstituted C6-C8 aryl-substituted or unsubstituted C1-C2 alkyl group, a substituted or unsubstituted 5-10 membered heteroaryl-substituted or unsubstituted C1-C2 alkyl group, a substituted or unsubstituted C3-C7 ester-substituted or unsubstituted 5-7 membered heteroalkyl group, or a substituted or unsubstituted C2-C4 ester-substituted or unsubstituted C1-C5 alkyl group.

[0014] In another preferred embodiment, R 1 , R 2 , R 3 and R 4 are each independently a substituted or unsubstituted C1-C4 alkyl group, a substituted or unsubstituted C1-C4 haloalkyl group, a substituted or unsubstituted C2-C4 alkenyl-substituted or unsubstituted C1-C2 alkyl group, a substituted or unsubstituted C4-C6 cycloalkyl group, a substituted or unsubstituted 5-7 membered heteroalkyl group, a substituted or unsubstituted C6-C8 aryl group, a substituted or unsubstituted 5-10 membered heteroaryl group, a substituted or unsubstituted C6-C8 aryl-substituted or unsubstituted C1-C2 alkyl group, a substituted or unsubstituted 5-10 membered heteroaryl-substituted or unsubstituted C1-C2 alkyl group, a substituted or unsubstituted C3-C7 ester-substituted or unsubstituted 5-7 membered heteroalkyl group, or a substituted or unsubstituted C2-C4 ester-substituted or unsubstituted C1-C5 alkyl group.

[0015] In another preferred embodiment, any of the "substituted" means that one or more (preferably 1, 2, 3, 4, 5, 6, 7 or 8) hydrogen atoms on the group are each independently replaced by a substituent.

[0016] In another preferred embodiment, any of the "substituted" means that one or more (preferably 1, 2, 3, 4, 5, 6, 7 or 8) hydrogen atoms on the group are each independently replaced by a substituent selected from the group consisting of: C1-C8 alkyl, C3-C8 cycloalkyl, C2-C8 alkenyl, C1-C8 haloalkyl, C3-C8 halocycloalkyl, C3-C8 cycloalkoxy, C3-C8 cycloalkylthio, C3-C8 halocycloalkoxy, C3-C8 halocycloalkylthio, halogen, hydroxy, mercapto, amino, C2-C8 ester, C2-C8 amide, C1-C8 alkoxy, C1-C8 alkylthio, C1-C8 haloakoxy, C1-C8 haloalkylthio, C6-C12 aryl, 5-12 membered heteroaryl.

[0017] In another preferred embodiment, any of the "substituted" means that one or more (preferably 1, 2, 3, 4, 5, 6, 7 or 8) hydrogen atoms on the group are each independently replaced by a substituent selected from the group consisting of: C1-C6 alkyl, C3-C8 cycloalkyl, C2-C6 alkenyl, C1-C6 haloalkyl, C3-C8 halocycloalkyl, C3-C8 cycloalkoxy, C3-C8 cycloalkylthio, C3-C8 halocycloalkoxy, C3-C8 halocycloalkylthio, halogen, hydroxy, mercapto, amino, C2-C6 ester, C2-C6 amide, C1-C6 alkoxy, C1-C6 alkylthio, C1-C6 haloakoxy, C1-C6 haloalkylthio, C6-C10 aryl, 5-10 membered heteroaryl.

[0018] In another preferred embodiment, any of the "substitutions" means that one or more (preferably 1, 2, 3, 4, 5, 6, 7 or 8) hydrogen atoms on the group are each independently replaced by a substituent selected from the group consisting of: C1-C4 alkyl, C3-C8 cycloalkyl, C2-C4 alkenyl, C1-C4 haloalkyl, C3-C8 halocycloalkyl, C3-C8 cycloalkoxy, C3-C8 cycloalkylthio, C3-C8 halocycloalkoxy, C3-C8 halocycloalkylthio, halogen, hydroxy, mercapto, amino, C2-C6 ester group, C2-C6 amide group, C1-C4 alkoxy, C1-C4 alkylthio, C1-C4 haloalkoxy, C1-C4 haloalkylthio, C6-C10 aryl, 5-10 membered heteroaryl.

[0019] In another preferred embodiment, the heterocycloalkyl and heteroaryl rings have 1-4 (preferably 1, 2, 3 or 4) heteroatoms each independently selected from N, O and S.

[0020] In another preferred embodiment, the heterocycloalkyl ring has 1-4 (preferably 1, 2, 3 or 4) heteroatoms each independently selected from N, O and S.

[0021] In another preferred embodiment, the heteroaryl ring has 1-4 (preferably 1, 2, 3 or 4) heteroatoms each independently selected from N, O and S.

[0022] In another preferred embodiment, the heterocycloalkyl has 0, 1 or 2 C═C ring double bonds.

[0023] In another preferred embodiment, R 1 , R 2 and R 3 are each independently phenyl.

[0024] In another preferred embodiment, R 1 , R 2 , R 3 and R 4 are each independently indolyl, methyl-substituted indolyl, pyrrolopyridyl, methyl-substituted pyrrolopyridyl, pentyl ester-tetrahydropyridyl-, thiophenyl, furyl, tetrahydropyranyl, halomethyl, halopropyl, halobutyl, methyl, ethyl, propyl, butyl, pentyl, hexyl, heptyl, octyl, nonyl, decyl, vinyl-methyl-, propenyl-methyl-, butenyl-methyl-, cyclopentyl, pyridyl-methyl-, propyl ester-propyl-,

[0025] R 5 , R 6 , R 7 , R 8 and R 9Each independently is hydrogen, a C1-C8 alkyl group, a C1-C8 alkoxy group, a C1-C8 alkylthio group, or a halogen.

[0026] In another preferred embodiment, R 5 , R 6 , R 7 , R 8 and R 9 each independently is hydrogen, a C1-C6 alkyl group, a C1-C6 alkoxy group, a C1-C6 alkylthio group, or a halogen.

[0027] In another preferred embodiment, R 5 , R 6 , R 7 , R 8 and R 9 each independently is hydrogen, a C1-C4 alkyl group, a C1-C4 alkoxy group, a C1-C4 alkylthio group, or a halogen.

[0028] In another preferred embodiment, R 5 , R 6 , R 7 , R 8 and R 9 each independently is hydrogen, a C1-C2 alkyl group, a C1-C2 alkoxy group, a C1-C2 alkylthio group, or a halogen.

[0029] In another preferred embodiment, R 5 , R 6 , R 7 , R 8 and R 9 each independently is hydrogen, methyl, methoxy, ethoxy, methylthio, ethylthio, or a halogen.

[0030] In another preferred embodiment, the indolyl group is

[0031] In another preferred embodiment, the methyl-substituted indolyl group is a monomethyl-substituted indolyl group.

[0032] In another preferred embodiment, the methyl-substituted indolyl group is In another preferred embodiment, the methyl-substituted pyrrolopyridyl group is a monomethyl-substituted pyrrolopyridyl group. In another preferred embodiment, the pyrrolopyridyl group is pyrrolo[3,2-b]pyridyl.

[0033] In another preferred embodiment, the pyrrolopyridyl group is 1H-pyrrolo[3,2-b]pyridyl.

[0034] In another preferred embodiment, the methyl-substituted pyrrolopyridyl group is In another preferred embodiment, the tetrahydropyridyl group is 1,2,3,6-tetrahydropyridyl.

[0035] In another preferred example, pentyl-tetrahydropyridyl- is In another preferred example, thienyl is In another preferred example, furyl is In another preferred example, tetrahydropyranyl is In another preferred example, propyl is n-propyl or isopropyl.

[0036] In another preferred example, butyl is In another preferred example, pentyl is In another preferred example, octyl is n-octyl.

[0037] In another preferred example, octyl is In another preferred example, halomethyl is monohalomethyl.

[0038] In another preferred example, halomethyl is monoiodomethyl.

[0039] In another preferred example, halomethyl is In another preferred example, halopropyl is monohalopropyl.

[0040] In another preferred example, halopropyl is monobromopropyl.

[0041] In another preferred example, halopropyl is In another preferred example, halobutyl is monohalobutyl.

[0042] In another preferred example, halobutyl is monobromobutyl.

[0043] In another preferred example, halobutyl is In another preferred example, vinyl-methyl- is In another preferred example, butenyl-methyl- is In another preferred example, cyclopentyl is

[0044] In another preferred example, pyridyl-methyl- is

[0045] In another preferred example, propyl ester-propyl- is

[0046] In another preferred example, propenyl-methyl- is

[0047] In another preferred example, the halogen is fluorine, chlorine, bromine, or iodine.

[0048] In another preferred example, the halogenation is fluorination, chlorination, bromination, or iodination.

[0049] In another preferred example, the halogenation is mono-halogenation, di-halogenation or per-halogenation.

[0050] In another preferred example, halogenation means that one or more (preferably 1, 2 or 3) hydrogen atoms on the group are each independently replaced by a halogen.

[0051] In another preferred example, the structure of the compound of formula I, or its optical isomer, or its racemate, or its pharmaceutically acceptable salt is as shown in formula I-1:

[0052]

[0053] Wherein, R 1 , R 2 , R 3 and R 4 are each independently defined as above;

[0054] X - is an anionic salt radical.

[0055] In another preferred example, X - is an anionic acid radical.

[0056] In another preferred example, the pharmaceutically acceptable salts of the compound of formula I include salts formed by the compound of formula I and an acid.

[0057] In another preferred example, the salt radical of the pharmaceutically acceptable salt of the compound of formula I includes a salt radical formed by an acid losing one H + .

[0058] In another preferred example, the acid includes one or more of hydrochloric acid, mucic acid, D-glucuronic acid, hydrobromic acid, hydrofluoric acid, hydroiodic acid, sulfuric acid, nitric acid, phosphoric acid, formic acid, acetic acid, trifluoroacetic acid, propionic acid, oxalic acid, malonic acid, succinic acid, fumaric acid, maleic acid, lactic acid, malic acid, tartaric acid, citric acid, picric acid, methanesulfonic acid, benzenesulfonic acid, benzoic acid, trifluoromethanesulfonic acid, aspartic acid and glutamic acid.

[0059] In another preferred example, the salt radical of the pharmaceutically acceptable salt of the compound of formula I includes F - , Cl - , Br - , I - , HCOO - , CH 3 COO - , SO 4 2- , NO 3 - or

[0060] In another preferred embodiment, X - is the salt radical formed by an acid losing one H + .

[0061] In another preferred embodiment, X - is F - , Cl - , Br - , I - , HCOO - , CH 3 COO - , SO 4 2- , NO 3 - or

[0062] In another preferred embodiment, the compound of Formula I, or its optical isomer, or its racemate, or its pharmaceutically acceptable salt is:

[0063]

[0064]

[0065]

[0066]

[0067]

[0068] In another preferred embodiment, the tumor is a human tumor.

[0069] In another preferred embodiment, the tumor is a human tumor.

[0070] In another preferred embodiment, the tumor includes tumors with low expression, no expression, low activity or no activity of the mitochondrial membrane permeability transition pore.

[0071] In another preferred embodiment, the tumor includes tumors with low expression, no expression, low activity or no activity of peptidyl-prolyl isomerase F.

[0072] In another preferred embodiment, the protein number of peptidyl-prolyl isomerase F is UniProtKB / Swiss-Prot: P30405, and its gene number is NCBI Entrez Gene: 10105.

[0073] In another preferred embodiment, the low expression, no expression, low activity or no activity of the mitochondrial permeability transition pore means that the ratio (H1 / H0) of the expression level or activity level H1 of the mitochondrial permeability transition pore in a certain cell (such as a tumor cell) to the expression level or activity level H0 of the mitochondrial permeability transition pore in the same type of cell or normal cell is < 1.0, preferably ≤ 0.8, more preferably ≤ 0.7, more preferably ≤ 0.6, more preferably ≤ 0.5, more preferably ≤ 0.4, more preferably ≤ 0.3, more preferably ≤ 0.2, more preferably ≤ 0.1, more preferably ≤ 0.05, more preferably ≤ 0.01, more preferably ≤ 0.005, more preferably ≤ 0.001, more preferably ≤ 0.0001, more preferably ≤ 0.00001, more preferably ≤ 0.000001, more preferably ≤ 0.0000001.

[0074] In another preferred embodiment, the same type of cells described above include cells with normal expression, high expression, normal activity or high activity of the mitochondrial permeability transition pore (such as the same type of tumor cells).

[0075] In another preferred embodiment, the normal cells described above include normal tissue cells with normal expression or normal activity of the mitochondrial permeability transition pore (such as the origin cells of tumor cells, adjacent tumor cells or paracancerous tissue cells).

[0076] In another preferred embodiment, the low expression, no expression, low activity or no activity of peptidyl-prolyl isomerase F means that the ratio (C1 / C0) of the expression level or activity level C1 of peptidyl-prolyl isomerase F in a certain cell (such as a tumor cell) to the expression level or activity level C0 of peptidyl-prolyl isomerase F in the same type of cell or normal cell is < 1.0, preferably ≤ 0.8, more preferably ≤ 0.7, more preferably ≤ 0.6, more preferably ≤ 0.5, more preferably ≤ 0.4, more preferably ≤ 0.3, more preferably ≤ 0.2, more preferably ≤ 0.1, more preferably ≤ 0.05, more preferably ≤ 0.01, more preferably ≤ 0.005, more preferably ≤ 0.001, more preferably ≤ 0.0001, more preferably ≤ 0.00001, more preferably ≤ 0.000001, more preferably ≤ 0.0000001.

[0077] In another preferred embodiment, the certain cell described above refers to a tumor cell.

[0078] In another preferred embodiment, the same type of cells described above includes the same kind of cells.

[0079] In another preferred embodiment, the same type of cells described above includes the same type of tumor cells.

[0080] In another preferred embodiment, the same type of cells described above includes the same kind of tumor cells.

[0081] In another preferred embodiment, the same type of cells includes cells with normal expression, high expression, normal activity or high activity of peptidyl-prolyl isomerase F (such as the same type of tumor cells).

[0082] In another preferred embodiment, the normal cells include normal tissue cells with normal expression or normal activity of peptidyl-prolyl isomerase F (such as tumor cell origin cells, tumor adjacent cells or para-carcinoma tissue cells).

[0083] In another preferred embodiment, the mitochondrial permeability transition pore of the tumor is made to have low expression, no expression, low activity or no activity by administering a mitochondrial permeability transition pore inhibitor.

[0084] In another preferred embodiment, the mitochondrial permeability transition pore inhibitor includes an inhibitor capable of making the mitochondrial permeability transition pore of the tumor have low expression, no expression, low activity or no activity.

[0085] In another preferred embodiment, the peptidyl-prolyl isomerase F of the tumor is made to have low expression, no expression, low activity or no activity by administering a peptidyl-prolyl isomerase F inhibitor.

[0086] In another preferred embodiment, the peptidyl-prolyl isomerase F inhibitor includes an inhibitor capable of making the peptidyl-prolyl isomerase F of the tumor have low expression, no expression, low activity or no activity.

[0087] In another preferred embodiment, the inhibitor includes a specific inhibitor.

[0088] In another preferred embodiment, the mitochondrial permeability transition pore inhibitor is selected from the group consisting of: Cyclosporin A, CyP-D protein inhibitor, peroxide scavenger, or a combination thereof.

[0089] In another preferred embodiment, the tumor includes a tumor with low expression or no expression of the NNMT gene.

[0090] In another preferred embodiment, the tumor includes a tumor with high expression of DNA methylase.

[0091] In another preferred embodiment, the DNA methylase is selected from the group consisting of: DNMT1, DNMT3a, DNMT3b, or a combination thereof.

[0092] In another preferred embodiment, the tumor includes a tumor with high expression of DNMT1.

[0093] In another preferred embodiment, the tumor includes a tumor with high expression of DNMT3a.

[0094] In another preferred embodiment, the tumor includes a tumor with high expression of DNMT3b.

[0095] In another preferred example, the tumor includes tumors with high expression of UHRF1.

