Bacterial microenvironment-responsive immunomodulatory antimicrobial peptides and their preparation method and application

Abstract

The present invention provides a kind of bacterial microenvironment responsive immunomodulatory antimicrobial peptide and its preparation method and application, belong to the field of bioengineering, its sequence is shown in SEQ ID No.1, its N-terminus is connected to the carboxyl group of indole 3-propionic acid, and the phenylalanine in the sequence is D-phenylalanine. Also disclosed is the application of the antimicrobial peptide of the present invention in the preparation of a drug for treating infectious diseases caused by Escherichia coli. The antimicrobial peptide of the present invention does not have direct bactericidal activity under physiological conditions, has a good antibacterial effect (16 μM) on Escherichia coli under acidic conditions, and has a macrophage immune response, promotes the phagocytic ability of macrophages to bacterial clusters. Therefore, the antimicrobial peptide of the present invention has selective bactericidal function, can coordinate the innate immune system, can effectively reduce bacterial selective pressure, and solves the problem of drug resistance.

Description

Technical Field

[0001] The present invention belongs to the field of bioengineering technology, and in particular relates to a bacterial microenvironment-responsive immunomodulatory antimicrobial peptide and a preparation method and application thereof. Background Art

[0002] Antimicrobial peptides (AMPs), as the primary component of the host's own defense system, are widely distributed in animals, plants, and microorganisms, and are considered to be one of the most promising alternatives to antibiotics. Although antimicrobial peptides exhibit excellent antibacterial properties, their application faces many challenges. Their powerful broad-spectrum antimicrobial activity often causes accidental damage to symbiotic bacteria in the host, and these symbiotic bacteria usually play a key role in enhancing the host's nutritional metabolism and immune response. In addition, although it is relatively difficult for pathogenic microorganisms to develop resistance to antimicrobial peptides, the resistance problem of antimicrobial peptides themselves cannot be ignored. Activating the innate immune system to synergistically resist bacterial infections can effectively solve the potential risk of bacterial resistance in traditional antimicrobial peptides.

[0003] During inflammatory reactions and certain disease processes, the microenvironment at the lesion site is often accompanied by a decrease in pH. For example, in cases of bacterial abscesses and fungal vaginitis, this acidic environment may affect the activity and stability of traditional antimicrobial peptides and produce drug resistance. Summary of the Invention

[0004] Based on the problems of the above background technology, the purpose of the present invention is to provide a bacterial microenvironment-responsive immunomodulatory antimicrobial peptide that can self-assemble into nanoparticles in ultrapure water and has a good killing effect on Escherichia coli in an acidic environment of pH 5.5, but has no antimicrobial activity under physiological conditions of pH 7.4. Therefore, the antimicrobial peptide of the present invention has selective bactericidal function, coordinates the innate immune system, can effectively reduce bacterial selective pressure, and solves the problem of drug resistance.

[0005] The technical solution adopted by the present invention is as follows: a bacterial microenvironment-responsive immunomodulatory antimicrobial peptide IPA-H D F-Rv2626c 123-131 Its amino acid sequence is shown in SEQ ID No. 1, its N-terminus is connected to the carboxyl group of indole-3-propionic acid, and the phenylalanine in the sequence is D-phenylalanine.

[0006] Another object of the present invention is to provide a bacterial microenvironment-responsive immunomodulatory antimicrobial peptide IPA-H D F-Rv2626c 123-131 The preparation method is as follows:

[0007] Step S1: Indole-3-propionic acid (IPA) was selected as a hydrophobic scaffold to provide hydrophobic interaction; histidine, with an imidazole group pKa of 6.0, was used as an acidic response element because its side chain was protonated under weakly acidic conditions and carried a positive charge; and the unnatural amino acid D-phenylalanine was selected to provide hydrophobic interaction while preventing protease hydrolysis.