[0096] In another preferred example, the tumor includes tumors with a high level of methylation at the nucleotide sites of the NNMT gene.

[0097] In another preferred example, the methylation at the nucleotide sites of the NNMT gene includes methylation at the cytosine nucleotide sites of the NNMT gene.

[0098] In another preferred example, the methylation at the nucleotide sites of the NNMT gene includes methylation of cytosine in the nucleotides of the NNMT gene.

[0099] In another preferred example, the methylation at the nucleotide sites of the NNMT gene includes methylation at the 5th carbon atom of cytosine in the nucleotides of the NNMT gene.

[0100] In another preferred example, the tumor includes tumors with a high level of methylation at the DNA CpG sites in the NNMT gene region.

[0101] In another preferred example, the methylation at the DNA CpG sites in the NNMT gene region includes methylation at the cytosine nucleotide sites of the DNA CpG sites in the NNMT gene region.

[0102] In another preferred example, the methylation at the DNA CpG sites in the NNMT gene region includes methylation of cytosine in the nucleotides of the DNA CpG sites in the NNMT gene region.

[0103] In another preferred example, the methylation at the DNA CpG sites in the NNMT gene region includes methylation at the 5th carbon atom of cytosine in the nucleotides of the DNA CpG sites in the NNMT gene region.

[0104] In another preferred example, the NNMT gene is a human-derived NNMT gene.

[0105] In another preferred example, the NNMT gene is the human NNMT gene.

[0106] In another preferred example, a tumor with low expression or no expression of the NNMT gene means that no NNMT protein can be detected by the NNMT antibody in 1 μg of protein extracted from the tumor. More preferably, no NNMT protein can be detected by the NNMT antibody in 5 μg of protein extracted from the tumor. More preferably, no NNMT protein can be detected by the NNMT antibody in 10 μg of protein extracted from the tumor. More preferably, no NNMT protein can be detected by the NNMT antibody in 100 μg of protein extracted from the tumor. More preferably, no NNMT protein can be detected by the NNMT antibody in 1000 μg of protein extracted from the tumor.

[0107] In another preferred example, the tumor with low or no expression of the NNMT gene refers to a tumor in which the expression level of the NNMT gene in tumor cells is less than that in the same type of cells or normal cells.

[0108] In another preferred example, the low or no expression of the NNMT gene means that the ratio (E1 / E0) of the expression E1 of the NNMT gene in a certain cell (such as a tumor cell) to the expression E0 of the NNMT gene in the same type of cells or normal cells is < 1.0, preferably ≤ 0.7, more preferably ≤ 0.6, more preferably ≤ 0.5, more preferably ≤ 0.4, more preferably ≤ 0.3, more preferably ≤ 0.2, more preferably ≤ 0.1, more preferably ≤ 0.05, more preferably ≤ 0.01, more preferably ≤ 0.005, more preferably ≤ 0.001, more preferably ≤ 0.0001, more preferably ≤ 0.00001, more preferably ≤ 0.000001, more preferably ≤ 0.0000001.

[0109] In another preferred example, the certain cell includes tumor cells.

[0110] In another preferred example, the same type of cells includes the same kind of cells.

[0111] In another preferred example, the same type of cells includes the same type of tumor cells.

[0112] In another preferred example, the same type of cells includes the same kind of tumor cells.

[0113] In another preferred example, the same type of cells includes cells with normal or high expression of the NNMT gene (such as the same type of tumor cells).

[0114] In another preferred example, the same type of cells includes cells of the same kind but with normal or high expression of the NNMT gene.

[0115] In another preferred example, the normal cells include normal tissue cells (such as the origin cells of tumor cells, tumor adjacent cells or para-carcinoma tissue cells).

[0116] In another preferred example, the normal cells include normal tissue cells with normal expression of the NNMT gene (such as the origin cells of tumor cells, tumor adjacent cells or para-carcinoma tissue cells).

[0117] In another preferred example, E0 is the expression level of the NNMT gene in cells with normal or high expression of the NNMT gene.

[0118] In another preferred embodiment, the cells with normal or high expression of the NNMT gene include cells that are insensitive to the compound of formula I, or its optical isomers, or its racemates, or its pharmaceutically acceptable salts.

[0119] In another preferred embodiment, the tumor with high expression of the DNA methyltransferase refers to that the DNA methyltransferase can be detected by the DNA methyltransferase antibody in 20 μg of protein extracted from the tumor, more preferably in 5 μg of protein extracted from the tumor, more preferably in 1 μg of protein extracted from the tumor, more preferably in 0.2 μg of protein extracted from the tumor, more preferably in 0.05 μg of protein extracted from the tumor, more preferably in 0.01 μg of protein extracted from the tumor by the DNA methyltransferase antibody.

[0120] In another preferred embodiment, the tumor with high expression of the DNA methyltransferase means that the expression level of the DNA methyltransferase in the tumor cells is higher than that in the same type of cells or normal cells.

[0121] In another preferred embodiment, the tumor with high expression of the DNA methyltransferase means that the ratio (A1 / A0) of the expression level A1 of the DNA methyltransferase in the tumor cells to the expression level A0 of the DNA methyltransferase in the same type of cells or normal cells is > 1.0, preferably ≥ 1.2, preferably ≥ 1.5, more preferably ≥ 2, more preferably ≥ 3, more preferably ≥ 5, more preferably ≥ 8, more preferably ≥ 10, more preferably ≥ 15, more preferably ≥ 20, more preferably ≥ 30, more preferably ≥ 50, such as 2 - 50.

[0122] In another preferred embodiment, the same type of cells includes the same kind of cells.

[0123] In another preferred embodiment, the same type of cells includes the same type of tumor cells.

[0124] In another preferred embodiment, the same type of cells includes the same kind of tumor cells.

[0125] In another preferred embodiment, the same type of cells includes cells with normal or low expression of the DNA methyltransferase (such as the same type of tumor cells).

[0126] In another preferred embodiment, the normal cells include normal tissue cells (such as the origin cells of tumor cells, adjacent cells of tumor or para-carcinoma tissue cells).

[0127] In another preferred example, the normal cells include normal tissue cells with normal expression of DNA methyltransferase (such as tumor cell origin cells, tumor adjacent cells or para-carcinoma tissue cells).

[0128] In another preferred example, A0 is the expression level of DNA methyltransferase in cells with normal or low expression of DNA methyltransferase.

[0129] In another preferred example, the tumor with high expression of UHRF1 means that the ratio (F1 / F0) of the expression level F1 of UHRF1 in tumor cells to the expression level F0 of UHRF1 in the same type of cells or normal cells is > 1.0, preferably ≥ 1.2, preferably ≥ 1.5, more preferably ≥ 2, more preferably ≥ 3, more preferably ≥ 5, more preferably ≥ 8, more preferably ≥ 10, more preferably ≥ 15, more preferably ≥ 20, more preferably ≥ 30, more preferably ≥ 50, such as 2 - 50.

[0130] In another preferred example, the same type of cells includes cells of the same species.

[0131] In another preferred example, the same type of cells includes the same type of tumor cells.

[0132] In another preferred example, the same type of cells includes tumor cells of the same species.

[0133] In another preferred example, the same type of cells includes cells with normal or low expression of UHRF1 (such as the same type of tumor cells).

[0134] In another preferred example, the normal cells include normal tissue cells (such as tumor cell origin cells, tumor adjacent cells or para-carcinoma tissue cells).

[0135] In another preferred example, the normal cells include normal tissue cells with normal expression of UHRF1 (such as tumor cell origin cells, tumor adjacent cells or para-carcinoma tissue cells).

[0136] In another preferred example, the high methylation level of the nucleotide site of the NNMT gene means that the methylation level of the nucleotide site of the NNMT gene in a certain cell (such as a tumor cell) is greater than the methylation level of the nucleotide site of the NNMT gene in the same type of cells or normal cells.

[0137] In another preferred example, a high methylation level at the nucleotide site of the NNMT gene means that the ratio (L1 / L0) of the methylation level L1 at the nucleotide site of the NNMT gene in a certain cell (such as a tumor cell) to the methylation level L0 at the nucleotide site of the NNMT gene in the same type of cell or normal cell is > 1.0, preferably ≥ 1.2, preferably ≥ 1.5, more preferably ≥ 2, more preferably ≥ 3, more preferably ≥ 5, more preferably ≥ 8, more preferably ≥ 10, more preferably ≥ 15, more preferably ≥ 20, more preferably ≥ 30, more preferably ≥ 50, for example, 2 - 50.

[0138] In another preferred example, a high methylation level at the nucleotide site of the NNMT gene means that the methylation level at the nucleotide site of the NNMT gene in a certain cell (such as a tumor cell) is ≥ 1%, preferably ≥ 3%, preferably ≥ 5%, preferably ≥ 10%, preferably ≥ 15%, preferably ≥ 20%, more preferably ≥ 25%, more preferably ≥ 30%, more preferably ≥ 40%, more preferably ≥ 50%.

[0139] In another preferred example, the certain cell includes a tumor cell.

[0140] In another preferred example, the same type of cell includes cells of the same species.

[0141] In another preferred example, the same type of cell includes the same type of tumor cells.

[0142] In another preferred example, the same type of cell includes tumor cells of the same species.

[0143] In another preferred example, the same type of cell includes cells (such as the same type of tumor cells) with a normal or low methylation level at the nucleotide site of the NNMT gene.

[0144] In another preferred example, the same type of cell includes cells of the same species but with a normal or low methylation level at the nucleotide site of the NNMT gene.

[0145] In another preferred example, the normal cell includes normal tissue cells (such as the origin cells of tumor cells, tumor adjacent cells, or paracancerous tissue cells).

[0146] In another preferred example, the normal cell includes normal tissue cells with a normal methylation level at the nucleotide site of the NNMT gene (such as the origin cells of tumor cells, tumor adjacent cells, or paracancerous tissue cells).

[0147] In another preferred example, L0 is the methylation level at the nucleotide site of the NNMT gene in a cell with a normal or low methylation level at the nucleotide site of the NNMT gene.

[0148] In another preferred example, the cells with normal or low methylation level at the nucleotide sites of the NNMT gene include cells that are insensitive to a compound of formula I, or its optical isomers, or its racemates, or its pharmaceutically acceptable salts.

[0149] In another preferred example, a high methylation level at the nucleotide sites of the NNMT gene means that the methylation level (M%) at the nucleotide sites of the NNMT gene in a certain cell (such as a tumor cell) is ≥ 3% and ≤ M1%, where M1 is any positive integer between 3 and 100.

[0150] In another preferred example, M1 is 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 80, 85, 90, 95 or 100.

[0151] In another preferred example, the methylation level at the nucleotide sites of the NNMT gene refers to the ratio of the number of methylated nucleotides in the NNMT gene region to the total number of nucleotides in the NNMT gene region.

[0152] In another preferred example, the methylation level at the nucleotide sites of the NNMT gene includes the methylation level at the nucleotide sites in the promoter region of the NNMT gene.

[0153] In another preferred example, the nucleotide sequence of the promoter region of the NNMT gene is as shown in SEQ ID NO:1.

[0154] In another preferred example, the methylation level at the nucleotide sites of the NNMT gene includes the methylation level at the nucleotide sites in the region from 1050 bp before the transcription start site of the NNMT gene to 499 bp after the transcription start site.

[0155] In another preferred example, the region from 1050 bp before the transcription start site of the NNMT gene to 499 bp after the transcription start site corresponds to positions 951 - 2500 of the nucleotide sequence shown in SEQ ID NO:1.

[0156] In another preferred example, the methylation level at the nucleotide sites of the NNMT gene includes the methylation level at the nucleotide sites in the region from 1050 bp before the transcription start site of the NNMT gene to 193 bp before the transcription start site.

[0157] In another preferred example, the region from 1050 bp before the transcription start site of the NNMT gene to 193 bp before the transcription start site corresponds to positions 951 - 1808 of the nucleotide sequence shown in SEQ ID NO:1.

[0158] In another preferred example, the methylation level of the nucleotide sites of the NNMT gene includes the methylation level of the nucleotide sites within the region from 840 bp before the transcription start site of the NNMT gene to 469 bp before the transcription start site.

[0159] In another preferred example, the region from 840 bp before the transcription start site of the NNMT gene to 469 bp before the transcription start site corresponds to positions 1161 - 1532 of the nucleotide sequence shown in SEQ ID NO:1.

[0160] In another preferred example, the methylation level of the nucleotide sites of the NNMT gene includes the methylation level of the nucleotide sites within the region (including these two sites themselves) between any two of the sites at positions 114165695, 114165730, 114165769, 114165804, 114165938, 114166050, and 114166066 on human chromosome 11.

[0161] In another preferred example, the methylation level of the nucleotide sites of the NNMT gene includes the methylation level of the nucleotides at the sites selected from the group consisting of: position 114165695 on human chromosome 11, position 114165730 on human chromosome 11, position 114165769 on human chromosome 11, position 114165804 on human chromosome 11, position 114165938 on human chromosome 11, position 114166050 on human chromosome 11, position 114166066 on human chromosome 11, or a combination thereof.

[0162] In another preferred example, the methylation level of the nucleotide sites of the NNMT gene includes the methylation level of the nucleotide sites within the region (including these two sites themselves) between any two of the sites at positions 1161, 1196, 1235, 1270, 1404, 1516, and 1532 of the nucleotide sequence of SEQ ID NO:1.

[0163] In another preferred example, the methylation level of the nucleotide sites of the NNMT gene includes the methylation level of the nucleotides at the sites selected from the group consisting of the sequence sites of SEQ ID NO:1: position 1161, position 1196, position 1235, position 1270, position 1404, position 1516, position 1532, or a combination thereof.

[0164] In another preferred example, a high methylation level of the DNA CpG sites in the NNMT gene region means that the methylation level of the DNA CpG sites in the NNMT gene region of a certain cell (such as a tumor cell) is greater than the methylation level of the DNA CpG sites in the NNMT gene region of the same type of cell or normal cells.

[0165] In another preferred example, a high level of DNA CpG site methylation in the NNMT gene region means that the ratio (G1 / G0) of the methylation level G1 of the DNA CpG sites in the NNMT gene region of a certain cell (such as a tumor cell) to the methylation level G0 of the DNA CpG sites in the NNMT gene region of the same type of cell or normal cells is > 1.0, preferably ≥ 1.2, preferably ≥ 1.5, more preferably ≥ 2, more preferably ≥ 3, more preferably ≥ 5, more preferably ≥ 8, more preferably ≥ 10, more preferably ≥ 15, more preferably ≥ 20, more preferably ≥ 30, more preferably ≥ 50, for example 2 - 50.

[0166] In another preferred example, a high level of DNA CpG site methylation in the NNMT gene region means that the methylation level of the DNA CpG sites in the NNMT gene region of a certain cell (such as a tumor cell) is ≥ 1%, preferably ≥ 3%, preferably ≥ 5%, preferably ≥ 10%, preferably ≥ 15%, preferably ≥ 20%, more preferably ≥ 25%, more preferably ≥ 30%, more preferably ≥ 40%, more preferably ≥ 50%.

[0167] In another preferred example, the certain cell includes a tumor cell.

[0168] In another preferred example, the same type of cells includes cells of the same species.

[0169] In another preferred example, the same type of cells includes the same type of tumor cells.

[0170] In another preferred example, the same type of cells includes tumor cells of the same species.

[0171] In another preferred example, the same type of cells includes cells (such as the same type of tumor cells) with a normal or low level of DNA CpG site methylation in the NNMT gene region.

[0172] In another preferred example, the same type of cells includes cells of the same species but with a normal or low level of DNA CpG site methylation in the NNMT gene region.

[0173] In another preferred example, the normal cells include normal tissue cells (such as tumor origin cells, tumor adjacent cells, or paracancerous tissue cells).

[0174] In another preferred example, the normal cells include normal tissue cells with a normal level of DNA CpG site methylation in the NNMT gene region (such as tumor cell origin cells, tumor adjacent cells, or paracancerous tissue cells).