[0008] Step S2: connecting with the active region LPEHAIVQF at positions 123-131 of the natural peptide Rv2626c of Mycobacterium tuberculosis to construct a polypeptide with an amino acid sequence as shown in SEQ ID No. 1;

[0009] Step S3: The peptide was prepared by solid-phase chemical synthesis and mass spectrometry identification. The peptide's nanomorphology, in vitro cytotoxicity, protease stability, bactericidal activity, and effect on macrophage phagocytosis were then measured. The peptide was named antimicrobial peptide IPA-H. D F-Rv2626c 123-131 .

[0010] Furthermore, the above-mentioned bacterial microenvironment-responsive immunomodulatory antimicrobial peptide IPA-H D F-Rv2626c 123-131 The self-assembly method is as follows: the concentration is 64 μM and incubated at 37°C for 24 hours to self-assemble into nanostructures.

[0011] Another object of the present invention is to provide the above-mentioned bacterial microenvironment-responsive immunomodulatory antimicrobial peptide IPA-H D F-Rv2626c 123-131 Application in the preparation of medicines for treating infectious diseases caused by Escherichia coli.

[0012] Furthermore, the antimicrobial peptide has a killing effect on Escherichia coli at a concentration of 16 μM and a pH of 5.5.

[0013] Beneficial effects and advantages of the present invention: The antimicrobial peptide IPA-H of the present invention D F-Rv2626c 123-131 It forms larger nanoparticles in a physiological environment and transforms into smaller nanoparticles in an acidic environment, which is more conducive to destroying bacterial cell membranes. It does not have direct bactericidal activity under physiological conditions, but has a good antibacterial effect (16μM) on Escherichia coli under acidic conditions. It also has the function of regulating the immune response of macrophages and promoting the phagocytic ability of macrophages to bacterial clusters. Therefore, the antimicrobial peptide of the present invention has a selective bactericidal function, can coordinate the innate immune system to fight bacteria, can effectively reduce the selective pressure of bacteria, and at the same time reduce the development of drug resistance. In summary, IPA-H D F-Rv2626c 123-131It is a self-assembling antimicrobial peptide with high application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 Antimicrobial peptide IPA-H D F-Rv2626c 123-131 Mass spectrum of

[0015] Figure 2 Antimicrobial peptide IPA-H D F-Rv2626c 123-131 chromatogram;

[0016] Figure 3 Antimicrobial peptide IPA-H D F-Rv2626c 123-131 Scanning electron microscope nanometer characterization images; (a) pH = 5.5 environment, (b) pH = 7.4 environment;

[0017] Figure 4 Antimicrobial peptide IPA-H D F-Rv2626c 123-131 Determination of cytotoxicity;

[0018] Figure 5 Antimicrobial peptide IPA-H D F-Rv2626c 123-131 Determination of protease stability;

[0019] Figure 6 Antimicrobial peptide IPA-H D F-Rv2626c 123-131 Killing activity against Escherichia coli ATCC 25922;

[0020] Figure 7 IPA-H for SEM observation D F-Rv2626c 123-131 Effects on the morphology of E. coli ATCC 25922, (a) pH = 7.4 environmental control group, (b) pH = 7.4 environmental peptide treatment group, (c) pH = 5.5 environmental control group, (d) pH = 5.5 environmental peptide treatment group;

[0021] Figure 8 Antimicrobial peptide IPA-H D F-Rv2626c 123-131 Promotes macrophage phagocytosis of E.coli ATCC 25922;

[0022] Figure 9 Antimicrobial peptide IPA-H D F-Rv2626c 123-131Promotes macrophage expression of chemokines; (a) CXCL1 expression level, (b) CXCL2 expression level, (c) IL-10 expression level. DETAILED DESCRIPTION

[0023] The present invention will be described in further detail below with reference to the embodiments and drawings, but the embodiments of the present invention are not limited thereto.