[0175] In another preferred embodiment, G0 is the DNA CpG site methylation level of the NNMT gene region in cells with a normal or low DNA CpG site methylation level in the NNMT gene region.

[0176] In another preferred embodiment, the cells with a normal or low DNA CpG site methylation level in the NNMT gene region include cells that are insensitive to the compound of formula I, or its optical isomers, or its racemates, or its pharmaceutically acceptable salts.

[0177] In another preferred embodiment, a high DNA CpG site methylation level in the NNMT gene region means that the DNA CpG site methylation level (M%) in a certain cell (such as a tumor cell) is ≥ 3% and ≤ M2%, where M2 is any positive integer between 3 and 100.

[0178] In another preferred embodiment, M2 is 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 80, 85, 90, 95 or 100.

[0179] In another preferred embodiment, the DNA CpG site methylation level in the NNMT gene region refers to the ratio of the number of methylated CpG nucleotides in the NNMT gene region to the total number of nucleotides in the NNMT gene region.

[0180] In another preferred embodiment, the DNA CpG site methylation level in the NNMT gene region refers to the ratio of the number of methylated CpG nucleotides in the NNMT gene region to the total number of CpG nucleotides in the NNMT gene region.

[0181] In another preferred embodiment, the DNA CpG site methylation level in the NNMT gene region refers to the ratio of the number of methylated CpG sites in the NNMT gene region DNA to the total number of CpG sites in the NNMT gene region DNA.

[0182] In another preferred embodiment, the DNA CpG site methylation level in the NNMT gene region refers to the ratio of the number of methylated CpG nucleotides in the NNMT gene region DNA to the total number of CpG nucleotides in the NNMT gene region DNA.

[0183] In another preferred embodiment, the DNA CpG site methylation level in the NNMT gene region includes the DNA CpG site methylation level in the NNMT gene promoter region.

[0184] In another preferred embodiment, the nucleotide sequence of the NNMT gene promoter region is as shown in SEQ ID NO:1.

[0185] In another preferred example, the DNA CpG site methylation level in the NNMT gene region includes the DNA CpG site methylation level in the region from 1050 bp upstream of the transcription start site of the NNMT gene to 499 bp downstream of the transcription start site.

[0186] In another preferred example, the region from 1050 bp upstream of the transcription start site of the NNMT gene to 499 bp downstream of the transcription start site corresponds to positions 951 - 2500 of the nucleotide sequence shown in SEQ ID NO:1.

[0187] In another preferred example, the DNA CpG site methylation level in the NNMT gene region includes the DNA CpG site methylation level in the region from 1050 bp upstream of the transcription start site of the NNMT gene to 193 bp upstream of the transcription start site.

[0188] In another preferred example, the region from 1050 bp upstream of the transcription start site of the NNMT gene to 193 bp upstream of the transcription start site corresponds to positions 951 - 1808 of the nucleotide sequence shown in SEQ ID NO:1.

[0189] In another preferred example, the DNA CpG site methylation level in the NNMT gene region includes the DNA CpG site methylation level in the region from 840 bp upstream of the transcription start site of the NNMT gene to 469 bp upstream of the transcription start site.

[0190] In another preferred example, the region from 840 bp upstream of the transcription start site of the NNMT gene to 469 bp upstream of the transcription start site corresponds to positions 1161 - 1532 of the nucleotide sequence shown in SEQ ID NO:1.

[0191] In another preferred example, the DNA CpG site methylation level in the NNMT gene region includes the DNA CpG site methylation level in the region between any two of the positions 114165695, 114165730, 114165769, 114165804, 114165938, 114166050, and 114166066 on human chromosome 11 (including these two positions themselves).

[0192] In another preferred example, the DNA CpG site methylation level in the NNMT gene region includes the methylation level of the sites selected from the group consisting of: position 114165695 on human chromosome 11, position 114165730 on human chromosome 11, position 114165769 on human chromosome 11, position 114165804 on human chromosome 11, position 114165938 on human chromosome 11, position 114166050 on human chromosome 11, position 114166066 on human chromosome 11, or a combination thereof.

[0193] In another preferred embodiment, the DNA CpG site methylation level in the NNMT gene region includes the DNA CpG site methylation level within the region (including these two sites themselves) between any two of the 1161st, 1196th, 1235th, 1270th, 1404th, 1516th, and 1532nd positions of the nucleotide sequence sites of SEQ ID NO:1.

[0194] In another preferred embodiment, the DNA CpG site methylation level in the NNMT gene region includes the methylation level of the SEQ ID NO:1 sequence sites selected from the group consisting of: the 1161st, 1196th, 1235th, 1270th, 1404th, 1516th, 1532nd positions, or a combination thereof.

[0195] In another preferred embodiment, the NNMT gene of the tumor is low-expressed or not expressed by administering an NNMT gene inhibitor.

[0196] In another preferred embodiment, the DNA methyltransferase of the tumor is highly expressed by administering a DNA methyltransferase promoter.

[0197] In another preferred embodiment, the UHRF1 of the tumor is highly expressed by administering a UHRF1 promoter.

[0198] In another preferred embodiment, the methylation level of the nucleotide sites of the NNMT gene in the tumor is high by administering an NNMT gene nucleotide site methylation promoter.

[0199] In another preferred embodiment, a promoter that can increase the DNA CpG site methylation level in the NNMT gene region of the tumor is administered by administering an NNMT gene region DNA CpG site methylation promoter.

[0200] In another preferred embodiment, the inhibitor includes a specific inhibitor.

[0201] In another preferred embodiment, the promoter includes a specific promoter.

[0202] In another preferred embodiment, the NNMT gene inhibitor includes an inhibitor that can make the NNMT gene of the tumor low-expressed or not expressed.

[0203] In another preferred embodiment, the DNA methyltransferase promoter includes a promoter that can make the DNA methyltransferase of the tumor highly expressed.

[0204] In another preferred embodiment, the UHRF1 promoter includes a promoter that can make the UHRF1 of the tumor highly expressed.

[0205] In another preferred example, the NNMT gene nucleotide site methylation promoter includes a promoter capable of increasing the methylation level of the NNMT gene nucleotide site in a tumor.

[0206] In another preferred example, the NNMT gene region DNA CpG site methylation promoter includes a promoter capable of increasing the methylation level of the NNMT gene region DNA CpG site in a tumor.

[0207] In another preferred example, the tumor is selected from the group consisting of: lung cancer, kidney cancer, breast cancer, intestinal cancer, lymphoma, leukemia, pancreatic cancer, brain tumor, liver cancer, prostate cancer, or a combination thereof.

[0208] In another preferred example, the lung cancer is selected from the group consisting of: non-small cell lung cancer, small cell lung cancer, or a combination thereof.

[0209] In another preferred example, the cells of the lung cancer include NCI-H82 cells.

[0210] In another preferred example, the intestinal cancer is selected from the group consisting of: colon cancer, rectal cancer, colorectal cancer, or a combination thereof.

[0211] In another preferred example, the intestinal cancer includes intestinal adenoma tumors.

[0212] In another preferred example, the colon cancer includes colon adenomas.

[0213] In another preferred example, the rectal cancer includes rectal adenomas.

[0214] In another preferred example, the colorectal cancer includes colorectal adenomas.

[0215] In another preferred example, the cells of the colon cancer include SW48 cells.

[0216] In another preferred example, the cells of the breast cancer include MDA-MB-453 cells.

[0217] In another preferred example, the breast cancer includes triple-negative breast cancer.

[0218] In another preferred example, the lymphoma is selected from the group consisting of: B lymphoma, cutaneous T cell lymphoma, or a combination thereof.

[0219] In another preferred example, the lymphoma includes diffuse large B lymphoma.

[0220] In another preferred example, the brain tumor is selected from the group consisting of: glioma, glioblastoma, gliocytoma, medulloblastoma, neuroblastoma, or a combination thereof.

[0221] In another preferred embodiment, the medulloblastoma includes cerebellar medulloblastoma.

[0222] In another preferred embodiment, the glioblastoma includes glioblastoma multiforme.

[0223] In another preferred embodiment, the brain tumor includes glioma.

[0224] In another preferred embodiment, the cells of the brain tumor include one or more of Daoy cells, GB-1 cells, and SF126 cells.

[0225] In another preferred embodiment, the renal cancer is selected from the group consisting of renal clear cell adenocarcinoma, Wilms' tumor of the kidney, or a combination thereof.

[0226] In another preferred embodiment, the renal cancer includes renal clear cell adenocarcinoma.

[0227] In another preferred embodiment, the renal cancer includes Wilms' tumor of the kidney.

[0228] In another preferred embodiment, the cancer cells of the renal cancer include Wilms' tumor cells of the kidney.

[0229] In another preferred embodiment, the cancer cells of the renal cancer include one or more of G-401 cells and 786-O cells.

[0230] In another preferred embodiment, the pancreatic cancer includes pancreatic ductal carcinoma.

[0231] In another preferred embodiment, the cancer cells of the pancreatic cancer include CFPAC-1 cells.

[0232] In another preferred embodiment, the leukemia is selected from the group consisting of T-lymphocyte leukemia, myelocytic leukemia, or a combination thereof.

[0233] In another preferred embodiment, the T-lymphocyte leukemia includes acute T-lymphocyte leukemia.

[0234] In another preferred embodiment, the myelocytic leukemia includes M4 grade AML acute myelocytic leukemia.

[0235] In another preferred embodiment, the myelocytic leukemia includes FAB M4 grade AML acute myelocytic leukemia.

[0236] In another preferred embodiment, the level includes protein level and / or mRNA level.

[0237] In another preferred embodiment, the expression includes protein expression and / or mRNA expression.

[0238] In another preferred embodiment, the composition or preparation is a pharmaceutical composition or preparation.

[0239] In another preferred embodiment, the composition or preparation further comprises a pharmaceutically acceptable carrier.

[0240] In another preferred embodiment, the dosage form of the composition or preparation is a solid preparation, a liquid preparation or a semi-solid preparation. In another preferred embodiment, the dosage form of the composition or preparation is an oral preparation, a topical preparation or an injection preparation.

[0241] In a second aspect of the present invention, there is provided a biomarker for determining whether a tumor patient is suitable for preventing and / or treating tumors with the compound of formula I as described in the first aspect of the present invention, or its optical isomer, or its racemate, or its pharmaceutically acceptable salt, wherein the biomarker comprises a mitochondrial membrane permeability transition pore, peptidyl-prolyl isomerase F, NNMT gene, DNA methyltransferase, UHRF1, methylation of nucleotide sites of the NNMT gene, and / or methylation of DNA CpG sites in the NNMT gene region.

[0242] In another preferred embodiment, the biomarker comprises the expression level or activity of a mitochondrial membrane permeability transition pore, the expression level or activity of peptidyl-prolyl isomerase F, the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of nucleotide sites of the NNMT gene, and / or the methylation level of DNA CpG sites in the NNMT gene region.

[0243] In another preferred embodiment, the biomarker comprises a biomarker in tumor cells.

[0244] In another preferred embodiment, when the tumor cells of a tumor patient have low expression, no expression, low activity or no activity of a mitochondrial membrane permeability transition pore, low expression, no expression, low activity or no activity of peptidyl-prolyl isomerase F, low expression or no expression of the NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, high methylation level of nucleotide sites of the NNMT gene, and / or high methylation level of DNA CpG sites in the NNMT gene region, then the tumor patient is suitable for preventing and / or treating with the compound of formula I as described in the first aspect of the present invention, or its optical isomer, or its racemate, or its pharmaceutically acceptable salt.

[0245] In another preferred embodiment, the tumor patient is suitable for using the compound of formula I as described in the first aspect of the present invention, or its optical isomer, or its racemate, or its pharmaceutically acceptable salt, which includes that the tumor of the tumor patient is sensitive to the compound of formula I as described in the first aspect of the present invention, or its optical isomer, or its racemate, or its pharmaceutically acceptable salt.

[0246] In the third aspect of the present invention, there is provided a use of a detection kit for preparing an accompanying diagnostic kit for determining whether a cancer patient is suitable for prevention and / or treatment with the compound of formula I described in the first aspect of the present invention, or its optical isomer, or its racemate, or its pharmaceutically acceptable salt;

[0247] The detection kit described above includes:

[0248] (i) Detection reagents for detecting the expression level or activity of mitochondrial permeability transition pore, the expression level or activity of peptidylprolyl isomerase F, the expression level of NNMT gene, the expression level of DNA methylase, the expression level of UHRF1, the methylation level of nucleotide sites of NNMT gene, and / or the methylation level of DNA CpG sites in the NNMT gene region.

[0249] In another preferred example, the detection sample of the detection kit includes cancer cells.

[0250] In another preferred example, the above-mentioned level includes protein level and / or mRNA level.

[0251] In another preferred example, the above-mentioned expression includes mRNA and / or protein expression.

[0252] In another preferred example, the accompanying diagnostic kit further includes an instruction manual or a label, and the instruction manual or the label records:

[0253] When the mitochondrial permeability transition pore in the cancer cells of a cancer patient shows low expression, no expression, low activity or no activity, peptidylprolyl isomerase F shows low expression, no expression, low activity or no activity, the NNMT gene shows low expression or no expression, DNA methylase shows high expression, UHRF1 shows high expression, the methylation level of nucleotide sites of NNMT gene is high, and / or the methylation level of DNA CpG sites in the NNMT gene region is high, then this cancer patient is suitable for prevention and / or treatment with the compound of formula I described in the first aspect of the present invention, or its optical isomer, or its racemate, or its pharmaceutically acceptable salt.

[0254] In another preferred example, the cancer patient is suitable for using the compound of formula I described in the first aspect of the present invention, or its optical isomer, or its racemate, or its pharmaceutically acceptable salt, which includes that the cancer of the cancer patient is sensitive to the compound of formula I described in the first aspect of the present invention, or its optical isomer, or its racemate, or its pharmaceutically acceptable salt.

[0255] In the fourth aspect of the present invention, there is provided a medicine box, and the medicine box includes:

[0256] (i) A detection reagent for detecting the expression level or activity of mitochondrial membrane permeability transition pore, the expression level or activity of peptidyl-prolyl isomerase F, the expression level of NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of nucleotide sites of NNMT gene, and / or the methylation level of DNA CpG sites in the NNMT gene region; and

[0257] (ii) A compound of formula I as described in the first aspect of the present invention, or its optical isomer, or its racemate, or its pharmaceutically acceptable salt.

[0258] In another preferred embodiment, the sample for detection includes tumors.

[0259] In the fifth aspect of the present invention, there is provided a method for preventing and / or treating tumors, the method comprising administering to a subject in need a compound of formula I as described in the first aspect of the present invention, or its optical isomer, or its racemate, or its pharmaceutically acceptable salt, thereby preventing and / or treating tumors.

[0260] In another preferred embodiment, the tumor is as described in the first aspect of the present invention.

[0261] In another preferred embodiment, the subject is a human and non-human mammals (rodents, rabbits, monkeys, livestock, dogs, cats, etc.).

[0262] In another preferred embodiment, the method comprises the steps of:

[0263] First, making the mitochondrial membrane permeability transition pore of the subject's tumor have low expression, no expression, low activity or no activity, peptidyl-prolyl isomerase F have low expression, no expression, low activity or no activity, the NNMT gene have low expression or no expression, DNA methyltransferase have high expression, UHRF1 have high expression, the methylation level of nucleotide sites of NNMT gene be high, and / or the methylation level of DNA CpG sites in the NNMT gene region be high, and then administering the compound of formula I, or its optical isomer, or its racemate, or its pharmaceutically acceptable salt for preventing and / or treating tumors.

[0264] In another preferred embodiment, the method comprises the steps of:

[0265] First, administer to a subject a mitochondrial permeability transition pore inhibitor, a peptidylprolyl isomerase F inhibitor, an NNMT gene inhibitor, a DNA methyltransferase promoter, a UHRF1 promoter, an NNMT gene nucleotide site methylation promoter, and / or an NNMT gene region DNA CpG site methylation promoter, such that the mitochondrial permeability transition pore in the subject's tumor is lowly expressed, not expressed, low in activity or inactive, peptidylprolyl isomerase F is lowly expressed, not expressed, low in activity or inactive, the NNMT gene is lowly expressed or not expressed, DNA methyltransferase is highly expressed, UHRF1 is highly expressed, the methylation level of the NNMT gene nucleotide site is high, and / or the methylation level of the NNMT gene region DNA CpG site is high. Then, administer the compound of formula I, or its optical isomer, or its racemate, or its pharmaceutically acceptable salt, for preventing and / or treating tumors.

[0266] In another preferred embodiment, the mitochondrial permeability transition pore inhibitor, peptidylprolyl isomerase F inhibitor, NNMT gene inhibitor, DNA methyltransferase promoter, UHRF1 promoter, NNMT gene nucleotide site methylation promoter, and / or NNMT gene region DNA CpG site methylation promoter are as described in the first aspect of the present invention.

[0267] In the sixth aspect of the present invention, there is provided the use of a mitochondrial permeability transition pore inhibitor, a peptidylprolyl isomerase F inhibitor, an NNMT gene inhibitor, a DNA methyltransferase promoter, a UHRF1 promoter, an NNMT gene nucleotide site methylation promoter, and / or an NNMT gene region DNA CpG site methylation promoter for preparing a composition or formulation for enhancing the anti-tumor effect of an anti-tumor drug.

[0268] In another preferred embodiment, the mitochondrial permeability transition pore inhibitor, peptidylprolyl isomerase F inhibitor, NNMT gene inhibitor, DNA methyltransferase promoter, UHRF1 promoter, NNMT gene nucleotide site methylation promoter, and / or NNMT gene region DNA CpG site methylation promoter are as described in the first aspect of the present invention above.

[0269] In another preferred embodiment, the anti-tumor drug includes the compound of formula I as described in the first aspect of the present invention, or its optical isomer, or its racemate, or its pharmaceutically acceptable salt.

[0270] In another preferred embodiment, the tumor is as described in the first aspect of the present invention.

[0271] In another preferred embodiment, the composition or formulation is a pharmaceutical composition or a pharmaceutical formulation.

[0272] In another preferred embodiment, the composition or preparation further comprises a pharmaceutically acceptable carrier.

[0273] In another preferred embodiment, the dosage form of the composition or preparation is a solid preparation, a liquid preparation or a semi-solid preparation.

[0274] In another preferred embodiment, the dosage form of the composition or preparation is an oral preparation, a topical preparation or an injection preparation.

[0275] In the seventh aspect of the present invention, there is provided an active ingredient combination, which comprises:

[0276] (1) A first active ingredient, which comprises an anti-tumor drug; and

[0277] (2) A second active ingredient, which comprises a mitochondrial membrane permeability transition pore inhibitor, a peptidyl-prolyl isomerase F inhibitor, an NNMT gene inhibitor, a DNA methylase promoter, a UHRF1 promoter, an NNMT gene nucleotide site methylation promoter, and / or an NNMT gene region DNA CpG site methylation promoter.

[0278] In another preferred embodiment, the anti-tumor drug is the compound of formula I as described in the first aspect of the present invention, or its optical isomer, or its racemate, or its pharmaceutically acceptable salt.

[0279] In another preferred embodiment, the mitochondrial membrane permeability transition pore inhibitor, the peptidyl-prolyl isomerase F inhibitor, the NNMT gene inhibitor, the DNA methylase promoter, the UHRF1 promoter, the NNMT gene nucleotide site methylation promoter, and / or the NNMT gene region DNA CpG site methylation promoter are as described in the first aspect of the present invention.

[0280] In the eighth aspect of the present invention, there is provided a composition, which comprises:

[0281] (1) A first active ingredient, which comprises an anti-tumor drug; and

[0282] (2) A second active ingredient, which comprises a mitochondrial membrane permeability transition pore inhibitor, a peptidyl-prolyl isomerase F inhibitor, an NNMT gene inhibitor, a DNA methylase promoter, a UHRF1 promoter, an NNMT gene nucleotide site methylation promoter, and / or an NNMT gene region DNA CpG site methylation promoter.

[0283] In another preferred embodiment, the anti-tumor drug is the compound of formula I as described in the first aspect of the present invention, or its optical isomer, or its racemate, or its pharmaceutically acceptable salt.

[0284] In another preferred embodiment, the mitochondrial membrane permeability transition pore inhibitor, peptidyl-prolyl isomerase F inhibitor, NNMT gene inhibitor, DNA methylase promoter, UHRF1 promoter, NNMT gene nucleotide site methylation promoter, and / or NNMT gene region DNA CpG site methylation promoter are as described in the first aspect of the present invention.

[0285] In another preferred embodiment, the composition is a pharmaceutical composition.

[0286] In another preferred embodiment, the composition further comprises a pharmaceutically acceptable carrier.

[0287] In the ninth aspect of the present invention, there is provided a compound of formula I, or an optical isomer thereof, or a racemate thereof, or a pharmaceutically acceptable salt thereof;

[0288]

[0289] In another preferred embodiment, R 1 , R 2 , R 3 and R 4 are each independently as described in the first aspect of the present invention.

[0290] In another preferred embodiment, the compound of formula I, or an optical isomer thereof, or a racemate thereof, or a pharmaceutically acceptable salt thereof is as described in the first aspect of the present invention.

[0291] In another preferred embodiment, R 1 , R 2 , R 3 and R 4 are each independently phenyl, phenyl substituted with methoxy, indolyl, indolyl substituted with methyl, pyrrolopyridinyl, pyrrolopyridinyl substituted with methyl, pentyl ester-tetrahydropyridinyl-, methyl, ethyl, propyl, butyl, pentyl, hexyl.

[0292] In another preferred embodiment, the phenyl substituted with methoxy is phenyl mono-substituted with methoxy.

[0293] In another preferred embodiment, the phenyl substituted with methoxy is

[0294] In another preferred embodiment, the indolyl is

[0295] In another preferred embodiment, the indolyl substituted with methyl is indolyl mono-substituted with methyl.

[0296] In another preferred embodiment, the indolyl substituted with methyl is

[0297] In another preferred embodiment, the methyl-substituted pyrrolopyridinyl is a mono-methyl-substituted pyrrolopyridinyl.

[0298] In another preferred embodiment, the pyrrolopyridinyl is pyrrolo[3,2-b]pyridinyl.

[0299] In another preferred embodiment, the pyrrolopyridinyl is 1H-pyrrolo[3,2-b]pyridinyl.

[0300] In another preferred embodiment, the methyl-substituted pyrrolopyridinyl is

[0301] In another preferred embodiment, the tetrahydropyridinyl is 1,2,3,6-tetrahydropyridinyl.

[0302] In another preferred embodiment, the pentyl ester group-tetrahydropyridinyl- is

[0303] In another preferred embodiment, the compound of formula I, or its optical isomer, or its racemate, or its pharmaceutically acceptable salt is:

[0304]

[0305]

[0306] In the tenth aspect of the present invention, there is provided a composition, which comprises (a) the compound of formula I as described in the ninth aspect of the present invention, or its optical isomer, or its racemate, or its pharmaceutically acceptable salt.

[0307] In another preferred embodiment, the content of (a) the compound of formula I as described in the ninth aspect of the present invention, or its optical isomer, or its racemate, or its pharmaceutically acceptable salt is 0.001-99.9 wt%, based on the weight of the composition.

[0308] In another preferred embodiment, the composition is a pharmaceutical composition.

[0309] In another preferred embodiment, the composition further comprises a pharmaceutically acceptable carrier.

[0310] In another preferred embodiment, the dosage form of the composition is a solid preparation, a liquid preparation or a semi-solid preparation.

[0311] In another preferred embodiment, the dosage form of the composition is an oral preparation, a topical preparation or an injection preparation

[0312] Within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described hereinafter can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be elaborated one by one here. Description of the Drawings

[0313] Figure 1 For detecting the expression level of PPIF protein by Western blot. Among them, Con shRNA is the expression level of PPIF protein in Daoy cells transfected with an empty virus vector without shRNA specifically inducing the degradation of PPIF mRNA, and PPIF shRNA is the expression level of PPIF protein in Daoy cells transfected with a virus vector carrying shRNA specifically inducing the degradation of PPIF mRNA.

[0314] Figure 2 For the relative cell viability of Daoy cells with inactive mPTP and Daoy cells with active mPTP. Among them, ConshRNA is the relative viability of Daoy cells transfected with an empty virus vector without shRNA specifically inducing the degradation of PPIF mRNA (i.e., Daoy cells with active mPTP), and PPIF shRNA is the relative viability of Daoy cells transfected with a virus vector carrying shRNA specifically inducing the degradation of PPIF mRNA (Daoy cells with inactive mPTP).

[0315] Figure 3 For detecting the expression content of NNMT protein in Con-NCI-H82 cells and ov-NNMT NCI-H82 cells by Western blot experiment. Among them, Con-NCI-H82 is the expression content of NNMT protein in NCI-H82 cells transfected with an empty virus vector without the NNMT gene, as a control; ov-NNMT NCI-H82 is the expression content of NNMT protein in NCI-H82 cells transfected with a virus vector carrying the NNMT gene.

[0316] Figure 4 For the relative cell viability of Con-NCI-H82 cells and ov-NNMT NCI-H82 cells. Among them, Con-NCI-H82 is the cell viability of NCI-H82 cells transfected with an empty virus vector without the NNMT gene, as a control; ov-NNMTNCI-H82 is the cell viability of NCI-H82 cells transfected with a virus vector carrying the NNMT gene.

[0317] Figure 5 For the expression of the NNMT gene in tumor cells sensitive and insensitive to the compounds of the embodiments of the present invention.

[0318] Figure 6 For the methylation level of DNA CpG sites in the promoter region of the NNMT gene in tumor cells sensitive and insensitive to the compounds of the embodiments of the present invention.

[0319] Figure 7 The DNA CpG site methylation levels in the region from 1050 bp upstream to 499 bp downstream of the transcription start site of the NNMT gene in tumor cells sensitive and insensitive to the compounds of the embodiments of the present invention.

[0320] Figure 8 The DNA CpG site methylation levels in the region from 1050 bp upstream to 193 bp upstream of the transcription start site of the NNMT gene in tumor cells sensitive and insensitive to the compounds of the embodiments of the present invention.

[0321] Figure 9 For the DNA CpG site methylation of specific NNMT gene regions in tumor cells sensitive and insensitive to the compounds of the embodiments of the present invention, i.e., at positions 114165695, 114165730, 114165769, 114165804, 114165938, 114166050, 114166066 on human chromosome 11. Black dots indicate that the relevant sites are methylated, white dots indicate that the relevant sites are not methylated, SST refers to the transcription start site, and Chr11 refers to human chromosome 11 defined according to the human genome version GCF_000001405.25 (GRCh37.p13).

[0322] Figure 10 For the correlation between the expression of NNMT and the expressions of DNMT1, UHRF1, DNMT3a, and DNMT3b in tumor cells. Detailed implementation manners

[0323] After long-term and in-depth research, the present inventors unexpectedly discovered for the first time that the compounds of the present invention have excellent precision treatment effects on tumor cells with low expression, no expression, low activity or no activity of mitochondrial membrane permeability transition pores, low expression, no expression, low activity or no activity of peptidyl-prolyl isomerase F, low expression or no expression of the NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, high methylation level of nucleotide sites of the NNMT gene, and / or high DNA CpG site methylation level in the NNMT gene region. On this basis, the inventors completed the present invention.

[0324] Terms

[0325] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains.

[0326] As used herein, the terms "comprising", "including" and "containing" are used interchangeably and include not only open-ended definitions but also semi-closed and closed definitions. In other words, the terms include "consisting of" and "consisting essentially of".

[0327] As used herein, the terms "cancer", "carcinoma", "tumor" and "neoplasm" are used interchangeably.

[0328] As used herein, the term "a cell" refers to a single cell (such as a single cancer cell) or a group of cells containing multiple similar cells (such as a tumor tissue).

[0329] As used herein, "a tumor patient is suitable for using the compound of the present invention" includes that the tumor of the tumor patient is sensitive to the compound of the present invention.

[0330] As used herein, the terms "high DNA CpG site methylation level", "high DNA CpG site methylation" and "high DNA CpG site hypermethylation" are used interchangeably.

[0331] As used herein, the terms "CpG site methylation", "CpG nucleotide methylation" and "CpG methylation" are used interchangeably.

[0332] As used herein, the term "IC50" and "IC 50 " are used interchangeably and refer to the half-inhibitory concentration (50% inhibiting concentration), that is, the concentration of the inhibitor when a 50% inhibitory effect is achieved.

[0333] As used herein, the term "P / S" refers to adding Penicillin and Streptomycin to the relevant culture medium.

[0334] As used herein, "low expression, no expression, low activity or no activity of the mitochondrial membrane permeability transition pore, low expression, no expression, low activity or no activity of peptidylprolyl isomerase F, low expression or no expression of the NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, high methylation level of the nucleotide site of the NNMT gene, and / or high DNA CpG site methylation level in the NNMT gene region" refers to one or more of low expression, no expression, low activity or no activity of the mitochondrial membrane permeability transition pore, low expression, no expression, low activity or no activity of peptidylprolyl isomerase F, low expression or no expression of the NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, high methylation level of the nucleotide site of the NNMT gene, and high DNA CpG site methylation level in the NNMT gene region.

[0335] As used herein, the term "mitochondrial permeability transition pore" is abbreviated as mPTP (mitochondria permeability transition pore).

[0336] As used herein, the term "peptidyl-prolyl cis-trans isomerase F" is abbreviated as PPIF (Peptidyl-prolyl cis-trans isomerase F).

[0337] As used herein, the English name of the term "NNMT" is Nicotinamide N-Methyltransferase.

[0338] As used herein, the term "bp" refers to base pair, a base pair.

[0339] As used herein, the term "SST" refers to the transcription start site.

[0340] As used herein, the term "Chr11" refers to human chromosome 11 defined by the human genome version GCF_000001405.25 (GRCh37.p13).

[0341] As used herein, "human chromosome 11" refers to human chromosome 11 defined by the human genome version GCF_000001405.25 (GRCh37.p13).

[0342] As used herein, the terms "before the transcription start site", "after the transcription start site", "prior to the transcription start site", and "subsequent to the transcription start site" do not include the transcription start site itself.

[0343] As used herein, the term "position 114165695 of human chromosome 11" refers to the nucleotide at position 114165695 of human chromosome 11, and so on.

[0344] As used herein, gene expression includes protein expression of the gene and / or mRNA expression of the gene, etc.

[0345] As used herein, the English for DNA methylation is DNA methylation.

[0346] As used herein, the term "DNMT3a" refers to DNA methyltransferase 3a (DNA methyltransferase 3a) and is used interchangeably with "DNMT3A".

[0347] As used herein, the term "DNMT3b" refers to DNA methyltransferase 3b (DNA methyltransferase 3b) and is used interchangeably with "DNMT3B".

[0348] As used herein, the term "DNMT1" refers to DNA methyltransferase 1.

[0349] As used herein, the term "UHRF1" refers to ubiquitin-like PHD and ring finger domain-containing protein 1.

[0350] As used herein, the term "CpG" refers to the dinucleotide, which is the abbreviation of cytosine (C)-phosphate (p)-guanine (G).

[0351] As used herein, the terms "SF-126 cell" and "SF126 cell" are used interchangeably.

[0352] As used herein, the term "MS-ESI" refers to mass spectrometry with an electrospray ionization source.

[0353] As used herein, the term " 1 H NMR" refers to proton nuclear magnetic resonance.

[0354] It should be understood that those of ordinary skill in the art can select substituents and substitution patterns on the compounds of the present invention to produce chemically stable compounds, which can be synthesized by techniques known in the art and the methods described below. If substituted by more than one substituent group, it should be understood that these groups can be on the same carbon or on different carbons, as long as a stable structure is produced.