[0024] Example 1

[0025] Antimicrobial peptide IPA-H D F-Rv2626c 123-131 The design of the peptide was as follows: indole-3-propionic acid was selected as the hydrophobic core to promote the self-assembly of the peptide molecules; histidine was used as the acidic response element to control the bactericidal activity of the peptide; the non-natural amino acid D-phenylalanine was selected to provide hydrophobic interaction while avoiding hydrolysis by proteases; and it was then connected with the active region LPEHAIVQF at positions 123-131 of the natural peptide Rv2626c of Mycobacterium tuberculosis to construct a peptide. The amino acid sequence of the peptide is shown in Table 1.

[0026] Table 1 Bacterial microenvironment-responsive immunomodulatory antimicrobial peptide IPA-H D F-Rv2626c 123-131 The amino acid sequence

[0027]

[0028] Example 2

[0029] Synthesis of bacterial microenvironment-responsive immunomodulatory antimicrobial peptide IPA-H by solid-phase chemical synthesis D F-Rv2626c 123-131

[0030] 1. The preparation of antimicrobial peptides is carried out one by one from the C-terminus to the N-terminus using a peptide synthesizer. First, Fmoc-X (X is the first amino acid at the C-terminus of each antimicrobial peptide) is connected to Wang resin, and the Fmoc group is removed to obtain X-Wang resin; then Fmoc-Y-Trt-OH (9-fluorenylmethoxycarboxyl-trimethyl-Y, Y is the second amino acid at the C-terminus of each antimicrobial peptide); the above synthesis is carried out from the C-terminus to the N-terminus until the synthesis is completed, obtaining a resin with the side chain protection of the Fmoc group removed;

[0031] 2. Add a cleavage reagent to the peptide resin obtained above, react at 20°C in the dark for 2 hours, and filter; wash with TFA (trifluoroacetic acid) to precipitate, mix the washing solution with the above filtrate, concentrate on a rotary evaporator, add about 10 times the volume of pre-cooled anhydrous ether, precipitate at -20°C for 3 hours, precipitate a white powder, centrifuge at 2500g for 10 minutes, collect the precipitate, wash with anhydrous ether, and vacuum dry to obtain the polypeptide. The cleavage reagent is prepared by mixing TFA, water, and TIS (triisopropylsilyl chloride) in a mass ratio of 95:2.5:2.5;

[0032] 3. Fmoc-S5-OH (1 mmol), HATU (1 mmol), HOAT (1 mmol), DIPEA (1 mmol) DMF (6 mL) was mixed for 15 min and then added to the resin at room temperature. After 2 hours, the resin was washed with DMF (3 times), DCM (3X, 5 mL) and DMF (3X, 5 mL) in sequence. Ring-closing metathesis reaction was carried out in 1,2-dichloroethane (DCE) at 35 ° C using Grubbs' first-generation catalyst. The resin was washed with DCM (3X, 5 mL) and DCE (3X, 5 mL) and then treated with a 10 mM solution of Grubbs' first-generation catalyst in DCE;

[0033] 4. Use 0.2 mol / L sodium sulfate (phosphoric acid adjusted to pH = 7.5) to equilibrate the column for 30 minutes, dissolve the polypeptide with 90% acetonitrile aqueous solution, filter, and apply gradient elution (eluent: methanol and sodium sulfate aqueous solution mixed in a volume ratio of 30:70 to 70:30) on a C18 reverse-phase atmospheric pressure column at a flow rate of 1 mL / min and a detection wave of 220 nm. Collect the main peak and freeze-dry. Further purification is performed using a reverse-phase C18 column, eluent A is 0.1% TFA / water solution; eluent B is 0.1% TFA / acetonitrile solution, the elution concentration is 25% B to 40% B, the elution time is 12 minutes, the flow rate is 1 mL / min, and the main peak is collected as above and freeze-dried.

[0034] 5. Identification of polypeptides: The polypeptides obtained above were analyzed by electrospray mass spectrometry, such as Figure 1 The molecular weight shown in the mass spectrum is basically consistent with the theoretical molecular weight in Table 1, and the purity of the polypeptide is greater than 95%.