[0355] As used herein, the term "substituted" or "substitution" means that a hydrogen atom on a group is replaced by a non-hydrogen atom group, provided that its valence requirements are met and a chemically stable compound is formed by the substitution, i.e., a compound that does not spontaneously undergo transformations such as cyclization, elimination, etc.

[0356] As used herein, represents the attachment site of the group.

[0357] As used herein, the term "alkyl" refers to a straight-chain (i.e., unbranched) or branched saturated hydrocarbon group containing only carbon and hydrogen atoms, or a group combining straight-chain and branched chains. When the alkyl is preceded by a carbon atom number limitation (such as C1-C6 alkyl), it means the number of carbon atoms contained in the alkyl (such as 1-6), for example, C1-C4 alkyl refers to an alkyl containing 1-4 carbon atoms. Representative examples of alkyl include, but are not limited to, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, pentyl, hexyl, heptyl, octyl, nonyl, decyl, or similar groups.

[0358] As used herein, the term "alkenyl" refers to a hydrocarbon group formed by removing a hydrogen atom bonded to a double bond from a straight-chain or branched-chain olefin molecule having one or more double bonds. When a carbon atom number limitation is provided before the alkenyl (such as C2-C6 alkenyl), it means the number of carbon atoms contained in the alkenyl (such as 2-6). For example, C2-C4 alkenyl refers to an alkenyl containing 2-4 carbon atoms. Representative examples include, but are not limited to, vinyl (CH 2 =CH-), butenyl (such as C(CH 3 ) 2 =CH-), or similar groups.

[0359] As used herein, the term "halogen" refers to F, Cl, Br, or I.

[0360] As used herein, the term "halo" means that one or more (preferably 1, 2, or 3) hydrogen atoms on a group are replaced by a halogen.

[0361] As used herein, the term "haloalkyl" means that one or more (preferably 1, 2, 3, or 4) hydrogen atoms of an alkyl group are replaced by a halogen, where the alkyl group and the halogen are as defined above. When a carbon atom number limitation is provided before the haloalkyl (such as C1-C8 haloalkyl), it means the number of carbon atoms contained in the haloalkyl (such as 1-8). For example, C1-C6 haloalkyl refers to a haloalkyl containing 1-6 carbon atoms. Representative examples of haloalkyl include, but are not limited to, -CF 3 、-CHF 2 、monofluoroisopropyl, difluorobutyl, or similar groups.

[0362] As used herein, the term "cycloalkyl" refers to a hydrocarbon group having a saturated or partially saturated monocyclic, bicyclic, or polycyclic (fused, bridged, or spiro) ring carbon system. When a carbon atom number limitation is provided before a certain cycloalkyl (such as C3-C12), it means the number of ring carbon atoms of the cycloalkyl (such as 3-12). For example, the term "C3-C8 cycloalkyl" refers to a saturated or partially saturated monocyclic or bicyclic alkyl having 3-8 ring carbon atoms, including cyclopropyl, cyclobutyl, cyclopentyl, cycloheptyl, or similar groups. "Spirocycloalkyl" refers to a bicyclic or polycyclic group in which a single carbon atom (called a spiro atom) is shared between monocyclic rings, and these can contain one or more double bonds, but none of the rings has a completely conjugated π electron system. "Fused cycloalkyl" refers to a fully carbon bicyclic or polycyclic group in which each ring in the system shares an adjacent pair of carbon atoms with other rings in the system, and one or more of the rings can contain one or more double bonds, but none of the rings has a completely conjugated π electron system. "Bridged cycloalkyl" refers to a fully carbon polycyclic group in which any two rings share two non-directly connected carbon atoms, and these rings can contain one or more double bonds, but none of the rings has a completely conjugated π electron system. The following are representative examples of cycloalkyl, including but not limited to:

[0363]

[0364] As used herein, the term "halocycloalkyl" means that one or more (preferably 1, 2, 3 or 4) hydrogens of cycloalkyl are substituted by halogen, and the cycloalkyl and halogen are as defined above. When a carbon atom number limit is provided before the halocycloalkyl (such as C3-C8 halocycloalkyl), it refers to the number of ring carbon atoms contained in the halocycloalkyl (such as 3-8 ring carbon atoms). For example, C3-C8 halocycloalkyl refers to a halocycloalkyl containing 3-8 ring carbon atoms. Representative examples of halocycloalkyl include, but are not limited to, monofluorocyclopropyl, monochlorocyclobutyl, monofluorocyclopentyl, difluorocycloheptyl, or similar groups.

[0365] As used herein, the term "alkoxy" means an R-O- group, where R is an alkyl group as defined hereinabove. When a carbon atom number limit is provided before the alkoxy, such as C1-C8 alkoxy, it means that the alkyl group in the alkoxy has 1-8 carbon atoms. Representative examples of alkoxy include, but are not limited to: methoxy, ethoxy, n-propoxy, isopropoxy, tert-butoxy, or similar groups.

[0366] As used herein, the term "alkylthio" means an R-S- group, where R is an alkyl group as defined hereinabove. When a carbon atom number limit is provided before the alkylthio, such as C1-C8 alkylthio, it means that the alkyl group in the alkylthio has 1-8 carbon atoms. Representative examples of alkylthio include, but are not limited to: methylthio, ethylthio, n-propylthio, isopropylthio, tert-butylthio, or similar groups.

[0367] As used herein, the term "haloalkoxy" means haloalkyl-O-, and the haloalkyl is as defined above. When a carbon atom number limit is provided before the haloalkoxy, for example, C1-C6 haloalkoxy means C1-C6 haloalkyl-O-, that is, a haloalkoxy containing 1-6 carbon atoms. Representative examples of haloalkoxy include, but are not limited to, monofluoromethoxy, monofluoroethoxy, difluorobutoxy, or similar groups.

[0368] As used herein, the term "haloalkylthio" means haloalkyl-S-, and the haloalkyl is as defined above. When a carbon atom number limit is provided before the haloalkylthio, for example, C1-C6 haloalkylthio means C1-C6 haloalkyl-S-, that is, a haloalkylthio containing 1-6 carbon atoms. Representative examples of haloalkylthio include, but are not limited to, monofluoromethylthio, monofluoroethylthio, difluorobutylthio, or similar groups.

[0369] As used herein, the term "cycloalkyloxy" refers to an R-O-group, where R is a cycloalkyl group as defined hereinabove. When a carbon atom number limitation is present before the cycloalkyloxy, such as C3-C8 cycloalkyloxy, it means that the cycloalkyl group in the cycloalkyloxy has 3 to 8 ring carbon atoms. Representative examples of cycloalkyloxy include, but are not limited to: cyclopropyloxy, cyclobutyloxy, or similar groups.

[0370] As used herein, the term "cycloalkylthio" refers to an R-S-group, where R is a cycloalkyl group as defined hereinabove. When a carbon atom number limitation is present before the cycloalkylthio, such as C3-C8 cycloalkylthio, it means that the cycloalkyl group in the cycloalkylthio has 3 to 8 ring carbon atoms. Representative examples of cycloalkylthio include, but are not limited to: cyclopropylthio, cyclobutylthio, or similar groups.

[0371] As used herein, the term "halocycloalkyloxy" means that one or more (preferably 1, 2, 3, or 4) hydrogens of the cycloalkyloxy are replaced by halogen, where the cycloalkyloxy and halogen are as defined above. When a carbon atom number limitation is present before the halocycloalkyloxy (such as C3-C8 halocycloalkyloxy), it means the number of ring carbon atoms contained in the halocycloalkyloxy (such as 3 to 8), for example, C3-C8 halocycloalkyloxy refers to a halocycloalkyloxy containing 3 to 8 ring carbon atoms. Representative examples of halocycloalkyloxy include, but are not limited to: monofluorocyclopropyl-O-, monochlorocyclobutyl-O-, monofluorocyclopentyl-O-, difluorocycloheptyl-O-, or similar groups.

[0372] As used herein, the term "halocycloalkylthio" means that one or more (preferably 1, 2, 3, or 4) hydrogens of the cycloalkylthio are replaced by halogen, where the cycloalkylthio and halogen are as defined above. When a carbon atom number limitation is present before the halocycloalkylthio (such as C3-C8 halocycloalkylthio), it means the number of ring carbon atoms contained in the halocycloalkylthio (such as 3 to 8), for example, C3-C8 halocycloalkylthio refers to a halocycloalkylthio containing 3 to 8 ring carbon atoms. Representative examples of halocycloalkylthio include, but are not limited to: monofluorocyclopropyl-S-, monochlorocyclobutyl-S-, monofluorocyclopentyl-S-, difluorocycloheptyl-S-, or similar groups.

[0373] As used herein, the term "heteroalkyl" refers to a fully saturated or partially unsaturated cyclic (including but not limited to, for example, 3- to 7-membered monocyclic, 7- to 11-membered bicyclic, or 8- to 16-membered tricyclic systems) group in which at least one heteroatom is present in a ring having at least one carbon atom, and the point of attachment of the group is on a ring containing a heteroatom. When a heteroalkyl is preceded by a limitation on the number of members, it refers to the number of ring atoms of the heteroalkyl. For example, 3- to 16-membered heteroalkyl refers to a heteroalkyl having 3 to 16 ring atoms. Each heteroatom-containing heterocycle may bear one or more (such as 1, 2, 3, or 4) heteroatoms, each independently selected from a nitrogen atom, an oxygen atom, or a sulfur atom, where the nitrogen atom or sulfur atom may be oxidized and the nitrogen atom may also be quaternized. Representative monocyclic heteroalkyls include but are not limited to azetidinyl, oxetanyl, tetrahydrofuranyl, piperidinyl, piperazinyl. Polycyclic heteroalkyls include spiro, fused, and bridged heterocyclic groups; the spiro, fused, and bridged heteroalkyls involved are optionally connected to other groups by a single bond or further fused to other cycloalkane rings or heterocycloalkane rings through any two or more atoms on the ring.

[0374] As used herein, the term "aryl" refers to a monocyclic or fused polycyclic (i.e., rings sharing adjacent pairs of carbon atoms) group of all-carbon atoms having a conjugated π-electron system, which is an aromatic cyclic hydrocarbon group. When an aryl is preceded by a limitation on the number of carbon atoms, it refers to the aryl having that number of ring carbon atoms. For example, C6-C12 aryl refers to an aryl having 6 to 12 ring carbon atoms, such as phenyl and naphthyl.

[0375] As used herein, the term "heteroaryl" refers to an aromatic heterocyclic system group having one or more (preferably 1, 2, 3, or 4) ring heteroatoms, where at least one heteroatom is present in a ring having at least one carbon atom, and it may be a monocyclic (monocyclic) or polycyclic (bicyclic, tricyclic, or polycyclic) group fused together or covalently linked. Each heteroatom-containing heterocycle may bear one or more (such as 1, 2, 3, 4) heteroatoms each independently selected from the group consisting of oxygen, sulfur, and nitrogen. When a heteroaryl is preceded by a limitation on the number of members, it refers to the number of ring atoms of the heteroaryl. For example, 5- to 12-membered heteroaryl refers to a heteroaryl having 5 to 12 ring atoms. Representative examples of heteroaryl include but are not limited to: pyrrolyl, pyrazolyl, imidazolyl, thiazolyl, furanyl, pyridyl, pyrimidinyl, etc.

[0376] As used herein, the term "ester group" refers to a group of R-C(O)-O- or -C(O)-O-R, where R is an alkyl group as defined hereinabove. For example, "C 2 -C 4 ester group" refers to C 1 -C 3A group of the structure alkyl-C(O)-O- or -C(O)-O-C 1 -C 3 A group of the alkyl structure. Representative examples of the ester group include, but are not limited to: CH 3 C(O)O-, C 2 H 5 C(O)O-, (CH 3 ) 2 CHC(O)O-, -C(O)OCH 3 -, -C(O)OC 2 H 5 , or a similar group.

[0377] As used herein, the term "amide group" refers to a group having the structure R-C(O)-NH- or -C(O)-NH-R, where R is an alkyl group as defined hereinabove, for example, "C 2 -C 4 The amide group" refers to a group of the structure alkyl-C(O)-NH- or -C(O)-NH-C 1 -C 3 -C 1 -C 3 alkyl structure. Representative examples of the amide group include, but are not limited to: CH 3 C(O)-NH-, C 2 H 5 C(O)-NH-, (CH 3 ) 2 CHC(O)-NH-, -C(O)-NH-CH 3 -, -C(O)-NH-C 2 H 5 , or a similar group.

[0378] As used herein, "-C(O)-" is used interchangeably with As used herein, when used alone or as part of another substituent, the term "amino" is -NH

[0379] 2 2 .

[0380] As used herein, when used alone or as part of another substituent, the term "hydroxyl" is -OH.

[0381] As used herein, when used alone or as part of another substituent, the term "mercapto" is -SH.

[0382] In the present invention, all substituents should be construed as unsubstituted unless explicitly described as "substituted" herein. The term "substituted" means that one or more hydrogen atoms on a group are each independently replaced by a substituent. The substituent can be the substituent described correspondingly above, or the substituent appearing in each embodiment. Unless otherwise specified, an arbitrarily substituted group can be substituted at any substitutable site of the group, and the substituents can be the same or different at each position.

[0383] In the present invention, the term "prevention" refers to a method of preventing the onset of a disease and / or its attendant symptoms or protecting a subject from acquiring a disease. As used herein, "prevention" also includes delaying the onset of a disease and / or its attendant symptoms and reducing the risk of the subject contracting the disease.

[0384] In the present invention, the term "treatment" includes delaying and terminating the progression of a disease, or eliminating the disease, and does not require 100% inhibition, eradication, and reversal. In some embodiments, compared to the level observed in the absence of the compounds of the present invention, the compounds of the present invention reduce, inhibit, and / or reverse a related disease (such as a tumor) and its complications by, for example, at least about 30%, at least about 50%, or at least about 80%, at least about 90%, or 100%.

[0385] Compound

[0386] As used herein, "the compounds of the present invention", "the compounds described in the present invention", "the compounds of formula I of the present invention", or "the compounds of formula I" are used interchangeably and refer to compounds having the structure of formula I, or their optical isomers, or their racemates, or their pharmaceutically acceptable salts.

[0387] The structure of the compounds of formula I of the present invention is as follows:

[0388]

[0389] Specifically, the compounds of formula I described in the present invention, or their optical isomers, or their racemates, or their pharmaceutically acceptable salts are as described in the first aspect of the present invention above.

[0390] Representatively, the compounds of formula I described in the present invention, or their optical isomers, or their racemates, or their pharmaceutically acceptable salts are as described in the specific compounds of the examples of the present invention (including their salt forms or free forms without salt groups).

[0391] NNMT gene

[0392] In the present invention, the English name of NNMT is Nicotinamide N-Methyltransferase, and different databases have different identification numbers for the NNMT gene: HGNC:7861; Entrez Gene:4837; Ensembl:ENSG00000166741; OMIM:600008; UniProtKB:P40261.

[0393] According to the human genome version GCF_000001405.25 (GRCh37.p13), the NNMT gene region is located at positions 114,128,528 bp to 114,184,258 bp on human chromosome 11, with a total length of 55,731 bp of DNA sequence, including the NNMT gene promoter region, the NNMT gene exon region, and the NNMT gene intron region. The transcription start site of the NNMT gene is at position 114,166,535 bp.

[0394] The NNMT gene promoter region is a nucleotide sequence from position 114,164,535 bp to 114,167,034 bp on human chromosome 11, that is, the sequence between 2000 bp before the transcription start site of the NNMT gene (bold part) to the transcription start site itself and 499 bp after it (underlined part). The region with a total length of 2500 bp is the NNMT gene promoter region. The nucleotide sequence of the NNMT gene promoter region is shown as SEQ ID NO:1 below:

[0395] SEQ ID NO:1:

[0396]

[0397]

[0398] DNA methylation

[0399] DNA methylation is a form of DNA chemical modification that can change genetic expression without changing the DNA sequence.

[0400] Typically, DNA methylation is DNA CpG site methylation. In the present invention, CpG is the abbreviation of cytosine (C) - phosphate (p) - guanine (G).

[0401] In a preferred embodiment of the present invention, the DNA methyltransferase is selected from the group consisting of: DNMT1, DNMT3a, DNMT3b, or a combination thereof.

[0402] Tumor

[0403] In the present invention, the terms "tumor", "cancer", "carcinoma" and "neoplasm" are used interchangeably.

[0404] Specifically, the tumor described in the present invention is as described in the first aspect of the present invention above.

[0405] Antitumor drug

[0406] In the present invention, the antitumor drug described may be the compound of formula I described in the present invention, or its optical isomer, or its racemate, or its pharmaceutically acceptable salt.

[0407] Use

[0408] The compound described in the present invention has a significantly excellent and precise therapeutic effect on tumors with low expression, no expression, low activity or no activity of the mitochondrial membrane permeability transition pore, low expression, no expression, low activity or no activity of peptidylprolyl isomerase F, low expression or no expression of the NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, high methylation level of nucleotide sites of the NNMT gene, and / or high methylation level of DNA CpG sites in the NNMT gene region.

[0409] Composition

[0410] The composition or preparation described in the present invention is preferably a pharmaceutical composition or a pharmaceutical preparation, and the composition or preparation described in the present invention may include a pharmaceutically acceptable carrier.

[0411] As used herein, "pharmaceutically acceptable carrier" refers to one or more compatible solid, semi-solid, liquid or gel fillers, which are suitable for human or animal use and must have sufficient purity and sufficiently low toxicity. "Compatibility" means that the components in the composition or preparation and the active ingredient and between them can be admixed with each other without significantly reducing the drug effect.

[0412] In the present invention, the pharmaceutically acceptable carrier is not particularly limited, and commonly used materials in the art can be selected, or prepared by conventional methods, or obtained by purchasing from the market. Some examples of pharmaceutically acceptable carriers are cellulose and its derivatives, gelatin, talc, solid lubricants, pH regulators, transdermal promoters, stabilizers, antioxidants, preservatives, bacteriostatic agents, pyrogen-free water, etc.

[0413] In a preferred embodiment of the present invention, the dosage form of the composition or preparation is a solid preparation, a liquid preparation or a semi-solid preparation.

[0414] In a preferred embodiment of the present invention, the dosage form of the composition or preparation is an oral preparation, a topical preparation or an injection preparation.

[0415] Typically, the dosage form of the composition or preparation is a tablet, an injection, an infusion, an ointment, a gel, a solution, a microsphere or a film.

[0416] The pharmaceutical preparation should match the mode of administration. The pharmaceutical agent of the present invention can also be used together with other co-therapeutic agents (including before, during or after use). When using the pharmaceutical composition or preparation, a safe and effective amount of the drug is administered to the desired subject (such as a human or non-human mammal), and the safe and effective amount is usually at least about 10 micrograms per kilogram of body weight, and in most cases does not exceed about 8 milligrams per kilogram of body weight. Preferably, the dose is about 10 micrograms per kilogram of body weight to about 1 milligram per kilogram of body weight. Of course, the specific dose should also consider factors such as the route of administration and the health status of the patient, which are within the scope of the skills of a skilled physician.

[0417] The main excellent technical effects of the present invention include:

[0418] The present invention unexpectedly discovers for the first time a compound that has excellent precision treatment effects on tumors with low expression, no expression, low activity or no activity of the mitochondrial membrane permeability transition pore, low expression, no expression, low activity or no activity of peptidylprolyl isomerase F, low expression or no expression of the NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, high methylation level of nucleotide sites of the NNMT gene, and / or high methylation level of DNA CpG sites in the NNMT gene region, that is, tumors with low expression, no expression, low activity or no activity of the mitochondrial membrane permeability transition pore, low expression, no expression, low activity or no activity of peptidylprolyl isomerase F, low expression or no expression of the NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, high methylation level of nucleotide sites of the NNMT gene, and / or high methylation level of DNA CpG sites in the NNMT gene region are highly sensitive to the compound of the present invention. Therefore, the compound described in the present invention can be used for the precision treatment of tumors with low expression, no expression, low activity or no activity of the mitochondrial membrane permeability transition pore, low expression, no expression, low activity or no activity of peptidylprolyl isomerase F, low expression or no expression of the NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, high methylation level of nucleotide sites of the NNMT gene, and / or high methylation level of DNA CpG sites in the NNMT gene region, improve the treatment effect of the compound described in the present invention, and avoid administering the compound of the present invention to tumor patients who are insensitive to it. Therefore, the compound of the present invention has advantages such as more excellent prevention and treatment effects on tumors, low drug dosage, and small side effects for the precision treatment of tumors with low expression, no expression, low activity or no activity of the mitochondrial membrane permeability transition pore, low expression, no expression, low activity or no activity of peptidylprolyl isomerase F, low expression or no expression of the NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, high methylation level of nucleotide sites of the NNMT gene, and / or high methylation level of DNA CpG sites in the NNMT gene region. While improving the precision prevention and treatment effect of the compound of the present invention on tumors, it can reduce side effects and improve the compliance of patients.

[0419] The following further elaborates the present invention in conjunction with specific embodiments. It should be understood that the following specific embodiments are based on the present technical solution and give detailed implementation manners and specific operation processes, but the protection scope of the present invention is not limited to this embodiment.

[0420] Example

[0421] The English name of the mitochondrial membrane permeability transition pore is mitochondria permeability transition pore, abbreviated as mPTP.

[0422] The English name of peptidyl-prolyl cis-trans isomerase F is Peptidyl-prolyl cis-trans isomerase F, abbreviated as PPIF.

[0423] The English name of the NNMT gene is Nicotinamide N-Methyltransferase.

[0424] DNMT3a refers to DNA methyltransferase 3a, with the English name DNA methyltransferase 3a, NCBI entrez gene: 1788; Uniprotkb / Swiss-port: Q9Y6K1.

[0425] DNMT3b refers to DNA methyltransferase 3b, with the English name DNA methyltransferase 3b, NCBI entrez gene: 1789; Uniprotkb / Swiss-port: Q9UBC3.

[0426] DNMT1 refers to DNA methyltransferase 1, with the English name DNA methyltransferase 1, NCBI entrez gene: 1786; Uniprotkb / Swiss-port: P26358.

[0427] UHRF1 refers to ubiquitin-like PHD and ring finger domain-containing protein 1, with the English name, NCBI entrez gene: 29128; Uniprotkb / Swiss-port: Q96T88.

[0428] The nucleotide sequence from 1050 bp upstream of the transcription start site to 499 bp downstream of the transcription start site of the NNMT gene is positions 951 - 2500 of the nucleotide sequence shown in SEQ ID NO:1.

[0429] The nucleotide sequence from 1050 bp upstream of the transcription start site to 193 bp upstream of the transcription start site of the NNMT gene is positions 951 - 1808 of the nucleotide sequence shown in SEQ ID NO:1.

[0430] The nucleotide sequence from 840 bp upstream of the transcription start site to 469 bp upstream of the transcription start site of the NNMT gene is positions 1161 - 1532 of the nucleotide sequence shown in SEQ ID NO:1.

[0431] Example 1 Compound AB36462

[0432] The structure of Compound AB36462 is as follows:

[0433]

[0434] The synthetic route of compound AB36462 is as follows:

[0435]

[0436] Dissolve compound 1 (100 mg, 0.27 mmol, 1 eq) in dimethyl sulfoxide (2 mL) in a sealed tube, add compound 2 (56 mg, 0.27 mmol, 1 eq) and tris(dibenzylideneacetone)dipalladium (17 mg, 0.027 mmol, 0.1 eq). Under nitrogen protection, react at 120 °C for 16 h. After cooling, dilute the reaction solution with water and extract with dichloromethane. The organic phase is dried over anhydrous sodium sulfate, filtered and concentrated by rotary evaporation. The crude product is purified by reverse-phase preparation (acetonitrile / water + 0.01% formic acid) to obtain compound AB36462.

[0437] MS-ESI: Theoretical value [M] + : 506.20; Measured value [M] + : 506.20.

[0438] 1 H NMR (400 MHz, DMSO-d6) δ 8.42 (s, 1H), 8.23 - 8.20 (m, 1H), 8.02 (d, J = 4.0 Hz, 1H), 7.86 - 7.83 (m, 2H), 7.69 - 7.82 (m, 5H), 7.49 - 7.38 (m, 2H), 7.32 - 7.29 (m, 4H), 6.84 (d, J = 4.0 Hz, 1H), 6.67 (d, J = 4.0 Hz, 1H), 3.92 (d, J = 12.0 Hz, 12H).

[0439] Example 2 Compound AB36590

[0440] The structure of compound AB36590 is as follows:

[0441]

[0442] The synthetic route of compound AB36590 is as follows:

[0443]

[0444] Dissolve compound 1 (50 mg, 0.16 mmol, 1.0 eq) in tetrahydrofuran (5 mL), add methyl iodide (26 mg, 0.18 mmol, 1.1 eq), and react at 65 °C for 16 h. Concentrate the reaction solution, and purify the crude product by flash chromatography (dichloromethane / methanol = 20 / 1) to obtain compound AB36590 (55.1 mg, yield: 74.9%), which is a white solid.

[0445] MS-ESI: Theoretical value [M] + : 316.12; Measured value: 316.05.

[0446] 1 H NMR (400 MHz, DMSO-d6) δ 12.05 (s, 1H), 7.95 (d, J = 8.0 Hz, 1H), 7.89 - 7.86 (m, 2H), 7.80 - 7.73 (m, 8H), 7.61 - 7.59 (m, 1H), 7.42 - 7.37 (m, 1H), 7.21 - 7.16 (m, 1H), 6.00 (s, 1H), 3.15 (d, J = 14.0 Hz, 3H).

[0447] Example 3 Compound AB36591

[0448] The structure of Compound AB36591 is as follows:

[0449]

[0450] The synthetic route of Compound AB36591 is as follows:

[0451]

[0452] Dissolve Compound 1 (50 mg, 0.16 mmol, 1.0 eq) in tetrahydrofuran (5 mL), add iodoethane (28 mg, 0.18 mmol, 1.1 eq), and react at 65 °C for 16 h. Concentrate the reaction solution, and use flash chromatography (dichloromethane / methanol = 20 / 1) for the crude product to obtain AB36591 (41.3 mg, Yield: 54.5%), which is a white solid.

[0453] MS-ESI: Theoretical value [M] + : 330.20; Measured value: 330.14.

[0454] 1 H NMR (400 MHz, DMSO-d6) δ 12.04 (s, 1H), 7.96 (d, J = 8.0 Hz, 1H), 7.89 - 7.79 (m, 6H), 7.76 - 7.73 (m, 4H), 7.58 (s, 1H), 7.46 - 7.37 (m, 2H), 5.91 (s, 1H), 3.67 - 3.58 (m, 2H), 1.25 - 1.16 (m, 3H).

[0455] Example 4 Compound AB36564

[0456] The structure of Compound AB36564 is as follows:

[0457]

[0458] The synthetic route of compound AB36564 is as follows:

[0459]

[0460] Note: Boc is tert-butoxycarbonyl.

[0461] Dissolve compound 1 (300 mg, 1.14 mmol, 1.0 eq) and compound 2 (454 mg, 1.37 mmol, 1.2 eq) in tetrahydrofuran (5 mL), add tetrakis(triphenylphosphine)palladium (127 mg, 0.11 mmol, 0.1 eq), react at 65 °C for 16 h. Dilute the reaction solution with water and extract with dichloromethane. Dry the organic phase with anhydrous sodium sulfate and filter. Rotate the filtrate to dryness. Purify the crude product by normal-phase preparation (dichloromethane / methanol = 15 / 1) to obtain compound AB36564.

[0462] MS-ESI: Theoretical value [M] + : 444.21; Measured value: 444.05.

[0463] 1 1H NMR (400 MHz, DMSO-d6) δ 7.08 - 7.00 (m, 8H), 6.96 - 6.91 (m, 5H), 6.20 (s, 1H), 4.31 - 4.27 (m, 1H), 3.93 (s, 1H), 2.57 (s, 4H), 1.59 - 1.56 (m, 1H), 1.01 - 0.98 (m, 1H), 0.54 (s, 9H).

[0464] Example 5 Compound AB35414

[0465] Compound AB35414 was obtained by commercial purchase. The structure of compound AB35414 is as follows:

[0466]

[0467] Example 6 Compound AB36540

[0468] Compound AB36540 was obtained by commercial purchase. The structure of compound AB36540 is as follows:

[0469]

[0470] Example 7 Compound AB36541

[0471] Compound AB36541 was obtained by commercial purchase. The structure of compound AB36541 is as follows:

[0472]

[0473] Example 8 Compound AB36543

[0474] Compound AB36543 was obtained by commercial purchase. The structure of Compound AB36543 is as follows:

[0475]

[0476] Example 9 Compound AB36544

[0477] Compound AB36544 was obtained by commercial purchase. The structure of Compound AB36544 is as follows:

[0478]

[0479] Example 10 Compound AB36558

[0480] Compound AB36558 was obtained by commercial purchase. The structure of Compound AB36558 is as follows:

[0481]

[0482] Example 11 Compound AB3020-28-8

[0483] Compound AB3020-28-8 was obtained by commercial purchase. The structure of Compound AB3020-28-8 is as follows:

[0484]

[0485] Example 12 Compound AB2065-66-9

[0486] Compound AB2065-66-9 was obtained by commercial purchase. The structure of Compound AB2065-66-9 is as follows:

[0487]

[0488] Example 13 Compound AB1530-32-1

[0489] Compound AB1530-32-1 was obtained by commercial purchase. The structure of Compound AB1530-32-1 is as follows:

[0490]

[0491] Example 14 Compound AB6228-47-3

[0492] Compound AB6228-47-3 was obtained through commercial purchase. The structure of compound AB6228-47-3 is as follows:

[0493]

[0494] Example 15 Compound AB1560-54-9

[0495] Compound AB1560-54-9 was obtained through commercial purchase. The structure of compound AB1560-54-9 is as follows:

[0496]

[0497] Example 16 Compound AB3607-17-8

[0498] Compound AB3607-17-8 was obtained through commercial purchase. The structure of compound AB3607-17-8 is as follows:

[0499]

[0500] Example 17 Compound AB24470-78-8

[0501] Compound AB24470-78-8 was obtained through commercial purchase. The structure of compound AB24470-78-8 is as follows:

[0502]

[0503] Example 18 Compound AB13371-17-0

[0504] Compound AB13371-17-0 was obtained through commercial purchase. The structure of compound AB13371-17-0 is as follows:

[0505]

[0506] Example 19 Compound AB7333-63-3

[0507] Compound AB7333-63-3 was obtained through commercial purchase. The structure of compound AB7333-63-3 is as follows:

[0508]

[0509] Example 20 Compound AB22884-29-3

[0510] Compound AB22884-29-3 was obtained through commercial purchase. The structure of compound AB22884-29-3 is as follows:

[0511]

[0512] Example 21 Compound AB21406-61-1

[0513] Compound AB21406-61-1 was obtained by commercial purchase. The structure of Compound AB21406-61-1 is as follows:

[0514]

[0515] Example 22 Compound AB28322-40-9

[0516] Compound AB28322-40-9 was obtained by commercial purchase. The structure of Compound AB28322-40-9 is as follows:

[0517]

[0518] Example 23 Compound AB1530-34-3

[0519] Compound AB1530-34-3 was obtained by commercial purchase. The structure of Compound AB1530-34-3 is as follows:

[0520]

[0521] Example 24 Compound AB42036-78-2

[0522] Compound AB42036-78-2 was obtained by commercial purchase. The structure of Compound AB42036-78-2 is as follows:

[0523]

[0524] Example 25 Compound AB7333-52-0

[0525] Compound AB7333-52-0 was obtained by commercial purchase. The structure of Compound AB7333-52-0 is as follows:

[0526]

[0527] Example 26 Compound AB2751-90-8

[0528] Compound AB2751-90-8 was obtained by commercial purchase. The structure of Compound AB2751-90-8 is as follows:

[0529]

[0530] Example 27 Compound AB99662-46-1

[0531] Compound AB99662-46-1 was obtained through commercial purchase. The structure of compound AB99662-46-1 is as follows:

[0532]

[0533] Example 28 Compound AB1449-46-3

[0534] Compound AB1449-46-3 was obtained through commercial purchase. The structure of compound AB1449-46-3 is as follows:

[0535]

[0536] Example 29 Compound AB18583-55-6

[0537] Compound AB18583-55-6 was obtained through commercial purchase. The structure of compound AB18583-55-6 is as follows:

[0538]

[0539] Example 30 Compound AB2492-23-1

[0540] Compound AB2492-23-1 was obtained through commercial purchase. The structure of compound AB2492-23-1 is as follows:

[0541]

[0542] Example 31 Compound AB3462-95-1

[0543] Compound AB3462-95-1 was obtained through commercial purchase. The structure of compound AB3462-95-1 is as follows:

[0544]

[0545] Example 32 Compound AB63368-37-6

[0546] Compound AB63368-37-6 was obtained through commercial purchase. The structure of compound AB63368-37-6 is as follows:

[0547]

[0548] Example 33 Compound AB18880-05-2

[0549] Compound AB18880-05-2 was obtained through commercial purchase. The structure of compound AB18880-05-2 is as follows:

[0550]

[0551] Example 34 Compound AB70219-09-9

[0552] Compound AB70219-09-9 was obtained by commercial purchase. The structure of Compound AB70219-09-9 is as follows:

[0553]

[0554] Compound AB70219-09-9

[0555] Example 35 Compound AB50479-11-3

[0556] Compound AB50479-11-3 was obtained by commercial purchase. The structure of Compound AB50479-11-3 is as follows:

[0557]

[0558] Example 36 Compound AB13138-25-5

[0559] Compound AB13138-25-5 was obtained by commercial purchase. The structure of Compound AB13138-25-5 is as follows:

[0560]

[0561] Example 37 Compound AB82105-88-2

[0562] Compound AB82105-88-2 was obtained by commercial purchase. The structure of Compound AB82105-88-2 is as follows:

[0563]

[0564] Example 38

[0565] Investigate the activity of mitochondrial membrane permeability transition pore in related cells

[0566] Experimental background: The mitochondrial membrane permeability transition pore (mPTP) is a non-specific channel on the inner mitochondrial membrane that allows small molecules with a molecular weight less than 1.5 KD to pass freely. Its activity is affected by peroxides in mitochondria (such as H 2 O 2) Effects of ROS, pH, and calcium ions. The mitochondrial permeability transition pores (mPTP) are active in some cells and inactive in others. For cells with active mPTP, the addition of peroxide (such as H 2 O 2 ) increases the activity of mPTP, leading to a decrease in mitochondrial membrane potential; while for cells with inactive mPTP, the addition of peroxide (such as H 2 O 2 ) has no significant effect on the activity of mPTP, and the mitochondrial membrane potential shows no significant change. Based on this principle, the activity of mPTP in specific cells can be determined by measuring the change in the potential difference of the mitochondrial membrane under peroxide stimulation.

[0567] Experimental methods and results: Daoy cells (human medulloblastoma cells, ATCC No. HTB-186) were cultured in DMEM medium containing 10% fetal bovine serum (supplemented with P / S). 1.5 μM cyclosporin A (CsA, which can effectively inhibit the activity of mPTP) was added to the cell culture medium, and cells without the addition of cyclosporin A (CsA) were selected as the blank control. The mitochondrial membrane potential difference of Daoy cells after different treatments was detected by Tetramethylrhodamine (TMRM). A higher TMRM fluorescence intensity indicates a higher membrane potential difference. The results are shown in Table 1:

[0568] Table 1 Relative TMRM signal intensity (%) of Daoy cells after different treatments

[0569]

[0570] Note: "+" indicates presence, and "-" indicates absence.

[0571] As can be seen from Table 1, for normal Daoy cells without CsA in the culture medium, their membrane potential decreased significantly under the action of H 2 O 2 , indicating that mPTP is active in Daoy cells. For Daoy cells with CsA added to the culture medium to inhibit the activity of mPTP, the addition of H 2 O 2 resulted in little change in their membrane potential, indicating that the active mPTP was inhibited by CsA and became inactive. In this case, H 2 O 2 did not cause a decrease in their membrane potential.

[0572] Therefore, as can be seen from Table 1, the mitochondrial permeability transition pore in Daoy cells is active.

[0573] Example 39

[0574] Examine the inhibitory effect of the compounds of the examples of the present invention on the viability of Daoy cells with active mPTP and Daoy cells with inactive mPTP constructed by transfection with shRNA specifically inducing degradation of PPIF mRNA

[0575] Peptidyl-prolyl cis-trans isomerase F is abbreviated as PPIF, the protein number is UniProtKB / Swiss-Prot: P30405, and its gene number is NCBI Entrez Gene: 10105.

[0576] 1. Construction of Daoy cells with inactive mitochondrial permeability transition pore (mPTP)

[0577] 1.1 Experimental background: The activity of the mitochondrial permeability transition pore (mPTP) is regulated by the protein PPIF. When the PPIF protein is inhibited, the mPTP activity is significantly reduced. The activity of the PPIF protein is subject to the intracellular PPIF protein expression level. By transfecting Daoy cells with shRNA specifically inducing degradation of PPIF mRNA, the PPIF protein expression level in Daoy cells is specifically reduced, thereby constructing Daoy cells with inactive mitochondrial permeability transition pore (mPTP) (hereinafter referred to as mPTP-inactive Daoy cells).

[0578] 1.2 Experimental methods and results: Through cloning technology, a viral vector carrying shRNA specifically inducing degradation of PPIF mRNA was obtained. The shRNA sequence carried by this viral vector (the nucleotide sequence of shRNA is: GTTCTTCATCTGCACCATAAA (SEQ ID NO: 2)) specifically induces degradation of PPIF mRNA. Daoy cells were transfected with the viral vector carrying shRNA specifically inducing degradation of PPIF mRNA, and Daoy cells transfected with the empty viral vector without shRNA specifically inducing degradation of PPIF mRNA were used as a control. The protein expression level of PPIF in Daoy cells was detected by western blot technology, and the results are as Figure 1 shown. From Figure 1 the results, it can be seen that PPIF is basically not expressed in Daoy cells transfected with shRNA specifically inducing degradation of the mPTP regulatory protein PPIF mRNA (that is Figure 1PPIF shRNA), while PPIF was normally expressed in Daoy cells transfected with non-specific shRNA that induced the degradation of PPIF mRNA (i.e., Figure 1 ConshRNA in the middle, as a control).

[0579] According to the method in Example 38 above, Daoy cells transfected with an empty virus vector without shRNA that specifically induced the degradation of PPIF mRNA and Daoy cells transfected with a virus vector carrying shRNA that specifically induced the degradation of PPIF mRNA were respectively cultured in DMEM medium (added with P / S) containing 10% fetal bovine serum. 1.5 μM Cyclosporin A (abbreviated as CsA, and CsA can effectively inhibit the activity of mitochondrial membrane permeability transition pores) was added to the cell culture medium. At the same time, cells without added Cyclosporin A (abbreviated as CsA) were selected as the blank control. The levels of mitochondrial membrane potential difference in Daoy cells transfected with an empty virus vector without shRNA that specifically induced the degradation of PPIF mRNA and Daoy cells transfected with a virus vector carrying shRNA that specifically induced the degradation of PPIF mRNA after different treatments were detected by Tetramethylrhodamine (TMRM). A high TMRM fluorescence intensity indicates a high membrane potential difference. The results are shown in Tables 2 and 3:

[0580] Table 2 Relative TMRM signal intensity (%) of Daoy cells transfected with an empty virus vector without shRNA that specifically induced the degradation of PPIF mRNA after different treatments

[0581]

[0582] Table 3 Relative TMRM signal intensity (%) of Daoy cells transfected with a virus vector carrying shRNA that specifically induced the degradation of PPIF mRNA after different treatments

[0583]

[0584] As can be seen from Tables 2 and 3, the mitochondrial membrane permeability transition pore (mPTP) in Daoy cells transfected with an empty virus vector without shRNA that specifically induced the degradation of PPIF mRNA was active. However, the membrane potential of Daoy cells transfected with a virus vector carrying shRNA that specifically induced the degradation of PPIF mRNA was not affected by Cyclosporin A (C S A) and H 2 O 2The results showed that the mitochondrial permeability transition pore (mPTP) in Daoy cells transfected with a viral vector carrying shRNA specifically inducing the degradation of PPIF mRNA was inactive. Therefore, Daoy cells with inactive mPTP were successfully constructed by transfecting Daoy cells with shRNA specifically inducing the degradation of the mPTP regulatory protein PPIF mRNA.

[0585] The Promega CellTiter-Glo kit (which reflects cell viability by detecting the intracellular ATP content) was used to detect the viability of the above-mentioned Daoy cells with inactive mPTP constructed by transfecting with shRNA specifically inducing the degradation of PPIF mRNA and the Daoy cells with active mPTP without transfection of shRNA specifically inducing the degradation of PPIF mRNA. The results are as Figure 2 shown. As can be seen from Figure 2 , the cell viability of the Daoy cells with inactive mPTP constructed by transfecting with shRNA specifically inducing the degradation of PPIF mRNA was almost the same as that of the Daoy cells with active mPTP without transfection of shRNA specifically inducing the degradation of PPIF mRNA, and the difference in cell viability was not statistically significant.

[0586] 2. Investigate the correlation between the effect of inhibiting tumor cells by the compounds in the examples of the present invention and the activity degree of mPTP

[0587] 2.1 Experimental background: The Promega CellTiter-Glo kit, which reflects cell viability by directly detecting the intracellular ATP content, was used to detect the IC 50 value of the inhibition of cell viability of the compounds in the examples of the present invention on Daoy cells with active mPTP without transfection of shRNA specifically inducing the degradation of PPIF mRNA and Daoy cells with inactive mPTP constructed by transfecting with shRNA specifically inducing the degradation of PPIF mRNA.

[0588] 2.2 Experimental methods and results: The above-mentioned Daoy cells with active mPTP without transfection of shRNA specifically inducing the degradation of PPIF mRNA and Daoy cells with inactive mPTP constructed by transfecting with shRNA specifically inducing the degradation of PPIF mRNA were cultured in DMEM medium (added with P / S) containing 10% fetal bovine serum, and the half-inhibitory dose IC 50 of the compounds in the examples of the present invention on these two types of cells was measured. The experimental results are shown in Table 4:

[0589] Table 4 Inhibitory effects of different compounds in the examples of the present invention on Daoy cells with active mPTP and Daoy cells with inactive mPTP (IC50 , μM)

[0590]

[0591]

[0592] Note: IC 50 is the half-maximal inhibitory concentration, that is, the concentration of the inhibitor compound required to achieve 50% inhibitory effect. The Daoy cells with active mPTP are the Daoy cells transfected with the empty virus vector without the shRNA specifically inducing the degradation of PPIF mRNA; the Daoy cells with inactive mPTP are the Daoy cells transfected with the virus vector carrying the shRNA specifically inducing the degradation of PPIF mRNA.

[0593] It can be seen from Table 4 that the compounds of the embodiments of the present invention have a more significant inhibitory effect on the Daoy cells with inactive mitochondrial permeability transition pore (mPTP), while have a poor inhibitory effect on the Daoy cells with active mPTP, indicating that reducing the mPTP activity of Daoy cells can significantly improve the inhibitory effect of the compounds of the embodiments of the present invention. Therefore, the compounds of the embodiments of the present invention have a more significant inhibitory effect on the Daoy cells with inactive mPTP, and the Daoy cells with inactive mPTP are more sensitive to the compounds of the embodiments of the present invention. Therefore, the compounds of the embodiments of the present invention have excellent precision treatment effects on the Daoy cells with inactive mPTP. As described above, when the PPIF protein is inhibited, the mPTP activity is significantly reduced. Inhibiting the expression level of the PPIF protein can reduce the mPTP activity of Daoy cells. Therefore, the compounds of the embodiments of the present invention have a more significant inhibitory effect on the Daoy cells with low expression of the PPIF protein, while have a poor inhibitory effect on the Daoy cells with normal expression of the PPIF protein, thus indicating that reducing the expression level of the PPIF protein can significantly improve the inhibitory effect of the compounds of the embodiments of the present invention. Therefore, the compounds of the embodiments of the present invention have a more significant inhibitory effect on the Daoy cells with low expression of the PPIF protein, that is, the Daoy cells with low expression of the PPIF protein are more sensitive to the compounds of the embodiments of the present invention, and the compounds of the embodiments of the present invention have excellent precision treatment effects on the Daoy cells with low expression of the PPIF protein.

[0594] Example 40

[0595] This example examines the sensitivity of the compounds of the embodiments of the present invention to the expression level of NNMT (Nicotinamide N-Methyltransferase) in NCI-H82 cells (human small cell lung cancer cells).

[0596] Experimental methods and results: The NNMT gene was introduced into NCI-H82 cells through a viral vector to overexpress the NNMT protein in NCI-H82 cells, resulting in NCI-H82 cells with high expression of the NNMT protein (ov-NNMT NCI-H82 cells), and NCI-H82 cells transfected with an empty viral vector without the NNMT gene (Con-NCI-H82 cells) were used as a control. The expression levels of the NNMT protein in Con-NCI-H82 cells and ov-NNMT NCI-H82 cells were detected by Western Blot assay, and the results are as Figure 3 shown. As can be seen from Figure 3 , compared with Con-NCI-H82 cells, the NNMT protein was highly expressed in ov-NNMT NCI-H82 cells.

[0597] The Promega CellTiter-Glo kit (which detects cell viability by measuring the intracellular ATP content) was used to detect the cell viability of Con-NCI-H82 cells and ov-NNMT NCI-H82 cells, and the results are as Figure 4 shown. As can be seen from Figure 4 , the cell viabilities of Con-NCI-H82 cells and ov-NNMT NCI-H82 cells were almost the same, and the difference in cell viability was not statistically significant.

[0598] The Promega CellTiter-Glo kit was used to determine the inhibitory effects (IC 50 ) of different compounds in the examples of the present invention on Con-NCI-H82 cells and ov-NNMT NCI-H82 cells by directly measuring the intracellular ATP content, and the results are shown in Table 5:

[0599] Table 5 Inhibitory effects (IC 50 , μM) of different compounds in the examples of the present invention on Con-NCI-H82 cells and ov-NNMT NCI-H82 cells

[0600]

[0601]

[0602]

[0603] Note: IC 50is the half-inhibitory concentration, i.e., the concentration of the compound required to achieve a 50% inhibitory effect; Con-NCI-H82 cells are NCI-H82 cells transfected with an empty virus vector without the NNMT gene and serve as a control; ov-NNMT NCI-H82 cells are NCI-H82 cells transfected with a virus vector carrying the NNMT gene, and in ov-NNMT NCI-H82 cells, the NNMT protein is highly expressed.

[0604] As can be seen from Table 5, in this example, by overexpressing the NNMT protein in NCI-H82 cells, it is further confirmed that the compounds of the embodiments of the present invention have a more significant inhibitory effect on tumor cells with low or no expression of the NNMT gene. Tumor cells with low or no expression of the NNMT gene are highly sensitive to the compounds of the embodiments of the present invention, and there is a significant negative correlation between the NNMT expression level of tumor cells and the sensitivity to the compounds of the embodiments of the present invention. Therefore, the compounds of the embodiments of the present invention have excellent precision treatment effects on tumor cells with low or no expression of the NNMT gene.

[0605] Example 41

[0606] Use a cell viability detection reagent to detect the inhibitory effect of the compounds of the embodiments of the present invention on different tumor cell lines.

[0607] Experimental background: Cell viability was detected using the Promega CellTiter-Glo kit, which detects cell viability by directly measuring the intracellular ATP content. In this experiment, the IC 50 values of the inhibitory effect of each compound of the embodiments of the present invention on the cell viability of different tumor cell lines were detected.