[0035] Example 3

[0036] Antimicrobial peptide IPA-H D F-Rv2626c 123-131 Scanning electron microscope nanometer characterization image:

[0037] Nanomorphology analysis: In order to further analyze IPA-H D F-Rv2626c 123-131To investigate the nanomorphology of the membrane, the peptide (1.28 mM) was diluted to a concentration of 64 μM in deionized water and incubated in a 37°C incubator for 24 hours. The sample was smeared on a glass slide and coated with metal using a Polaron SC7640 sputter coater after natural drying. The sample was observed at 5 kV using a Hitachi S-4800 SEM (Hitachi, Japan). The results are shown in Figure 3 .

[0038] from Figure 3 (b) It can be seen that the antimicrobial peptide IPA-H D F-Rv2626c 123-131 At pH = 7.4, larger nanorods were formed; Figure 3 (a) It can be seen that the antimicrobial peptide IPA-H D F-Rv2626c 123-131 In a pH = 5.5 aqueous solution, it transforms into nanoparticles of smaller size.

[0039] Example 4

[0040] Antimicrobial peptide IPA-H D F-Rv2626c 123-131 In vitro cytotoxicity, stability, and bactericidal activity assays:

[0041] 1. Cytotoxicity assay: Cells frozen in liquid nitrogen were revived and inoculated into a culture medium containing 10% fetal bovine serum and 1% double-antibody, and subcultured at 37°C and 5% CO2. The cultured cells were digested with 0.25% trypsin and the cell density was adjusted to 2-4×10 5 cells / mL. 50 μL of cell suspension was mixed with 50 μL of peptides of different concentrations in a 96-well plate and incubated at 37°C and 5% CO2 for 24 h. Subsequently, 25 μL of MTT (5 mg / mL) was added to each well and incubated for another 4 h. After incubation, the supernatant was discarded, and the crystals at the bottom of the well were dissolved with 100 μL of DMSO. The absorbance of each well was measured at 570 nm using a microplate reader. The culture medium wells served as blank controls. The test results are shown in Figure 4 .

[0042] from Figure 4 It can be seen that even with high concentrations of antimicrobial peptide IPA-H D F-Rv2626c 123-131 After treatment, the cell survival rate of RAW 264.7 was greater than 50%, indicating that the antimicrobial peptide IPA-H D F-Rv2626c 123-131 It has good biocompatibility and has the potential to become an alternative to antibiotics.

[0043] 2. Protease Stability Assay: To test the ability of antimicrobial peptides to resist protease hydrolysis, we incubated antimicrobial peptides at a concentration of 2.56 mM with different types of proteases. The antimicrobial peptides were incubated with simulated porcine gastrointestinal fluid and 10 mg / ml trypsin, chymotrypsin, and pepsin solutions at 37°C for 8 hours. Circular dichroism spectroscopy was then used to evaluate the protease stability of the peptides. The control group was not treated with protease. The test results are attached. Figure 5 .

[0044] pass Figure 5 It can be seen that the simulated porcine gastrointestinal fluid and high concentration of protease have an effect on the antimicrobial peptide IPA-H D F-Rv2626c 123-131 The secondary structure of the antimicrobial peptide IPA-H D F-Rv2626c 123-131 It can maintain its intact structure even in the presence of high concentrations of proteases and has excellent resistance to hydrolysis by high concentrations of proteases.

[0045] 3. Determination of bactericidal activity: The minimum bactericidal concentration of antimicrobial peptides was determined by microdilution method. D F-Rv2626c 123-131 HEPES solution at pH 7.4 and pH 5.5 was added to a 96-well plate, followed by an equal volume of HEPES solution with a final concentration of 1 × 10 5 CFUmL -1 The final peptide concentration ranged from 4 to 128 μM in a 96-well plate suspension of E. coli ATCC 25922. After incubation at 37°C for 3 hours, 50 μL was aspirated and serially diluted in PBS. The minimum bactericidal concentration was determined using the plate count method, with the peptide concentration that killed 99.99% of the bacteria. The test results are shown in Figure 6 .