[0608] Experimental methods and results: Each tumor cell was cultured in a relevant medium. After cell passage, different compounds of the present invention at gradient dilutions were added respectively, and the half-inhibitory concentration IC 50 was measured after 3 days of culture. The names, sources, and culture conditions of each tumor cell line are as follows:

[0609] The NCI-H82 cells transfected with an empty virus vector without the NNMT gene in Example 40 were cultured in RPMI1640 medium + P / S containing 10% fetal bovine serum;

[0610] The cell line G-401 (ATCC, No. CRL-1441) was cultured in McCoy's 5a medium + P / S containing 10% fetal bovine serum;

[0611] The cell line MDA-MB-453 (ATCC, No. HTB-131) was cultured in Leibovitz's L-15 medium + P / S containing 10% fetal bovine serum;

[0612] The cell line SW48 (ATCC, No. CCL-231) was cultured in Leibovitz's L-15 medium + P / S containing 10% fetal bovine serum;

[0613] The cell line CFPAC-1 (ATCC, No. CRL-1918) was cultured in IMDM medium + P / S containing 10% fetal bovine serum;

[0614] The cell line 786-O (ATCC, No. CRL-1932) was cultured in RPMI1640 medium + P / S containing 10% fetal bovine serum;

[0615] The cell line GB-1 (JCRB, No. IFO50489) was cultured in DMEM medium + P / S containing 10% fetal bovine serum;

[0616] The cell line SF-126 (JCRB, No. IFO50286) was cultured in EMEM medium + P / S containing 10% fetal bovine serum. The experimental results are shown in Table 6:

[0617] Table 6 Inhibitory effects of different compounds in the examples of the present invention on different cell lines (IC 50 , μM)

[0618]

[0619]

[0620]

[0621] Note: IC 50 is the half-inhibitory concentration (50% inhibiting concentration), that is, the compound concentration required to achieve 50% inhibitory effect; NCI-H82 is the NCI-H82 cell transfected with the empty virus vector without the NNMT gene in Example 40.

[0622] As can be seen from Table 6, NCI-H82 (human small cell lung cancer cells), G-401 (human renal carcinoma Wilms cells), MDA-MB-453 (breast cancer cells), SW48 (human colon adenocarcinoma cells) are sensitive to the compounds in the examples of the present invention (IC 50low values). However, 786-O (renal clear cell adenocarcinoma cell line), CFPAC-1 (human pancreatic cancer cell), GB-1 (human glioblastoma cell) and SF-126 (human glioblastoma multiforme cell) are insensitive to the compounds of the embodiments of the present invention (IC 50 values are high).

[0623] Example 42

[0624] The mRNA transcription levels of the NNMT gene in different tumor cells were detected by RT-qPCR gene expression analysis for 4 tumor cell lines sensitive and 4 tumor cell lines insensitive to the compounds of the embodiments of the present invention, and the NNMT gene expression in these tumor cell lines was measured respectively. The results are as Figure 5 shown.

[0625] It can be seen from Figure 5 that the mRNA transcription levels of the NNMT gene were detected by RT-qPCR gene expression analysis for 4 tumor cells (NCI-H82, G-401, MDA-MB-453, SW48) sensitive and 4 tumor cells (786-O, CFPAC-1, GB-1 and SF-126) insensitive to the compounds of the embodiments of the present invention, and it was found that the NNMT gene was lowly expressed in the sensitive cell lines (NCI-H82, G-401, MDA-MB-453 and SW48) and highly expressed in the insensitive cell lines (786-O, CFPAC-1, GB-1 and SF-126).

[0626] Therefore, it can be concluded from Figure 5 that compared with the tumor cell lines with high expression of the NNMT gene, the inhibitory effect of the compounds of the embodiments of the present invention on the tumor cell lines with low expression or non-expression of the NNMT gene is significantly enhanced. That is, the expression of the NNMT gene in tumor cells is negatively correlated with their sensitivity to the compounds of the embodiments of the present invention. Therefore, tumors with low expression or non-expression of the NNMT gene are highly sensitive to the compounds of the embodiments of the present invention, and the compounds of the embodiments of the present invention have excellent precision treatment effects on tumors with low expression or non-expression of the NNMT gene.

[0627] Example 43

[0628] Bisulfite sequencing was performed on the promoter region of the NNMT gene, the region between 1050 bp upstream and 499 bp downstream of the transcription start site of the NNMT gene, and the region between 1050 bp upstream and 193 bp upstream of the transcription start site of the NNMT gene in 4 tumor cell lines (NCI-H82, G-401, MDA-MB-453, and SW48) sensitive to the compounds of the embodiments of the present invention and 4 tumor cell lines (786-O, CFPAC-1, GB-1, and SF-126) insensitive to detect the methylation level of DNA CpG sites in the relevant regions. First, genomic DNA was treated with bisulfite to deaminate unmethylated cytosine into uracil, while methylated cytosine did not undergo deamination. Therefore, based on this, the bisulfite-treated and untreated sequencing samples could be compared to discover the methylated sites. The results are as Figure 6 , Figure 7 and Figure 8 shown.

[0629] As Figure 6 (NNMT gene promoter region), Figure 7 (region between 1050 bp upstream and 499 bp downstream of the transcription start site of the NNMT gene) and Figure 8(The region between 1050 bp upstream and 193 bp upstream of the transcriptional start site of the NNMT gene) As shown, the compounds of the embodiments of the present invention have significantly stronger inhibitory effects on tumor cell lines with high DNA CpG site methylation levels in the promoter region of the NNMT gene, the region between 1050 bp upstream and 499 bp downstream of the transcriptional start site of the NNMT gene, and the region between 1050 bp upstream and 193 bp upstream of the transcriptional start site of the NNMT gene. The inhibitory effects on tumor cell lines with low DNA CpG site methylation levels in the promoter region of the NNMT gene, the region between 1050 bp upstream and 499 bp downstream of the transcriptional start site of the NNMT gene, and the region between 1050 bp upstream and 193 bp upstream of the transcriptional start site of the NNMT gene are significantly weaker. This indicates that the DNA CpG site methylation levels in the promoter region of the NNMT gene, the region between 1050 bp upstream and 499 bp downstream of the transcriptional start site of the NNMT gene, and the region between 1050 bp upstream and 193 bp upstream of the transcriptional start site of the NNMT gene in tumor cells are positively correlated with their sensitivity to the compounds of the embodiments of the present invention. Therefore, tumor cells with high DNA CpG site methylation levels in the promoter region of the NNMT gene, the region between 1050 bp upstream and 499 bp downstream of the transcriptional start site of the NNMT gene, and the region between 1050 bp upstream and 193 bp upstream of the transcriptional start site of the NNMT gene are highly sensitive to the compounds of the embodiments of the present invention, and the compounds of the embodiments of the present invention have excellent precision treatment effects on tumors with high DNA CpG site methylation levels in the promoter region of the NNMT gene, the region between 1050 bp upstream and 499 bp downstream of the transcriptional start site of the NNMT gene, and the region between 1050 bp upstream and 193 bp upstream of the transcriptional start site of the NNMT gene.

[0630] Example 44

[0631] The methylation status of specific DNA CpG sites in the region from 840 bp upstream (i.e., position 114165695 on human chromosome 11) to 469 bp upstream (i.e., position 114166066 on human chromosome 11) of the transcriptional start site of the NNMT gene in 3 tumor cell lines (NCI-H82, G-401, and SW48) sensitive to the compounds of the embodiments of the present invention and 3 tumor cell lines (786-O, CFPAC-1, and SF-126) insensitive to the compounds of the embodiments of the present invention was studied.

[0632] First, the genomic DNA of cells was treated with bisulfite. The cytosine that was not methylated was deaminated to uracil, while the methylated cytosine was not deaminated. Therefore, based on this, the bisulfite-treated and untreated sequencing samples can be compared to discover the methylated sites. Subsequently, the corresponding primers were used to perform PCR amplification and sequencing analysis on this region to detect the methylation level of CpG sites within this DNA region.

[0633] Analysis found that almost all of the 7 CpG sites (positions 114165695, 114165730, 114165769, 114165804, 114165938, 114166050, 114166066 on human chromosome 11) within this region were methylated in the NCI-H82, G-401, and SW48 cell lines sensitive to the compounds of the examples of the present invention, while none of these 7 CpG sites in this region were methylated in the 786-O, CFPAC-1, and SF-126 cell lines insensitive to the compounds of the examples of the present invention. The methylation status of the relevant sites is as Figure 9 shown.

[0634] Among them, the sites at positions 114165695, 114165730, 114165769, 114165804, 114165938, 114166050, and 114166066 on human chromosome 11 correspond to the sites of the nucleotide sequence of SEQ ID NO:1 as shown below:

[0635]

[0636] Example 45

[0637] The methylation level of cellular DNA is maintained by DNA methyltransferases DNMT3a (DNA methyltransferase 3a), DNMT3b (DNA methyltransferase 3b), and DNMT1 (DNA methyltransferase 1). DNMT3a and DNMT3b can de novo methylate DNA, while DNMT1 can, with the help of the protein UHRF1 (ubiquitin-like PHD and ring finger domain-containing protein 1), maintain the replication of methylated DNA. The examples of the present invention detected the correlation between the expression of NNMT and the expression of DNMT1, UHRF1, DNMT3a, and DNMT3b in tumors.

[0638] Experimental methods and results: Expression data of the NNMT gene, DNMT1, UHRF1, DNMT3a, and DNMT3b in various cells were obtained from a public database (Cancer Cell Line Encyclopedia, CCLE, a total of 1019 cell lines), and then bioinformatics methods were used to analyze the correlation between NNMT expression and the expression of DNMT1, UHRF1, DNMT3a, and DNMT3b in these cells, and to analyze the correlation between the expression levels of the NNMT gene and DNMT1, UHRF1, DNMT3a, and DNMT3b in each cell. The experimental results are as Figure 10 shown.

[0639] As can be seen Figure 10 from this, the expression of NNMT in each cell was negatively correlated with the expression of DNA methyltransferases (DNMT3a, DNMT3b, and DNMT1) and UHRF1. Therefore, tumor cells with high expression of DNA methyltransferases (DNMT3a, DNMT3b, and DNMT1) and UHRF1 are highly sensitive to the compounds of the embodiments of the present invention, and the compounds of the embodiments of the present invention have excellent precision treatment effects on tumors with high expression of DNA methyltransferases (DNMT3a, DNMT3b, and DNMT1) and UHRF1.

[0640] The above is an implementation scheme designed by the present invention for a case. It should be noted that for those of ordinary skill in the art, several improvements can be made without departing from the principle of the present invention, and these improvements should also be regarded as the protection scope of the present invention.

Claims

1. Use of a compound of formula I, or an optical isomer thereof, or a racemate thereof, or a pharmaceutically acceptable salt thereof, for preparing a composition or preparation for preventing and / or treating tumors; Wherein, R 1 、R 2 、R 3 and R 4 are each independently a substituted or unsubstituted C1-C16 alkyl group, a substituted or unsubstituted C1-C16 haloalkyl group, a substituted or unsubstituted C2-C8 alkenyl-substituted or unsubstituted C1-C10 alkyl group, a substituted or unsubstituted C3-C16 cycloalkyl group, a substituted or unsubstituted 3-16 membered heteroalkyl group, a substituted or unsubstituted C6-C16 aryl group, a substituted or unsubstituted 3-16 membered heteroaryl group, a substituted or unsubstituted C6-C16 aryl-substituted or unsubstituted C1-C8 alkyl group, a substituted or unsubstituted 3-16 membered heteroaryl-substituted or unsubstituted C1-C8 alkyl group, a substituted or unsubstituted C2-C10 ester-substituted or unsubstituted 3-12 membered heteroalkyl group, or a substituted or unsubstituted C2-C10 ester-substituted or unsubstituted C1-C10 alkyl group.

2. The use according to claim 1, characterized in that the compound of formula I, or an optical isomer thereof, or a racemate thereof, or a pharmaceutically acceptable salt thereof is:

3. The use according to claim 1, characterized in that the tumors are selected from the group consisting of: lung cancer, kidney cancer, breast cancer, intestinal cancer, lymphoma, leukemia, pancreatic cancer, brain tumor, liver cancer, prostate cancer, or a combination thereof.

4. The use according to claim 1, characterized in that the tumors include tumors with low expression, no expression, low activity or no activity of mitochondrial membrane permeability transition pore; the tumors include tumors with low expression, no expression, low activity or no activity of peptidylprolyl isomerase F; the tumors include tumors with low expression or no expression of NNMT gene; the tumors include tumors with high expression of DNA methyltransferase; the tumors include tumors with high expression of UHRF1; the tumors include tumors with high methylation level of nucleotide sites of NNMT gene; and / or the tumors include tumors with high methylation level of DNA CpG sites in the NNMT gene region.

5. The use according to claim 4, characterized in that the DNA methyltransferases are selected from the group consisting of: DNMT1, DNMT3a, DNMT3b, or a combination thereof.

6. A biomarker for determining whether a tumor patient is suitable for preventing and / or treating tumors with the compound of formula I, or an optical isomer thereof, or a racemate thereof, or a pharmaceutically acceptable salt thereof according to claim 1, the biomarker including mitochondrial membrane permeability transition pore, peptidylprolyl isomerase F, NNMT gene, DNA methyltransferase, UHRF1, methylation of nucleotide sites of NNMT gene, and / or methylation of DNA CpG sites in the NNMT gene region.

7. Use of a detection kit, characterized in that for preparing an accompanying diagnostic kit for determining whether a tumor patient is suitable for preventing and / or treating with the compound of formula I, or an optical isomer thereof, or a racemate thereof, or a pharmaceutically acceptable salt thereof according to claim 1; the detection kit includes: (i) Detection reagents for detecting the expression level or activity of mitochondrial membrane permeability transition pore, the expression level or activity of peptidylprolyl isomerase F, the expression level of NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of nucleotide sites of NNMT gene, and / or the methylation level of DNA CpG sites in the NNMT gene region; The accompanying diagnostic kit further includes an instruction manual or label, and the instruction manual or label records: When the mitochondrial permeability transition pore in the tumor cells of a tumor patient has low expression, no expression, low activity or no activity, peptidyl-prolyl isomerase F has low expression, no expression, low activity or no activity, the NNMT gene has low expression or no expression, DNA methyltransferase has high expression, UHRF1 has high expression, the methylation level of nucleotide sites of the NNMT gene is high, and / or the methylation level of DNA CpG sites in the NNMT gene region is high, then the tumor patient is suitable for prevention and / or treatment with the compound of formula I as described in claim 1, or its optical isomer, or its racemate, or its pharmaceutically acceptable salt.

8. Use of an inhibitor of mitochondrial permeability transition pore, an inhibitor of peptidyl-prolyl isomerase F, an inhibitor of NNMT gene, a promoter of DNA methyltransferase, a promoter of UHRF1, a promoter of methylation of nucleotide sites of NNMT gene, and / or a promoter of methylation of DNA CpG sites in the NNMT gene region, characterized in that, for preparing a composition or a preparation, and the composition or the preparation is used for enhancing the anti-tumor effect of an anti-tumor drug; the anti-tumor drug is the compound of formula I as described in claim 1, or its optical isomer, or its racemate, or its pharmaceutically acceptable salt.

9. A compound of formula I, or its optical isomer, or its racemate, or its pharmaceutically acceptable salt; wherein, R 1 、R 2 、R 3 and R 4 each independently represents phenyl, phenyl substituted with methoxy, indolyl, indolyl substituted with methyl, pyrrolopyridyl, pyrrolopyridyl substituted with methyl, pentyl ester - tetrahydropyridyl -, methyl, ethyl, propyl, butyl, pentyl, hexyl.

10. The compound of formula I as described in claim 1, or its optical isomer, or its racemate, or its pharmaceutically acceptable salt, characterized in that, the compound of formula I, or its optical isomer, or its racemate, or its pharmaceutically acceptable salt is:

Images