[0046] Depend on Figure 6 It can be seen that under physiological conditions, pH = 7.4, the antimicrobial peptide IPA-H D F-Rv2626c 123-131 It has no bactericidal ability, but when the pH of the bacterial infection microenvironment is 5.5, 16μM antimicrobial peptide IPA-H D F-Rv2626c 123-131 It can kill E. coli.

[0047] Example 5

[0048] Mechanism of action determination: Immunomodulatory antimicrobial peptide IPA-H responsive to bacterial microenvironment using high-resolution scanning electron microscopy D F-Rv2626c 123-131The mechanism of action was investigated. A single colony of Escherichia coli ATCC 25922 was cultured overnight in MHB medium and transferred to a new MHB medium to grow to the mid-logarithmic phase. The bacterial solution was then centrifuged and resuspended in phosphate buffer to a final concentration of OD 600 =0.4, and the prepared antimicrobial peptide was added to a final concentration of 16 μM MBC. After incubation at room temperature for 2 hours, dehydration-replacement-plating treatment was performed and the film was observed and photographed using a scanning electron microscope. Figure 7 .

[0049] from Figure 7 It can be seen that under physiological conditions, the antimicrobial peptides form nanofibers and attach to the E. coli, which maintains an intact membrane structure. However, in the bacterial infection microenvironment (pH = 5.5), the positively charged antimicrobial peptides first bind to LPS on the E. coli surface through electrostatic attraction, rapidly adsorbing to the E. coli surface, increasing the permeability of the outer membrane, and then penetrating the outer membrane to reach the plasma membrane, causing depolarization and thus disrupting the integrity of the plasma membrane, leading to leakage of bacterial contents and bacterial death.

[0050] Example 6

[0051] Gentamycin protection assay: To evaluate the antimicrobial peptide IPA-H D F-Rv2626c 123-131 To determine whether it promotes the phagocytosis of bacterial clusters by macrophages, the bacterial content in macrophages was detected by gentamicin protection test. E. coli 25922 culture in the logarithmic growth phase was collected by centrifugation at 3000 rpm for 5 minutes, washed 3 times with PBS buffer, and resuspended in PBS buffer. The bacterial concentration was adjusted to OD 600nm =0.4. Add 16 μM IPA-H D F-Rv2626c 123-131 Co-culture with bacterial suspension at 37°C for 2 hours. Add the bacterial particles pretreated with peptides to the cell culture medium of RAW 264.7 and culture at 37°C for 2 hours. Aspirate the cell culture medium and wash 3 times. Add 50μg / mL gentamicin solution to remove extracellular bacteria. Use 0.1% Triton X-100 to lyse for 10 minutes. Aspirate 50μL of lysate and add 450μL of high-temperature sterilized PBS for gradient dilution. Take 100μL of dilution and evenly inoculate on MHA plate culture medium. Culture overnight in a 37°C incubator. Count the number of colonies (CFU) of each sample. Repeat the experiment three times. The test results are shown in the table. Figure 8 .

[0052] from Figure 8 It can be seen that compared with the control group, 16 μM antimicrobial peptide IPA-H D F-Rv2626c123-131 After pretreatment, the internalization of E. coli particles in RAW 264.7 was significantly increased. This indicates that the antimicrobial peptide IPA-H D F-Rv2626c 123-131 It can capture bacteria and promote the phagocytic ability of phagocytes.

[0053] Example 7

[0054] Antimicrobial peptide IPA-H D F-Rv2626c 123-131 To evaluate the effect of antimicrobial peptide IPA-H on the expression of immunomodulatory factors in macrophages D F-Rv2626c 123-131 Will it affect the production of immune regulatory factors - chemokines and anti-inflammatory cytokines by macrophages? Chemokines can activate the phagocytic ability of other immune cells and attract more immune cells to the site of infection. Take the Escherichia coli ATCC 25922 bacterial solution in the logarithmic growth phase, centrifuge at 3000rpm for 5 minutes to collect the bacteria, wash 3 times with PBS buffer, resuspend in PBS buffer, and adjust the bacterial concentration to OD 600nm = 0.4. Add 16μM IPA-H D F-Rv2626c 123-131 Co-culture with bacterial suspension at 37°C for 2 hours. Add the peptide-pretreated bacterial particles to the cell culture medium of RAW264.7 and culture at 37°C for 2 hours. Aspirate the cell culture medium and wash 3 times. Add 200 μL of cell lysis buffer Trizol to extract RNA. After reverse transcription into cDNA, β-actin was used as the internal reference gene. According to 2 -ΔΔCt Methods: The relative mRNA levels of the chemokine CXCL1 and CXCL2 genes were calculated. β-actin upstream primer: 5'GTGCTATGTTGCTCTAGACTTCG 3', downstream primer: 5'ATGCCACAGGATTCCATACC 3'; CXCL1 upstream primer: 5'ACCGAAGTCATAGCCACACTC 3', downstream primer: 5'CTCCGTTACTTGGGGACACC 3'; CXCL2 upstream primer: 5'CCAGACAGAAGTCATAGCCACT 3', downstream primer: 5'GGTTCTTCCGTTGAGGGACA 3'; IL-10 upstream primer: 5'GGTTGCCAAGCCTTATCGGA 3', downstream primer: 5'GAGAAATCGATGACAGCGCC 3'.

[0055] from Figure 9 It can be seen that compared with the control group, the antimicrobial peptide IPA-H D F-Rv2626c 123-131After pretreatment of bacteria, RAW 264.7 macrophages were significantly promoted to express chemokines CXCL1, CXCL2 and anti-inflammatory cytokine IL-10, which is beneficial to further attract more immune cells to gather at the bacterial infection site, eliminate pathogens, promote anti-inflammatory response, and maintain immune homeostasis.

Claims

1. A bacterial microenvironment-responsive immunomodulatory antimicrobial peptide, IPA-H D F-Rv2626c 123-131 , characterized in that, The amino acid sequence is shown in SEQ ID No. 1, wherein the N-terminus is connected to the carboxyl group of indole-3-propionic acid, and the phenylalanine at positions 5 to 8 in the sequence is D-phenylalanine.

2. A bacterial microenvironment-responsive immunomodulatory antimicrobial peptide IPA-H according to claim 1 D F-Rv2626c 123-131 The preparation method is characterized in that Here are the steps: Step S1: Indole-3-propionic acid (IPA) is selected as a hydrophobic scaffold to provide hydrophobic interaction; histidine, with an imidazole group pKa of 6.0, becomes positively charged after protonation of its side chain under weakly acidic conditions, serving as an acidic response element; and an unnatural amino acid, D-phenylalanine, is selected to provide hydrophobic interaction while preventing protease hydrolysis. Step S2: connecting with the active region LPEHAIVQF at positions 123-131 of the natural peptide Rv2626c of Mycobacterium tuberculosis to construct a polypeptide with an amino acid sequence as shown in SEQ ID No. 1, wherein the phenylalanine at positions 5-8 in the sequence is D-phenylalanine; Step S3: The peptide was prepared by solid-phase chemical synthesis and mass spectrometry identification. The peptide's nanomorphology, in vitro cytotoxicity, protease stability, bactericidal activity, and effect on macrophage phagocytosis were then measured. The peptide was named antimicrobial peptide IPA-H. D F-Rv2626c 123-131 .

3. A bacterial microenvironment-responsive immunomodulatory antimicrobial peptide IPA-H according to claim 1 D F-Rv2626c 123-131 The self-assembly method is characterized in that: The concentration was 64 μM and the product was incubated at 37°C for 24 hours to self-assemble into nanostructures.

4. A bacterial microenvironment-responsive immunomodulatory antimicrobial peptide IPA-H according to claim 1 D F-Rv2626c 123-131 The application of the invention in the preparation of medicines for treating infectious diseases caused by Escherichia coli is carried out under an environment with a concentration of pH=5.5.

Images